MODULATION OF TRANSTHYRETIN EXPRESSION
20190169613 ยท 2019-06-06
Assignee
Inventors
- Brett P. Monia (Encinitas, CA)
- Susan M. Freier (San Diego, CA)
- Andrew M. Siwkowski (Carlsbad, CA)
- Shuling Guo (Carlsbad, CA)
Cpc classification
A61P25/18
HUMAN NECESSITIES
A61P7/00
HUMAN NECESSITIES
A61P9/04
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A61K31/712
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61P7/04
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61P15/00
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods, compounds, and compositions for reducing expression of transthyretin mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate transthyretin amyloidosis, or a symptom thereof.
Claims
1-40. (canceled)
41. A compound consisting of a conjugate group and a sodium salt of a single-stranded modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of SEQ ID NO: 80, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5 wing segment consisting of five linked nucleosides; and a 3 wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment, wherein each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine of the modified oligonucleotide is a 5-methylcytosine.
42. A composition comprising the compound of claim 41.
43. A method of treating transthyretin amyloidosis in an individual comprising administering to the individual the compound of claim 41.
44. The method of claim 43, wherein the transthyretin amyloidosis is familial amyloid polyneuropathy (FAP).
45. The method of claim 43, wherein the transthyretin amyloidosis is familial amyloid cardiopathy (FAC).
46. A method of treating transthyretin amyloidosis in an individual comprising administering to the individual the composition of claim 42.
47. The method of claim 46, wherein the transthyretin amyloidosis is familial amyloid polyneuropathy (FAP).
48. The method of claim 46, wherein the transthyretin amyloidosis is familial amyloid cardiopathy (FAC).
Description
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0485] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1
Antisense Inhibition of Human Transthyretin in HepG2 Cells
[0486] Antisense oligonucleotides were designed targeting a transthyretin nucleic acid and were tested for their effects on transthyretin mRNA in vitro. Cultured HepG2 cells at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS1396 (forward sequence CCCTGCTGAGCCCCTACTC, designated herein as SEQ ID NO: 5; reverse sequence TCCCTCATTCCTTGGGATTG, designated herein as SEQ ID NO: 6; probe sequence ATTCCACCACGGCTGTCGTCAX , designated herein as SEQ ID NO: 7). Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells.
[0487] The chimeric antisense oligonucleotides in Tables 1 and 2 were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of ten 2-deoxynucleotides and is flanked on both sides (in the 5 and 3 directions) by wings comprising five nucleotides each. Each nucleotide in the 5 wing segment and each nucleotide in the 3 wing segment has a 2-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P?S) linkages. All cytidine residues throughout each gapmer are 5-methylcytidines. Human Target start site indicates the 5-most nucleotide to which the gapmer is targeted in the human gene sequence. Human Target stop site indicates the 3-most nucleotide to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 1 is targeted to human transthyretin mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_000371.2). Certain gapmers were also designed which targeted intronic sequences or intron-exon junctions of the human transthyretin genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_010966.10 truncated from nucleotides 2009236 to 2017289) and are listed in Table 2.
[0488] The human oligonucleotides of Tables 1 and 2 are also cross-reactive with rhesus monkey gene sequences. Mismatches indicate the number of nucleobases by which the human oligonucleotide is mismatched with a rhesus monkey gene sequence. The greater the complementarity between the human oligonucleotide and the rhesus monkey sequence, the more likely the human oligonucleotide can cross-react with the rhesus monkey sequence. The human oligonucleotides in Table 1 were compared to exons 1-4 extracted from the rhesus monkey genomic sequence GENBANK Accession No. NW_001105671.1, based on similarity to human exons. The human oligonucleotides in Table 2 were compared to the rhesus monkey genomic sequence, designated herein as SEQ ID NO: 4 (GENBANK Accession No. NW_001105671.1 truncated from nucleotides 628000 to 638000). Rhesus monkey Target start site indicates the 5-most nucleotide to which the gapmer is targeted in the rhesus monkey gene sequence. Rhesus monkey Target stop site indicates the 3-most nucleotide to which the gapmer is targeted rhesus monkey gene sequence.
