PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS cDNA CLONE AND USES THEREOF

20190177721 · 2019-06-13

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for preparing cDNA infectious clones based on the genome of an attenuated Porcine Reproductive and Respiratory Syndrome virus (PRRSV) and uses thereof for preparing efficacious and safety-enhanced vaccines against PRRSV. The invention further comprises an infectious cDNA clone obtainable by such method. The invention further provides an attenuated modified PRRSV, and immunogenic compositions and vaccines comprising that attenuated PRRSV. The present invention further provides the attenuated PRRSV for use in the prophylaxis and/or the treatment of PRRSV infections, and the attenuated PRRSV for use as vaccine or medicament in the prophylaxis and/or the treatment of PRRSV infections.

Claims

1. A method for generating an infectious cDNA clone based on the genome of an attenuated PRRSV strain, characterized in that it comprises: a) identifying polymorphic zones of the genome sequence of an attenuated strain of PRRSV, b) determining the most frequent sequence within the polymorphic zones identified in step a), and c) constructing an infectious cDNA clone comprising the most frequent sequence in at least one of the polymorphic zones identified in step a).

2. A method according to claim 1, characterized in that the genome sequence corresponds to a sequence having at least 99.90% degree of identity with the consensus sequence of an attenuated strain of PRRSV.

3. A method according to claim 1, characterized in that the polymorphic zones are selected from the group consisting of 5UTR, ORF1a, ORF1b, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7, and 3UTR.

4. A method according to claim 1, characterized in that the attenuated PRRSV strain is selected from the group consisting of an attenuated European PRRSV strain and an attenuated North American PRRSV strain.

5. An infectious cDNA clone made by the method of claim 1.

6. An infectious cDNA clone according to claim 5, characterized in that it comprises the most frequent sequence corresponding to at least one of the following polymorphic zones: i) from position 3902 to 3959, ii) from position 6792 to 7672, and iii) at the region comprising ORF3 to ORF6, wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.

7. An infectious cDNA clone according to claim 6, characterized in that the infectious clone is named pVAC 5.2, deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen accession number DSM 32341.

8. An infectious cDNA clone according to claim 5, characterized in that the infectious clone comprises the most frequent sequence corresponding to the polymorphic zones: i) from position 3902 to 3959, ii) from 6792 to 7672, and iii) from position 12938 to 14151, wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.

9. An infectious cDNA clone according to claim 8, characterized in that the infectious clone is named pVAC 5.1, deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen accession number DSM 32340.

10. An infectious cDNA clone according to claim 5, characterized in that it comprises the most frequent sequence corresponding to at least one of the following polymorphic zones: i) from position 1164 to 2113, ii) from 4630 to 6543, iii) from 6906 to 8402, iv) from 11618 to 12274, and v) at the region comprising ORF3 to 3UTR, wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163.

11. An infectious cDNA clone according to claim 10, characterized in that the infectious clone is named pVAC 6.1, deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen accession number DSM 32542.

12. A recombinant nucleic acid comprising the infectious cDNA clone of claim 5.

13. A DNA construct comprising a copy of the recombinant nucleic acid of claim 12.

14. A RNA transcript of the DNA construct of claim 13.

15. An attenuated PRRSV encoded by the RNA transcript of claim 14.

16. An immunogenic composition comprising the attenuated PRRSV of claim 15.

17. A vaccine comprising an immunologically effective amount of the attenuated PRRSV of claim 15 and a pharmaceutically acceptable diluent or excipient.

18. A method for the prophylaxis and/or treatment of PRRSV virus infections comprising the step of administering a vaccine comprising the attenuated PRRSV of claim 15 and a pharmaceutically acceptable diluent or excipient to a subject.

19. A method for the prophylaxis and/or treatment of PRRSV virus infections comprising the step of administering the attenuated PRRSV of claim 15 to a subject.

20. A method for the prophylaxis and/or treatment of PRRSV virus infections comprising the step of administering a vaccine or medicament comprising the attenuated PRRSV of claim 15 to a subject.

21. A vaccine comprising an immunologically effective amount of the infectious cDNA clone of claim 5 and a pharmaceutically acceptable diluent or excipient.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0037] FIG. 1 shows the assembling of restriction fragments. The segmented line represents PRRSV genome. Thick arrows above indicate the restriction sites used to assemble the viral cDNAs. Thick lines represent the viral cDNAs produced by RT-PCR and cloned into pUC19 or pACYC-177-ADAP. The sequence of subcloning of cDNAs is indicated by thin arrows (steps 1 to 11).

[0038] FIG. 2 depicts schematically the structure of full-length clone pVAC-T7-5. Viral cDNAs assembled to obtain the full-length clone are represented by boxes. Restriction sites used to assemble cDNAs are indicated. T7 promoter is represented by an arrow. Vector pACYC-177-ADAP is represented by a line. Restriction sites suitable to release full insert (AscI and XbaI) are shown.

[0039] FIG. 3 represents the strategy for modification of pVAC-T7-5 to obtain pVAC 5.0. Template clone pVAC-T7-5 is represented above. Dotted lines indicate uncompleted draw of a full-length clone. The following steps are shown in FIG. 3: [0040] Step 1: Introduction of AscI and SwaI restriction sites upstream PRRSV genome. Primers are represented by horizontal arrows. Restriction sites included in the primers sequence are indicated. pVAC-T7-5 sites SwaI and RsrII used for replacing the 5 terminal cDNA are indicated. [0041] Step 2: Introduction of the Hepatitis delta virus ribozyme (HDV-Rz) downstream PRRSV genome by PCR. Primers are represented by horizontal arrows. pVAC-T7-5 sites HpaI and XbaI used for replacing of the 3 terminal cDNA and introduction of the ribozyme are shown. [0042] Step 3: Cloning of Human cytomegalovirus promoter in the intermediate clone Asc-Swa-pVAC5-HDV-Rz. Primers used for PCR amplification of the promoter, and their restriction sites are represented. The AscI and SwaI sites of the intermediate clone pVAC-T7-5 Asc-Swa-pVAC5-HDV-Rz used to introduce the promoter are shown.

[0043] FIG. 4 depicts the structure of clone pVAC 5.0. Viral cDNAs assembled to obtain the full-length clone are represented by boxes. Restriction sites used to assemble cDNAs are indicated. Human cytomegalovirus promoter (pCMV) is represented by an arrow. The Hepatitis delta virus ribozyme (HDV-Rz) is represented by an oval. pACYC-177-ADAP vector is represented by a line. Restriction sites suitable to release full insert (AscI and XbaI) are shown.

[0044] FIG. 5 represents the location of primers used, and the positions sequenced in the variability study of strain VP-046 BIS of PRRSV for construction of clone pVAC 5.2.

[0045] FIG. 6 depicts the cloning event from pVAC 5.0 to pVAC 5.2. Location of the primers used to amplify the most frequent sequence variant and of the cleavage sites used to replace the cDNA region 25R in pVAC 5.0 for the most frequent sequence variant cDNA.

[0046] FIG. 7 indicates the location of primers used, and the positions sequenced in the variability study of strain VP-046 BIS of PRRSV for construction of clone pVAC 5.1.

[0047] FIG. 8 represents the cloning events from pVAC 5.0 to pVAC 5.1. Location of the primers used to amplify the most frequent sequence variants and of the cleavage sites used to replace cDNA regions in pVAC 5.0 for the most frequent sequence variant cDNA.

[0048] FIG. 9 represents the mean titers (CCID.sub.50/mL, being CCID.sub.50, 50% cell culture infective dose) of viremia at day 3 up to day 37 of the study after for group A (pVAC 5.2) and group B (VP-046 BIS), as described in Example 4.

[0049] FIG. 10 shows the percentages of animals positive to PRRSV in lung tissues, tonsil and faecal swabs for inoculated animals of group A (pVAC 5.2) and group B (VP-046 BIS), as described in Example 4.

[0050] FIG. 11 represents the percentages of viremic animals (Second serial passage) in inoculated pVAC 5.2 group (group A) and VP-046 BIS (group B), as described in Example 4.

[0051] FIG. 12 represents the percentages of viremic animals for each group (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) after challenge with a homologous virulent strain of PRRSV as a function of the day of study, as described in Example 5.

[0052] FIG. 13 represents the percentage of positive animals with faecal shedding for each group (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) after challenge with a homologous virulent strain of PRRSV as a function of the day of study, as disclosed in Example 5.

[0053] FIG. 14 represents the percentage of positive animals to PRRSV in tonsil swabs at day 83 of the study for each group (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) after homologous challenge, as shown in Example 5.

[0054] FIG. 15 shows the relative index of antibodies against PRRSV for the vaccinated and non-vaccinated animals (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) before and after challenge (D34) with a heterologous virulent strain of PRRS virus, as disclosed in Example 6. Antibodies were determined by means of ELISA Civtest suis PRRS-E (Laboratorios Hipra, S.A., Amer, Girona, Spain).

[0055] FIG. 16 represents the mean viremia titers after challenge with a heterologous virulent strain of PRRS virus, as CCID.sub.50/mL, for the vaccinated and non-vaccinated animals (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) as a function of the day of study, as described in Example 6

[0056] FIG. 17 represents the percentage of viremic animals after challenge with a heterologous virulent strain of PRRS virus, as CCID.sub.50/mL, for the vaccinated and non-vaccinated animals (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) as a function of the day of study, as described in Example 6.

[0057] FIG. 18 represents the mean value of PRRSV titer obtained from faecal swabs expressed as CCID.sub.50/mL for each group of animals (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) as a function of the day of study, as disclosed in Example 6.

[0058] FIG. 19 shows the percentage of positive animals with faecal shedding for each group (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) as a function of the day of study, as described in Example 6.

[0059] FIG. 20 represents the mean quantity of PRRSV, expressed in CCID.sub.50/ml, for each group (Group A=group vaccinated with pVAC 5.2, Group B=group vaccinated with VP-046 BIS, and Group C=Control group, non-vaccinated) present in lung tissues and in tonsil swabs, as described in Example 6.

[0060] FIG. 21 shows the assembling of restriction fragments for clone pVAC 6.1. The segmented line represents PRRSV genome. Thick arrows above indicate the restriction sites used to assemble the viral cDNAs. Thick lines represent the viral cDNAs produced by RT-PCR. Boxes represent intermediate cDNA clones. The sequence of subcloning of cDNAs is indicated by thin arrows (steps 1 to 11).

[0061] FIG. 22 represents the mean titers of antibodies against PRRSV (IRPC) for the vaccinated and non-vaccinated animals, being Group A=vaccinated with the V1042-P62 PRRSV quasispecies, Group B=vaccinated with the clone pVAC 6.1, and Group C=non-vaccinated, at different days post-vaccination, as disclosed in Example 8.

[0062] FIG. 23 represents the percentage of cohabitant animals positive to viremia for each group (Group A=vaccinated with the V1042-P62 PRRSV quasispecies, and Group B=vaccinated with the clone pVAC 6.1) at different days post-vaccination, as disclosed in Example 8.

DETAILED DESCRIPTION OF THE INVENTION

[0063] The object of the present invention is a method for generating an infectious cDNA clone based on the genome of an attenuated PRRSV strain, which comprises: [0064] a) identifying polymorphic zones of the genome sequence of an attenuated strain of PRRSV, [0065] b) determining the most frequent sequence within the polymorphic zones identified in step a), and [0066] c) constructing an infectious cDNA clone comprising the most frequent sequence in at least one of the polymorphic zones identified in step a).

[0067] The authors of the present invention have developed for the first time a method for generating an infectious cDNA clone based on the genome of an attenuated PRRSV, wherein at least a part of the nucleotides of the whole sequence is substituted by the most frequent sequence present in polymorphic population that constitutes an attenuated PRRSV. The vaccine comprising virus rescued from such infectious clone shows higher safety than a commercially available vaccine, as it reduces faecal and salivary shedding in infected animals, and it reduces the number of positive animals with virus load in lung tissues, and surprisingly the efficacy of the vaccine is maintained. Safety and efficacy of vaccines are two distinct features but they are completely interrelated. Usually when trying to improve safety vaccine profile results in a lost on the efficacy and vice versa. Therefore, with this invention, a new generation of efficacious and safer modified live vaccines is provided against PRRSV.

[0068] In the present description as well as in the claims, the singular forms a and an include also the plural reference unless the context clearly indicates otherwise.

[0069] Also, when reference to a particular sequence from the Sequence Listing section of the subject application is made, it is intended, unless otherwise specified, to refer to both the DNA of the Sequence Listing, as well as RNA corresponding to the DNA sequence, and includes sequences complementary to the DNA and RNA sequences. In such contexts in this application, corresponding to refers to sequences of DNA and RNA that are identical to one another but for the fact that the RNA sequence contains uracil in place of thymine and the backbone of the RNA molecule contains ribose instead of deoxyribose.

[0070] Sequencing can be carried out using standard methods well known by the skilled person, which comprise the use of several cDNA clones or Sanger sequencing of RT-PCR reaction products, as disclosed in Sanger et al., A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase, J. Mol. Biol., 1975, 94(3), 441-448, and also massive sequencing, as disclosed, for example, in Buermans et al., Next generation sequencing technology: Advances and applications, Biochim. Biophys. Acta, 2014, 1842, 1932-1941.

[0071] Assessment of the variability in a region, i.e. polymorphism, can be done by sequencing a specific number of clones, e.g. about 20 or more. Alternatively, restriction fragment length polymorphism (RFLP), deep-sequencing or single-strand conformation polymorphism (SSCP) can be used. Such methodologies are disclosed, for example, in Beckmann et al., Restriction fragment length polymorphisms in genetic improvement: methodologies, mapping and costs, Theor. Appl. Genet., 1983, 67, 35-43; Goldman et al., Making sense of deep sequencing, Int. J. Neuropsychopharmacol., 2014, 17, 1717-1725, and Sheffield et al., The Sensitivity of Single-Strand Conformation Polymorphism Analysis for the detection of Single Base Substitutions, Genomics, 1993, 16, 325-332.

[0072] Construction of the genome sequences can be done by assembling of restriction fragments, as shown in the examples in the present invention, or by chemical synthesis.

[0073] Substitution of specific regions in a genome sequence can be done by standard cloning methods or directed mutagenesis, as shown in the examples of the present invention, or chemical synthesis.

[0074] An infectious clone is a plasmid vector molecule in which the whole genome of a virus has been cloned under the control of a promotor and, if necessary, other control elements (e.g., the Hepatitis delta virus ribozyme used as terminator) such as direct transcription of the cloned genome results in a RNA molecule that directly is able of initiating an infection.

[0075] The infectious cDNA clone can be introduced into cells by transfection (transformation-infection) to produce infectious virus.

[0076] Infectious clone and infectious cDNA clone are used as synonyms in the present invention.

[0077] The method for generating an infectious clone of the present invention is based on the genome of an attenuated PRRSV.

[0078] The term attenuated PRRSV means a viable PRRSV strain, which has been attenuated in vitro and/or in vivo, and which shows a reduced virulence in comparison to wild type pathogenic PRRSV, wherein virulence means a degree of pathogenicity, i.e. the ability of the pathogen to produce clinical signs in the host or the offspring of the host, such as elevated body temperature or reproductive failure. In the case of pigs, lung lesion, temperature increases up to 41 C. are also associated with virulence of the PRRSV. The presence of the virus in sera and body secretions are also reduced in attenuated virus compared to the virulent ones.

[0079] The attenuation of a strain can be determined by the skilled person, for example, by in vitro unadaptation to the porcine alveolar macrophages, changes of the replication kinetics, or changes of the shape of the cytopathic effect in the cell culture.

[0080] Preferably, the attenuated PRRSV strain may be a European PRRSV or a North American PRRSV.

[0081] The term European PRRSV refers to any strain of PRRSV having the genetic characteristics associated with the PRRSV that was first isolated in Europe around 1991 (see, e.g., Wensvoort et al., Mystery swine disease in the Netherlands: the isolation of Lelystad virus, Vet. Quart., 1991, 13, 121-130). European PRRS virus is also sometimes referred to in the art as genotype 1 or I, and being the Lelystad virus the prototype of the European PRRSV isolates. Therefore, any Lelystad-like isolate is also comprised as European PRRSV. Lena strain is also representative of genotype 1 (Karniychuck et al., Research article Pathogenesis and antigenic characterization of a new East European subtype 3 porcine reproductive and respiratory syndrome virus isolate, BMC Vet. Res., 2010, 6, 30 (1-10)).

[0082] The term North American PRRSV means any PRRSV having genetic characteristics associated with a North American PRRSV isolate, such as, but not limited to the PRRSV that was first isolated in the United States around the early 1990's (see, e.g., Collins et al., Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs J. Vet. Diagn. Invest., 1992, 4, 117-126). North American PRRSV is also referred as genotype 2 or II, being the VR-2332 strain the prototype of the North American PRRSV isolates. Other North American PRRSV isolates are: North American PRRS virus isolate MN-1 b (Kwang et al., Cloning, expression, and sequence analysis of the ORF4 gene of the porcine reproductive and respiratory syndrome virus MN-1 b, J. Vet. Diagn. Invest., 1994, 6, 293-296); the Quebec IAF-exp91 strain of PRRSV (Mardassi et al., Molecular analysis of the ORFs 3 to 7 of porcine reproductive and respiratory syndrome virus, Quebec reference strain, Arch. Virol., 1995, 140, 1405-1418); and North American PRRSV isolate VR 2385 (Meng et al., Molecular cloning and nucleotide sequencing of the 3-terminal genomic RNA of the porcine reproductive and respiratory syndrome virus, J. Gen. Virol., 1994, 75, 1795-1801).

[0083] In a preferred embodiment the attenuated PRRSV strain is an attenuated European PRRSV strain, and more preferably is VP-046 BIS strain (Accession number CNCM I-1642, deposited on Nov. 23, 1995, in Collection Nationale de Cultures de Micro-organismes-Pasteur Institute (CNCM), Institut Pasteur, 25-28, Rue du Dr. Roux, 75724 Paris Cdex 15, France). In another preferred embodiment the attenuated European PRRSV strain is VP1042-P62 strain (Accession number CNCM 1-5219, deposited on Jul. 19, 2017 by Hipra Scientific S.L.U. in Collection Nationale de Cultures de Micro-organismes-Pasteur Institute (CNCM)).

