CELLULOSE SYNTHASE INHIBITORS AND MUTANT PLANTS
20190177743 ยท 2019-06-13
Inventors
Cpc classification
A01N43/90
HUMAN NECESSITIES
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01N43/90
HUMAN NECESSITIES
Abstract
The present invention relates to specific inhibitors of the cellulose synthase subunits 1 and 3 activity in plants, useful as a herbicide. In addition, the invention relates to mutant plants which are tolerant to the identified inhibitors. Specific mutant alleles of CESA1 and CESA3 genes can be used to obtain resistance in a plant when the inhibitors are used as herbicide.
Claims
1. A plant comprising a protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
2. A gene comprising the following elements: a plant expressible promoter, a nucleic acid encoding a protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F, and a 3 end region comprising transcription termination and polyadenylation signals functioning in cells of a plant.
3. A plant comprising the gene of claim 2.
4. A plant transformation marker system, the system comprising: a herbicide with the structure ##STR00005## wherein R1 is a halogen, R2 is H or a halogen and R3 is H or N(CH.sub.3).sub.2; and a gene encoding a protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
5. The plant transformation marker system of claim 4, wherein R1 is Cl, R2 is H, and R3 is H.
6. A method of treating a plant, the method comprising: treating the plant with a compound with the structure ##STR00006## wherein R1 is a halogen, R2 is H or a halogen and R3 is H or N(CH.sub.3).sub.2; and wherein the plant comprises a protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
7. The method according to claim 6, wherein compound is an inhibitor of cellulose synthesis.
8. The method according to claim 6 wherein R1 is Cl, R2 is H and R3 is H.
Description
FIGURES
[0005]
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
DETAILED DESCRIPTION OF THE INVENTION
[0012] As used herein, each of the following terms has the meaning associated with it in this section. The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element. About as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of 20% or 10%, more preferably 5%, even more preferably 1%, and still more preferably 0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. The term abnormal when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the normal (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term comprising is used in the present description and claims, it does not exclude other elements or steps. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments, of the invention described herein are capable of operation in other sequences than described or illustrated herein.
[0013] Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4.sup.th ed., Cold Spring Harbor Press, Plainsview, N.Y. (2012); and Ausubel et al., current Protocols in Molecular Biology (Supplement 100), John Wiley & Sons, New York (2012), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.
[0014] In a first embodiment the invention provides a mutant CESA1 or mutant CESA3 gene wherein said mutation encodes for a mutant CESA1 or CESA3 protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0015] In yet another embodiment the invention provides a mutant CESA1 or mutant CESA3 gene wherein said mutation encodes for a mutant CESA1 or CESA3 protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T and CESA1.sup.V1023T.
[0016] In another embodiment the invention provides a plant having a mutation in the CESA1 or CESA3 gene wherein said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0017] In another embodiment the invention provides a plant having a mutation in the CESA1 or CESA3 gene wherein said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T and CESA1.sup.V1023T.
[0018] In yet another embodiment the plant has a mutation in at least one CESA1 or CESA3 allele said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0019] In yet another embodiment the plant has a mutation in at least one CESA1 or CESA3 allele said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T and CESA1.sup.V1023T.
[0020] In yet another embodiment the plant has a mutation in at least two CESA1 or CESA3 alleles said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0021] In yet another embodiment the plant has a mutation in at least two CESA1 or CESA3 alleles said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T and CESA1.sup.V1023T.
[0022] In yet another embodiment the plant has a mutation in all CESA1 or CESA3 alleles said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0023] In yet another embodiment the plant has a mutation in all CESA1 or CESA3 alleles said mutation encodes for a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T and CESA1.sup.V1023T.
[0024] It is well known in the art to introduce specific mutations in plants. Indeed, significant advances have been made in the last few years towards development of methods and compositions to target and cleave genomic DNA by site specific nucleases (e.g., Zinc Finger Nucleases (ZFNs), Meganucleases, Transcription Activator-Like Effector Nucleases (TALENS) and Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRISPR/Cas) with an engineered crRNA/tracr RNA), to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination of an exogenous donor DNA polynucleotide within a predetermined genomic locus. See, for example, U.S. Patent Publication No. 20030232410; 20050208489; 20050026157; 20050064474; and 20060188987, and WO 2007/014275, the disclosures of which are incorporated by reference in their entireties for all purposes. U.S20080182332 describes the use of non-canonical zinc finger nucleases (ZFNs) for targeted modification of plant genomes and U.S. Patent Publication No. 20090205083 describes ZFN-mediated targeted modification of a plant specific genomic locus. Current methods for targeted insertion of exogenous DNA typically involve co-transformation of plant tissue with a donor DNA polynucleotide containing at least one transgene and a site specific nuclease (e.g. ZFN) which is designed to bind and cleave a specific genomic locus of an actively transcribed coding sequence.