TABLE-US-00001 TABLE1 InhibitionofhumantransthyretinmRNAlevelsbychimeric antisenseoligonucleotideshaving5-10-5MOEwingsand deoxygaptargetedtoSEQIDNO:1andSEQIDNO:4 Rhesus Rhesus Human Human monkey monkey SEQ ISIS Start Stop % start stop Mis- ID NO Site Site Region Sequence inhibition site site matches NO 304267 217 236 coding ACTGGTTTTCC 53 217 236 0 8 CAGAGGCAA 304268 222 241 coding GACTCACTGGT 16 222 241 0 9 TTTCCCAGA 304280 353 372 coding TGAATACCAC 51 353 372 0 10 CTCTGCATGC 304284 425 444 coding CCGTGGTGGA 82 425 444 0 11 ATAGGAGTAG 304285 427 446 coding AGCCGTGGTG 89 427 446 0 12 GAATAGGAGT 304286 431 450 coding CGACAGCCGT 63 431 450 0 13 GGTGGAATAG 304287 438 457 coding TTGGTGACGA 88 438 457 0 14 CAGCCGTGGT 304288 440 459 coding GATTGGTGAC 82 440 459 0 15 GACAGCCGTG 304289 442 461 coding GGGATTGGTG 78 442 461 0 16 ACGACAGCCG 304290 443 462 coding TGGGATTGGT 85 443 462 0 17 GACGACAGCC 304291 449 468 coding- ATTCCTTGGGA 52 449 468 0 18 stop TTGGTGACG codon 304292 450 469 coding- CATTCCTTGGG 34 450 469 0 19 stop ATTGGTGAC codon 304293 451 470 coding- TCATTCCTTGG 29 451 470 0 20 stop GATTGGTGA codon 304294 460 479 coding- AGAAGTCCCT 32 460 479 0 21 stop CATTCCTTGG codon- 3UTR 304296 481 500 3- GTCCTTCAGGT 84 478 497 2 22 UTR CCACTGGAG 304297 489 508 3- CATCCCTCGTC 0 486 505 1 23 UTR CTTCAGGTC 304298 501 520 3- TACATGAAAT 26 498 517 0 24 UTR CCCATCCCTC 304299 507 526 3- CTTGGTTACAT 85 504 523 0 25 UTR GAAATCCCA 304300 513 532 3- AATACTCTTGG 49 510 529 0 26 UTR TTACATGAA 304301 526 545 3UTR TTAGTAAAAA 0 523 542 0 27 TGGAATACTC 304302 532 551 3UTR ACTGCTTTAGT 42 529 548 0 28 AAAAATGGA 304303 539 558 3UTR TGAAAACACT 41 536 555 0 29 GCTTTAGTAA 304304 546 565 3UTR TATGAGGTGA 49 543 562 0 30 AAACACTGCT 304307 564 583 3UTR TGGACTTCTAA 73 561 580 2 31 CATAGCATA 304308 572 591 3UTR TCTCTGCCTGG 55 569 588 1 32 ACTTCTAAC 304309 578 597 3- TTATTGTCTCT 77 575 594 0 33 UTR GCCTGGACT 304311 597 616 3- TGCCTTTCACA 80 594 613 0 34 UTR GGAATGTTT 304312 598 617 3- GTGCCTTTCAC 71 595 614 0 35 UTR AGGAATGTT 420871 36 55 coding CAGAGGAGGA 48 36 55 0 36 GCAGACGATG 420872 120 139 coding TCTAGAACTTT 55 120 139 0 37 GACCATCAG 420873 212 231 coding TTTTCCCAGAG 54 212 231 0 38 GCAAATGGC 420874 226 245 coding TCCAGACTCAC 63 226 245 0 39 TGGTTTTCC 420875 271 290 coding TATCCCTTCTA 40 271 290 0 40 CAAATTCCT 420876 285 304 coding ATTTCCACTTT 42 285 304 0 41 GTATATCCC 420877 293 312 coding TGGTGTCTATT 76 293 312 0 42 TCCACTTTG 420878 303 322 coding CAGTAAGATTT 80 303 322 0 43 GGTGTCTAT 420879 307 326 coding CTTCCAGTAAG 73 307 326 0 44 ATTTGGTGT 420880 347 366 coding CCACCTCTGCA 76 347 366 0 45 TGCTCATGG 420881 355 374 coding TGTGAATACC 58 355 374 0 46 ACCTCTGCAT 420882 357 376 coding GCTGTGAATA 69 357 376 0 47 CCACCTCTGC 420883 362 381 coding CGTTGGCTGTG 64 362 381 0 48 AATACCACC 420884 428 447 coding CAGCCGTGGT 93 428 447 0 49 GGAATAGGAG 420885 430 449 coding GACAGCCGTG 93 430 449 0 50 GTGGAATAGG 420886 432 451 coding ACGACAGCCG 92 432 451 0 51 TGGTGGAATA 420887 433 452 coding GACGACAGCC 93 433 452 0 52 GTGGTGGAAT 420888 434 453 coding TGACGACAGC 95 434 453 0 53 CGTGGTGGAA 420889 435 454 coding GTGACGACAG 93 435 454 0 54 CCGTGGTGGA 420890 436 455 coding GGTGACGACA 97 436 455 0 55 GCCGTGGTGG 420891 437 456 coding TGGTGACGAC 97 437 456 0 56 AGCCGTGGTG 420892 439 458 coding ATTGGTGACG 93 439 458 0 57 ACAGCCGTGG 420893 441 460 coding GGATTGGTGA 96 441 460 0 58 CGACAGCCGT 420894 444 463 coding TTGGGATTGGT 88 444 463 0 59 GACGACAGC 420895 445 464 coding CTTGGGATTGG 95 445 464 0 60 TGACGACAG 420896 446 465 coding CCTTGGGATTG 95 446 465 0 61 GTGACGACA 420897 447 466 coding TCCTTGGGATT 94 447 466 0 62 GGTGACGAC 420898 448 467 coding- TTCCTTGGGAT 86 448 467 0 63 stop TGGTGACGA codon 420899 452 471 coding- CTCATTCCTTG 94 452 471 0 64 stop GGATTGGTG codon- 3UTR 420900 453 472 coding- CCTCATTCCTT 92 453 472 0 65 stop GGGATTGGT codon- 3UTR 420901 454 473 coding- CCCTCATTCCT 93 454 473 0 66 stop TGGGATTGG codon- 3UTR 420902 455 474 coding- TCCCTCATTCC 75 455 474 0 67 stop TTGGGATTG codon- 3UTR 420903 456 475 coding- GTCCCTCATTC 57 456 475 0 68 stop CTTGGGATT codon- 3UTR 420904 457 476 coding- AGTCCCTCATT 62 457 476 0 69 stop CCTTGGGAT codon- 3UTR 420905 458 477 coding- AAGTCCCTCAT 58 458 477 0 70 stop TCCTTGGGA codon- 3UTR 420906 459 478 coding- GAAGTCCCTC 79 459 478 0 71 stop ATTCCTTGGG codon- 3UTR 420907 461 480 coding- GAGAAGTCCC 59 461 480 0 72 stop TCATTCCTTG codon- 3UTR 420908 462 481 coding- GGAGAAGTCC 75 462 481 0 73 stop CTCATTCCTT codon- 3UTR 420909 500 519 3UTR ACATGAAATC 82 497 516 0 74 CCATCCCTCG 420910 502 521 3UTR TTACATGAAAT 74 499 518 0 75 CCCATCCCT 420911 503 522 3UTR GTTACATGAA 81 500 519 0 76 ATCCCATCCC 420912 504 523 3UTR GGTTACATGA 92 501 520 0 77 AATCCCATCC 420913 505 524 3UTR TGGTTACATGA 95 502 521 0 78 AATCCCATC 420914 506 525 3UTR TTGGTTACATG 93 503 522 0 79 AAATCCCAT 420915 508 527 3UTR TCTTGGTTACA 92 505 524 0 80 TGAAATCCC 420916 509 528 3UTR CTCTTGGTTAC 88 506 525 0 81 ATGAAATCC 420917 510 529 3UTR ACTCTTGGTTA 92 507 526 0 82 CATGAAATC 420918 511 530 3UTR TACTCTTGGTT 88 508 527 0 83 ACATGAAAT 420919 512 531 3UTR ATACTCTTGGT 89 509 528 0 84 TACATGAAA 420920 514 533 3UTR GAATACTCTTG 87 511 530 0 85 GTTACATGA 420921 515 534 3UTR GGAATACTCTT 92 512 531 0 86 GGTTACATG 420922 516 535 3UTR TGGAATACTCT 95 513 532 0 87 TGGTTACAT 420923 517 536 3UTR ATGGAATACT 90 514 533 0 88 CTTGGTTACA 420924 518 537 3UTR AATGGAATAC 75 515 534 0 89 TCTTGGTTAC 420925 519 538 3UTR AAATGGAATA 87 516 535 0 90 CTCTTGGTTA 420926 520 539 3UTR AAAATGGAAT 88 517 536 0 91 ACTCTTGGTT 420927 521 540 3UTR AAAAATGGAA 50 518 537 0 92 TACTCTTGGT 420928 522 541 3UTR TAAAAATGGA 26 519 538 0 93 ATACTCTTGG 