Step a): Identification of the Polymorphic Zones of the Genome Sequence of an Attenuated Strain of PRRSV

[0084] In the method of the invention it is used the genome sequence of an attenuated strain of PRRSV. In a preferred embodiment, the genome sequence corresponds to a sequence having at least 99.90%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%, 99.999% degree of identity with the consensus sequence. In a more preferred embodiment, the genome sequence is the consensus sequence of an attenuated strain of PRRSV, i.e. the sequence has 100.00% identity with the consensus sequence. A degree of identity of 99.90% represents 10 different nucleotides in a sequence of 10000 nucleotides, and a degree of identity of 99.99% represents 1 different nucleotide in a sequence of 10000 nucleotides

[0085] The term consensus sequence is used to describe a number of related, but not identical sequences. It is compiled by inserting the nucleotide or amino acid, in the case of a polypeptide sequence, occurring most often at each position in the real sequences. Usually it is generated by aligning several PRRSV full-genome sequences, followed by selecting the most common nucleotide found at each position of the alignment. Alternatively, consensus sequences can be generated using suitable online tools or software such as, for example, JalView, ClustalW2 or Ugene. The consensus sequence can be also obtained by direct Sanger sequencing method of RT-PCR products. Other techniques such as those disclosed in Buermans et al., op.cit., are also useful to generate a consensus sequence. In that case, polymorphic zones are automatically identified on the genome sequence of the attenuated PRRSV strain.

[0086] Preferably, the consensus sequence is the calculated order of nucleotides that are found at a frequency equal or higher than at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% at each position of the sequence. Alternatively, the consensus sequence is obtained by direct Sanger sequencing of RT-PCR reaction products, wherein, a position is named polymorphic if more than one peak is observed in the chromatogram.

[0087] In the present invention, in the event of sequencing cDNA clones, the consensus sequence is obtained from at least two, preferably from at least five, more preferably from at least 50, and yet more preferably up to 100 overlapping DNA clones complementary to RNA extracted of attenuated PRRSV strain, and for each position the consensus sequence is obtained as the nucleotide present in at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% at each position of the sequences. Alternatively, the consensus sequence is obtained by direct Sanger sequencing of RT-PCR reaction products, wherein, in this case, a position is named polymorphic if more than one peak is observed in the chromatogram.

[0088] In a preferred embodiment the consensus sequence of the attenuated PRRSV is SEQ ID NO:1, which is obtained from attenuated virus VP-046 BIS strain.

[0089] In another preferred embodiment the consensus sequence of the attenuated PRRSV is SEQ ID NO:163, which is obtained from attenuated virus V1042-P62 strain.

[0090] The infectious clone pVAC 5.0 contains the genome sequence SEQ ID NO:2, which is the PRRSV genome present in clone pVAC-T7-5, and which shows a degree of identify of 99.98% with the consensus sequence SEQ ID NO:1.

[0091] A partial pVAC 5.0 infectious clone includes a fragment of pACYC177-ADAP and has the following structure: [0092] 1-32: pACYC-ADAP (partial), [0093] 33-40: AscI restriction site, [0094] 41-622: Promoter pCMV from Human cytomegalovirus, [0095] 623-630: SwaI restriction site, [0096] 631-15753: PRRSV genome SEQ ID NO:2, [0097] 15754-15837: Hepatitis delta virus ribozyme, [0098] 15838-15843: XbaI restriction site, [0099] 15844-15917: pACYC177-ADAP (partial).

[0100] The partial nucleotide sequence of infectious clone pVAC 5.0 is SEQ ID NO:3. The full nucleotide sequence of infectious clone pVAC 5.0 is SEQ ID NO:223, which also includes the full sequence of pACYC-ADAP.

[0101] The infectious clone pVAC 5.0 was deposited by Hipra Scientific S.L.U. in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32339 (Jul. 19, 2016). The preparation of clones pVAC-T7-5 and pVAC 5.0 is described in Example 1.

[0102] A polymorphic zone is a genomic region with a size lower than 2.5 kb, preferably lower than 2.0 kb, more preferably lower than 1.5 kb, yet more preferably lower than 1.3 kb, which contains one or more polymorphic positions. In the context of the present invention, a polymorphic position is defined as a position at which all nucleotides found were at a frequency lower than 75%.

[0103] The identification of the polymorphic zones is usually carried out by assembling nucleotide sequences from different overlapping clones covering the full attenuated PRRSV genome using mapping tools, for example those included in Geneious R.9.0.2 package (Biomatters Ltd). After assembly, tools included in the software allow to construct the consensus sequence as defined above. Alternatively, polymorphic zones can be identified by visual inspection when more than one peak is observed in the chromatograms resulting from direct Sanger sequencing of RT-PCR reaction products. The analysis can be also performed for example with the tools included in Geneious R.9.0.2. package (Biomatters Ltd.). Massive sequencing, as disclosed, for example, in Buermans et al., op. cit., can also be used for identifying polymorphic regions.

[0104] Polymorphic zones may be selected from the group consisting of 5 UTR, ORF1a, ORF1b, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7 and 3UTR, preferably ORF1a, ORF1b, ORF4, ORF5 and ORF7, and more preferably ORF1a, ORF1b, ORF4, and ORF5.

[0105] In a preferred embodiment the polymorphic zones are selected from ORF1a, ORF1b, ORF3, ORF4, ORF5, and ORF6, and more preferably from ORF1a, ORF1b, ORF3, ORF4, ORF5, and ORF6 of the attenuated virus VP-046 BIS strain. In another preferred embodiment the polymorphic zones selected from ORF1a, ORF1b, ORF2, ORF3, ORF4, ORF5, ORF7, and 3UTR, and more preferably from ORF1a, ORF1b, ORF2, ORF3, ORF4, ORF5, ORF7, and 3UTR of the attenuated virus V1042-P62 strain.

[0106] The open reading frames (ORF) identified in the attenuated virus VP-046 BIS strain are located in the following positions of the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1: [0107] 5UTR: from 1 to 221 [0108] ORF1A: from 222 to 7412 [0109] ORF1B: from 7394 to 11785 [0110] ORF2A: from 11796 to 12545 [0111] ORF2B: from 11801 to 12013 [0112] ORF3: from 12404 to 13201 [0113] ORF4: from 12946 to 13497 [0114] ORF5: from 13494 to 14099 [0115] ORF6: from 14087 to 14608 [0116] ORF7: from 14598 to 14984 [0117] 3UTR: from 14985 to 15098

[0118] The position of the open reading frames (ORF) can vary slightly depending on the PRRSV strain. In the case of the attenuated virus V1042-P62 strain, ORFs are located in the same positions of the virus VP-046 BIS strain.

[0119] In a preferred embodiment for a European PRRSV, polymorphic zones are located: [0120] i) from position 3902 to 3959, [0121] ii) from 6792 to 7672, and [0122] iii) at the region comprising ORF2 to ORF5, encoding for the corresponding glycoproteins GP2 to GP5; preferably at the region comprising ORF4 to ORF5, and more preferably from position 12938 to 14151,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.

[0123] In another preferred embodiment for a European PRRSV, polymorphic zones are located: [0124] i) from position 3902 to 3959, [0125] ii) from 6792 to 7672, and [0126] iii) at the region comprising ORF3 to ORF6, and more preferably from position 12938 to 14151,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.

[0127] In another preferred embodiment that the polymorphic zones are located at the regions: [0128] i) from position 1164 to 2113, [0129] ii) from 4630 to 6543, [0130] iii) from 6906 to 8402, [0131] iv) from 11618 to 12274, and [0132] v) at the region comprising ORF3 to 3UTR, and more preferably at the region selected from position 12970 to 13887 and from position 14633 to 15082,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163.

[0133] The characterization of proteins encoded by ORFs 2 to 7 of PRRS virus (Lelystad virus) is disclosed in Meulenberg et al., Characterization of Proteins Encoded by ORFs 2 to 7 of Lelystad Virus, Virology, 1995, 206, 155-163. Nucleotide sequences of the whole genome of Lelystad virus and the ORF's are disclosed under GenBank accession M96262.2.

Step b): Determination of the Most Frequent Sequence within the Identified Polymorphic Zones

[0134] The determination of the most frequent sequence within the polymorphic zones identified in the previous step is carried out by obtaining at least about 20 clones of the region, preferably from at least about 50, more preferably from up to about 100 overlapping DNA clones complementary to RNA extracted of attenuated PRRSV strain, and aligning the sequences using adequate software, for example, Geneious package (Biomatters Ltd). Tools included in the software allow the identification of the sequence shared by the largest number of clones, i.e. the most frequent sequence. Alternatively, deep sequencing can also be used for the determination of the most frequent sequence.

[0135] Alternatively, the determination of the most frequent nucleotide sequence within the identified polymorphic zones can be carried out by obtaining at least about 20 clones of the region, preferably from at least about 50, more preferably from up to about 100 overlapping DNA clones complementary to the region of interest in the attenuated PRRSV strain. If no majority nucleotide sequence is found, nucleotide sequences are then translated into protein, aligned using any suitable software package and the most frequent amino acid sequences is subsequently identified. A nucleotide sequence that encodes for the most abundant amino acid sequence is then chosen.

Step c): Construction of an Infectious Clone Comprising the Most Frequent Sequence in at Least One of the Polymorphic Zones Identified in Step a).

[0136] In the method of the present invention once the most frequent sequence in at least one polymorphic zone is determined, then an infectious clone comprising such most frequent sequence in at least one polymorphic zone is constructed using standard methods of molecular cloning, as shown in the Examples section.

Infectious cDNA Clone

[0137] The object of the present invention further provides an infectious cDNA clone obtainable by such method.

[0138] The infectious clone obtainable by the method of the invention comprises the viral genome and control elements, wherein the viral genome comprises the most frequent sequence in at least one of the polymorphic zones identified in the sequence of an attenuated strain of PRRSV, preferably an attenuated European PRRSV, and more preferably selected from VP-046 BIS PRRSV strain and VP1042-P62 PRRSV strain.

[0139] In a preferred embodiment, the sequence corresponds to the consensus sequence of an attenuated strain of PRRSV, and in a more preferred embodiment of an attenuated European PRRSV, and more preferably selected from VP-046 BIS PRRSV strain and VP1042-P62 PRRSV strain.

[0140] In a preferred embodiment, the infectious clone comprises the most frequent sequence in at least one of the polymorphic zones selected from the group consisting of: [0141] i) from position 3902 to 3959, [0142] ii) from position 6792 to 7672, and [0143] iii) at the region comprising ORF2 to ORF5, encoding for the corresponding glycoproteins GP2 to GP5, preferably ORF4 to ORF5, and more preferably from position 12938 to 14151,
wherein positions being referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.

[0144] In a particularly preferred embodiment the infectious clone comprises the most frequent sequence corresponding to the region comprising ORF2 to ORF5, encoding for the corresponding glycoproteins GP2 to GP5, preferably to the region comprising ORF4 to ORF5, and more preferably the region from position 12938 to 14151, positions being referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1. In a particularly preferred embodiment, the infectious clone comprises only the most frequent sequence in the region from position 12938 and 14151.

[0145] In another preferred embodiment the infectious clone comprises the most frequent sequence in at least one polymorphic zone selected from the group consisting of: [0146] i) from position 3902 to 3959, [0147] ii) from 6792 to 7672, and [0148] iii) at the region comprising ORF3 to ORF6, and more preferably from position 12938 to 14151,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.

[0149] In a particularly preferred embodiment the infectious clone comprises the most frequent sequence corresponding to the region comprising ORF3 to ORF6, and more preferably the region from position 12938 to 14151, positions being referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1. In a particularly preferred embodiment, the infectious clone comprises only the most frequent sequence in the region from position 12938 and 14151.

[0150] The infectious clone containing the most frequent sequence corresponding to the region from position 12938 to 14151 is named pVAC 5.2.

[0151] A partial pVAC 5.2 infectious clone includes a fragment of pACYC177-ADAP and has the following structure: [0152] 1-32: pACYC177-ADAP (partial), [0153] 33-40: AscI restriction site, [0154] 41-622: Promoter pCMV from Human cytomegalovirus, [0155] 623-630: SwaI restriction site, [0156] 631-15753: attenuated virus VP-046 BIS Genome sequence variant 5.2, [0157] 15754-15837: Hepatitis delta virus ribozyme, [0158] 15838-15843: XbaI restriction site, [0159] 15844-15917: pACYC177-ADAP (partial).

[0160] The partial nucleotide sequence of infectious clone pVAC 5.2 is SEQ ID NO:4. The full nucleotide sequence of infectious clone pVAC 5.2 is SEQ ID NO:225, which also includes the full sequence of pACYC-ADAP.

[0161] The infectious clone pVAC 5.2 was deposited by Hipra Scientific S.L.U. in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32341 (Jul. 19, 2016). The preparation of infectious clone pVAC 5.2 is described in Example 2.

[0162] In another preferred embodiment, the infectious clone comprises the most frequent sequence in the following polymorphic zones: [0163] i) from position 3902 to 3959, [0164] ii) from 6792 to 7672, and [0165] iii) from position 12938 to 14151,
wherein positions being referred to the consensus sequence of the attenuated PRRSV defined by SEQ ID NO:1.

[0166] The infectious clone containing the most frequent sequence corresponding to these three regions from position 3902 to 3959, from 6792 to 7672 and from 12938 to 14151, is named pVAC 5.1.

[0167] A partial pVAC 5.1 infectious clone includes a fragment of pACYC177-ADAP and has the following structure: [0168] 1-32: pACYC177-ADAP (partial), [0169] 33-40: AscI restriction site, [0170] 41-622: Promoter pCMV from Human cytomegalovirus, [0171] 623-630: SwaI restriction site, [0172] 631-15753: attenuated virus VP-046 BIS Genome sequence variant 5.1, [0173] 15754-15837: Hepatitis delta virus ribozyme, [0174] 15838-15843: XbaI restriction site, [0175] 15844-15917: pACYC177-ADAP (partial).

[0176] The partial nucleotide sequence of infectious clone pVAC 5.1 is SEQ ID NO:5. The full nucleotide sequence of infectious clone pVAC 5.1 is SEQ ID NO:224, which also includes the full sequence of pACYC-ADAP.

[0177] The infectious clone pVAC 5.1 was deposited by Hipra Scientific S.L.U. in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32340 (Jul. 19, 2016). The preparation of infectious clone pVAC 5.1 is described in Example 3.

[0178] In a preferred embodiment, the infectious clone comprises the most frequent sequence corresponding to at least one of the following polymorphic zones: [0179] i) from position 1164 to 2113, [0180] ii) from 4630 to 6543, [0181] iii) from 6906 to 8402, [0182] iv) from 11618 to 12274, and [0183] v) at the region comprising ORF3 to ORF7, and more preferably at the region selected from position 12970 to 13887 and from position 14633 to 15082,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163.

[0184] In a more preferred embodiment, the infectious clone comprises the most frequent sequence corresponding to the polymorphic zones: [0185] i) from position 1164 to 2113, [0186] ii) from 4630 to 6543, [0187] iii) from 6906 to 8402, [0188] iv) from 11618 to 12274, [0189] v) from 12970 to 13887 and [0190] vi) from 14633 to 15082,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163.

[0191] The infectious clone that contains the most frequent nucleotide sequence variant in genomic regions ranging from positions 1164 to 2113, 6906 to 8402, 11618 to 12274, and 14633 to 15082; one of the nucleotide sequence variants coding for the most frequent protein in positions 4630 to 6543 and 12970 to 13887; and the consensus nucleotide sequence in the rest of positions, except for position 8806 that contains C instead of U, referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163, is named clone pVAC 6.1 The full nucleotide sequence of infectious clone pVAC 6.1 is SEQ ID NO:162.

[0192] The infectious clone pVAC 6.1 was deposited by Hipra Scientific S.L.U. in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32542 (Jun. 22, 2017). The preparation of infectious clone pVAC 6.1 is described in Example 7.

[0193] The clone pVAC 6.1 has the following structure: [0194] 1-15123: PRRSV V1042-P62 genome, [0195] 15124-15206: HDV-Rz, [0196] 15207-15212: XbaI restriction site, [0197] 15213-18737: Vector pACYC177-ADAP-Pcmv, [0198] 18738-18745: SwaI restriction site.

[0199] In a preferred embodiment the infectious cDNA clone is selected from the group of clone pVAC 5.2, clone pVAC 5.1 and clone pVAC 6.1. In a more preferred embodiment the infectious cDNA clone is pVAC 5.2. In another preferred embodiment the infectious cDNA clone is pVAC 5.1. In another preferred embodiment the infectious cDNA clone is pVAC 6.1.

[0200] The configuration of the infectious clone of the invention includes the viral genome, which comprises the most frequent sequence in at least one of the polymorphic zones identified in the consensus sequence of an attenuated PRRSV strain, and also control elements such as direct transcription of the cloned genome results in a RNA molecule that directly is able of initiating an infection. Such control elements comprise a promoter sequence, preferably the Human cytomegalovirus promoter (pCMV), a ribozyme, for example, the one from the Hepatitis delta virus. Viral cDNA and control elements are carried by a bacterial plasmid with suitable restriction sites for cloning.

Nucleic Acids, DNA-Vectors, Host Cells, and Virus

[0201] It is an object of the present invention a recombinant nucleic acid comprising the infectious cDNA clone of the invention. The recombinant nucleic acid on the invention comprises the most frequent sequence in at least one polymorphic zone. It is an object of the present invention a DNA construct comprising a copy of the recombinant nucleic acid of the invention. In a preferred embodiment said DNA construct is a DNA vector such as a plasmid. In a preferred embodiment the DNA construct is an isolated DNA construct.

[0202] It is an object of the present invention a RNA transcript of such DNA construct. In a preferred embodiment the RNA transcript is an isolated RNA transcript.

[0203] Standard cloning procedures and preparation of nucleic acid molecules can be carried out as described in well-known manuals to the skilled person in the art such as, for example, J. Sambrook and D. W. Russell, Molecular Cloning: A laboratory manual, 4.sup.th edition, Cold Spring Harbor Laboratory Press, New York, 2012.

[0204] It is an object of the present invention a host cell transfected with the DNA construct of the invention.

[0205] The transfection can be done either with circular infectious cDNA plasmid or with a previously linearization molecule, according to standard methods in the art. Cells suitable for transfection are for example clone 8 cells (Collection Nationale de Cultures de Microorganismes accession number 1-1643), BHK-21 cells, VERO cells or MARC-145 cells (ATCC CRL-11171). Preferably, clone 8 cells are used.

[0206] The results observed in the transfection and amplification experiments confirm the ability of the infectious clone of the invention to generate biologically active PRRSV in in vitro conditions.

[0207] It is an object of the present invention an attenuated PRRSV encoded by the RNA transcript of the invention.