[0025] As used herein the term zinc fingers, defines regions of amino acid sequence within a DNA binding protein binding domain whose structure is stabilized through coordination of a zinc ion.
[0026] A zinc finger DNA binding protein (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be engineered to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for engineering zinc finger proteins are design and selection. A designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496.
[0027] A TALE DNA binding domain or TALE is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence. A single repeat unit (also referred to as a repeat) is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. See, e.g., U.S. Patent Publication No. 20110301073, incorporated by reference herein in its entirety.
[0028] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR Associated) nuclease system. Briefly, a CRISPR DNA binding domain is a short stranded RNA molecule that acting in concert with the CAS enzyme can selectively recognize, bind, and cleave genomic DNA. The CRISPR/Cas system can be engineered to create a double-stranded break (DSB) at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair. See, e.g., Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife 2:e00471, and David Segal, (2013) eLife 2:e00563).
[0029] Zinc finger, CRISPR and TALE binding domains can be engineered to bind to a predetermined nucleotide sequence such as a specific site in the CESA1 or CESA3 gene, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger. Yet another possibility is the use of targeted nucleotide editing of DNA using hybrid vertebrate and bacterial immune systems components. Nuclease-deficient type II CRISPR/Cas9 and the activation-induced cytidine deaminase (AID) ortholog PmCDA1 can be engineered to form a synthetic complex (Target-AID) to perform highly efficient target-specific mutagenesis (see Nishida K. et al (2016) Science). Similarly, TALEs can be engineered to bind to a predetermined nucleotide sequence, for example by engineering of the amino acids involved in DNA binding (the repeat variable di-residue or RVD region). Therefore, engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non-naturally occurring. Non-limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and/or TALE designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496 and U.S. Publication Nos. 20110301073, 20110239315 and 20119145940.
[0030] A selected zinc finger protein, CRISPR or TALE is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,200,759; WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO 01/88197 and WO 02/099084 and U.S. Publication Nos. 20110301073, 20110239315 and 20119145940.
[0031] Additional methods for altering the DNA sequence of specific genes in plants are also known in the art and can be similarly applied to the instant invention. These methods include other forms of mutagenesis, such as ethyl methanesulfonate (EMS)-induced mutagenesis and fast neutron deletion mutagenesis used in a reverse genetics sense (with PCR) to identify plant lines in which the endogenous CESA1 or CESA3 gene has been mutated. For examples of these methods see, Ohshima, et al, (1998) Virology 243:472-481; Okubara, et al, (1994) Genetics 137:867-874 and Quesada, et al, (2000) Genetics 154:421-436, each of which is herein incorporated by reference. In addition, a fast and automatable method for screening for chemically induced mutations, TILLING (Targeting Induced Local Lesions in Genomes), using denaturing HPLC or selective endonuclease digestion of selected PCR products is also applicable to the instant invention. See, McCallum, et al, (2000) Nat. Biotechnol 18:455-457, herein incorporated by reference. In yet another embodiment the invention encompasses still additional methods for mutating one or more CESA1 and/or CESA3 alleles. Examples of other methods for altering or mutating a genomic nucleotide sequence in a plant are known in the art and include, but are not limited to, the use of RNA:DNA vectors, RNA:DNA mutational vectors, RNA:DNA repair vectors, mixed-duplex oligonucleotides, self-complementary RNA:DNA oligonucleotides and recombinogenic oligonucleotide bases. Such vectors and methods of use are known in the art. See, for example, U.S. Pat. Nos. 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972 and 5,871,984, each of which are herein incorporated by reference.
[0032] In yet another embodiment the invention provides a chimeric gene comprising the following elements: [0033] a. a plant expressible promoter, [0034] b. a mutant CESA1 or CESA3 gene encoding a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F, [0035] c. a 3 end region comprising transcription termination and polyadenylation signals functioning in cells of a plant.