420929 523 542 3UTR GTAAAAATGG 56 520 539 0 94 AATACTCTTG 420930 524 543 3UTR AGTAAAAATG 18 521 540 0 95 GAATACTCTT 420931 525 544 3UTR TAGTAAAAAT 12 522 541 0 96 GGAATACTCT 420932 527 546 3UTR TTTAGTAAAA 1 524 543 0 97 ATGGAATACT 420933 528 547 3UTR CTTTAGTAAAA 0 525 544 0 98 ATGGAATAC 420934 529 548 3UTR GCTTTAGTAAA 6 526 545 0 99 AATGGAATA 420935 530 549 3UTR TGCTTTAGTAA 0 527 546 0 100 AAATGGAAT 420936 531 550 3UTR CTGCTTTAGTA 40 528 547 0 101 AAAATGGAA 420937 533 552 3UTR CACTGCTTTAG 47 530 549 0 102 TAAAAATGG 420938 534 553 3UTR ACACTGCTTTA 30 531 550 0 103 GTAAAAATG 420939 535 554 3UTR AACACTGCTTT 0 532 551 0 104 AGTAAAAAT 420940 536 555 3UTR AAACACTGCTT 0 533 552 0 105 TAGTAAAAA 420941 537 556 3UTR AAAACACTGC 0 534 553 0 106 TTTAGTAAAA 420942 538 557 3UTR GAAAACACTG 0 535 554 0 107 CTTTAGTAAA 420943 540 559 3UTR GTGAAAACAC 14 537 556 0 108 TGCTTTAGTA 420944 541 560 3UTR GGTGAAAACA 43 538 557 0 109 CTGCTTTAGT 420945 542 561 3UTR AGGTGAAAAC 41 539 558 0 110 ACTGCTTTAG 420946 543 562 3UTR GAGGTGAAAA 20 540 559 0 111 CACTGCTTTA 420947 544 563 3UTR TGAGGTGAAA 69 541 560 0 112 ACACTGCTTT 420948 545 564 3UTR ATGAGGTGAA 63 542 561 0 113 AACACTGCTT 420949 579 598 3UTR TTTATTGTCTC 84 576 595 0 114 TGCCTGGAC 420950 580 599 3UTR TTTTATTGTCT 69 577 596 0 115 CTGCCTGGA 420951 581 600 3UTR GTTTTATTGTC 87 578 597 0 116 TCTGCCTGG 420952 582 601 3UTR TGTTTTATTGT 67 579 598 0 117 CTCTGCCTG 420953 583 602 3UTR ATGTTTTATTG 51 580 599 0 118 TCTCTGCCT 420954 584 603 3UTR AATGTTTTATT 60 581 600 0 119 GTCTCTGCC 420955 585 604 3UTR GAATGTTTTAT 65 582 601 0 120 TGTCTCTGC 420956 586 605 3UTR GGAATGTTTTA 67 583 602 0 121 TTGTCTCTG 420957 587 606 3UTR AGGAATGTTTT 68 584 603 0 122 ATTGTCTCT 420958 588 607 3UTR CAGGAATGTTT 45 585 604 0 123 TATTGTCTC 420959 589 608 3UTR ACAGGAATGT 28 586 605 0 124 TTTATTGTCT
TABLE-US-00002 TABLE2 InhibitionofhumantransthyretinmRNAlevelsbychimericantisense oligonucleotideshaving5-10-5MOEwingsanddeoxygaptargetedto SEQIDNO:2andSEQIDNO:4 Rhesus Rhesus Human Human monkey monkey SEQ ISIS Start Stop % start stop Mis- ID NO Site Site Region Sequence inhibition site site matches NO 420960 606 625 exon1- GATGTCACAG 13 1755 1774 0 125 intron1 AAACACTCAC 420961 665 684 intron GCAAAGCTGG 7 1814 1833 0 126 1 AAGGAGTCAC 420962 748 767 intron GAACTTCATTC 0 1897 1916 0 127 1 TTTTTGAAG 420963 882 901 intron AGCTTCCTTAA 0 2031 2050 0 128 1 TATCATATC 420964 966 985 intron TATAGGGCCA 10 2115 2134 0 129 1 GAATATAATC 420965 1010 1029 intron ACTAAGCCTTT 17 2159 2178 0 130 1 TAAAGATTA 420966 1208 1227 intron TGGAATTACT 35 2356 2375 0 131 1 GAAAAGATGT 420967 1289 1308 intron ACCAGGGATG 43 2437 2456 0 132 1 TGTATAATGA 420968 1364 1383 intron TCCCTACTCAG 0 2512 2531 0 133 1 TATAACACA 420969 1472 1491 intron GATCAGAGTG 0 2620 2639 0 134 1 AAAGGATTTA 420970 1687 1706 intron GGGAAGATAA 46 2826 2845 0 135 2 AACCAAGTCC 420971 1739 1758 intron TAAATTCTTTA 0 2878 2897 0 136 2 GCAGATGAT 420972 1842 1861 intron AATGATGCTC 23 2980 2999 0 137 2 AGGTTCCTGG 420973 2051 2070 intron TTGGTGTTACC 0 3187 3206 0 138 2 CAGGGACAC 420974 2207 2226 intron AAAGTGTTCA 29 3344 3363 0 139 2 TTAGGCAAAA 420975 2655 2674 intron GGCATTTTATA 0 3798 3817 0 140 2 TAAACATAA 420976 2733 2752 intron AAGAACATTG 0 3876 3895 0 141 2 GAATATTTTT 420977 2874 2893 intron GTTGGAAATT 9 4017 4036 0 142 2 GCTTCCCATT 420978 3015 3034 intron AGTGGAAAAC 0 4156 4175 0 143 2 CTAAAGTAGG 420979 3618 3637 intron TTCCCCTCAAC 0 4795 4814 0 144 2 TAAGTCAGA 420980 3735 3754 intron2- CCTATAAGGT 0 4930 4949 0 145 exon3 GTGAAAGTCT 420981 4096 4115 intron TGTAAGTTCA 0 5291 5310 0 146 3 AGTCATGTTA 420982 4306 4325 intron GTGTTGCCAA 0 5502 5521 0 147 3 GAATCACTTG 420983 4404 4423 intron AAAACACTTA 0 5600 5619 0 148 3 TAATTGTGTC 420984 4518 4537 intron CTTTGACAAGT 0 5714 5733 0 149 3 TATTTGACT 420985 4880 4899 intron ATCCATGACT 0 6073 6092 0 150 3 AAGCCAGAGA 420986 5185 5204 intron ATGGTTCCCAT 0 6379 6398 0 151 3 CAGGCTGAG 420987 5542 5561 intron GCATTTATCAG 0 6732 6751 0 152 3 AAGAAGCTG 420988 6030 6049 intron TTGACCTTCAG 0 7226 7245 0 153 3 CCCACTTGA 420989 6133 6152 intron AGGAAGTGAG 0 7641 7660 0 154 3 AATCACCTAA 420990 6320 6339 intron AGAAGACAGT 0 7828 7847 0 155 3 AAAGATGTGT 420991 6457 6476 intron AAATTGTGGA 0 7966 7985 0 156 3 TCAAAATGCT 420992 6736 6755 intron AACCAGACTT 0 8246 8265 0 157 3 GAATTATTGT 420993 6811 6830 intron AGTGGCTGCC 0 8321 8340 0 158 3 AACCACAGAC 420994 7106 7125 intron GGAAGTCCAG 0 8615 8634 0 159 3 TGCCAACTTA 420995 7162 7181 intron ATCCATTTCCA 0 8670 8689 0 160 3 CCAGAGCCC
[0489] Due to the short length of the human transthyretin mRNA, a second primer probe set was designed away from the first primer probe set, RTS1396, to avoid amplicon oligonucleotides. The antisense oligonucleotides were also tested for their effects on transthyretin mRNA in vitro using new human primer probe set RTS3029 (forward sequence CTTGCTGGACTGGTATTTGTGTCT, designated herein as SEQ ID NO: 161, reverse sequence AGAACTTTGACCATCAGAGGACACT, designated herein as SEQ ID NO: 162; probe sequence CCCTACGGGCACCGGTGAATCCX, designated herein as SEQ ID NO: 163). Cultured HepG2 cells at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. The results are presented in Table 3 as percent inhibition of the PBS control cell set.