[0208] Attenuated PRRSV can be obtained from cell culture supernatant after transfection of host cells according to standard methods.

[0209] A process for preparing attenuated PRRSV comprises transfection of a host cell with the infectious cDNA clone of the invention and the isolation of the virus particles from the cell culture supernatant.

[0210] The transfection process of a host cell produces attenuated PRRSV particles, encoded by the RNA transcript of the invention.

[0211] Therefore, the invention also provides an attenuated PRRSV produced by the aforementioned host cell, preferably an attenuated European PRRSV or an attenuated American PRRSV, and more preferably an isolated attenuated European PRRSV.

Vaccines and Immunogenic Compositions

[0212] It is an object of the present invention an immunogenic composition comprising the attenuated PRRSV, preferably an attenuated PRRSV selected from the group consisting of an attenuated European PRRSV and attenuated North American PRRSV.

[0213] In a preferred aspect, the immunogenic composition comprises a titer per dose of 10 to 10.sup.7 CCID.sub.50 of the attenuated PRRSV strain of the invention, preferably 10.sup.2 to 10.sup.6, and more preferably 10.sup.3 to 10.sup.6.

[0214] It is an object of the present invention a vaccine comprising an immunologically effective amount of attenuated PRRSV of the invention and a pharmaceutically acceptable diluent or excipient, preferably an attenuated PRRSV selected from the group of an attenuated European PRRSV and an attenuated North American PRRSV, more preferably an attenuated European PRRSV, and more preferably selected from VP-046 BIS PRRSV strain and VP1042-P62 PRRSV strain.

[0215] Alternatively the vaccine comprises an immunologically effective amount of the infectious cDNA clone of the invention and a pharmaceutically acceptable diluent or excipient.

[0216] The vaccine of the invention is a composition, which elicits a protective response in an animal, which has been exposed to the composition.

[0217] The expression immunologically effective means that the amount of virus administered in the vaccination process is sufficient to induce an effective immunological response in the host against an infection by the virulent forms of PRRSV.

[0218] It is known that the dose to be used depends on the age, physiological status and weight of the animal to be vaccinated and on the administration route. Suitable doses are generally comprised in the range 10 to 10.sup.7 CCID.sub.50 of the attenuated PRRSV strain of the invention per dose, preferably 10.sup.2 to 10.sup.6, and more preferably 10.sup.3 to 10.sup.6CCID.sub.50 per dose.

[0219] The vaccine of the invention is intended for swine including, among others, pigs, boars, sows, and piglets of any age or in any phase of their production cycle; it is preferably intended for pigs in the fattening stage, and more preferably for pigs from 1 week of age onwards, and for breeding females (gilts and sows in gestation and/or in lactation).

[0220] The vaccine can be administered intranasally, intradermally, mucosally or submucosally, subcutaneously, by means of aerosol, intramuscularly, or orally.

[0221] Said vaccine can be prepared according to the typical methods used by the person skilled in the art for preparing pharmaceutical formulations suitable for the different dosage forms, such as described, for example, in the manual Remington The Science and Practice of Pharmacy, 20.sup.th edition, Lippincott Williams & Wilkins, Philadelphia, 2000 [ISBN: 0-683-306472].

[0222] The vaccines are typically prepared as injection vaccines in the form of emulsions or liquid suspensions. They can also be prepared in a solid form suitable to be dissolved or suspended in a liquid vehicle before injection.

[0223] The typical volume of a dose of an injection vaccine is between 0.2 ml and 5 ml, preferably between 1 ml and 3 ml, and more preferably between 1 ml and 2 ml.

[0224] The liquid vehicles which can be used for preparing the vaccine include, for example, water, saline solution with a physiological salt concentration, or the culture liquid in which the host cells are cultured.

[0225] Additionally, if desired, the vehicle can contain pharmaceutically acceptable excipients or auxiliary substances such as, for example, wetting agents, dispersing agents, emulsifying agents, buffering agents (for example, phosphate buffer), stabilizing agents such as carbohydrates (for example, glucose, sucrose, mannitol, sorbitol, starch, or dextrans), or proteins (for example, albumin, casein, bovine serum, or skimmed milk).

[0226] The physicochemical characteristics of the excipients as well as the name of the commercial products under which they are marketed can be found in the book by R. C. Rowe et al., Handbook of Pharmaceutical Excipients, 4.sup.th edition, Pharmaceutical Press, London, 2003 [ISBN: 0-85369-472-9].

[0227] Adjuvants can also optionally be incorporated in the vaccine to enhance the effectiveness thereof. Preferably the vaccine of the invention further comprises an adjuvant. Adjuvants are non-specific immune system stimulants which increase immunological response of the host against the vaccine antigen. Examples of adjuvants are: aluminium hydroxide, aluminium phosphate, aluminium oxide, vitamin E, squalene, vegetable oil, saponins, ginseng, zymosan, glucans, dimethylaminoethyldextran, dextrans, non-ionic block polymers, complete Freund's adjuvant, incomplete Freund's adjuvant, muramyl dipeptides, W/O, O/W, W/OW type emulsions, and mixtures thereof.

[0228] In a preferred embodiment the vaccine is an injection vaccine and comprises the attenuated PRRSV of the invention suspended in a vehicle, e.g. MEM G (Glasgow Minimum Essential Medium, Thermo Fisher Scientific) supplemented with 10% FBS (Fetal Bovine Serum, Gibco).

[0229] In a preferred embodiment the vaccine can comprise the strain of the invention in a lyophilised form. The lyophilisation process is carried out by means of methods well known by the person skilled in the art.

[0230] In a preferred embodiment the vaccine includes an antigenic component against another disease or additional pathological conditions affecting pigs. The vaccine is preferably aimed at conferring protection to pigs against diseases or pathological conditions such as, for example, those caused by the Actinobacillus sp., Brachyspira sp., Pasteurella multocida, Salmonella sp., Streptococcus sp., Isospora sp., Erysipelothrix rhusiopathiae, Leptospira sp., Staphylococcus sp., Haemophilus parasuis, Bordetella bronchiseptica, Clostridium sp., Mycoplasma sp., Lawsonia intracellularis, Escherichia coli microorganisms, Swine influenza virus, Contagious gastroenteritis virus, Porcine parvo virus, Encephalomyocarditis virus, coronavirus, rotavirus, Porcine circovirus, porcine periweaning failure to thrive syndrome agent, Classical swine fever virus, African swine fever virus, calicivirus and/or Torque teno virus.

[0231] In a more preferred embodiment, the additional disease is that known as PCVAD (Porcine Circovirus Associated Diseases) caused by Porcine circovirus (PCV2), and/or mycoplasmal pneumonia caused by Mycoplasma hyopneumoniae.

[0232] It is an object of the present invention a vaccine comprising that attenuated PRRSV and a pharmaceutically acceptable diluent or excipient for use in the prophylaxis and/or the treatment of PRRSV infections.

[0233] It is an object of the present invention the attenuated PRRSV virus for use in the prophylaxis and/or the treatment of PRRSV virus infections.

[0234] It is an object of the present invention the attenuated PRRSV for use as vaccine or medicament in the prophylaxis and/or the treatment of PRRSV infections.

[0235] The prophylaxis and/or treatment of PRRSV infections refers to the ability of the attenuated PRRSV of the invention to prevent an animal from clinical signs of a PRRSV infection and/or to reduce such clinical signs such as, for example, respiratory signs, body temperature, viremia, or faecal, nasal or saliva shedding, reproductive disorders, ameliorate the pig performance (i.e., average daily weight gain, weight at weaning), and reduction of weak piglets and mortality.

[0236] The prophylaxis is associated to the prevention process, in which an animal, preferably swine, more preferably a breeding female, more preferably a pig, and even more preferably a piglet, is exposed to the immunogenic composition or to the vaccine of the present invention prior to the induction or onset of the disease process by a virulent strain of PRRSV.

[0237] The treatment is associated to the reduction of the clinical signs caused by PRRS virus infection in an animal, preferably swine, and more preferably a pig.

[0238] Within the scope of this invention, the reduction of clinical signs means the reduction of viremia, i.e. the reduction of the PRRSV load, the reduction of the viral load in faecal shedding, and the reduction of the body temperature in an animal that has received the vaccine or the immunogenic composition of the invention in comparison to animals not receiving it. Preferably these clinical signs are reduced in subjects receiving the attenuated PRRSV of the present invention by at least 10%, preferably by at least 20%, more preferably by at least 30%, more preferably by at least 40%, and yet more preferably by at least 50% in comparison to animals not receiving it.

[0239] The viremia in the blood serum of animals was measured as CCID.sub.50/mL, being CCID.sub.50 the 50% cell culture infective dose. The viremia in animals receiving the immunogenic composition or the vaccine of the invention is reduced usually by at least 10%, 20%, 30%, 40%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.90%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, or 99.99%, in comparison to subjects not receiving the composition.

Attenuation and Reversion to Virulence Trials

[0240] Trials to assess attenuation and reversion to virulence of the infectious clones of the invention show the following results in comparison to the attenuated PRRS virus strain VP-046 BIS:

First Serial Passage

[0241] Viremia in inoculated animals Lower viremia titer for the group vaccinated with pVAC 5.2 in comparison to the group vaccinated with VP-046 BIS. [0242] Lower percentage of viremic animals in the pVAC 5.2 group. [0243] Viremia in cohabitant animals pVAC 5.2 did not raise viremia, in comparison to VP-046 BIS. [0244] Lower percentage of viremic animals in the pVAC 5.2 group. [0245] Virus tissue load and shedding in inoculated animals Lower percentage of animals positive to PRRSV in lung tissues, tonsil and faecal swabs in the pVAC 5.2 group. [0246] Virus tissue load and shedding in cohabitant animals Significant reduction in lung virus load for the pVAC 5.2 group in comparison to the VP-046 BIS group. [0247] Lower percentage of animals positive to PRRSV in lung tissues and tonsil swabs favourable to pVAC 5.2 group.

Second Serial Passage

[0248] Viremia in inoculated animals Lower percentage of viremic animals in the pVAC 5.2 group. [0249] Viremia in cohabitant animals Clearance of the viremia in the cohabitant animals for the pVAC 5.2 group. [0250] Lower percentage of cohabitant animals positive to viremia in the pVAC 5.2 group. [0251] Virus tissue load and shedding in inoculated and cohabitant animals Undetectable PRRSV in lung virus load and in tonsil swabs for the pVAC 5.2 group in comparison to the VP-046131S group. [0252] Clear reduction (to zero) in the percentage of animals with lung virus load and in tonsil swabs for the pVAC 5.2 group. [0253] No faecal shedding was seen in animals inoculated with pVAC 5.2 [0254] General conclusions pVAC 5.2 shows lower viremia and replication capacity, which represents lower capacity of accumulation in lungs and tonsils, and consequently less capacity of reversion. [0255] The reduced viremia and shedding seen in the pVAC 5.2 group in comparison to the VP-046 BIS group reduces the trend to infection in cohabitant animals and consequently less opportunities of reversion. [0256] Probability of reversion to virulence due to serial passages in vivo is clearly reduced.

Efficacy in Front of an Homologous Infection

[0257] The efficacy of the infectious clone of the invention against of a homologous infection by a virulent PRRSV is comparable to a commercially available vaccine (Laboratorios Hipra, Amer, Girona, Spain) in terms of viremia, faecal and salivary shedding, and the presence of virus in tonsil swabs.

Efficacy in Front of an Heterologous Infection

[0258] The efficacy of the infectious clone of the invention is comparable to a commercially available vaccine (Laboratorios Hipra, Amer, Girona, Spain) against of a heterologous infection with a PRRSV, [0259] Serological profiles Increase in the antibody level for vaccinated animals either with the vaccine prepared from clone pVAC 5.2 or commercial vaccine, in comparison to the Control group after experimental infection. [0260] Viremia Significant differences in mean viremia between the groups of vaccinated animals and the Control group at days 38, 41, 44, and 48 post-vaccination. [0261] Reduction of two orders of magnitude in viremia for the group of pVAC 5.2 in comparison to the Control group. [0262] Significant differences in the percentages of viremic animals after challenge for each group of vaccinated animals and the Control group at days 38, 41, 44, and 48 post-vaccination (4, 7, 10 days post-infection). [0263] Faecal shedding Significant differences in the mean faecal shedding at day 41 (pVAC 5.2) and 44 post-vaccination (VP-046 BIS) in comparison to Control group. [0264] At day 48 it was observed a clear reduction in the shedding for the vaccinated groups. [0265] Lower percentage of shedding animals and statistically differences between vaccinated and non-vaccinated animals at days 41 and 44 post-vaccination (4, 7 days post-infection). [0266] Lung and tonsil swabs Significant differences in virus loads in lung tissues favourable to the group of vaccinated animals with pVAC 5.2 than the control group at day 70 post-vaccination (day 36 post-infection). [0267] Significant reduction in percentage of animals with PRRSV detected in lung in pVAC 5.2 group in comparison to Control group. [0268] General conclusions Clear reduction in the percentage of viremic animals and titre of the detected viremia after challenge for the vaccinated groups. [0269] Clear reduction of shedding animals for the vaccinated groups. [0270] Vaccination with pVAC 5.2 reduced the presence of virus in lung tissues and in tonsil swabs after a heterologous infection.

[0271] Thus, the vaccine comprising the attenuated PRRSV, obtained according to the method of the invention, shows higher safety than a commercially available vaccine, as it reduces faecal and salivary shedding in infected animals, it reduces the number of positive animals with virus load in lung tissues and the transmission of the virus from vaccinated animals to non-vaccinated ones is also clearly reduced. Surprisingly, the efficacy of the vaccine is maintained.

[0272] Therefore, the vaccine of the invention has very interesting safety features and represents an improved alternative over the prior art in the control of PRRSV infections.

Assessment of the Seroconversion and Safety of Clone pVAC 6.1

[0273] The seroconversion obtained using clone pVAC 6.1 as vaccine is comparable to that obtained by using the V1042-P62 PRRS quasispecies. In Example 8, it is shown that 73% of animals vaccinated in both groups were already seropositive (IRPC>20%) at day 28 after vaccination (D28).

[0274] The PRRSV dissemination was assessed by means of viremia values in cohabitant animals. It is shown that cohabitant animals with the group vaccinated using the clone pVAC 6.1 is significantly lower than in the cohabitant animals with the group vaccinated using the V1042-P62 PRRSV quasiespecies.

[0275] The lower viremia of pVAC 6.1 group in contrast to V1042-P62 PRRSV quasispecies represents lower capacity of accumulation in lungs and tonsils, and consequently less capacity of reversion to virulence of the vaccine of the invention.

[0276] The invention comprises the flowing embodiments:

1.A method for generating an infectious cDNA clone based on the genome of an attenuated PRRSV strain, characterized in that it comprises: [0277] a) identifying polymorphic zones of the genome sequence of an attenuated strain of PRRSV, [0278] b) determining the most frequent sequence within the polymorphic zones identified in step a), and [0279] c) constructing an infectious cDNA clone comprising the most frequent sequence in at least one of the polymorphic zones identified in step a).
2.A method according to embodiment 1, characterized in that the genome sequence corresponds to a sequence having at least 99.90% degree of identity with the consensus sequence of an attenuated strain of PRRSV.
3.A method according to embodiment 2, characterized in that the genome sequence is the consensus sequence of an attenuated strain of PRRSV.
4.A method according to any of embodiments 1 to 3, characterized in that the polymorphic zones are selected from the group consisting of 5UTR, ORF1a, ORF1b, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7, and 3UTR.
5.A method according to embodiment 4, characterized in that the polymorphic zones are selected from the group consisting of ORF1a, ORF1b, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7, and 3UTR.
6.A method according to any of embodiments 1 to 5, characterized in that the attenuated PRRSV strain is selected from the group consisting of an attenuated European PRRSV strain and an attenuated North American PRRSV strain.
7.A method according to embodiment 6, characterized in that the attenuated PRRSV strain is VP-046 BIS strain.
8.A method according to embodiment 7, characterized in that the consensus sequence is SEQ ID NO:1.
9.A method according to embodiment 8, characterized in that the polymorphic zones are located at the regions: [0280] i) from position 3902 to 3959, [0281] ii) from 6792 to 7672, and [0282] iii) at the region comprising ORF3 to ORF6, and more preferably from position 12938 to 14151,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.
10.A method according to embodiment 6, characterized in that the attenuated PRRSV strain is V1042-P62 strain.
11.A method according to embodiment 10, characterized in that the consensus sequence is SEQ ID NO: 163.
12.A method according to embodiment 11, characterized in that the polymorphic zones are located at the regions: [0283] i) from position 1164 to 2113, [0284] ii) from 4630 to 6543, [0285] iii) from 6906 to 8402, [0286] iv) from 11618 to 12274, and [0287] v) at the region comprising ORF3 to 3UTR, encoding for the corresponding glycoproteins GP2 to GP5, the membrane protein and the nucleocapsid protein; and preferably at the region selected from position 12970 to 13887 and from position 14633 to 15082,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO: 163.
13.An infectious cDNA clone obtainable by the method of any of embodiments 1 to 12.
14.An infectious clone according to embodiment 13, characterized in that it comprises the most frequent sequence corresponding to at least one of the following polymorphic zones: [0288] i) from position 3902 to 3959, [0289] ii) from position 6792 to 7672, and [0290] iii) at the region comprising ORF3 to ORF6, and more preferably the region from position 12938 to 14151,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1
15.An infectious clone according to embodiment 14, characterized in that it comprises the most frequent sequence corresponding to the region comprising ORF3 to ORF6, and more preferably the region from position 12938 to 14151, positions being referred to the consensus sequence of the attenuated PRRSV defined by SEQ ID NO:1.
16.An infectious clone according to embodiment 15, characterized in that the infectious clone is named pVAC 5.2 and deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen accession number DSM 32341.
17.An infectious clone according to embodiment 13, characterized in that the infectious clone comprises the most frequent sequence corresponding to the polymorphic zones: [0291] i) from position 3902 to 3959, [0292] ii) from 6792 to 7672, and [0293] iii) from position 12938 to 14151,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:1.
18.An infectious clone according to embodiment 17, characterized in that the infectious clone is named pVAC 5.1 and deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen accession number DSM 32340.
19.An infectious clone according to embodiment 13, characterized in that it comprises the most frequent sequence corresponding to at least one of the following polymorphic zones: [0294] i) from position 1164 to 2113, [0295] ii) from 4630 to 6543, [0296] iii) from 6906 to 8402, [0297] iv) from 11618 to 12274, and [0298] v) at the region comprising ORF3 to 3UTR, and preferably at the region selected from position 12970 to 13887 and from position 14633 to 15082,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163.
20.An infectious clone according to embodiment 19, characterized in that the infectious clone comprises the most frequent sequence corresponding to the polymorphic zones: [0299] i) from position 1164 to 2113, [0300] ii) from 4630 to 6543, [0301] iii) from 6906 to 8402, [0302] iv) from 11618 to 12274, [0303] v) from 12970 to 13887 and [0304] vi) from 14633 to 15082,
wherein positions are referred to the consensus sequence of the attenuated PRRS virus defined by SEQ ID NO:163.
21.An infectious clone according to embodiment 20, characterized in that the infectious clone is named pVAC 6.1 and deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen accession number DSM 32542.
22.A recombinant nucleic acid comprising the infectious cDNA clone of any of embodiments 13 to 21.
23.A DNA construct comprising a copy of the recombinant nucleic acid of embodiment 22.
24.A DNA construct according to embodiment 23, characterized in that the said DNA construct is a plasmid.
25.A RNA transcript of DNA construct of embodiment 24.
26.An attenuated PRRSV encoded by the RNA transcript of embodiment 25.
27.An immunogenic composition comprising the attenuated PRRSV of embodiment 26.
28.An immunogenic composition according to embodiment 27, characterized in that the attenuated PRRSV is selected from the group consisting of an attenuated European PRRSV and an attenuated North American PRRSV.
29.A vaccine comprising an immunologically effective amount of attenuated PRRSV of embodiment 26 or infectious cDNA clone of embodiment 13 and a pharmaceutically acceptable diluent or excipient.
30.A vaccine according to embodiment 29, characterized in that the attenuated PRRSV is selected from the group of an attenuated European PRRSV and an attenuated North American PRRSV, more preferably an attenuated European PRRSV.
31.A vaccine according to any of embodiments 29 or 30, characterized in that it includes an antigenic component against another disease or additional pathological conditions affecting pigs selected from the group consisting of those caused by the Actinobacillus sp., Brachyspira sp., Pasteurella multocida, Salmonella sp., Streptococcus sp., Isospora sp., Erysipelothrix rhusiopathiae, Leptospira sp., Staphylococcus sp., Haemophilus parasuis, Bordetella bronchiseptica, Clostridium sp., Mycoplasma sp., Lawsonia intracellularis, Escherichia coli microorganisms, Swine influenza virus, Contagious gastroenteritis virus, Porcine parvo virus, Encephalomyocarditis virus, coronavirus, rotavirus, Porcine circovirus, porcine periweaning failure to thrive syndrome agent, Classical swine fever virus, African swine fever virus, calicivirus and/or Torque teno virus.
32.A vaccine comprising the attenuated PRRSV of embodiment 26 and a pharmaceutically acceptable diluent or excipient for use in the prophylaxis and/or the treatment of PRRS virus infections.
33.An attenuated PRRSV of embodiment 26 for use in the prophylaxis and/or the treatment of PRRSV infections.
34.An attenuated PRRSV of embodiment 26 for use as vaccine or medicament in the prophylaxis and/or the treatment of PRRSV infections.
35.A host cell transfected with the DNA construct according to embodiment 23.