[0036] In yet another embodiment the invention provides a chimeric gene comprising the following elements: [0037] a. a plant expressible promoter, [0038] b. a mutant CESA1 or CESA3 gene encoding a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, and CESA1.sup.V1023T, [0039] c. a 3 end region comprising transcription termination and polyadenylation signals functioning in cells of a plant.
[0040] A chimeric gene or chimeric construct is a recombinant nucleic acid sequence in which a promoter or regulatory nucleic acid sequence is operatively linked to, or associated with, a nucleic acid sequence that codes for an mRNA, such that the regulatory nucleic acid sequence is able to regulate transcription or expression of the associated nucleic acid coding sequence. The regulatory nucleic acid sequence of the chimeric gene is not operatively linked to the associated nucleic acid sequence as found in nature.
[0041] In the present invention a plant promoter comprises regulatory elements, which mediate the expression of a coding sequence segment in plant cells. For expression in plants, the nucleic acid molecule must be linked operably to or comprise a suitable promoter which expresses the gene at the right point in time and with the required spatial expression pattern.
[0042] The term operably linked as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
[0043] A constitutive promoter refers to a promoter that is transcriptionally active during most, but not necessarily all, phases of growth and development and under most environmental conditions, in at least one cell, tissue or organ.
[0044] In yet another embodiment the invention provides a plant comprising a chimeric gene comprising the following elements: [0045] a. a plant expressible promoter, [0046] b. a mutant CESA1 or CESA3 gene encoding a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F, [0047] c. a 3 end region comprising transcription termination and polyadenylation signals functioning in cells of a plant.
[0048] In yet another embodiment the invention provides a plant comprising a chimeric gene comprising the following elements: [0049] a. a plant expressible promoter, [0050] b. a mutant CESA1 or CESA3 gene encoding a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T and CESA1.sup.V1023T, [0051] c. a 3 end region comprising transcription termination and polyadenylation signals functioning in cells of a plant.
[0052] The term plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest. The term plant also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the gene/nucleic acid of interest.
[0053] Plants that are particularly useful in the methods of the invention include in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Moms nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., amongst others.
[0054] In yet another embodiment the invention provides a plant transformation marker system, comprising a herbicide with the structure
##STR00001## [0055] wherein R1 is a halogen, R2 is H or a halogen and R3 is H or N(CH.sub.3).sub.2 and a herbicide resistance gene, which encodes a mutant protein of cellulose synthase subunit 1 (CESA1) or cellulose synthase subunit 3 (CESA3) selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0056] In a specific embodiment the invention provides a plant transformation marker system comprising a herbicide with the structure
##STR00002## [0057] wherein R1 is a C1, R2 is H or a halogen and R3 is H and a herbicide resistance gene, which encodes a mutant protein of cellulose synthase subunit 1 (CESA1) or cellulose synthase subunit 3 (CESA3) selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F.
[0058] In yet another embodiment the invention provides the use of a compound with the following structure
##STR00003## [0059] wherein R1 is a halogen, R2 is H or a halogen and R3 is H or N(CH.sub.3).sub.2 as a herbicide.
[0060] In yet another embodiment the invention provides the use of a compound with the following structure
##STR00004##
wherein R1 is a halogen, R2 is H or a halogen and R3 is H or N(CH.sub.3).sub.2 as a herbicide to inhibit cellulose biosynthesis.
[0061] In yet another embodiment the invention provides a method to transform plants, said method comprising (1) using a vector comprising a mutant CESA1 or CESA3 gene encoding a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F, and (2) selecting the transformants using a compound as herbicide according to the invention. Preferably, said compound is incorporated in the medium.
[0062] It is understood that the vector comprising a mutant CESA1 or CESA3 gene can control the expression of the gene under its own CESA1 or CESA3 promoter or alternatively the CESA1 or CESA3 gene can be brought under control of a heterologous promoter.