TABLE-US-00003 TABLE 3 Inhibition of human transthyretin mRNA levels by chimeric antisense oligonucleotides having 5-10-5 MOE wings and deoxy gap with primer probe set RTS3029 ISIS NO Region % inhibition 304267 coding 13 304268 coding 10 304280 coding 23 304284 coding 10 304285 coding 34 304286 coding 0 304287 coding 34 304288 coding 45 304289 coding 3 304290 coding 16 304291 coding-stop codon 4 304292 coding-stop codon 10 304293 coding-stop codon 14 304294 stop codon-3 UTR 30 304296 exon 4 78 304297 exon 4 29 304298 exon 4 19 304299 exon 4 85 304300 exon 4 52 304301 exon 4 15 304302 exon 4 45 304303 exon 4 51 304304 exon 4 62 304307 exon 4 76 304308 exon 4 63 304309 exon 4 75 304311 exon 4 81 304312 exon 4 68 420871 coding 0 420872 coding 5 420873 coding 19 420874 coding 0 420875 coding 6 420876 coding 20 420877 coding 28 420878 coding 37 420879 coding 34 420880 coding 36 420881 coding 10 420882 coding 27 420883 coding 13 420884 coding 28 420885 coding 4 420886 coding 21 420887 coding 39 420888 coding 37 420889 coding 9 420890 coding 27 420891 coding 39 420892 coding 43 420893 coding 39 420894 coding 0 420895 coding 0 420896 coding 24 420897 coding 31 420898 coding- 0 420899 stop codon-3UTR 41 420900 stop codon-3UTR 26 420901 stop codon-3UTR 28 420902 stop codon-3UTR 20 420903 stop codon-3UTR 20 420904 stop codon-3UTR 22 420905 stop codon-3UTR 32 420906 stop codon-3UTR 13 420907 -stop codon-3UTR 0 420908 stop codon-3UTR 45 420909 3UTR 41 420910 3UTR 14 420911 3UTR 45 420912 3UTR 62 420913 3UTR 81 420914 3UTR 68 420915 3UTR 71 420916 3UTR 54 420917 3UTR 50 420918 3UTR 43 420919 3UTR 65 420920 3UTR 61 420921 3UTR 65 420922 3UTR 68 420923 3UTR 62 420924 3UTR 9 420925 3UTR 17 420926 3UTR 47 420927 3UTR 57 420928 3UTR 51 420929 3UTR 46 420930 3UTR 39 420931 3UTR 14 420932 3UTR 6 420933 3UTR 1 420934 3UTR 48 420935 3UTR 13 420936 3UTR 62 420937 3UTR 65 420938 3UTR 48 420939 3UTR 7 420940 3UTR 3 420941 3UTR 31 420942 3UTR 0 420943 3UTR 40 420944 3UTR 78 420945 3UTR 58 420946 3UTR 52 420947 3UTR 71 420948 3UTR 73 420949 3UTR 88 420950 3UTR 82 420951 3UTR 90 420952 3UTR 82 420953 3UTR 71 420954 3UTR 67 420955 3UTR 73 420956 3UTR 65 420957 3UTR 74 420958 3UTR 69 420959 3UTR 63 420960 exon1-intron1 14 420961 intron 1 16 420962 intron 1 0 420963 intron 1 0 420964 intron 1 14 420965 intron 1 23 420966 intron 1 25 420967 intron 1 12 420968 intron 1 0 420969 intron 1 0 420970 intron 2 25 420971 intron 2 0 420972 intron 2 25 420973 intron 2 7 420974 intron 2 28 420975 intron 2 9 420976 intron 2 21 420977 intron 2 14 420978 intron 2 37 420979 intron 2 37 420980 intron2-exon 3 16 420981 intron 3 0 420982 intron 3 28 420983 intron 3 0 420984 intron 3 0 420985 intron 3 0 420986 intron 3 7 420987 intron 3 0 420988 intron 3 0 420989 intron 3 0 420990 intron 3 6 420991 intron 3 15 420992 intron 3 0 420993 intron 3 0 420994 intron 3 0 420995 intron 3 10
[0490] Based on the inhibition results using the new primer probe set RTS3029, antisense oligonucleotides exhibiting 50% or more inhibition of transthyretin mRNA were selected for further studies.
Example 2
Antisense Inhibition of Human Transthyretin in HepG2 Cells by Oligonucleotides Designed by Microwalk
[0491] Additional gapmers were designed based on the gapmers presented in Table 3 that demonstrated an inhibition of at least 50%. These gapmers were designed by creating gapmers shifted slightly upstream and downstream (i.e. microwalk) of the original gapmers from Table 3. Gapmers were also created with various motifs, e.g. 5-10-5 MOE, 3-14-3 MOE, 2-13-5 MOE, and 4-11-5 MOE motifs. These gapmers were tested in vitro. Cultured HepG2 cells at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3029 was used to measure transthyretin mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. The results are presented in Table 4.
[0492] The chimeric antisense oligonucleotides in Table 4 were designed as 5-10-5 MOE, 3-14-3 MOE, 2-13-5 MOE or 4-11-5 MOE gapmers. The gapmers designated with an asterisk (*) in Table 4 are the original gapmers from which gapmers, ISIS 425650-425763, were designed via microwalk. The 5-10-5 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of ten 2-deoxynucleotides and is flanked on both sides (in the 5 and 3 directions) by wings comprising five nucleotides each. The 3-14-3 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of fourteen 2-deoxynucleotides and is flanked on both sides (in the 5 and 3 directions) by wings comprising three nucleotides each. The 2-13-5 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of thirteen 2-deoxynucleotides and is flanked on the 5 and the 3 directions with wings comprising two and five nucleotides respectively. The 4-11-5 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of eleven 2-deoxynucleotides and is flanked on the 5 and the 3 directions with wings comprising four and five nucleotides respectively. For each of the motifs (5-10-5, 3-14-3, 2-113-5, and 4-11-5), each nucleotide in the 5 wing segment and each nucleotide in the 3 wing segment has a 2-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P?S) linkages. All cytidine residues throughout each gapmer are 5-methylcytidines. Target start site indicates the 5-most nucleotide to which the gapmer is targeted. Target stop site indicates the 3-most nucleotide to which the gapmer is targeted. Each gapmer listed in Table 4 is targeted to the target region spanning nucleobases 481-619 of SEQ ID NO: 1 (GENBANK Accession No. NM_000371.2).
[0493] As shown in Table 4, several of the gapmers exhibited at least 50% inhibition, including ISIS numbers: 304296, 425655, 425695, 425735, 425649, 425656, 425696, 425736, 420912, 425657, 425697, 425737, 420913, 425658, 425698, 425738, 420914, 425659, 425699, 425739, 304299, 425660, 425700, 425740, 420915, 420916, 425662, 425702, 420919, 425703, 420920, 425664, 425704, 425742, 420921, 425665, 425705, 425743, 420922, 425666, 425706, 420923, 420937, 420944, 425669, 425709, 425746, 425710, 425711, 425747, 420948, 425712, 425748, 425673, 425713, 425749, 425651, 425675, 425715, 425751, 304309, 425676, 425716, 425752, 420949, 425677, 425717, 425753, 420950, 425678, 425718, 425754, 420951, 425679, 425719, 425755, 420952, 425680, 425720, 425756, 420953, 425681, 425721, 425757, 420954, 425722, 425758, 420955, 425759, 425724, 425760, 425762, 304310, 425729, 425764, 425653, 425690, 425730, 425765, 304311, 425691, 425731, 425766, 304312, 425692, 425732, 425767, 425654, 425693, 425733, 425768, 304313, 425734, and 425769.