[0305] Next, several examples of the invention are provided for illustrative but not limitative purposes.

EXAMPLES

General Procedures

[0306] Standard cloning procedures were carried out as described in J. Sambrook and D. W. Russell, Molecular Cloning: A laboratory manual, 4.sup.th edition, Cold Spring Harbor Laboratory Press, New York, 2012. Commercial kits and enzymes were used; otherwise indicated, following the instructions provided by the manufacturer.

Example 1: Construction of Infectious Clone pVAC 5.0 (SEQ ID NO:3)

[0307] Clone pVAC 5.0 contains a consensus genomic sequence of the quasispecies found in the attenuated PRRSV strain VP-046 BIS except for positions 13173 and 13922, i.e. it has a degree of identity of 99.98%. Consensus genomic sequence is defined as the sequence composed at each position by the nucleotide present in a frequency of at least 75% among all the molecular clones sequenced. Consensus sequence of PRRSV strain VP-046 BIS was determined by a number of 2 to 5 (median=3.5) overlapping molecular clones. A position is named polymorphic here if the frequency of all the nucleotides is lower than 75%. In positions 13173 and 13922 the consensus sequence (SEQ ID NO:1) contained a C and U, respectively (both at frequency of 75%), whereas at these positions clone pVAC 5.0 contained a U and a C, respectively (both found at a frequency of 2.5%). Clone pVAC 5.0 shares 99.868% nucleotide identity with a previously reported sequence (GenBank accession GU067771).

1.a) Virus

[0308] The starting material for this work was PRRSV strain VP-046 BIS (GenBank accession GU067771, CNCM accession 1-1642, 23 Nov. 1995), sampled from a frozen dried material commercially available through Laboratorios Hipra, S.A., Amer, Girona, Spain.

1.b) Isolation of Viral RNA

[0309] Frozen dried material was resuspended in 10 mL of sterilized deionized water. RNA extractions were carried out using the kit High Pure Viral RNA (Roche).

1.c) Reverse Transcription

[0310] cDNAs were obtained using the reverse transcriptase AccuScript High Fidelity Reverse Transcriptase (Agilent Technologies) and primers shown in Table I:

TABLE-US-00001 TABLEI cDNAname Primer Sequence Position.sup.1 F1 PRRSV-56R AAGTCGTTGGAGGAAGTTGT 515-496 (SEQIDNO:85) F2 PRRSV-47R CCTAGATTGTCGGGTGTTTG 2596-2577 (SEQIDNO:86) 4R PRRSV-4R CCSAGTAACYTGCCAAGAATG 3958-3938 (SEQIDNO:87) Nsi- PRRSV-67R CCAAATCCTCTAGAATGCATAAACG 4000-3981 cDNA1 TAAGAAAAC (SEQIDNO:88) 6R PRRSV-6R TTKGAAGCAGAWACAAAGCACTT 6562-6540 (SEQIDNO:89) 19R PRRSV-19R GGACTTCCARGCCTTYTTCATG 8512-8491 (SEQIDNO:90) 29R PRRSV-29R TCRAAGCCRACAGGGTGAAGTTG 10104-10082 (SEQIDNO:91) 19-29 PRRSV-29R TCRAAGCCRACAGGGTGAAGTTG 10104-10082 (SEQIDNO:92) 30R PRRSV-30R CAACCACACTAACAAGRAACTC 11873-11852 (SEQIDNO:93) 28R PRRSV-28R TAAAAAAGRCACGCRGARAG 13271-13252 (SEQIDNO:94) 25R PRRSV-25R CRCGAATYARGCGCACYGTRTG 14949-14928 (SEQIDNO:95) 33 PRRSV-33R GGCGATCGGGCGTCTAGGAATTCT poly(A)tail AGA(T)41V (SEQIDNO:96) Nsi PRRSV-48R CCCACATTTTRTCRAGCCAC 3171-3152 (cDNA2) (SEQIDNO:97) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771.
1.d) Amplification of cDNA by PCR

[0311] Before the amplification of cDNA, primers were phosphorylated using T4 polynucleotide kinase (Thermo Fisher Scientific) to ligate the resulting PCR products into the vector pUC19 linearized by digestion with SmaI (Thermo Fisher Scientific).

[0312] cDNAs were amplified by PCR using Phusion high fidelity DNA polymerase (Finnzymes) and primers shown in Table II:

TABLE-US-00002 TABLEII cDNA name Primer Sequence Position.sup.1 F1 PRRSV- GGCGCGCCTAATACGACTCACTATAGAT 1-15 62F GATGTGTAGGGTA (SEQIDNO:98) PRRSV- CAGTGAAGCTTTCTAGAAGGCTTGTAAA 380-365 58R ACAAG (SEQIDNO:99) F2 PRRSV- TTYCGGAGMGSACCTGCTTTAC 180-201 53F (SEQIDNO:100) PRRSV- CCTAGATTGTCGGGTGTTTG 2596-2577 47R (SEQIDNO:101) 4R2 PRRSV- TTYTGGACYCTYGACAAAATG 1929-1949 38F (SEQIDNO:102) PRRSV-4R CCSAGTAACYTGCCAAGAATG 3958-3938 (SEQIDNO:103) Nsi- PRRSV- ACTGTGTTGGTTCTGGTATTGCTGACTT 1876-1905 cDNA1 66F TC (SEQIDNO:104) PRRSV- CCAAATCCTCTAGAATGCATAAACGTAA 4000-3981 67R GAAAAC (SEQIDNO:105) 6R PRRSV- TYAARTTCCTCCCYGACATG 3238-3257 26F (SEQIDNO:106) PRRSV-6R TTKGAAGCAGAWACAAAGCACTT 6562-6540 (SEQIDNO:107) 19R2 PRRSV-7F ATGATGGRCCATGCCTGGAC 5961-5980 (SEQIDNO:108) PRRSV- GGACTTCCARGCCTTYTTCATG 8512-8491 19R (SEQIDNO:109) 29R2 PRRSV- RACCACYGARCARGCTTTAAAC 7385-7406 20F (SEQIDNO:110) PRRSV- TCRAAGCCRACAGGGTGAAGTTG 10104-10082 29R (SEQIDNO:111) 19-29 PRRSV-7F ATGATGGRCCATGCCTGGAC 5961-5980 (SEQIDNO:112) PRRSV- GACTGCATCTAGACCTCGACG 9640-9620 71R (SEQIDNO:113) 30R PRRSV- CTYGCATAYCACATGAARG 9116-9134 27F (SEQIDNO:114) PRRSV- CAACCACACTAACAAGRAACTC 11873-11852 30R (SEQIDNO:115) 28R PRRSV- AYAACYTRGGGTTYTACTTTTC 10686-10707 31F (SEQIDNO:116) PRRSV- TAAAAAAGRCACGCRGARAG 13271-13252 28R (SEQIDNO:117) 25R PRRSV- TACGYTMTGTTTTTGGTTTCCAYTGG 12493-12518 11F (SEQIDNO:118) PRRSV- CRCGAATYARGCGCACYGTRTG 14949-14928 25R (SEQIDNO:119) 33 PRRSV- TTCCAGATGCAGATTGTGTTGCCTAGG 14371-14397 35F (SEQIDNO:120) PRRSV- GGCGATCGGGCGTCTAGGAATTCTAGA PolyAdenine 34R (T).sub.41V (SEQIDNO:121) Nsi- PRRSV- ACTGTGTTGGTTCTGGTATTGCTGACTT 1876-1905 cDNA2 66F TC (SEQIDNO:122) PRRSV- CCAAATCCTCTAGAATGCATAAACGTAA 4014-3981 67R GAAAAC (SEQIDNO:123) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771. .sup.2The obtained cDNA was used to determine consensus sequence but not included in the infectious clones described below.

1.e) Preparation of the Vectors

[0313] Linearized vector pUC19-SmaI was used to clone cDNAs F2, 4R, Nsi-cDNA1, 6R, 19R, 29R, 30R, 28R, 25R, 33R and Nsi-cDNA2 (Table II).

[0314] Vector pUC19-SmaI was digested with XbaI and purified from 1% agarose gel using GeneJet Gel Purification Kit (Thermo Fisher Scientific) for directional cloning of cDNA F1 (Table II).

[0315] Commercial vector pACYC177 (New England BioLabs) was modified to insert a new multiple cloning site. First, the polynucleotide fragment GAACGCCGGA GGATCC GGCGCGCC GATATC TTAATTAA ACGCGT TCTAGA GCCCTTCCGG CTGGCTGGTT (SEQ ID NO:124) was synthetized by the company IDT (Integrated DNA Technologies, https://eu.idtdna.com/site) and cloned between the BamHI and AscI sites of the pIDTSMART-Amp vector. Second, plasmids pACYC177 and pIDTSMART-Amp were prepared from pre-transformed E. coli cultures using the Maxi Plasmid kit (Qiagen). Third, both plasmids were digested with the restriction enzymes BamHI and AscI. The fragment of pACYC177 that contains the kanamycin resistance marker and the fragment from pIDTSMART-Amp that contained the new multiple cloning sites were purified from an agarose gel using the Zymoclean gel DNA recovery kit (Zymo Research), ligated using the T4 DNA ligase (Thermo Fisher Scientific), and transformed in E. coli DH5a electro-competent cells. The resulting plasmid DNA was isolated using the Maxi Plasmid kit (Qiagen) and named pACYC177-ADAP. For ligation of cDNA 19-29 (table II) the plasmid was digested with EcoRV.

[0316] Digested vectors were dephosphorylated using shrimp alkaline phosphatase (Sigma).

1.f) Preparation of the Inserts

[0317] RT-PCR products F2, 4R, Nsi-cDNA1, 6R, 19R, 29R, 19-29, 30R, 28R, 25R, 33R and Nsi-cDNA2 (Table II) were purified from a 1% agarose gels using the Zymoclean gel DNA recovery kit (Zymo Research).

[0318] For directional cloning in SmaI-XbaI-digested pUC19 vector RT-PCR product F1 (Table II) was purified using the purification columns GeneJet (Thermo Fisher Scientific), digested with XbaI and purified from an agarose gel.

1.g) Production and Amplification of cDNA for the 5 Terminus of Viral Genomic RNA

[0319] The sequence corresponding to the 5 terminus of the viral genomic RNA was determined using the 5 RACE technique and using the 5 RACE system kit (Invitrogen), according to the instructions provided by the manufacturer. Primers used for this experiment are shown in Table III:

TABLE-US-00003 TABLEIII cDNA name Primer Position.sup.1 Sequence5'-3' 5 RACE- 515-496 AAGTCGTTGGAGGAAGTTGT RACE 56R (SEQIDNO:125) RACE- 472-453 AATGGGAAGATGGCTGAGAG 57R (SEQIDNO:126) RACE- 380-365 CAGTGAAGCTTTCTAGAAGGCTTGTA 58R AAACAAG(SEQIDNO:127) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771.

1.h) Cloning and Sequencing of the Fragments

[0320] Inserts F2, 4R, Nsi-cDNA1, 6R, 19R, 29R, 30R, 28R, 33R, Nsi-cDNA2 and 5RACE (Tables II and III) were ligated in SmaI-digested pUC19 plasmid. Insert F1 was ligated into and SmaI-XbaI-digested pUC19 vector.

[0321] Insert 19-29 was ligated in EcoRV-digested pACYC177-ADAP vector.

[0322] Ligations were carried out using the enzyme T4 DNA ligase (Thermo Fisher Scientific). Ligation products were electroporated into E. coli DH5a.

[0323] Plasmids were isolated from 1 to 5 transformant colonies. Viral cDNAs cloned in pUC19 were first sequenced using primers M13F and M13R, shown in Table IV:

TABLE-US-00004 TABLEIV cDNA Name Sequence5-3 Position.sup.1 sequenced M13F GTAAAACGACGGCCAGT pUC19 Allexcept (SEQIDNO:128) 19-29 M13R CAGGAAACAGCTATGAC pUC19 (SEQIDNO:129) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771.

[0324] To obtain full insert sequences adequate primers in tables I and II were used. Gaps were covered by sequencing with primers designed from the obtained sequences. Viral cDNA 19-29, cloned in pACYC-177-ADAP, was sequenced using the same strategy, but using exclusively PRRSV specific primers.

1.i) Construction of the Consensus Sequence.

[0325] Sequences obtained from 2 to 5 clones of cDNAs F1, F2, 4R, Nsi-cDNA1, 6R, 19R, 29R, 30R, 28R, 25R, and 33 were edited and assembled using the software Geneious R.9.0.2 (Biomatters Ltd). For each position the consensus sequence was obtained as the nucleotide present in at least 75% of the clones (SEQ ID NO:1).

[0326] The consensus nucleotide sequence obtained by steps a) to f), shares 99.897% identity with the genome of the isolated VP-046 strain (GenBank accession GU067771).

1.j) Preparation of the Restriction Fragments

[0327] Restriction fragments were assembled from 5 to 3 using the sites shown in FIG. 1.

[0328] For each region one clone containing the consensus sequence was chosen to be included in the infectious clone. Since all clones corresponding to the region 25R had sequences different from the consensus, the clone used to assemble the infectious clone was randomly chosen.

[0329] Whenever necessary, the pUC19 clones obtained in the previous steps, were amplified in E. coli and plasmid DNA isolated using the Wizard Plus SV Minipreps DNA Purification System kit (Promega). In the case of pACYC177-ADAP clones, DNA was purified using the Maxi Plasmid kit (Qiagen).

[0330] Whenever necessary, restriction fragments were amplified by PCR using the enzyme Phusion high fidelity DNA polymerase (Finnzymes), plasmids obtained in previous steps as template and primers shown in Table V:

TABLE-US-00005 TABLEV Name Position Sequence5-3 PRRSV-64F 218-237.sup.1 AACCATGTCTGGGACGTTCT (SEQIDNO:130) PRRSV-65R 2007-1989.sup.1 CCAATAGTAATTTATACAATCTAGAGAAGCC (SEQIDNO:131) PRRSV-66F 1876-1905.sup.1 ACTGTGTTGGTTCTGGTATTGCTGACTTTC (SEQIDNO:132) PRRSV-67R 4000-3981.sup.1 CCAAATCCTCTAGAATGCATAAACGTAAGAAAAC (SEQIDNO:133) PRRSV-72F 12485-12512.sup.1 TCCAGCCGTACGCTATGTTTTTGGTTTC (SEQIDNO:134) PRRSV-73R 14611-14600.sup.1 TTCTTCTGGCTCTAGATTTTTACCGGCC (SEQIDNO:135) pACYC-87F 3248-3266.sup.2 CAGTACCGACGGTGATAT (SEQIDNO:136) pACYC-88R 544-525.sup.2 CCGTCGTGTAGATAACTACG (SEQIDNO:137) M13F 380-395.sup.3 GTAAAACGACGGCCAGT (SEQIDNO:138) M3R 481-461.sup.3 CAGGAAACAGCTATGAC (SEQIDNO:139) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771. .sup.2Cloning vector pACY177 (GenBank accession X06402.1). .sup.3Cloning vector pUC19 (GenBank accession L09137).

1.k) Digestion and Ligation of the Fragments

[0331] Plasmids were digested using the suitable restriction enzymes as shown in FIG. 1. Size of the fragments was confirmed by electrophoresis on 1% agarose gel and the fragments showing the expected sizes were purified using the Zymoclean gel DNA recovery kit (Zymo Research).