[0063] In yet another embodiment the invention provides a chimeric gene comprising the following elements: [0064] a. a plant expressible promoter, [0065] b. a mutant CESA1 or CESA3 gene encoding a mutant protein selected from the group consisting of CESA1.sup.V297M, CESA1.sup.S307L, CESA1.sup.L872F, CESA1.sup.S892N, CESA1.sup.G892N, CESA1.sup.K945R, CESA1.sup.P1010L, CESA1.sup.G1013R, CESA1.sup.G1013E, CESA1.sup.A1018V, CESA1.sup.S1018V, CESA1.sup.A1023T, CESA1.sup.L1023T, CESA1.sup.V1023T, CESA3.sup.S983F and CESA3.sup.S1037F, [0066] c. a 3 end region comprising transcription termination and polyadenylation signals functioning in cells of a plant.
[0067] The following examples are intended to promote a further understanding of the present invention. While the present invention is described herein with reference to illustrated embodiments, it should be understood that the invention is not limited hereto. Those having ordinary skill in the art and access to the teachings herein will recognize additional modifications and embodiments within the scope thereof. Therefore, the present invention is limited only by the claims attached herein.
Examples
1. C17 Possesses Growth Inhibitory Activity
[0068] C17 (5-(4-chlorophenyl)-7-(2-methoxyphenyl)-1,5,6,7-tetrahydro-[1,2,4]triazolo[1,5-a] pyrimidine; ChemDiv, Catalogue #: 7693622), a synthetic molecule, was identified from a chemical screen as a ploidy-inducing compound in Arabidopsis protoplasts. To test the effects of C17 on plants, Arabidopsis seeds were plated on half MS medium (Murashige, T. and F. Skoog, 1962) in the presence or absence of 200 nM C17 or its analogues. C17-treated plants displayed severe growth inhibition accompanied by radial swelling of the root tip (
2. Mutations in CESA1 and CESA3 Confer C17 Resistance
[0069] To gain insight into growth inhibitory activity of C17, a forward genetic screen was performed to isolate the mutants showing C17 resistance. 300,000 independent ethylmethanesulphonate (EMS) mutagenized seedlings within the Col-0 background were divided into 20 pools and screened for normal root growth in the presence of 2 M C17. 22 mutants from 12 independent pools were obtained and used to back-cross with WT (Col-0) to define the genetic basis. By analysing the segregation ratio of F2 progenies to C17 sensitivity, 18 mutants were found to exhibited semi-dominant C17 resistance with 1:2:1 ratio (sensitive:intermediate resistant:resistant), whereas 4 mutants (14V, 9R, 9Q and 18A1) exhibited a recessive C17 resistant phenotype with 3:1 ratio (sensitive:resistant), indicating the different mutations were caused by single-gene mutations. Subsequently, all mutants were used to generate mapping populations through crossing with another ecotype (Ler-0). By using 24 general simple sequence length polymorphism (SSLP) markers, these 22 mutants were divided into two groups based on the linkage with SSLP markers, which were designated by corresponding markers, CH4-14494 and CH5-512 respectively. Following fine mapping and genome sequencing approaches to 7L and 2C, a nucleotide mutation at respectively Cellulose Synthase A1 (CESA1) and Cellulose Synthase A3 (CESA3) locus were identified (
3. Cell Wall Composition of C17 Resistant Mutants
[0070] Given that the amino acid changes in CESA1 and CESA3 of the C17-resistant mutants might cause an altered cell wall, all C17-resistant mutants were used for cell wall composition analysis through Fourier Transform InfraRed (FTIR) spectroscopy. No statistical difference was observed compared to that of wild-type plants, illustrating that in the absence of C17, CESA mutants show a normal cell wall.
4. C17 Operates Differently from the Cellulose Inhibitor Isoxaben
[0071] To date, several cellulose synthase inhibitors have been reported. In terms of molecular structure, the C17 compound differs completely from any known cellulose inhibitor. Isoxaben is a typical and potent cellulose synthase inhibitor, for which resistant mutants (ixr1-1, ixr1-2, and ixr2-1) have been described, corresponding to mutant alleles of CESA3 and CESA6. ixr1-1, ixr1-2, and ixr2-1 are still sensitive towards C17 (
5. C17 resistance as a marker for the selection of transformants in Arabidopsis
[0072] To test whether the identified mutant CESA alleles can be used as an innovative selection marker, using C17 as selective agent, Arabidopsis plants were transformed by the floral-dip method using a T-DNA harbouring the cesa3.sup.2c mutant allele (CESA3.sup.S983F) under its own promoter, and a hygromycin selection gene as positive control. To select transgenic plants, seeds resulting from dipped plants were plated on medium supplemented with 2 M C17. Out of a total of 2,000 plants, 5 plants could be identified showing normal root growth (
6. C17-Induced Depletion of Membrane CESAs Results in a Weaker Cell Wall
[0073] We observed that C17 treatment resulted in the depletion of the CESA complex from the plasma membrane of wild-type root cells with a dramatic drop after 10 to 15 min of C17 application. Because the cellulose synthesized by the CESA1/CESA3 complex is a primary cell wall component, it was expected that C17-treated plants would display a weaker cell wall, which can be visualized by the uptake of propidium iodide (PI) following the application of a gentle pressure on the root. Indeed, cell wall weakening was observed in the root elongation zone within 2 h after applying C17, which increased over time and correlated with growth inhibition. No PI-positive cells and growth inhibition were observed in C17-tolerant mutants.