[0494] Several of the gapmers exhibited at least 60% inhibition, including ISIS numbers: 304296, 425655, 425695, 425735, 425649, 425656, 425696, 425736, 420912, 425657, 425697, 425737, 420913, 425658, 425698, 425738, 420914, 425659, 425739, 304299, 425740, 420915, 425702, 420919, 420920, 425742, 420921, 425665, 425705, 425706, 420923, 425746, 425711, 425747, 420948, 425712, 425748, 425651, 425715, 425751, 304309, 425716, 425752, 425677, 425717, 425753, 420950, 425718, 425754, 420951, 425679, 425719, 425755, 420952, 425680, 425720, 420953, 425681, 425721, 425757, 420954, 425722, 425758, 420955, 425724, 425760, 425764, 425653, 425690, 425730, 425765, 304311, 425691, 425731, 425766, 304312, 425692, 425732, 425767, 425654, 425693, 425733, 304313, and 425769.
[0495] Several of the gapmers exhibited at least 70% inhibition, including ISIS numbers: 304296, 425655, 425695, 425735, 425649, 425656, 425696, 425736, 420912, 425657, 425737, 420913, 425738, 420914, 425659, 304299, 420915, 420920, 425742, 425712, 425748, 425716, 425754, 420951, 425679, 425719, 425755, 425680, 425721, 425757, 425760, 425653, 425690, 425730, 425765, 304311, 425691, 425731, 425766, 304312, 425767, 425693, and 304313.
[0496] Several of the gapmers exhibited at least 80% inhibition, including ISIS numbers: 304296, 425655, 425695, 425736, 420913, 425659, 304299, 420915, 425716, 425754, 425719, 425757, 425765, and 425767.
[0497] Several of the gapmers exhibited at least 85% inhibition, including ISIS numbers: 420913, 425716, 425754, and 425719.
[0498] One gapmer, ISIS 425719, exhibited 90% inhibition.
TABLE-US-00004 TABLE4 InhibitionofhumantransthyretinmRNAlevelsby chimericantisenseoligonucleotidestargetedto SEQIDNO:1(GENBANKAccessionNo.NM_000371.2) SEQ Start Stop % ID OligoID Site Site Sequence Motif inhibition NO *304296 481 500 GTCCTTCAGGTCCACTGGAG 5-10-5 83 22 425655 481 500 GTCCTTCAGGTCCACTGGAG 3-14-3 80 22 425695 481 500 GTCCTTCAGGTCCACTGGAG 2-13-5 80 22 425735 481 500 GTCCTTCAGGTCCACTGGAG 4-11-5 72 22 425649 482 501 CGTCCTTCAGGTCCACTGGA 5-10-5 75 170 425656 482 501 CGTCCTTCAGGTCCACTGGA 3-14-3 78 170 425696 482 501 CGTCCTTCAGGTCCACTGGA 2-13-5 74 170 425736 482 501 CGTCCTTCAGGTCCACTGGA 4-11-5 83 170 *420912 504 523 GGTTACATGAAATCCCATCC 5-10-5 73 77 425657 504 523 GGTTACATGAAATCCCATCC 3-14-3 76 77 425697 504 523 GGTTACATGAAATCCCATCC 2-13-5 69 77 425737 504 523 GGTTACATGAAATCCCATCC 4-11-5 78 77 *420913 505 524 TGGTTACATGAAATCCCATC 5-10-5 89 78 425658 505 524 TGGTTACATGAAATCCCATC 3-14-3 69 78 425698 505 524 TGGTTACATGAAATCCCATC 2-13-5 61 78 425738 505 524 TGGTTACATGAAATCCCATC 4-11-5 78 78 *420914 506 525 TTGGTTACATGAAATCCCAT 5-10-5 70 79 425659 506 525 TTGGTTACATGAAATCCCAT 3-14-3 83 79 425699 506 525 TTGGTTACATGAAATCCCAT 2-13-5 56 79 425739 506 525 TTGGTTACATGAAATCCCAT 4-11-5 69 79 *304299 507 526 CTTGGTTACATGAAATCCCA 5-10-5 83 25 425660 507 526 CTTGGTTACATGAAATCCCA 3-14-3 59 25 425700 507 526 CTTGGTTACATGAAATCCCA 2-13-5 52 25 425740 507 526 CTTGGTTACATGAAATCCCA 4-11-5 69 25 *420915 508 527 TCTTGGTTACATGAAATCCC 5-10-5 81 80 425661 508 527 TCTTGGTTACATGAAATCCC 3-14-3 48 80 425701 508 527 TCTTGGTTACATGAAATCCC 2-13-5 41 80 425741 508 527 TCTTGGTTACATGAAATCCC 4-11-5 37 80 *420916 509 528 CTCTTGGTTACATGAAATCC 5-10-5 52 81 425662 509 528 CTCTTGGTTACATGAAATCC 3-14-3 57 81 425702 509 528 CTCTTGGTTACATGAAATCC 2-13-5 63 81 *420919 512 531 ATACTCTTGGTTACATGAAA 5-10-5 69 84 425663 512 531 ATACTCTTGGTTACATGAAA 3-14-3 46 84 425703 512 531 ATACTCTTGGTTACATGAAA 2-13-5 52 84 *420920 514 533 GAATACTCTTGGTTACATGA 5-10-5 71 85 425664 514 533 GAATACTCTTGGTTACATGA 3-14-3 57 85 425704 514 533 GAATACTCTTGGTTACATGA 2-13-5 58 85 425742 514 533 GAATACTCTTGGTTACATGA 4-11-5 71 85 *420921 515 534 GGAATACTCTTGGTTACATG 5-10-5 68 86 425665 515 534 GGAATACTCTTGGTTACATG 3-14-3 65 86 425705 515 534 GGAATACTCTTGGTTACATG 2-13-5 60 86 425743 515 534 GGAATACTCTTGGTTACATG 4-11-5 56 86 *420922 516 535 TGGAATACTCTTGGTTACAT 5-10-5 54 87 425666 516 535 TGGAATACTCTTGGTTACAT 3-14-3 56 87 425706 516 535 TGGAATACTCTTGGTTACAT 2-13-5 64 87 425744 516 535 TGGAATACTCTTGGTTACAT 4-11-5 39 87 *420923 517 536 ATGGAATACTCTTGGTTACA 5-10-5 62 88 425667 517 536 ATGGAATACTCTTGGTTACA 3-14-3 44 88 425707 517 536 ATGGAATACTCTTGGTTACA 2-13-5 30 88 *420937 533 552 CACTGCTTTAGTAAAAATGG 5-10-5 59 102 425668 533 552 CACTGCTTTAGTAAAAATGG 3-14-3 37 102 425708 533 552 CACTGCTTTAGTAAAAATGG 2-13-5 32 102 425745 533 552 CACTGCTTTAGTAAAAATGG 4-11-5 43 102 *420944 541 560 GGTGAAAACACTGCTTTAGT 5-10-5 52 109 425669 541 560 GGTGAAAACACTGCTTTAGT 3-14-3 54 109 425709 541 560 GGTGAAAACACTGCTTTAGT 2-13-5 54 109 425746 541 560 GGTGAAAACACTGCTTTAGT 4-11-5 60 109 *420945 542 561 AGGTGAAAACACTGCTTTAG 5-10-5 38 110 425670 542 561 AGGTGAAAACACTGCTTTAG 3-14-3 38 110 425710 542 561 AGGTGAAAACACTGCTTTAG 2-13-5 52 110 *420947 544 563 TGAGGTGAAAACACTGCTTT 5-10-5 34 112 425671 544 563 TGAGGTGAAAACACTGCTTT 3-14-3 27 112 425711 544 563 TGAGGTGAAAACACTGCTTT 2-13-5 68 112 425747 544 563 TGAGGTGAAAACACTGCTTT 4-11-5 61 112 *420948 545 564 ATGAGGTGAAAACACTGCTT 