[0332] PCR products were purified using the purification columns GeneJet (Thermo Fisher Scientific), digested with the suitable enzymes as shown in FIG. 1 and purified from 1% agarose gels as described above.

[0333] Restriction fragments of expected size were purified from agarose gels and ligated using T4 DNA ligase (Thermo Fisher Scientific). Ligation products were used to transform electro-competent E. coli cells.

1.l) Assembling of the Restriction Fragments

[0334] Restriction fragments were assembled in the sense 5 to 3 according to the following procedure, which is represented in FIG. 1: [0335] Step 1.Clone pUC19-F1 was digested with DraIII and XbaI. Viral cDNA F2 was PCR-amplified from clone pUC19-F2-9B with primers PRRSV-64F and PRRSV-65R and digested with DraIII and XbaI. Digestion products were ligated. [0336] Step 2.Clone pUC19-Nsi-cDNA1-4 and the clone generated in Step 1 were digested with RsrII and XbaI and ligated. [0337] Step 3.Viral cDNA 6R was PCR-amplified from clone pUC19-1-6R-3 (cloned in direction 5 SmaI-3 XbaI) with primers M13F and M13R. The construct obtained in Step 2 and the product of this PCR were both digested with NsiI and XbaI and ligated. [0338] Step 4.To substitute the pUC19 vector by the pACYC-ADAP one, the clone obtained in Step 3 and the pACYC177-ADAP plasmid were both digested with AscI and XbaI and ligated. [0339] Step 5.The clone obtained in Step 4 and clone pACYC177-ADAP-19-29-1 were both digested with SpeI and XbaI and ligated. [0340] Step 6.Clones pUC19-30R-6 and pUC19-28R-1 were both digested with CspCI and XbaI and ligated. [0341] Step 7.The DNA fragment obtained in Step 6 was excised from vector by digestion with SmaI and XbaI and subcloned into a pACYC177-ADAP previously opened with EcoRV and XbaI digested. [0342] Step 8.A PCR reaction was done using the construct generated in Step 7 as template and the primers pACYC-87F and pACYC-88R. The result from this PCR and the clone generated in Step 5 were both digested with BglII and XbaI and ligated. [0343] Step 9.A PCR reaction of clone pUC19-25R was done using primers PRRSV-72F and PRRSV-73R. The resulting product and the clone generated in Step 8 were both digested with Bs/WI and XbaI and ligated. [0344] Step 10.Clone pUC19-33-6 and the construct generated in Step 9 were digested with HpaI and XbaI and ligated. [0345] Step 11.Sequencing of the clone generated in Step 10 showed a deletion in the region Nsi-cDNA1. To correct this problem and to introduce the right sequence an additional RT-PCR was done using viral RNA and primers PRRSV-66F and PRRSV-67R. The resulting product and the construct generated in Step 10 were both digested with RsrII and SalI and ligated. The construct resulting in this step was named pVAC-T7-5.

[0346] Clone pVAC-T7-5 was sequenced using primers suitable to cover the whole genome (SEQ ID NO:2). FIG. 2 shows a scheme of the clone pVAC-T7-5.

1.m) Preparation of the Human Cytomegalovirus Promoter (pCMV) and of the Hepatitis Delta Virus Ribozyme (HDV-Rz) to be Introduced in pVAC-T7-5

[0347] DNA was amplified by PCR with Phusion high fidelity DNA polymerase (Finnzymes) according to the instructions provided by the manufacturer. Before the digestion with the suitable restriction enzyme, PCR products were purified with the GeneJet PCR purification kit (Thermo Fisher Scientific). Digested products were purified from 1% agarose gel using the GeneJet gel extraction kit (Thermo Fisher Scientific). The primers used in this cloning step are shown in Table VI:

TABLE-US-00006 TABLEVI Name Position.sup.1 Sequence5-3 RRSV-110F 1-12 GGCGCGCCATTTAAATATGATGTGTAGG (SEQIDNO:140) PRRSV-103R 1967-1995 TTATACAAGCTAGAGAAGCCGGACCGTTC (SEQIDNO:141) PRRSV-112F 14566-14587 TGTTAAACGAGGAGTGGTTAAC (SEQIDNO:142) HDV-114R.sup.2 ATGTTGCCCAGCCGGCGCCAGCGAGGAGG CTGGGACCATGCCGGCC(T).sub.25AATTTCGG (SEQIDNO:143) HDV-115R.sup.3 GGTCTAGAGTCCCATTCGCCATTACCGAGG GGACGGTCCCCTCGGAATGTTGCCCAGC (SEQIDNO:144) pCMV-102F GGCGCGCCATGCATTAGTTATTAATAGT (SEQIDNO:145) pCMV-116R CATATTTAAATACTAAACCAGCTCTGCTTATA TAG (SEQIDNO:146) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771. .sup.2Y.W. Huang etal., Virus Res. 2009, 145,1-8, with modifications in 3. .sup.3cY.W. Huang etal. Virus Res. 2009, 145,1-8.

1.n) Preparation of the Vectors

[0348] Plasmids to be used as vectors in steps o) and p) below (pVAC-T7-5, Asc-Swa-pVAC5 and Asc-Swa-pVAC5-HDV) were digested with the suitable restriction enzymes (FIG. 3) and purified from 1% agarose gels using the GeneJet gel purification kit (Thermo Fisher Scientific). Purified vectors were treated with shrimp alkaline phosphatase (Sigma) for dephosphorylation.

1.o) Ligations

[0349] Ligations were carried out with the enzyme T4 DNA Ligase (Thermo Fisher Scientific). Ligation products were electroporated in electro-competent E. coli DH5a. Plasmid DNA was purified with the QIAGEN Plasmid Maxi kit (Qiagen).

1.p) Assembly of Fragments

[0350] Clone pVAC-T7-5 was modified according to a process comprising the following steps represented in FIG. 3. [0351] Step 1: The 5 terminus of viral genome was PCR amplified using the clone pVAC-T7-5 as template and primers PRRSV-110F and PRRSV-103R (Table VI). The resulting PCR product was digested with AscI and RsrII, and cloned into the vector generated by the digestion of pVAC-T7-5 with the same enzymes. This clone was named Asc-Swa-pVAC5. [0352] Step 2: Two consecutive PCRs were done to introduce the HDV-Rz. In the first PCR, clone pVAC-T7-5 was used as template with primers PRRSV-112F and HDV-114R (Table VI). The resulting PCR product was purified and used as template for a second PCR reaction with primers PRRSV-112F and HDV-115R (Table VI). The resulting PCR product was digested with HpaI and XpaI and cloned into the vector generated by digestion with the same pair of enzymes of the clone obtained in Step 1. This clone was named Asc-Swa-pVAC5-HDV-Rz. [0353] Step 3: The pCMV promoter was obtained by PCR, using the vector pCMV-Script XR (Agilent Technologies) as template and primers pCMV-102F and pCMV-116R (Table VI). The resulting PCR product was digested with AscI and SwaI and cloned into the vector resulting of digesting the clone obtained in Step 2 with the same two restriction enzymes. The clone obtained was named pVAC 5.0 and is shown in FIG. 4.

1.q) Verification of the Sequence

[0354] To confirm the PRRSV sequence inserted in pVAC 5.0, DNA was sequenced using primers suitable to obtain the sequence of the genome, the pCMV promoter, the HDV-Rz ribozyme and the joins with the cloning vector. Sequence of clone pVAC 5.0 is provided (SEQ ID NO:3).

[0355] In SEQ ID NO:3:

[0356] Fragment 1 (positions 1-962) was obtained by sequencing of plasmid pVAC 5.0 with primer pACYC-87F (Table VII). This fragment contains from 5 to 3: partial sequence of vector pACYC177-ADAP (positions 1-32), the sequence of AscI restriction site (positions 33-40), the sequence of pCMV promoter (positions 41-622), the sequence of SwaI restriction site (positions 623-630), the 5 terminal of PRRSV virus (positions 631-962). The sequence of this fragment was confirmed by sequencing with the reverse primer PRRSV-63R.

[0357] Fragment 2: Since the genome of PRRSV can be assumed not to change during the introduction of the promoter into the 5 terminus, positions 333-14612 of SEQ ID NO:2 (pVAC-T7-5) were copy and pasted to positions 963-15242 of SEQ ID NO:3 (pVAC5.0).

[0358] Fragment 3: Positions 15243-15917 were obtained by sequencing of plasmid pVAC 5.0 with primer pACYC-88R, as shown in Table VII:

TABLE-US-00007 TABLEVII Name Sequence5-3 Position pACYC-87F TCAGTACCGACGGTGATAT 18041-18059.sup.2 (SEQIDNO:147) pACYC-88R CCGTCGTGTAGATAACTACG 15318-15337.sup.2 (SEQIDNO:148) PRRSV-63R CGATAGGGACTTTCCAGTGAAGTCTAGATTTAGGC 368-411.sup.1 TTGTAAAAC (SEQIDNO:149) .sup.1The position corresponds to the genome of the isolated VP-046 BIS strain with the GenBank accession GU067771. .sup.2Cloning vector pACY177 (GenBank accession X06402.1).

[0359] This sequence contains 3 terminal part of PRRSV including the poly(A) tail (positions 15243-15753), the HDV-Rz positions (15754-15837), the restriction site of XbaI (15838-15843) and partial sequence of vector pACYC177-ADAP (15844-15917). In Fragment 3 there are two differences between the genome of PRRSV in clones pVAC-T7-5 and pVAC 5.0 (both introduced by primer HDV-114R) cytosine 15098 in SEQ ID NO:2 (pVAC-T7-5) is mutated to thymidine (position 15728 in SEQ ID NO:3, pVAC 5.0). Poly(A) tail (positions 15099-15139) in SEQ ID NO:2 (pVAC-T7-5) is 16 nucleotides shorter in pVAC 5.0 (positions 15729 to 15753).

1.r) Alignment of Consensus Sequence of VP-046 BIS and Clone pVAC 5.0.

[0360] As for all RNA viruses, the attenuated virus VP-046 BIS has a quasispecies population structure, meaning that it contains multiple sequence variants. When pVAC 5.0 was generated, the genomic sequence of PRRSV cloned represents a chimeric genome that not necessarily contains the most abundant alleles at all possible polymorphic positions. To explore the existence of polymorphisms at different nucleotide positions, a number of 2 to 5 (median=3.5) overlapping molecular clones were sequenced and assembled as described in i). Median coverage was of 4 reads for each position, ranging between 2 and 13.

[0361] Table VIII shows the differences between the consensus sequence and pVAC 5.0 sequences detected with the sample size used, the nucleotides found at each polymorphic position and the nucleotide incorporated in pVAC 5.0:

TABLE-US-00008 TABLE VIII Nucleotide Nucleotide Position.sup.1 Consensus.sup.2 (Number of clones).sup.3 in pVAC 5.0.sup.4 3902 S G (5) C (7) C 3962 Y C (5) T (7) T 7219 R G (2) A (2) A 7292 Y T (2) C (2) C 7340 M A (2) C (2) C 7540 R G (2) A (4) A 13136 M C (2) A (5) A 13141 Y T (2) C (4) C 13173 C C (3) T (1) T 13922 T T (3) C (1) C 14403 R G (4) A (4) A 14852 Y T (2) C (2) C 15098 Y T (2) C (2) C .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1). .sup.2SEQ ID NO: 1. .sup.3Example 1.h), 1.i). .sup.4SEQ ID NO: 3.

[0362] It is observed that in most cases, the most frequent allele was already present in pVAC 5.0, but in a few positions the allele presented in the clone does not reflect the most abundant one in the VP-046 BIS attenuated virus.

[0363] The full nucleotide sequence of infectious clone pVAC 5.0 is SEQ ID NO:223. The partial nucleotide sequence of infectious clone pVAC 5.0 is SEQ ID NO:3

[0364] The infectious clone pVAC 5.0 was deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32339 (Jul. 19, 2016).

Example 2: Construction of Infectious Clone pVAC 5.2

[0365] Clone pVAC 5.2 contains the same full PRRSV genomic sequence than clone pVAC 5.0 with the exception of the fragment between positions 12492-14584, which encodes the glycoproteins GP3 (partial), GP4, GP5, and GP6 (partial). This fragment has been replaced by the most frequent sequence variant found in the attenuated virus VP-046 BIS quasispecies. The variability study for the region positions 12938 to 14151, encoding for GP4 and GP5, and the cloning of the most frequent sequence variant in the infectious clone pVAC 5.0 to obtain clone pVAC 5.2, are described below

2.A) Virus.

[0366] The starting material for this work was PRRSV strain VP-046 BIS (GenBank accession 00067771, CNCM accession 1-1642, 23 Nov. 1995), sampled from a frozen dried material commercially available through Laboratorios Hipra, S.A., Amer, Girona, Spain.

2.b) Isolation of Viral RNA.

[0367] Frozen dried material was resuspended in 10 mL of sterilized deionized water. RNA extractions were carried out using the High Pure Viral RNA kit (Roche).

2.c) Reverse Transcription.

[0368] cDNAs were obtained using the AccuScript high fidelity reverse transcriptase (Agilent Technologies) and primer PRRSV-2R shown in Table X.

2.d) Amplification of cDNA by PCR.

[0369] Before the amplification of cDNA, primers PRRSV-1F and PRRSV-2R, shown in Table IX, were phosphorylated using the enzyme T4 polynucleotide kinase (Thermo Fisher Scientific).

TABLE-US-00009 TABLEIX Primer Sequence Position PRRSV-1F TAGACGGGGGYAAYTGGTT 12918-12936.sup.1 (SEQIDNO:150) PRRSV-2R GACACCTTAAGRGCRTATATCAT 14193-14171.sup.1 (SEQIDNO:151) .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1).

[0370] cDNAs were then amplified by PCR using Phusion high fidelity DNA polymerase (Finnzymes) and primers PRRSV-1F and PRRSV-2R (Table X). RT-PCR products were purified from 1% agarose gels, using the Zymoclean gel DNA recovery kit (Zymo Research).

2.e) Cloning and Sequencing of cDNAs.

[0371] Purified cDNAs and vector pUC19 previously digested with SmaI (Thermo Fisher Scientific) were ligated with the T4 DNA ligase (Thermo Fisher Scientific). Ligation products were transformed into E. coli DH5a electro-competent cells. Ligation was confirmed by colony PCR with primers M13F and M13R (Table IV). Plasmid DNA was purified with the Wizard Plus SV Minipreps DNA purification system kit (Promega).

[0372] Plasmid DNA was isolated from 21 colonies and inserts were sequenced with primers M13F and M13R (Table IV). Sequences were edited and aligned using the software Geneious R.9.0.2 (Biomatters Ltd), and are provided as SEQ ID NO: 6-26.

[0373] Positions 12938-14151 of viral genome were determined for 21 cDNA clones (FIG. 5). Most frequent variant had a frequency of 0.238, while the frequency of the rest was 0.048. The most frequent sequence corresponded to variant defined by SEQ ID NO:6.

2.f) Virus and Isolation of Viral RNA were the Same as in a) and b)

2.g) Reverse Transcription.

[0374] Viral cDNA was obtained using AccuScript high fidelity reverse transcriptase (Agilent Technologies) and primer PRRSV-120R (Table X).

2.h) Amplification of cDNA by PCR.

[0375] Before the amplification of cDNA, primers PRRSV-119F and PRRSV-120R (Table XI) were phosphorylated using the T4 polynucleotide kinase (Thermo Fisher Scientific). cDNAs were amplified by PCR using Phusion high fidelity DNA polymerase (Finnzymes) and primers PRRSV-119F and PRRSV-120R (Table II). RT-PCR products were purified from agarose gels, using the Zymoclean gel DNA recovery kit (Zymo Research).

2.i) Cloning and Sequencing of cDNAs.

[0376] Viral cDNA and vector pUC19 digested with SmaI (Thermo Fisher Scientific) were ligated with the enzyme T4 DNA Ligase (Thermo Fisher Scientific). Ligation products were electroporated in E. coli DH5a. Ligation was confirmed by colony PCR with primers M13F and M13R (Table IV). Plasmid DNA was purified from 10 colonies with the Wizard Plus SV Minipreps DNA Purification System kit (Promega). Inserts were sequenced with primers suitable to obtain the whole insert sequence. Sequences were edited and aligned with the most frequent sequence found in e) (SEQ ID NO:6) using the software Geneious R.9.0.2 (Biomatters Ltd). One clone was chosen for the following steps. This clone was named GPsM-clon 1, the sequence of viral cDNA in this clone is provided (SEQ ID NO: 27).

2.j) Subcloning of Viral cDNA in Clone GPsM-Clon 1 in pVAC 5.0 (FIG. 6).

[0377] Viral cDNA in clone GPsM-clon1 was amplified by PCR using Phusion High Fidelity DNA polymerase (Finnzymes) and primers PRRSV-119F and PRRSV-120R, as shown in Table X:

TABLE-US-00010 TABLEX Primer Sequence Position PRRSV-119F GAATTCCAGCCGTACGCTATG 12481-12501.sup.1 (SEQIDNO:152) PRRSV-120R TACTTGACGAGGTTAACCACTCCTC 14598-14574.sup.1 (SEQIDNO:153) .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1).

[0378] DNA was purified using GeneJet PCR purification kit (Thermo Fisher Scientific) and digested with Bs/WI and HpaI.

[0379] Plasmid pVAC 5.0 was digested with the Bs/WI and HpaI, purified from agarose gel using the Zymoclean gel DNA recovery kit (Zymo Research), and dephosphorylated using the shrimp alkaline phosphatase (Sigma).

[0380] Restriction products were ligated with the enzyme T4 DNA Ligase (Thermo Fisher Scientific). Ligation products were electroporated in E. coli DH5.

[0381] Plasmid DNA was isolated from a transformant colony using the NucleoBond Xtra Maxi kit (Macherey-Nagel). This new clone was named as pVAC 5.2.

2.k) Alignment of Consensus Sequence of VP-046 BIS and Clones pVAC 5.0 and pVAC 5.2.