Materials and Methods
1. Analysis of Root Growth and Observation of Root Structure
[0074] For studying the growth inhibitory effects of C17 on plants, wild type and C17 resistant mutants were germinated on half MS medium (Murashige and Skoog, 1962) supplemented with or without indicated levels of C17 or its analogs. Seven-day-old seedlings were photographed. For observation of the root structure, five-day-old Arabidopsis seedlings were transferred to half MS medium containing different dosages of C17. After a three-day treatment, seedlings were photographed and their root tips were stained with propidium iodide (PI), a fluorescent dye that is excluded from the membranes of healthy cells but penetrates the plasma membrane of dead cells. The stained root tips were visualized by confocal laser scanning microscopy (LSM710, ZEISS). The ixr1-1 (collection number CS6201), ixr1-2 (CS6202) and ixr2-1 (CS6203) mutants were acquired from the ABRC. Five-day-old Arabidopsis seedlings were transferred to half MS medium with or without 200 nM C17. After 3 day, the plants were photographed.
2. C17 Resistant Mutants Screening
[0075] To obtain mutants resistant to C17, seeds from an ethylmethanesulphonate (EMS)-treated seed collection with Col background were plated on half MS medium containing 2 M C17. After growing for 7 days under long-day conditions (16 h of light/8 h of darkness) at 22 C., plants with a long root were identified as C17 resistant mutants. Out of a total of 300,000 independent EMS mutagenized seeds (divided over 20 pools) 22 mutants were isolated (from 12 independent pools).
3. Map-Based Cloning
[0076] To define the mutations underlying C17 resistance, all C17 resistant mutants were backcrossed with wild-type (Col-0) plants to obtain F1 progenies. F2 progenies from self-pollinated F1 plants were grown in the presence of 500 nM C17 for 7 days, allowing calculation of the segregation ratio of C17 resistance within the F2 progenies. All mutants were also used to generate mapping populations through crossing with another ecotype (Ler-0). Simple sequence length polymorphism (SSLP) markers (Table 1) were used to map the position of the mutated genes in Arabidopsis genome. Subsequently, the mutant genes were identified through candidate gene sequencing.
4. Proteins Alignment
[0077] Protein amino acid sequences of CESA1 and CESA3 from 7 species, extracted from the GenBank database, were aligned using CLUSTALW. Sequence data can be found under the following accession numbers: CESA1.sub.A.thaliana (NP_194967), CESA1.sub.G.max (XP_003522623), CESA1.sub.F.vesca (XP_004291468), CESA1.sub.V.vinifera (XP_002282575), CESA1.sub.S.lycopersicum (XP_004245031), CESA1.sub.Z.mays (NP_001104954), CESA1.sub.O.sativa (NP_001054788), CESA3.sub.A.thaliana (NP_196136), CESA3.sub.G.max (XP_003540527), CESA3.sub.F.vesca (XP_004306536), CESA3.sub.V.vinifera (XP_002278997), CESA3.sub.S.lycopersicum (XP_004229630), CESA3Z.mays (NP_001105621), and CESA3.sub.O.sativa (NP_001059162).