5-10-5 66 113 425672 545 564 ATGAGGTGAAAACACTGCTT 3-14-3 47 113 425712 545 564 ATGAGGTGAAAACACTGCTT 2-13-5 70 113 425748 545 564 ATGAGGTGAAAACACTGCTT 4-11-5 71 113 *304304 546 565 TATGAGGTGAAAACACTGCT 5-10-5 46 30 425673 546 565 TATGAGGTGAAAACACTGCT 3-14-3 51 30 425713 546 565 TATGAGGTGAAAACACTGCT 2-13-5 50 30 425749 546 565 TATGAGGTGAAAACACTGCT 4-11-5 58 30 425650 547 566 ATATGAGGTGAAAACACTGC 5-10-5 28 171 425674 547 566 ATATGAGGTGAAAACACTGC 3-14-3 40 171 425714 547 566 ATATGAGGTGAAAACACTGC 2-13-5 44 171 425750 547 566 ATATGAGGTGAAAACACTGC 4-11-5 47 171 425651 577 596 TATTGTCTCTGCCTGGACTT 5-10-5 65 172 425675 577 596 TATTGTCTCTGCCTGGACTT 3-14-3 55 172 425715 577 596 TATTGTCTCTGCCTGGACTT 2-13-5 65 172 425751 577 596 TATTGTCTCTGCCTGGACTT 4-11-5 62 172 *304309 578 597 TTATTGTCTCTGCCTGGACT 5-10-5 66 33 425676 578 597 TTATTGTCTCTGCCTGGACT 3-14-3 59 33 425716 578 597 TTATTGTCTCTGCCTGGACT 2-13-5 87 33 425752 578 597 TTATTGTCTCTGCCTGGACT 4-11-5 67 33 *420949 579 598 TTTATTGTCTCTGCCTGGAC 5-10-5 57 114 425677 579 598 TTTATTGTCTCTGCCTGGAC 3-14-3 67 114 425717 579 598 TTTATTGTCTCTGCCTGGAC 2-13-5 68 114 425753 579 598 TTTATTGTCTCTGCCTGGAC 4-11-5 69 114 *420950 580 599 TTTTATTGTCTCTGCCTGGA 5-10-5 61 115 425678 580 599 TTTTATTGTCTCTGCCTGGA 3-14-3 59 115 425718 580 599 TTTTATTGTCTCTGCCTGGA 2-13-5 69 115 425754 580 599 TTTTATTGTCTCTGCCTGGA 4-11-5 86 115 *420951 581 600 GTTTTATTGTCTCTGCCTGG 5-10-5 78 116 425679 581 600 GTTTTATTGTCTCTGCCTGG 3-14-3 73 116 425719 581 600 GTTTTATTGTCTCTGCCTGG 2-13-5 90 116 425755 581 600 GTTTTATTGTCTCTGCCTGG 4-11-5 73 116 *420952 582 601 TGTTTTATTGTCTCTGCCTG 5-10-5 61 117 425680 582 601 TGTTTTATTGTCTCTGCCTG 3-14-3 77 117 425720 582 601 TGTTTTATTGTCTCTGCCTG 2-13-5 67 117 425756 582 601 TGTTTTATTGTCTCTGCCTG 4-11-5 57 117 *420953 583 602 ATGTTTTATTGTCTCTGCCT 5-10-5 65 118 425681 583 602 ATGTTTTATTGTCTCTGCCT 3-14-3 61 118 425721 583 602 ATGTTTTATTGTCTCTGCCT 2-13-5 77 118 425757 583 602 ATGTTTTATTGTCTCTGCCT 4-11-5 83 118 *420954 584 603 AATGTTTTATTGTCTCTGCC 5-10-5 63 119 425682 584 603 AATGTTTTATTGTCTCTGCC 3-14-3 42 119 425722 584 603 AATGTTTTATTGTCTCTGCC 2-13-5 69 119 425758 584 603 AATGTTTTATTGTCTCTGCC 4-11-5 61 119 *420955 585 604 GAATGTTTTATTGTCTCTGC 5-10-5 65 120 425683 585 604 GAATGTTTTATTGTCTCTGC 3-14-3 30 120 425723 585 604 GAATGTTTTATTGTCTCTGC 2-13-5 44 120 425759 585 604 GAATGTTTTATTGTCTCTGC 4-11-5 50 120 *420956 586 605 GGAATGTTTTATTGTCTCTG 5-10-5 47 121 425684 586 605 GGAATGTTTTATTGTCTCTG 3-14-3 44 121 425724 586 605 GGAATGTTTTATTGTCTCTG 2-13-5 65 121 *420957 587 606 AGGAATGTTTTATTGTCTCT 5-10-5 37 122 425685 587 606 AGGAATGTTTTATTGTCTCT 3-14-3 46 122 425725 587 606 AGGAATGTTTTATTGTCTCT 2-13-5 43 122 425760 587 606 AGGAATGTTTTATTGTCTCT 4-11-5 78 122 *420958 588 607 CAGGAATGTTTTATTGTCTC 5-10-5 41 123 425686 588 607 CAGGAATGTTTTATTGTCTC 3-14-3 6 123 425726 588 607 CAGGAATGTTTTATTGTCTC 2-13-5 41 123 425761 588 607 CAGGAATGTTTTATTGTCTC 4-11-5 39 123 *420959 589 608 ACAGGAATGTTTTATTGTCT 5-10-5 43 124 425687 589 608 ACAGGAATGTTTTATTGTCT 3-14-3 22 124 425727 589 608 ACAGGAATGTTTTATTGTCT 2-13-5 25 124 425762 589 608 ACAGGAATGTTTTATTGTCT 4-11-5 57 124 425652 590 609 CACAGGAATGTTTTATTGTC 5-10-5 23 173 425688 590 609 CACAGGAATGTTTTATTGTC 3-14-3 11 173 425728 590 609 CACAGGAATGTTTTATTGTC 2-13-5 37 173 425763 590 609 CACAGGAATGTTTTATTGTC 4-11-5 38 173 304310 595 614 CCTTTCACAGGAATGTTTTA 5-10-5 57 174 425689 595 614 CCTTTCACAGGAATGTTTTA 3-14-3 38 174 425729 595 614 CCTTTCACAGGAATGTTTTA 2-13-5 58 174 425764 595 614 CCTTTCACAGGAATGTTTTA 4-11-5 60 174 425653 596 615 GCCTTTCACAGGAATGTTTT 5-10-5 79 175 425690 596 615 GCCTTTCACAGGAATGTTTT 3-14-3 73 175 425730 596 615 GCCTTTCACAGGAATGTTTT 2-13-5 76 175 425765 596 615 GCCTTTCACAGGAATGTTTT 4-11-5 83 175 *304311 597 616 TGCCTTTCACAGGAATGTTT 5-10-5 71 34 425691 597 616 TGCCTTTCACAGGAATGTTT 3-14-3 74 34 425731 597 616 TGCCTTTCACAGGAATGTTT 2-13-5 73 34 425766 597 616 TGCCTTTCACAGGAATGTTT 4-11-5 79 34 *304312 598 617 GTGCCTTTCACAGGAATGTT 5-10-5 71 35 425692 598 617 GTGCCTTTCACAGGAATGTT 3-14-3 69 35 425732 598 617 GTGCCTTTCACAGGAATGTT 2-13-5 67 35 425767 598 617 GTGCCTTTCACAGGAATGTT 4-11-5 83 35 425654 599 618 AGTGCCTTTCACAGGAATGT 5-10-5 64 176 425693 599 618 AGTGCCTTTCACAGGAATGT 3-14-3 79 176 425733 599 618 AGTGCCTTTCACAGGAATGT 2-13-5 68 176 425768 599 618 AGTGCCTTTCACAGGAATGT 4-11-5 50 176 304313 600 619 AAGTGCCTTTCACAGGAATG 5-10-5 73 177 425694 600 619 AAGTGCCTTTCACAGGAATG 3-14-3 45 177 425734 600 619 AAGTGCCTTTCACAGGAATG 2-13-5 55 177 425769 600 619 AAGTGCCTTTCACAGGAATG 4-11-5 62 177
Example 3
Dose-Dependent Antisense Inhibition of Human Transthyretin in HepG2 Cells
[0499] Gapmers from Example 2 exhibiting significant in vitro inhibition of human transthyretin were tested at various doses in HepG2 cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 625 nM, 1250 nM, 2500 nM, 5000 nM and 10000 nM concentrations of antisense oligonucleotide, as specified in Table 5. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS3029 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells.