[0382] Polymorphic positions in consensus sequence of attenuated virus VP-046 BIS, and differences between consensus sequence and clones pVAC 5.0 and pVAC 5.2 are shown in Table XI:

TABLE-US-00011 TABLEXI Consensusnucleotide andnumberof Nucleotide Nucleotide Nucleotide clonescontaining inclone (Numberof inclone Position.sup.1 eachvariant.sup.2 pVAC5.0.sup.3 clones).sup.4 pVAC5.2.sup.4 3902 S:G(5)C(7) C C.sup.3 3962 Y:C(5)T(7) T T.sup.3 7219 R:G(2)A(2) A A.sup.3 7292 Y:T(2)C(2) C C.sup.3 7340 M:A(2)C(2) C C.sup.3 7540 R:G(2)A(4) A A.sup.3 12940 T:>75% T T(5)C(16) C.sup.5 13136 M:C(2)A(5) A A(6)C(15) C.sup.5 13141 Y:T(2)C(4) C C(6)T(15) T.sup.5 13173 C:>75% T T(0)C(21) C.sup.5 13320 C:>75% C C(4)T(17) T.sup.5 13518 T:>75% T T(4)C(17) C.sup.5 13562 G:>75% G G(5)T(16) T.sup.5 13663 C:>75% C T(1)C(4) G.sup.5 G(16) 13668 T:>75% T T(5)C(16) C.sup.5 13913 T:>75% T C(8)T(13) C.sup.5 13922 T:T(3)C(1) C C(0)T(21) T.sup.5 14403 R:G(4)A(4) A A.sup.5 14852 Y:T(2)C(2) C C.sup.3 15098 Y:T(2)C(2) C .sup.C3 .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1). .sup.2From Example 1.h), 1.i). .sup.3SEQ ID NO: 3. .sup.4From Example 2.e). .sup.5SEQ ID NO: 27.

[0383] The infectious clone containing the most frequent sequence corresponding to the region from position 12938 to 14151 is named pVAC 5.2.

[0384] The full nucleotide sequence of infectious clone pVAC 5.2 is SEQ ID NO:225. The partial nucleotide sequence of infectious clone pVAC 5.2 is SEQ ID NO:4.

[0385] The infectious clone pVAC 5.2 was deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32341 (Jul. 19, 2016).

Example 3: Construction of Infectious Clone pVAC 5.1

[0386] Clone pVAC 5.1 contains the most frequent sequence variant in the quasispecies of the attenuated virus VP-046 BIS in the regions i) from position 3902 to 3959 ii) from 6792 to 7672 and iii) 12938 to 14151 encoding for GP4 and GP5

[0387] The nucleotide variation of the attenuated virus VP-046 BIS in the region from position 6792 to 7672 was assessed according to the following procedure:

3.a) Virus and RNA Isolation were Done as Described in Example 2 a) and b).
3.b) Reverse Transcription was Performed with Primer PRRSV-126R (Table XII) as Described in Example 2 c).
3.c) Amplification of Viral cDNAs by PCR was Performed with Primers PRRSV-125F and PRRSV-126R as Described in Example 2 d).
3.d) Ligation of Viral cDNAs in the Cloning Vector pUC19 and Transformation of E. coli Cells was Done as Described in Example 2 e).
3.e) Sequencing of cDNAs and Selection of the Most Frequent Variant.

[0388] Colony PCR was conducted with primers PRRSV-97F and PRRSV-32R (Table I). PCR products from 30 colonies were sequenced with primers PRRSV-97F and PRRSV-32R (Table I). Sequences were edited and aligned using the software Geneious R.9.0.2 (Biomatters Ltd) and provided as SEQ ID NO: 28-57.

[0389] Positions 6792 to 7672 of viral genome were determined for 30 cDNA clones (FIG. 5). Most frequent variant has a frequency of 0.533 followed by others with frequencies less than 0.167.

[0390] Plasmid DNA was isolated from one colony containing the most frequent variant. This clone was named pUC19-INT-4, and sequenced using primers suitable to obtain the complete insert sequence. Sequence of insert in pUC19-INT-4 is provided as SEQ ID NO:58.

[0391] The subcloning of viral cDNA insert in clone pUC19-INT-4 in pVAC 5.2 was performed according to the following procedure:

3.f) Viral cDNA was Amplified from Clone pUC19-INT-4 Using the Primers PRRSV-125F and 126R, Shown in Table XII, and Directionally Cloned Between SpeI and BglII Sites of Plasmid pVAC 5.2 Using the Methodology Described in Example 2 j) (FIG. 6):

TABLE-US-00012 TABLEXII Primer Sequence Position PRRSV-125F GTGACTAGTTATGTTCCCACCAT 6271-6295.sup.1 (SEQIDNO:154) PRRSV-126R AGAGGAGATCTACCAGCCCC 9500-9519.sup.1 (SEQIDNO:155) PRRSV-97F CGGATCCATCCTCGATATTAATGTG 6749-6773.sup.1 (SEQIDNO:156) PRRSV-32R TGCAGTTTCAAAATCCCAAA 7719-7738.sup.1 (SEQIDNO:157) .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1).

[0392] Positive clones were identified by colony PCR with primers PRRSV-97F and PRRSV-32R and sequencing of PCR products with the same primers. Plasmid DNA was purified from one positive colony as in Example 2 j). This construct was named pVAC 5.2-INTm.

[0393] The nucleotide variation of the attenuated virus VP-046 BIS in the region from position 3902 to 3959 was assessed according to the following procedure:

3.g) Virus, and isolation of PRRSV genomic RNA were as described in Example 1 a) and b).
3.h) Reverse transcription was performed with primer PRRSV-124R (Table XIV) as described in Example 2 c).
3.i) Amplification of viral cDNAs by PCR was performed with primers PRRSV-123F and PRRSV-124R (Table II) as described in example 2 d).
3.j) Ligation of viral cDNAs in the cloning vector pUC19 and transformation of electro-competent E. coli cells was done as described in Example 2 e).
3.k) Sequencing of cDNAs and selection of the most frequent variant.

[0394] Colony PCR was conducted with primers PRRSV-93F and PRRSV-67R (Table II). PCR products of 25 colonies were sequenced with primers PRRSV-93F and PRRSV-67R (Table XIII). Sequences were edited and aligned using the software Geneious R.9.0.2 (Biomatters Ltd). Sequences are provided as SEQ ID NO:59-83. [0395] Positions 3902 to 3959 of viral genome were determined for 25 cDNA clones (FIG. 5). The most frequent variant has a frequency of 0.440, closely followed by the variant already present in pVAC 5.0 (0.400), the other two variants have a frequency as low as 0.040. [0396] Plasmid DNA was isolated from one colony containing the most frequent variant. This clone was named pUC19-DEG-3, and sequenced using primers suitable to obtain the complete insert sequence. Sequence is provided as SEQ ID NO: 84. [0397] The subcloning of viral cDNA insert in clone pUC19-DEG-3 in pVAC 5.2-INTm was performed according to the following procedure:
3.l) Viral cDNA was amplified from clone pUC19-DEG-3 using the primers PRRSV-123F and 124R (Table XIII), and directionally cloned between the RsrII and SpeI sites of plasmid pVAC 5.2-INTm using the methodology described in Example 2 j) (FIG. 6). Positive clones were identified by colony PCR with primers PRRSV-93F and PRRSV-67R, shown in Table XIII, and sequencing of PCR products with the same primers. Plasmid DNA was purified from one positive colony as in Example 2 j):

TABLE-US-00013 TABLEXIII Primer Sequence Position PRRSV-93F CATGCTGAGCTTTTGGCTCTTG 3852-3873.sup.1 (SEQIDNO:158) PRRSV-67R CCAAATCCTCTAGAATGCATAAACGTAAGAAAAC 3981-4000.sup.1 (SEQIDNO:159) PRRSV-123F CAGAACGGTCCGGCTTCT 1966-1983.sup.1 (SEQIDNO:160) PRRSV-124R ACATAACTAGTCACAGCAAGAACCC 6286-6262.sup.1 (SEQIDNO:161) .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1). .sup.2Cloning vector pUC19 (GenBank accession L09137). This construct was named as pVAC 5.1.
3.m) Alignment of consensus sequence of VP-046 BIS and clones pVAC 5.0 and pVAC 5.2 and pVAC 5.1.

[0398] Polymorphic positions in consensus sequence of attenuated virus VP-046 BIS, and differences between consensus sequence and clones pVAC 5.0, pVAC 5.2 and pVAC 5.1 are shown in Table XIV:

TABLE-US-00014 TABLE XIV Consensus: number of clones Nucleotide Nucleotide Nucleotide containing in clone Nucleotide in clone in clone Position.sup.1 each variant.sup.2 pVAC 5.0 .sup.3 (Number of clones) pVAC 5.2 pVAC 5.1 3000 G G G .sup.3 A .sup.9 3902 S: G (5) C (7) C C (12) G (13) .sup.8 C .sup.3 G .sup.9 3962 Y: C (5) T (7) T C (13) T (12) .sup.8 T .sup.3 C .sup.9 7219 R: G (2) A (2) A A (6) G (24) .sup.6 A .sup.3 G .sup.7 7292 Y: T (2) C (2) C C (9) T (21) .sup.6 C .sup.3 T .sup.7 7340 M: A (2) C (2) C C (9) A (21) .sup.6 C .sup.3 A .sup.7 7540 R: G (2) A (4) A A (30) .sup.6 A .sup.3 A .sup.7 12940 T: >75% T T (5) C (16) .sup.4 C .sup.5 C .sup.5 13136 M: C (2) A (5) A A (6) C (15) .sup.4 C .sup.5 C .sup.5 13141 Y: T (2) C (4) C C (6) T (15) .sup.4 T .sup.5 T .sup.5 13173 C: >75% T T (0) C (21) .sup.4 C .sup.5 C .sup.5 13320 C: >75% C C (4) T (17) .sup.4 T .sup.5 T .sup.5 13518 T: >75% T T (4) C (17) .sup.4 C .sup.5 C .sup.5 13562 G: >75% G G (5) T (16) .sup.4 T .sup.5 T .sup.5 13663 C: >75% C T (1) C (4) G (16) .sup.4 G .sup.5 G .sup.5 13668 T: >75% T T (5) C (16) .sup.4 C .sup.5 C .sup.5 13913 T: >75% T C (8) T (13) .sup.4 C .sup.5 C .sup.5 13922 T: T (3) C (1) C C (0) T (21) .sup.4 T .sup.5 T .sup.5 14403 R: G (4) A (4) A A .sup.3 A .sup.3 14852 Y: T (2) C (2) C C .sup.3 C .sup.3 15098 Y: T (2) C (2) C C .sup.3 C .sup.3 .sup.1The position corresponds to the consensus sequence of the attenuated virus VP-046 BIS (SEQ ID NO: 1). .sup.2Example 1.h), 1.i). .sup.3 SEQ ID NO: 3. .sup.4 Example 2.e). .sup.5 SEQ ID NO: 27. .sup.6 Example 3.e). .sup.7 SEQ ID NO: 58. .sup.8 Example 3.k). .sup.9 SEQ ID NO: 84.

[0399] The infectious clone containing the most frequent sequence corresponding to these three regions from position 3902 to 3959, from 6792 to 7672 and from 12938 to 14151, is named pVAC 5.1.

[0400] The full nucleotide sequence of infectious clone pVAC 5.1 is SEQ ID NO:224. The partial nucleotide sequence of infectious clone pVAC 5.1 is SEQ ID NO:5.

[0401] The infectious clone pVAC 5.1 was deposited in the Leibnitz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen under accession number DSM 32340 (Jul. 19, 2016).

Example 4: Assessment of the Attenuation and Reversion to Virulence of Infectious Clone pVAC 5.2 in Piglets

[0402] In this example the attenuation of infectious clone pVAC 5.2 in piglets was assessed in view of the infection kinetics compared with the attenuated original virus strain VP-046 BIS of PRRSV (GenBank accession GU067771), and the reversion to virulence of infectious clone pVAC 5.2 was assessed with serial passages in piglets.

[0403] The animals were porcine males and females of 5 weeks of age at the beginning of the study, free of PRRSV and antibody free against PRRSV. 35 animals were used in the first serial passage and 35 animals for the second serial passage.

[0404] The infection kinetics was measured by real time quantitative PCR (RT-qPCR). Reversion to virulence was assessed by viremia values and the presence of clinical signs in animals.

[0405] For the first serial passage in piglets were used the clone pVAC 5.2 and VP-046 BIS strain.

[0406] The clone pVAC 5.2 was digested with XbaI and purified with GeneJet PCR purification kit to obtain a linearized DNA. Afterwards it was transfected in Clone 8 cells (Collection Nationale de Cultures de Microorganismes accession 1-1643) at a confluence of 90% using Lipofectamine 3000 kit (Thermofisher), in 24-veil plates, adjusting at 2 g of linearized DNA in 100 l/well. The DNA-lipofectamine complex was incubated 30 minutes at room temperature before adding it to the wells. After the addition, the DNA-lipofectamine complex was incubated 3 h at 37 C. under 5% carbon dioxide atmosphere. After 3 h, MEMg medium supplemented with 10% FBS (fetal bovine serum) was added.

[0407] PRRSV were amplified also in Clone 8 cells and after 4 virus passages the titre reached was 9.0210.sup.4 CCID.sub.50/mL. Virus was diluted in PBS in order to uniform all the virus dose/animals among groups. It was administered a dose of 2 m L/animal.

[0408] The result of the transfection and amplification confirms the ability of the infectious clone of the infection to generate PRRS virus.

[0409] Vaccine VP-046 BIS was reconstituted with PBS to achieve 1.4410.sup.4 CCID.sub.50/mL.

[0410] In the first serial passage both products were administered intranasally, one single dose of 1 mL in each nostril, corresponding to 1.810.sup.5 CCID.sub.50/animal for pVAC 5.2, and 2.8810.sup.4 CCID.sub.50/animal for vaccine VP-046 BIS.

[0411] In the study the following designations were used: [0412] Group A=group inoculated with pVAC 5.2, [0413] Group B=group inoculated with vaccine VP-046 BIS, and [0414] Group C=Control group, inoculated with PBS

[0415] Homogenized lung tissues from piglets from the first serial passage, which were positive for PRRS virus by RT-qPCR, were used for the second serial passage in piglets. Viability of such inocula was confirmed by isolation.

[0416] In the second serial passage both products were administered intranasally, one single dose of 0.5 mL in each nostril, corresponding to 7.2710 CCID.sub.50/animal for pVAC 5.2, and 3.7810 CCID.sub.50/animal for vaccine VP-046 BIS

[0417] In both serial passages 10 animals of each group were inoculated either with pVAC 5.2 o VP-046 BIS, and 5 animals were not inoculated but shared the room with the inoculated ones. These animals were considered cohabitants in order to assess the transmission level of the PRRS virus.

[0418] The variables evaluated in this study and the statistical tests applied are listed below: [0419] viral isolates: descriptive statistics and parametric test for comparing groups. [0420] clinical signs: descriptive statistics and non-parametric test for comparing groups, temperature and weight nonparametric ANOVA.

4.1.Results for the First Serial Passage

4.1.1.Viremia in Inoculated and Cohabitant Animals

[0421] Sera at day 3 and up to day 37 of the study were analysed by RT-qPCR.

[0422] In FIG. 9 are represented the mean titers (CCID.sub.50/mL) of viremia at day 3 up to day 37 of the study after for each group. At days 3, 7 and 21 there were significant differences between group A (pVAC 5.2) and group B (VP-046 BIS), and a trend to lower titer for group A is observed.

[0423] When comparing the percentages of viremic animals for each group, it was observed a clear trend for group A (pVAC 5.2) to show a reduction in the number of positive animals during the study in comparison to group B (VP-046 BIS). There were statistical differences also at 3, 7 and 21 days post-vaccination.

[0424] From sera analysis by RT-qPCR from cohabitant animals it was observed that pVAC 5.2 did not raise viremia in those animals, in comparison to VP-046 BIS, showing a mean value of 2.3810 CCID.sub.50/mL.

[0425] When comparing the percentages of cohabitant animals positive to viremia for each group, it was observed again a clear trend for group A (pVAC 5.2) to show a reduction in the number of positive animals during the study in comparison to group B (VP-046 BIS).

[0426] The lower viremia of pVAC 5.2 group in front of VP-046 BIS represents lower capacity of accumulation in lungs and tonsils, and consequently less capacity of reversion to virulence of the vaccine of the invention.

4.1.2.Virus Tissue Load and Shedding in Inoculated and Cohabitant Animals

[0427] At day 35 after inoculation animals were euthanized and the presence of virus in lung tissue, tonsil and faecal swabs was analysed.

[0428] In FIG. 10 are represented the percentages of inoculated animals positive to PRRSV detection in lung tissues, tonsil and faecal swabs for each group, showing a clear reduction in the number of positive animals of group A (pVAC 5.2) in comparison to group B (VP-046 BIS).

[0429] At day 35 cohabitant animals were euthanized and the presence of virus in lung tissue, tonsil and faecal swabs was analysed.

[0430] It was observed a significant reduction in lung virus load for the pVAC 5.2 group in comparison to the VP-046 BIS group in cohabitant animals. An analogous reduction was observed in the percentages of animals positive to PRRSV in lung tissues and tonsil swabs favourable to group A (pVAC 5.2).

[0431] The lower tissue load of pVAC 5.2 in front of VP-046 BIS represents less capacity of reversion to virulence. Therefore, it confirms increased safety of the vaccine of the invention.

4.1.3.Seroconversion in Inoculated and Cohabitant Animals

[0432] It was observed that 70% of animals inoculated with pVAC 5.2 were already seropositive (IRPC>20) at day 14, being 80% for those animals inoculated with VP-046 BIS. 100% of animals of both groups were seropositive at day 35.

[0433] In cohabitant animals, it was observed that seroconversion was lower in the group pVAC 5.2. In fact only one animal of this group showed an effective seroconversion. At day 35 the percentages of seroconversion were 20% of the pVAC 5.2 cohabitant animals and 80% of the cohabitants with the VP-046 BIS inoculated animals. The reduced viremia and shedding seen in the group A (pVAC 5.2) in comparison to the group B (VP-046 BIS) reduces the trend to infection in cohabitant animals. In this way, probability of reversion to virulence due to serial passages in vivo is reduced.

4.1.4.Clinical Signs and Temperature in Inoculated and Cohabitant Animals

[0434] Clinical signs are assessed according to the method disclosed in Martelli et al., Vaccine, 2009, 27, 3788-3799.

[0435] It was observed that the vaccination with pVAC 5.2 produced better results in terms of reduction of clinical signs in comparison to VP-046 BIS.

[0436] Differences between groups of cohabitant animals were not significant.

4.2.Results for the Second Serial Passage

4.2.1.Viremia in Inoculated and Cohabitant Animals

[0437] Sera at day 0 and up to day 35 of the study were analysed by RT-qPCR.