5. Plant Transformations
[0078] CESA3.sup.2c sequences were amplified from cDNA of CESA3.sup.2c mutant plants by PCR using the following primer pairs (CESA3_ATTB1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAAT-CCGAAGGAGAAACCGCG; CESA3_ATTB2: GGGGACCACTTTGTACAAGAAAGCTGGGTGTCGCTTC-TCAACAGTTGATTCC). The resulting fragments were created with the Pfu DNA polymerase kit (Promega) and were cloned into a pDONR22 I entry vector by BP recombination cloning and subsequently transferred into the modified pGWB2 destination vector in which 35S promoter was replace by CESA3 promoter. Arabidopsis plants (cesa3.sup.je5) were transformed using the floral-dip method as described (Clough and Bent, 1998). T1 seeds were germinated on MS medium supplemented with 2 M C17 or 25 mg/l hygromycin to screen for transformants.
6. Detection of Cell Wall Weakening
[0079] For the detection of cell wall weakening, 3-day-old seedlings grown on half-strength MS medium were transferred to liquid medium without or with 200 nM C17. The root tips were stained with 10 mg mL.sup.1 prodium iodide for three min. The stained root tips were put on the Nunc Lab-Tek Chambered Coverglass (Catalog #155361) without pressure or microscope slide with cover slip that gave a gentle exerting of pressure. By using confocal laser scanning microscopy (LSM710, ZEISS), the brittle cells could be visualized by the uptake of PI.
REFERENCES
[0080] Austin, R. S., Vidaurre, D., Stamatiou, G., Breit, R., Provart, N. J., Bonetta, D., Zhang, J., Fung, P., Gong, Y., Wang, P. W., McCourt, P., and Guttman, D. S. 2011. Next-generation mapping of Arabidopsis genes. Plant J 67, 715-725. [0081] Brabham, C and DeBolt, S. 2013. Chemical genetics to examine cellulose biosynthesis. Frontiers in Plant science 3, article 309. [0082] Clough, S. J. and Bent A. F. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743. [0083] Deprez, T., Vernhettes, S., Fagard, M., Refregier, G., Desnos, T., Aletti, E., Py, S and Hfte, H. 2002. Resistance against herbicide Isoxaben and cellulose deficiency caused by distinct mutations in same cellulose synthase isoform CESA6. Plant Physiol. 128, 482-490. [0084] Endler, A. and Persson, S. 2011. Cellulose synthases and synthesis in Arabidopsis. Mol. Plant 4, 199-211. [0085] Festucci-Buselli, R. A., Otoni, W. C. and Joshi, C. P. 2007. Structure, organization and functions of cellulose synthase complexes in higher plants. Braz. J. Plant. Physiol. 19, 1-13. [0086] Garcia-Angulo, P., Alonso-Simon, A., Encina, A., Alvarez, J. M., and Acebes, J. L. 2012. Cellulose biosynthesis inhibitors: comparative effect on bean cell cultures. Int J Mol Sci 13, 3685-3702. [0087] Harris, D. M., Corbin, K., Wang, T., Gutierrez, R., Bertolo, A. L., Petti, C., Smilgies, D. M., Estevez, J. M., Bonetta, D., Urbanowicz, B. R., Ehrhardt, D. W., Somerville, C. R., Rose, J. K., Hong, M., and Debolt, S. 2012. Cellulose microfibril crystallinity is reduced by mutating C-terminal transmembrane region residues CESA1.sup.A903V and CESA3.sup.T942I of cellulose synthase. Proc Natl Acad Sci USA 109, 4098-4103. [0088] Heim, D. R., Roberts, J. L., Pike, P. D. and Larrinua, I. M. 1989. Mutations of a locus of Arabidopsis thaliana confers resistance to the herbicide isoxaben. Plant Physiol. 90, 146-150 [0089] Kimura, S., Laosinchai, W., Itoh, T., Cui, X., Linder, R. and Brwon, R. M. Jr. 1999. Immunogold labeling of rosette terminal cellulose synthesizing complexes in the vascular plant Vigna angularis. The Plant Cell 11, 2075-2085. [0090] Lei, L., Li, S. and Gu, Y. 2012. Cellulose synthase complexes: composition and regulation. Frontiers in plant science, 3, article 75. [0091] Murashige. T, and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobacco cultures. Physiol. Plant 15, 473-497. [0092] Scheible, W. R., Eshed, R., Richmond, T., Delmer, D. and Somerville, C. 2001. Modifications of cellulose synthase confer resistance to isoxaben and thiazolidinone herbicides in Arabidospsis Ixr1 mutants. Proc. Nat. Acad. Sci. USA 98, 10079-10084.