[0500] The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is also presented in Table 5 and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of transthyretin mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of transthyretin mRNA expression was achieved compared to the control. As illustrated in Table 5, transthyretin mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE-US-00005 TABLE 5 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using electroporation ISIS 625 1250 2500 5000 10000 IC.sub.50 NO nM nM nM nM nM (?M) 304296 57 74 83 91 96 <0.625 304299 43 76 82 95 94 0.627 420913 59 75 90 88 98 <0.625 420915 60 85 91 95 99 <0.625 420951 64 77 90 97 99 <0.625 425653 70 86 86 88 82 <0.625 425655 48 80 85 97 96 <0.625 425656 70 89 92 92 96 <0.625 425659 46 56 68 82 93 0.8 425679 63 77 72 94 97 <0.625 425680 28 79 85 93 98 0.8 425693 2 64 74 76 81 1.7 425695 74 87 91 97 98 <0.625 425716 69 84 95 97 98 <0.625 425719 58 84 92 96 98 <0.625 425721 40 75 89 95 98 0.7 425736 64 71 86 93 93 <0.625 425737 78 93 95 97 98 <0.625 425738 40 77 88 94 95 0.7 425754 56 75 87 96 99 <0.625 425755 58 84 88 94 97 <0.625 425757 62 82 94 97 99 <0.625 425760 58 42 74 85 93 <0.625 425765 81 86 87 83 88 <0.625 425766 83 89 81 75 74 <0.625 425767 56 75 83 81 80 <0.625
[0501] Gapmers from Example 2 were also tested at various doses in HepG2 cells using the transfection reagent, lipofectin. Cells were plated at a density of 10,000 cells per well and transfected using electroporation with 6.25 nM, 12.5 nM, 25 nM, 50 nM and 100 nM concentrations of antisense oligonucleotide, as specified in Table 6. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS3029 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 6, transthyretin mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE-US-00006 TABLE 6 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using lipofectin reagent ISIS 6.25 12.5 25 50 100 IC.sub.50 NO nM nM nM nM nM (nM) 304296 26 41 43 52 65 39 304299 22 70 43 74 83 20 420913 4 60 60 68 82 30 420915 36 31 46 64 67 28 420951 10 37 56 85 84 19 425653 25 38 60 74 77 18 425655 27 15 62 79 81 16 425656 37 62 47 69 82 15 425659 17 35 33 79 73 30 425679 32 6 63 79 77 14 425680 16 48 41 84 84 28 425693 10 19 51 66 61 26 425695 36 23 54 76 84 28 425716 57 52 36 85 81 38 425719 25 39 28 60 76 45 425721 0 22 38 73 75 32 425736 25 60 30 77 80 22 425737 36 52 50 60 76 14 425738 13 15 19 65 70 27 425754 8 18 38 75 71 42 425755 26 46 54 77 86 20 425757 0 37 81 83 71 19 425760 28 46 72 70 80 18 425765 0 52 48 66 69 29 425766 24 19 48 69 71 29 425767 41 49 48 65 75 14
Example 4
Dose-Dependent Antisense Inhibition of Human Transthyretin in HepG2 Cells
[0502] Gapmers selected from Example 3 were tested at various doses in HepG2 cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.0617 ?M, 0.1852 ?M, 0.5556 ?M, 1.6667 ?M and 5 ?M concentrations of antisense oligonucleotide, as specified in Table 7. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS3029 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 7, transthyretin mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE-US-00007 TABLE 7 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using electroporation ISIS 0.0617 0.1852 0.5556 1.6667 5 IC.sub.50 NO ?M ?M ?M ?M ?M (?M) 304296 0 6 44 58 83 1.2 304299 38 10 57 83 92 0.6 420913 51 51 54 73 93 0.2 420915 33 35 62 65 93 0.2 420951 40 33 36 82 96 0.4 425653 55 58 74 72 84 <0.06 425655 8 35 54 57 90 0.5 425656 12 43 43 78 94 0.4 425659 14 35 19 46 82 0.6 425679 30 13 23 69 91 0.8 425680 0 35 45 74 84 0.7 425693 0 6 14 32 59 3.4 425695 15 47 61 81 91 0.3 425716 20 17 53 77 91 0.6 425719 0 14 45 78 94 0.8 425721 0 0 22 74 84 0.9 425736 42 43 56 76 91 0.3 425737 21 29 61 81 97 0.3 425738 14 39 57 74 93 0.4 425754 29 34 45 78 94 0.4 425755 8 21 57 78 95 0.5 425757 29 28 62 83 95 0.4 425760 3 6 9 56 77 1.4 425765 24 51 75 77 88 0.3 425766 7 41 59 73 77 0.3 425767 1 18 49 66 79 1.0
Example 5
Dose Response Confirmation of Antisense Oligonucleotides Targeting Human Transthyretin in Hep3B Cells
[0503] Gapmers from Example 4 exhibiting significant in vitro inhibition of human transthyretin were tested at various doses in Hep3B cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.0206 ?M, 0.062 ?M, 0.185 ?M, 0.556 ?M, 1.667 ?M and 5 ?M concentrations of antisense oligonucleotide, as specified in Table 8. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS1396 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 8, transthyretin mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells. The IC.sub.50 of each oligonucleotide is also presented in Table 8.