[0438] In FIG. 11 are represented the percentages of inoculated animals (Second serial passage) positive to viremia for each group. It was observed a clear trend for group A (pVAC 5.2) to show a reduction in the number of positive inoculated animals and the virus titre during the study in comparison to group B (VP-046 BIS). It was observed also a clear trend for group A (pVAC 5.2) to show the clearance of the viremia in the cohabitant animals (0 CCID.sub.50/mL for the pVAC 5.2 group during all the study) and a reduction in the number of positive cohabitant animals during the study in comparison to group B (VP-046 BIS).

4.2.2.Virus Tissue Load and Shedding in Inoculated and Cohabitant Animals

[0439] At day 35 after inoculation animals were euthanized and the presence of virus in lung tissue, tonsil and faecal swabs was analysed by RT-qPCR.

[0440] It was observed a significant reduction in lung virus load and in tonsil swabs for the pVAC 5.2 group in comparison to the VP-046 BIS group.

[0441] It was also observed a clear reduction in the percentage of animals with presence of the virus in lung tissue and/or in tonsil swabs for the pVAC 5.2 group in comparison to the VP-046 BIS group: 0% of animals were positive in the pVAC 5.2 group, whereas 90% and 100% were positive in lung tissues and in tonsil swab respectively in the VP-046 BIS group.

[0442] No faecal shedding was practically seen in animals inoculated with pVAC 5.2 (Second serial passage).

[0443] Regarding cohabitant animals, analogous results were observed in viremia (lung tissues and tonsil swabs), percentages of animals positive to viremia in lung tissues and tonsil swabs with a clear significant reduction in lung virus load and tonsil swabs for the pVAC 5.2 group in comparison to the VP-046 BIS group, and no faecal shedding was practically seen when pVAC 5.2 (Second serial passage) was inoculated.

4.2.3.Seroconversion in Inoculated and Cohabitant Animals

[0444] It was observed that none of the animals inoculated with pVAC 5.2 (Second serial passage) was seropositive (IRPC>20), because none animal was infected with the virus. In the opposite, animals inoculated with VP-046 BIS (Second serial passage) showed 100% seroconversion, in spite the small amount of virus that was inoculated.

[0445] This result confirmed the lower viremia and replication capacity of pVAC 5.2.

[0446] Analogously, none of the cohabitant animals of the group pVAC 5.2 was seropositive and the IRPC ELISA showed values below 20 (i.e. negative). This is the consequence of the lower viremia and replication capacity of pVAC 5.2 shown in the inoculated animals (Second serial passage).

4.2.4.Clinical Signs and Temperature in Inoculated and Cohabitant Animals

[0447] Clinical signs are assessed according to the method disclosed in Martelli et al.

[0448] No severe clinical signs were observed in inoculated animals with pVAC 5.2 or VP-046 BIS from the second serial passage, or in cohabitant animals.

Example 5: Homologous Efficacy Assessment of Infectious Clone pVAC 5.2 in Piglets

[0449] In this example of efficacy trial, the PRRSV-infection consequences were compared between a vaccinated group with a vaccine prepared from clone pVAC 5.2 and a non-vaccinated group after a homologous challenge. In the trial it was included also a positive control (commercially available VP-046 BIS strain, Laboratorios Hipra, S.A., Amer, Girona, Spain) that was also challenged.

[0450] The clone pVAC 5.2 was transfected and amplified, as disclosed in Example 4, to achieve the desired volume and titer (10.sup.3.88 CCID.sub.50/ML). It was administered a dose of 1 mL/animal.

[0451] Freeze dried vials of VP-046 BIS strain, were reconstituted with PBS to achieve 10.sup.3.88 CCID.sub.50/animal in a dose of 1 mL.

[0452] The animals were porcine males and females of 4 weeks of age at the vaccination day, free of PRRSV and antibody free against PRRSV. They were randomly distributed into 3 groups of 15 piglets each one. One group was vaccinated with the vaccine prepared from clone pVAC 5.2 by intramuscular route using 10.sup.3.88 CCID.sub.50/animal. Another group was vaccinated with the same virus titer but with VP-046 BIS vaccine. The last group was vaccinated with sterile PBS and was maintained in the same housing conditions (as a challenge control).

[0453] In the study the following designations were used: [0454] Group A=group vaccinated with pVAC 5.2, [0455] Group B=group vaccinated with VP-046 BIS, and [0456] Group C=Control group, non-vaccinated

[0457] The efficacy of pVAC 5.2 vaccine and the VP-046 BIS against PRRSV was confirmed by means of a challenge with the homologous virulent strain of PRRSV (5711) in piglets 42 days after the vaccination. The challenge was performed by intranasal route, which is one of the virus' natural infection routes.

[0458] After the challenge, the incidence and duration of viremia and the virus excretion in nasal secretion/faeces (RT-qPCR) was followed up to support the efficacy claims of pVAC 5.2 vaccine and VP-046 BIS. The clinical signs of all the piglets (including general and respiratory signs, mortality and temperature increases) and the average daily weight gain were also monitored. The observation period of all animals was prolonged up to 42 days after challenge. Lung and tonsil swabs presence of the PRRS virus in piglets was also determined after euthanasia (RT-qPCR). In addition, each piglet was observed to detect any local or systemic clinical sign after vaccination.

[0459] Finally, serology (PRRSV antibody level; total IgG by ELISA) of all the animals was performed after vaccination (in order to assess the correct immunization) and after challenge (antibody kinetics description). Furthermore, the induction of neutralizing antibodies (NA) was also evaluated with the sera from all the animals to support the protective properties of the pVAC 5.2 vaccine with quantification of effective antibodies.

[0460] This study was blind, thus the person who vaccinated the animals was not the same that the one who performed the rest of the samplings and observations.

[0461] The variables evaluated in this study and the statistical tests applied are listed below: [0462] Viremia and serological profiles: descriptive statistics and a non-parametric Kruskal Wallis test or ANOVA test were applied for group comparison on viremia. Results were plotted in graphics including the serological profiles of the mean titres for PRRSV antibodies from all groups. [0463] Body weight of piglet: tabulation of body weights, descriptive statistics, and ANOVA test for comparisons between groups were done. [0464] Rectal temperature data: taking into account that temperature is normal distributed, body temperature was evaluated using descriptive statistics, an ANOVA model analysis of variance was used to analyse the body temperature evolution over time, taking in account treatment. [0465] Clinical signs and lesions: relevant clinical signs for vaccinated and control groups were compared. Clinical observations are discrete variables and they were analysed using a non-parametric Kruskal Wallis test of association between treatment and clinical signs. [0466] Mortality data: descriptive statistics and a non-parametric Kruskal Wallis test were applied for group comparison.

[0467] A significance level p<0.05 was used for all the variables evaluated in this trial. SPSS 20.0 (SPSS Inc.), StatCalc (EpiInfo 6) and Microsoft Excel 2000 (Microsoft Corp.) were used for data analysis.

[0468] In view of the results on viremic animals (FIG. 12), mean faecal shedding of the virus (FIG. 13), percentage of animals excreting the virus by faecal and salivary routes, and the presence of virus in tonsil swabs (FIG. 14) obtained from the groups vaccinated with pVAC 5.2 or with VP-046 BIS after a homologous infection, it can be concluded that the pVAC 5.2 vaccine according to the present invention shows an analogous efficacy as VP-046 BIS vaccine. The favourable results of the vaccinated groups were significantly different from the control. The number of permanently infected animals having virus in tonsil swabs was reduced by both vaccines in the same extend. The pVAC 5.2 vaccine has shown a good seroconversion at the date of challenge and onwards, which confirms a persistent immune response and its suitability as immunoprotective agent.

Example 6: Heterologous Efficacy Assessment of Infectious Clone pVAC 5.2 in Piglets

[0469] In this example of efficacy trial, the PRRSV-infection consequences were compared between a vaccinated group with a vaccine prepared from clone pVAC 5.2 and a non-vaccinated group after a heterologous challenge. In the trial it was included also a positive control (vaccinated with VP-046 BIS strain, Laboratorios Hipra, S.A., Amer, Girona, Spain) that was also challenged.

[0470] The clone pVAC 5.2 was transfected and amplified, as disclosed in Example 4, to achieve the desired volume and titer (10.sup.3.88 CCID.sub.50/mL). Virus was suspended in MEM G supplemented with 10% FBS. It was administered a dose of 1 mL/animal, i.e. 10.sup.3.88 CCID.sub.50/animal.

[0471] Freeze dried vials of VP-046 BIS strain with a titer of 10.sup.59 CCID.sub.50/mL were used. They were reconstituted with PBS to achieve 10.sup.3.88 CCID.sub.50/animal.

[0472] The animals were porcine males and females of 5 weeks of age at the vaccination day, free of PRRSV and antibody free against PRRSV. They were randomly distributed into 3 groups of 12 piglets each one. One group was vaccinated with the vaccine prepared from clone pVAC 5.2 by the intramuscular route using 10.sup.3.88 CCID.sub.50/animal. Another group was vaccinated with the same virus titer but with VP-046 BIS vaccine. The last group was vaccinated with sterile PBS and was maintained in the same housing conditions (as a challenge control).

[0473] In the study the following designations were used: [0474] Group A=group vaccinated with pVAC 5.2, [0475] Group B=group vaccinated with VP-046 BIS, and [0476] Group C=Control group, non-vaccinated

[0477] The efficacy against PRRSV was confirmed by means of a challenge with a heterologous virulent strain of PRRSV 35 days after the vaccination. The challenge was performed by intranasal route, which is one of the virus' natural infection routes. The challenge strain showed a virus titer of 10.sup.4.99 CCID.sub.50/mL. At the end of the experimental infection the titre of the inocula was confirmed.

[0478] After the challenge, the incidence and duration of viremia and the virus excretion in saliva and faeces (RT-qPCR) was followed up to support the efficacy claims of both clone pVAC 5.2 and VP-046 BIS vaccine. The clinical signs of all the piglets (including general and respiratory signs, mortality and temperature increases) and the average daily weight gain were also monitored. The observation period of all animals was prolonged up to 42 days after challenge. Lung and tonsil swabs presence of the PRRS virus in piglets was also determined after euthanasia (RT-qPCR). In addition, each piglet was observed to detect any local or systemic clinical sign after vaccination.

[0479] Finally, serology (PRRSV antibody level; total IgG by ELISA) of all the animals was performed after vaccination (in order to assess the correct immunization) and after challenge (antibody kinetics description).

[0480] This study was blind, thus the person who vaccinated the animals was not the same that the one who performed the rest of the samplings and observations.

[0481] The variables evaluated in this study and the statistical tests applied are listed below: [0482] Viremia and serological profiles: descriptive statistics and a non-parametric Kruskal Wallis test or ANOVA test were applied for group comparison on viremia. Results were plotted in graphics including the serological profiles of the mean titres for PRRSV antibodies from all groups. [0483] Body weight of piglet: tabulation of body weights, descriptive statistics, and ANOVA test for comparisons between groups was done. [0484] Rectal temperature data: taking into account that temperature is normal distributed, body temperature was evaluated using descriptive statistics, an ANOVA model analysis of variance was used to analyse the body temperature evolution over time, taking in account treatment. [0485] Clinical signs and lesions: relevant clinical signs for vaccinated and control groups were compared. Clinical observations are discrete variables and they were analysed using a non-parametric Kruskal Wallis test of association between treatment and clinical signs. [0486] Mortality data: descriptive statistics and a non-parametric Kruskal Wallis test were applied for group comparison.

[0487] A significance level p<0.05 was used for all the variables evaluated in this trial. SPSS 20.0 (SPSS Inc.), StatCalc (EpiInfo 6) and Microsoft Excel 2000 (Microsoft Corp.) were used for data analysis.

6.1.Serological Profiles

[0488] In FIG. 15 it is observed an increase in the antibody level for vaccinated animals either with the vaccine prepared from clone pVAC 5.2 or VP-046 BIS vaccine, in comparison to the Control group. It is also observed that after challenge with a virulent strain of PRRS, antibody level of the Control group increase up to similar levels shown in the vaccinated animals at day 69 of the study.

6.2.Viremia

[0489] Sera at day 0 and after challenge up to day 69 of the study were analysed by RT-qPCR in order to detect and quantify PRRSV.

[0490] In FIG. 16 are represented the mean titers (CCID.sub.50/mL) viremia after challenge for each group. Significant differences in viremia were observed between the groups of vaccinated animals and the Control group at days 38, 41, 44, and 48. It was observed also a reduction of two orders of magnitude in viremia for the group of pVAC 5.2 in comparison to the Control group.

[0491] In FIG. 17 are represented the percentages of viremic animals after challenge for each group. Significant differences these percentages were observed between the groups of vaccinated animals and the Control group at days 38, 41, 44, and 48

6.3.Shedding

[0492] Faecal swabs were obtained from vaccinated and non-vaccinated animals after challenge with a heterologous virulent strain of PRRSV. Titers of PRRSV were analysed by RT-qPCR. In FIG. 18 is represented the mean value of PRRSV titer expressed as CCID.sub.50/mL for each group of animals. Differences between vaccinated and non-vaccinated animals were clearly observed at days 41 and 44. At day 48 it was observed a clear reduction in the shedding for the vaccinated groups. Vaccine obtained from pVAC 5.2 and VP-046 BIS vaccine provided good heterologous protection in front of PRRSV infection.

[0493] In FIG. 19 is represented the percentage of positive animals with faecal shedding for each group. It was observed a clear reduction in the percentage of positive shedding animals for the vaccinated groups. At day 44 these differences were significant. These positive shedding animals are responsible for the spreading of the infection in the farms. It can be observed that the control of viremia influences positively the reduction in the shedding.

6.4.Lung and Tonsil Swabs

[0494] At day 70, it was observed significant differences in the titre of the virus in lung tissue and the percentage of positive lungs to PRRSV between animals of the group A (pVAC 5.2 group) and the Control group. Also, there were differences in the mean virus titre found in tonsil swabs. Control group had significantly more virus than vaccinated animals in group A (pVAC 5.2). In FIG. 20 are represented the mean quantity of PRRS virus expressed in CCID.sub.50/ml for each group present in lung tissues and in tonsil swabs.

[0495] Vaccination with pVAC 5.2 (group A) or VP-046 BIS reduced the presence of virus in lung tissues and in tonsil swabs.

6.5.Clinical Signs

[0496] No significant differences were observed regarding the presence of clinical signs between the different treatment groups.

Example 7: Construction of Infectious Clone pVAC 6.1 (SEQ ID NO:162)

[0497] Consensus sequence of the attenuated PRRSV strain V1042-P62 was determined by sequencing of RT-PCR reaction products by the Sanger method (SEQ ID NO:163), wherein a position is considered polymorphic if more than one peak is observed in the chromatogram. Consensus sequence contains thirty polymorphic positions (1979, 2010, 4979, 5528, 5915, 6490, 6998, 7067, 7447, 7478, 7603, 8032, 8077, 8161, 8213, 8227, 8239, 8242, 8248, 8257, 8342, 8343, 8347, 8353, 8355, 11845, 13097, 13643, 13761, and 15025). Clone pVAC 6.1 contains the most frequent nucleotide sequence variant in genomic regions ranging from positions 1164 to 2113, 6906 to 8402, 11618 to 12274, and 14633 to 15082; one of the nucleotide sequence variants coding for the most frequent protein in positions 4630 to 6543 and 12970 to 13887; and the consensus nucleotide sequence in the rest of positions, except for position 8806 that contains C instead of U.

7.a) Virus

[0498] The starting material was PRRSV strain V1042-P62 (HIPRA SCIENTIFIC, S.L.U., Amer, Girona, Spain) (Accession number CNCM 1-5219).

7.b) Isolation of Viral RNA

[0499] PRRSV RNA extractions were carried out using the High Pure Viral RNA kit (Roche) from cell cultures in Clon 8 cell type (Laboratorios Hipra, S.A., Amer, Girona, Spain).

7.c) Reverse Transcription.

[0500] Reverse transcription reactions were performed as in Example 1 c), using the primers shown in Table XV:

TABLE-US-00015 TABLEXV cDNAname Primer Sequence Position.sup.1 F1 PRRSV-455R GCTAGGTTGATTGGGCTAGCTAG 2458-2432 AACC (SEQIDNO:164) F2 PRRSV-439R ACTTCTAGAGTGCCACCTCCGTA 4103-4087 G (SEQIDNO:165) F3 PRRSV-441R ACTTCTAGAGTCTCTTGAACGGA 6810-6790 CACAG (SEQIDNO:166) F4 PRRSV-444R ACTTCTAGATGAGGTCCTCATAC 9233-9212 CACTC (SEQIDNO:167) F5-5 PRRSV-462R CCCGAGTGATGGCTACTAGTGCT 10394-10418 CG (SEQIDNO:168) F5 PRRSV-445R ACTCTAGAGCAGGGCATACATAT 12578-12559 G (SEQIDNO:169) F6 PRRSV-453R ACTTCTAGAGGTTAACCACTCCTC 14590-14565 GTTTAACAG (SEQIDNO:170) F7 PRRSV-274R GGCGATCGGGCGTCTAGGAATTC poly(A)tail TAGA(T)41 (SEQIDNO:171) .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163).
7.d) Amplification of cDNA by PCR

[0501] Primer phosphorylation and PCR reactions were performed as in Example 1 d). Primers used here are shown in Table XVI:

TABLE-US-00016 TABLEXVI cDNAname Primer Sequence Position.sup.1 F1 PRRSV-457F AAATATGATGTGTGGGGTATTCCC 1-25 CCTAC (SEQIDNO:172) PRRSV-455R GCTAGGTTGATTGGGCTAGCTAGA 2458-2432 ACC (SEQIDNO:173) F2 PRRSV-448F AAATTCTAGCTAGCCCAATCAACC 2434-2458 TAGC (SEQIDNO:174) PRRSV-439R ACTTCTAGAGTGCCACCTCCGTAG 4103-4087 (SEQIDNO:175) F3 PRRVS-440F CGTCATTCTTGGTAAGTTACTCGG 3935-3961 TGG (SEQIDNO:176) PRRSV-441R ACTTCTAGAGTCTCTTGAACGGAC 6810-6790 ACAG (SEQIDNO:177) F4 PRRSV-443F TTGACACAGGTGACGTGATTGTCC 6706-6729 (SEQIDNO:178) PRRSV-444R ACTTCTAGATGAGGTCCTCATACC 9233-9212 ACTC (SEQIDNO:179) F5-5 PRRSV-461F CCTCTAGACTTAAGTTCCTCGAGG 8855-8874 AGCA (SEQIDNO:180) PRRSV-462R CCCGAGTGATGGCTACTAGTGCT 10394-10418 CG (SEQIDNO:181) F5 PRRSV-244F TAGCAGCCCTTGCATATCA 9108-9126 (SEQIDNO:182) PRRSV-445R ACTCTAGAGCAGGGCATACATATG 12578-12559 (SEQIDNO:183) F6 PRRSV-452F GCTTCGAATTCCAGCCGTACGCTA 12476-12501 TG (SEQIDNO:184) PRRSV-453R ACTTCTAGAGGTTAACCACTCCTC 14590-14565 GTTTAACAG (SEQIDNO:185) F7 PRRSV-446F GGCAACCTCGTCACCATCAAACAT 14010-14034 G (SEQIDNO:186) PRRSV-34R GGCGATCGGGCGTCTAGGAATTC PRRSV-274R.sup.2 (SEQIDNO:187) .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163). .sup.2Primer PRRSV-34R anneals with primer PRRSV-274R of Table XV.

7.e) Preparation of the Vectors

[0502] Preparation of vectors pUC19-SmaI, pUC19 double digested with SmaI and XbaI, pACYC177-ADAP and pACYC177-ADAP-EcoRV is described in Example 1 e).

7.f) Preparation of the Inserts

[0503] RT-PCR products were purified for blunt end or directional cloning as explained in Example 1 f).

7.g) Production and Amplification of cDNA for the 5 Terminus of Viral Genomic RNA

[0504] The sequence corresponding to the 5 terminus of the viral genomic RNA was determined by 5RACE system as in Example 1 g). Primers used for this experiment are shown in Table XVII:

TABLE-US-00017 TABLEXVII cDNAname Primer Position.sup.1 Sequence5-3 5 RACE RRSV-286R 81-361 TAGGCTTGTAAAACAAGCCAA (SEQIDNO:188) RRSV-288R 55-334 GCAAGGTCAGTTTCCTGAAGCT (SEQIDNO:189) .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163).

7.h) Cloning and Sequencing of the Fragments

[0505] Inserts F2, F3, F4, F5-5 and F5 (Table XVI) were ligated into an SmaI-digested pUC19 plasmid.

[0506] Insert F7 was ligated into an SmaI-XbaI-digested pUC19 vector.

[0507] Inserts F1, F3, F5 and F6 (Table XVI) were ligated into an EcoRV-digested pACYC177-ADAP vector.

[0508] Insert 5 RACE (Table XVII) was ligated in commercial vector pTZ57R/T (Thermo Fisher Scientific).

[0509] Ligations were carried out as in Example 1 h). Ligation products were electroporated into E. coli Top 10 cells (Invitrogene).

[0510] Plasmids carrying cDNAs of genomic regions containing polymorphic positions in the consensus sequence were isolated from 18 to 24 transformant colonies. Plasmids carrying cDNAs of genomic regions not containing polymorphic positions were isolated from 2 to 9 colonies. The number of molecular clones obtained for each genomic region, and the primers used for sequencing are shown in Table XVIII:

TABLE-US-00018 TABLEXVIII Numberof molecular cDNA clones Sequencing Positions name obtained primer Primersequence analyzed.sup.1 5 RACE 9 PRRSV-288R GCAAGGTCAGTTTCCTG 1-289 AAGCT (SEQIDNO:190) F1 24 PRRSV-56R AAGTCGTTGGAGGAAG 26-461 TTGT (SEQIDNO:191) PRRSV-430R ACACTCATCCAGAGACA 1164-2113 CAGAC (SEQIDNO:192) F2 2 M13F GTAAAACGACGGCCAG 2434-4103 T (SEQIDNO:193) M13R CAGGAAACAGCTATGAC (SEQIDNO:194) PRRSV-410 CACTGCGCCACCAGTC GCTTCAG (SEQIDNO:195) F3 24 PRRSV-207R ACCCTRGGYARGAAGC 4630-6543 AGTATGT (SEQIDNO:196) PRRSV-413F AGGAACTCTGTCTCCAC CAAG (SEQIDNO:197) PRRSV-442R CATACGCTGCCTCAATG TACTG (SEQIDNO:198) F4 24 PRRSV-20F RACCACYGARCARGCTT 6906-8402 TAAAC (SEQIDNO:199) PRRSV-19R GGACTTCCARGCCTTYT TCATG (SEQIDNO:200) PRRSV-209R GACGGTGGRTGAGGYC TCATCAA (SEQIDNO:201) F5-5 5 M13F GTAAAACGACGGCCAG 8855-10418 T (SEQIDNO:202) M13R CAGGAAACAGCTATGAC (SEQIDNO:203) F5 18 PRRSV-420R ATGATCCAACGTGGTAT 111618-12274 TATACTGC (SEQIDNO:204) F6 24 PRRSV-1F TAGACGGGGGYAAYTG 12970-13887 GTT (SEQIDNO:205) F7 24 PRRSV-112F TGTTAAACGAGGAGTG 14633-15082 GTTAAC (SEQIDNO:206) .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163).
7.i) Sequence Analysis and Selection of cDNA Clones to be Inserted in the Infectious Clone.

[0511] Sequences obtained from clones of cDNAs in Table XVIII were edited, assembled, translated (if necessary) and aligned using the software Geneious R.9.0.2 (Biomatters Ltd).

[0512] Prior to assembly of the infectious clone, cDNAs of genomic regions not containing polymorphic positions (cDNAs F2 and F5-5) were sequenced as indicated in Table XVIII. Clones containing the consensus sequence (SEQ ID NO:163) were selected for assembly of the infectious clone. Selected clones were named F2-1 and pUC19-F5-5-5.

[0513] For each of the genomic regions F1, F4, F5, and F7 containing polymorphic positions, the most frequent sequence variant was selected. Selected clones were named pUC19-F1-4, pUC19-F4-2A, F5-6B, and F7-1.

[0514] Genomic regions F3 and F6 contained polymorphic positions, but there was not most frequent nucleotide sequence variant amongst the sequenced clones (all clones of F3 region contained a different sequence variants, and F6 clones had three sequence variants at equal frequency). Nucleotide sequences were then translated to proteins according to the standard genetic code, and one clone of each region coding for the most frequent protein variant was selected. To select between clones coding for the same protein sequence, 50%, 75% and 100% nucleotide consensus sequences were calculated for each genomic region. The largest percentage consensus sequence not containing polymorphic sites was selected as reference sequence. For region F3 one of the cDNA clones coding for the most frequent protein sequence corresponded to the reference sequence and was selected. For region F6 the reference sequence corresponded to a variant present al low frequency and was discarded; a clone containing one of the three most frequent sequence variants and the most frequent protein variant was randomly selected. Selected clones were named F3-14B and F6-12-1.

7.j) Preparation of the Cloning and Expression Vector pACYC-ADAP-pCMV

[0515] pACYC-ADAP-pCMV vector was prepared by digestion of clone pVAC 5.0 (Example 1) with SwaI and XbaI.

7.k) Insertion of Hepatitis Delta Virus Ribozyme (HDV-Rz) in 3 End of F7 Region

[0516] Insertion of HDV-Rz in 3 end of viral genome was performed as in Example 1 p) Step 2, using as template the plasmid F7-1 obtained in i). PCR product was digested with HpaI and XbaI and cloned in vector pUC19-SmaI-XbaI e). This clone was named F7-1-Rz.

7.l) Digestion, Ligation, Transformation and Plasmids Purification

[0517] Inserts were prepared by PCR as described in Example 1 j) using as templates the cDNA clones selected in step i) and the primers in Table XIX. Alternatively were prepared by digestion of plasmid DNA with enzymes suitable for V1042-P62 strain (FIG. 21).

[0518] Plasmids used as vectors were prepared as in Example 1 k). Ligation reactions, transformation of Top 10 electro competent cells and plasmid purification were performed as described in Example 1 k).

TABLE-US-00019 TABLEXIX Template cDNA Primer Sequence Position pUC19-F1-4 PRRSV-457F AAATATGATGTGTGGGGTATTC 1-25.sup.1 CCCCTAC (SEQIDNO:207) PRRSV-455R GCTAGGTTGATTGGGCTAGCTA 2458-2432.sup.1 GAACC (SEQIDNO:208) F2-1 PRRSV-438F TTCTAGCTAGCCCAATCAACCTA 2434-2458.sup.1 GC (SEQIDNO:209) PRRSV-439R ACTTCTAGAGTGCCACCTCCGT 4103-4087.sup.1 AG (SEQIDNO:210) F3-14B pACYC-87F CAGTACCGACGGTGATAT 3248-3266.sup.2 (SEQIDNO:211) pACYC-88R CCGTCGTGTAGATAACTACG 544-525.sup.2 (SEQIDNO:212) pUC19-F4-2A PRRSV-443F TTGACACAGGTGACGTGATTGT 6706-6729.sup.1 CC (SEQIDNO:213) PRRSV-444R ACTTCTAGATGAGGTCCTCATAC 9233-9212.sup.1 CACTC (SEQIDNO:214) pUC19-F5-5-5 PRRSV-461F CCTCTAGACTTAAGTTCCTCGA 8855-8874.sup.1 GGAGCA (SEQIDNO:215) PRRSV-462R CCCGAGTGATGGCTACTAGTGC 10394-10418.sup.1 TCG (SEQIDNO:216) F5-6B PRRSV-244F TAGCAGCCCTTGCATATCA 9108-9126.sup.1 (SEQIDNO:217) PRRSV-42F AGACTGCTTTCCAAAACACC 10037-10056.sup.1 (SEQIDNO:218) F6-12-1 PRRSV-452F GCTTCGAATTCCAGCCGTACGC 12476-12501.sup.1 TATG (SEQIDNO:219) PRRSV-453R ACTTCTAGAGGTTAACCACTCCT 14590-14565.sup.1 CGTTTAACAG (SEQIDNO:220) .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163). .sup.2Cloning vector pACY177 (GenBank accession X06402.1).

7.m) Assembling of the Restriction Fragments

[0519] Restriction fragments were assembled in the sense 5 to 3 according to the following scheme, which is summarized in FIG. 21: [0520] Step 1.Correct insert orientation in clone pUC19-F1-4 was verified by colony PCR with primers M13F and PRRSV-56R (Table XVIII). [0521] Step 2.Insert F2-1 obtained in I) was digested with NheI and XbaI, and ligated into vector pUC19-F1-4 digested with the same enzymes. [0522] Step 3.Insert F3-14B obtained in I) was digested with NsiI and XbaI, and ligated in the vector obtained in step 2 digested with the same enzymes. [0523] Step 4.Viral cDNA in the clone obtained in step 3 was amplified by PCR with primers PRRSV-457F and PRRSV-441R (Table XVI), and digested with SwaI and XbaI. This insert was ligated into SwaI and XbaI sites of vector pACYC-ADAP-pCMV, obtained as indicated in j). [0524] Step 5.Correct insert orientation in clone pUC19-F4-2A was verified by colony PCR with primers M13R (Table XVIII) and a suitable PRRSV specific forward primer. This clone was digested with AfiII and XbaI. [0525] Step 6.Correct insert orientation in clone pUC19-F5-5-5 was verified by sequencing with primer M13F (Table XVIII). This plasmid was digested with AfiII and XbaI, and ligated in the vector obtained in step 5. [0526] Step 7.Insert F5-6B obtained in I) was digested with SpeI and XbaI, and ligated in the vector obtained in step 6 digested with the same enzymes. [0527] Step 8.Viral cDNA in clone obtained in step 7 was excised from vector by double digestion with EcoRV and XbaI. This insert was ligated into vector obtained in step 4 digested with the same enzymes. [0528] Step 9.Insert F6-12-1 obtained in I) was digested with XbaI and subcloned in vector pUC19-SmaI-XbaI e). [0529] Step 10.Viral cDNA in clone F7-1-Rz obtained in k) was excised from the vector by double digestion with HpaI and XbaI, and cloned between the HpaI and XbaI sites of the vector obtained in step 9. [0530] Step 11.Viral cDNA in the clone obtained is step 10 was excised from the vector by double digestion with Bs/WI and XbaI and cloned between the Bs/WI and XbaI sites of the vector obtained in step 8. This clone was named CI-1042p62-V1.
7.n) Sequence of the Clone p1042

[0531] To confirm the PRRSV sequence inserted in CI-1042p62-V1, DNA was sequenced using suitable primers to obtain the sequence of the whole genome, the pCMV promoter, the HDV-Rz and the joins with the cloning vector. The sequence of the clone showed three mutations compared with the consensus sequence of V1042-P62: C6633T and T8806C.

[0532] Mutation C6633T was reversed by PCR performed with the overlapping mutagenic primers PRRSV-465F and PRRSV-466R and Phusion high fidelity DNA polymerase (Finnzymes). The product of PCR reaction was used to transform Top 10 cells. Plasmids were isolated and sequenced with a primer suitable to verify the reversion of the mutation. Viral insert was excised by double digestion with SwaI and EcoRV, and subcloned between the SwaI and EcoRV sites of CI-1042p62-V1. The obtained clone was named pVAC 6.1.

TABLE-US-00020 TABLEXX Primer Sequence Position.sup.1 PRRSV-465F CGAGAGTTGGCCTCCCTAGTCCAG 6618 GTTGACAAAATGAAAG (SEQIDNO:221) PRRSV-466R CTTTCATTTTGTCAACCTGGACTAG 6657 GGAGGCCAACTCTCG (SEQIDNO:222) .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163).
7.o) Sequence of the Clone pVAC 6.1

[0533] Clone pVAC 6.1 was sequenced with suitable primers, sequence is provided (SEQ ID NO: 162).

7.p) Alignment of Consensus Sequence of V1042-P62 and Clone pVAC 6.1 is Shown in Table XXI:

TABLE-US-00021 TABLE XXI Consensus nucleotide Nucleotide sequence of (Number of Nucleotide in Position.sup.1 V1042-P62.sup.2 clones) .sup.3 clone pVAC 6.1.sup.4 1979 Y C (20) T (4) C 2010 R G (19) A (5) G 4979 M C (15) A (9) C 5528 Y T (19) C (5) T 5915 Y C (12) T (12) C 6490 R A (18) G (6) A 6998 Y C (14) T (10) C 7067 Y C (15) T (9) T 7447 W T (22) C (2) T 7478 R G (16) A (8) G 7603 K T (17) G (7) T 8032 Y T (14) C (10) T 8077 Y C (14) T (10) C 8161 R A (13) G (11) A 8191 G G (22) A (2) A 8213 R A (13) G (11) A 8227 R A (14) G (10) A 8239 Y C (13) T (11) T 8242 R G (13) A (11) G 8248 Y T (13) C (11) T 8257 Y C (14) T (10) C 8259 A A (22) G (2) G 8342 S C (14) G (10) C 8343 K G (14) T (10) G 8347 Y T (14) C (10) T 8353 R G (14) A (10) G 8355 M C (14) A (10) C 8806 T C 11845 Y C (14) T (4) C 13097 R G (13) A (11) A 13353 A A (19) G (5) G 13643 Y C (13) T (11) T 13761 Y T (16) C (8) T 15025 Y T (13) C (11) T .sup.1The position corresponds to the consensus sequence of the attenuated virus PRRSV V1042-P62 (SEQ ID NO: 163). .sup.2(SEQ ID NO: 163). .sup.3 Section 7.h). .sup.4(SEQ ID NO: 162).

Example 8: Assessment of the Immunization and Safety of V1042-P62 PRRSV Quasispecies Vs Clone pVAC 6.1

[0534] In this example, the immunogenicity and safety characteristics of V1042-P62 PRRS quasispecies and clone pVAC 6.1 were compared. Three groups were used: one group received a vaccine containing clone pVAC 6.1, another group received a vaccine containing V1042-P62 PRRSV quasispecies and the third group was a non-vaccinated group.

[0535] Clone pVAC 6.1 was transfected and amplified as disclosed in Example 4 in order to achieve a desired volume and titter of 10.sup.55 CCID.sub.50/dose. A stock of attenuated V1042-P62 PRRSV strain was also adjusted to the desired titre. Viruses were diluted in PBS in order to uniform all the virus dose/animal among groups. A dose of 2 ml/animal was administered by intramuscular route.

[0536] Piglets between 4-5 weeks of age at the beginning of the study were used. All animals were PRRSV-free and antibody free against PRRSV.

[0537] A total of 55 animals were used in the study. The animals were distributed randomly into three groups. The two vaccinated groups contained 20 piglets. Fifteen piglets were vaccinated and five piglets were cohabitants (non-vaccinated). One group was vaccinated with the clone pVAC 6.1. Other group was vaccinated with attenuated V1042-P612 PRRSV quasispecies. One extra group of 15 animals was included as a non-vaccinated group. This group were used as a control group and received a 2 ml of sterile PBS solution. The control group was maintained in the same housing conditions.

[0538] In the study the following designations were used: [0539] Group A=group vaccinated with the attenuated V1042-P62 PRRSV quasispecies [0540] Group B=group vaccinated with the clone pVAC 6.1 [0541] Group C=control group, non-vaccinated

[0542] The efficacy and safety of the vaccines was assessed by serology and viremia in both, inoculated and cohabitant animals.

[0543] Results

[0544] Seroconversion in Inoculated and Cohabitant Animals.

[0545] Serology of inoculated and cohabitant animals was performed after vaccination in order to assess the correct immunization.

[0546] It was observed that 73% of animals vaccinated in both groups were already seropositive (IRPC>20) at day 28 after vaccination (D28). Animals in groups A and B, demonstrated the same immunization (seroconversion) profile.

[0547] In FIG. 22 mean titers of antibodies against PRRSV (IRPC) for the vaccinated and for the non-vaccinated animals are represented at different days post-vaccination.

[0548] These results demonstrate that the mean of the IRPC in all vaccinated groups was above the cut-off level (>20% IRPC) from D28, which means that the mean IRPC is positive to seroconversion.

[0549] In cohabitant animals, seroconversion was not observed in animals of groups A and B.

[0550] Viremia in Cohabitant Animals

[0551] The PRRSV dissemination was assessed by viremia values in cohabitant animals.

[0552] Sera from day 3 to day 28 of the study were analyzed by RT-qPCR. In FIG. 23 it is represented the percentage of cohabitant animals positive to viremia. When comparing the percentages of animals positive to viremia, it was observed a clear trend of the group B (clone pVAC 6.1) to show a reduction in the number of positive animals during the study in comparison to the other vaccinated group A.

[0553] The lower viremia of pVAC 6.1 group in contrast to V1042-P62 PRRSV quasiespecies represents lower capacity of accumulation in lungs and tonsils, and consequently less capacity of reversion to virulence of the vaccine of the invention.