TABLE-US-00008 TABLE 8 Dose-dependent antisense inhibition of human transthyretin in Hep3B cells using electroporation ISIS 0.0206 0.062 0.185 0.556 1.667 5 IC.sub.50 NO ?M ?M ?M ?M ?M ?M (?M) 304299 27 2 25 52 76 96 0.5 420915 0 12 27 30 69 93 0.8 425653 23 13 55 86 88 91 0.1 425655 3 30 32 62 84 94 0.3 425656 0 0 29 66 82 95 0.5 425679 0 21 36 71 92 97 0.3 425695 37 23 63 79 94 98 0.1 425736 31 43 40 64 82 95 0.1 425737 0 13 62 82 95 98 0.2 425755 17 8 18 69 86 98 0.4 425757 22 47 53 79 96 98 0.2
Example 6
Dose Response Confirmation of Antisense Oligonucleotides Targeting Human Transthyretin in Human Transthyretin-Transgenic Mouse Primary Hepatocytes
[0504] Gapmers from Example 5 were also tested at various doses in primary hepatocytes of human transthyretin-transgenic mice. ISIS 304309, ISIS 304311, ISIS 304312 and ISIS 420951 (see Example 2) were also retested along with these gapmers under the same culture conditions. Cells were plated at a density of 10,000 cells per well and transfected using cytofectin with 18.75 nM, 37.5 nM, 75 nM, 150 nM and 300 nM concentrations of antisense oligonucleotide, as specified in Table 9. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS1396 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 9, transthyretin mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE-US-00009 TABLE 9 Dose-dependent antisense inhibition of human transthyretin in mouse primary hepatocytes using cytofectin ISIS 18.75 37.5 75 150 300 NO nM nM nM nM nM Motif 304299 54 79 97 98 99 5-10-5 304309 48 77 94 99 99 5-10-5 304311 45 79 92 96 98 5-10-5 304312 33 71 89 96 98 5-10-5 420915 40 70 92 98 99 5-10-5 420951 41 86 96 98 99 5-10-5 425653 44 81 93 96 99 5-10-5 425655 61 88 96 99 99 3-14-3 425656 61 84 94 98 99 3-14-3 425679 74 78 97 98 99 3-14-3 425695 66 84 96 98 99 2-13-5 425736 58 84 95 98 99 4-11-5 425737 57 77 95 98 99 4-11-5 425755 61 82 96 99 99 4-11-5 425757 37 77 93 98 98 4-11-5
Example 7
Dose Response Confirmation of Antisense Oligonucleotides Targeting Human Transthyretin in HepG2 Cells
[0505] Gapmers from Example 6 were tested at various doses in HepG2 cells. Cells were plated at a density of 10,000 cells per well and transfected using electroporation with 0.062 ?M, 0.185 ?M, 0.556 ?M, 1.66 ?M and 5000 ?M concentrations of antisense oligonucleotide, as specified in Table 10. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS1396 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 10, transthyretin mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE-US-00010 TABLE 10 Dose-dependent antisense inhibition of human transthyretin in HepG2 cells using electroporation ISIS 0.062 0.185 0.556 1.667 5.000 IC.sub.50 NO ?M ?M ?M ?M ?M (?M) Motif 304299 55 66 72 87 96 0.037 5-10-5 304309 41 65 72 91 96 0.087 5-10-5 304311 57 83 88 89 83 0.001 5-10-5 304312 46 69 74 84 81 0.038 5-10-5 420915 38 62 80 90 98 0.096 5-10-5 420951 45 71 84 93 97 0.049 5-10-5 425653 48 73 87 88 82 0.017 5-10-5 425655 40 57 77 85 95 0.105 3-14-3 425656 28 54 70 94 97 0.177 3-14-3 425679 43 51 81 95 99 0.106 3-14-3 425695 49 67 90 96 99 0.043 2-13-5 425736 32 63 85 95 98 0.108 4-11-5 425737 42 71 90 98 99 0.053 4-11-5 425755 24 63 85 95 99 0.137 4-11-5 425757 21 62 86 96 99 0.148 4-11-5
Example 8
Dose Response Confirmation of Antisense Oligonucleotides Targeting Human Transthyretin in Human Transthyretin-Transgenic Mouse Primary Hepatocytes
[0506] Gapmers from Example 6 were also tested at various doses in primary hepatocytes of human transthyretin-transgenic mice. Cells were plated at a density of 10,000 cells per well and transfected using cytofectin with 5 nM, 10 nM, 20 nM, 40 nM and 80 nM concentrations of antisense oligonucleotide, as specified in Table 11. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS3029 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 11, transthyretin mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE-US-00011 TABLE 11 Dose-dependent antisense inhibition of human transthyretin in mouse primary hepatocytes using cytofectin ISIS 5 10 20 40 80 NO nM nM nM nM nM Motif 304299 0 8 37 69 90 5-10-5 304309 0 9 39 75 93 5-10-5 304311 1 13 43 70 81 5-10-5 304312 0 3 32 64 76 5-10-5 420915 0 0 34 59 87 5-10-5 420951 0 12 57 84 92 5-10-5 425653 0 9 44 72 84 5-10-5 425655 0 19 45 80 91 3-14-3 425656 0 2 33 70 93 3-14-3 425679 0 13 42 72 90 3-14-3 425695 3 12 33 70 90 2-13-5 425736 2 7 37 70 89 4-11-5 425737 0 4 36 65 89 4-11-5 425755 0 25 50 75 94 4-11-5 425757 0 5 43 72 92 4-11-5
[0507] Gapmers were also tested using electroporation as the transfection agent. Cells were plated at a density of 35,000 cells per well and transfected using electroporation with 148.148 nM, 444.444 nM, 1,333.333 nM, 4,000 nM and 12,000 nM concentrations of antisense oligonucleotide, as specified in Table 12. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS3029 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells.
TABLE-US-00012 TABLE 12 Dose-dependent antisense inhibition of human transthyretin in mouse primary hepatocytes using electroporation ISIS 148.148 444.444 1333.333 4000 12000 NO nM nM nM nM nM Motif 304299 75 96 98 98 99 5-10-5 304309 72 96 98 98 98 5-10-5 304311 68 92 93 94 97 5-10-5 304312 50 84 92 93 97 5-10-5 420915 55 89 96 96 97 5-10-5 420951 65 92 95 96 98 5-10-5 425653 68 89 91 93 95 5-10-5 425655 63 94 96 96 96 3-14-3 425656 69 93 98 98 98 3-14-3 425679 63 92 97 98 98 3-14-3 425695 69 92 96 96 95 2-13-5 425736 75 93 96 96 96 4-11-5 425737 71 94 96 96 95 4-11-5 425755 70 93 95 95 95 4-11-5 425757 61 91 95 95 95 4-11-5
Example 9
Dose Response Confirmation of Antisense Oligonucleotides Targeting Human Transthyretin in Cynomolgus Monkey Primary Hepatocytes
[0508] Gapmers from Example 6 were also tested at various doses in primary hepatocytes of cynomolgus monkeys. Cells were plated at a density of 35,000 cells per well and transfected using electroporation with 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM concentrations of antisense oligonucleotide, as specified in Table 13. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS1396 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 13, transthyretin mRNA levels were reduced in a dose-dependent manner in hepatocytes treated with ISIS oligonucleotides.
[0509] In absence of a complete cynomolgus monkey gene sequence in the NCBI database, the oligonucleotides were tested for cross-reactivity against the rhesus monkey gene sequence, since the two species are from the same genus, Macaca. The human oligonucleotides are cross-reactive with rhesus monkey transthyretin gene, designated herein as SEQ ID NO: 4 (exons 1-4 extracted from GENBANK Accession No. NW_001105671.1). Mismatches indicates the number of mismatches between the human oligonucleotide and the rhesus monkey transthyretin gene. n/a indicates that the human oligonucleotide has more than 3 mismatches with the rhesus monkey transthyretin gene and therefore does not cross-react with it.
TABLE-US-00013 TABLE 13 Dose-dependent antisense inhibition of human transthyretin in Rhesus monkey primary hepatocytes using electroporation Rhesus Rhesus monkey monkey ISIS 1,250 2,500 5,000 10,000 2,0000 IC.sub.50 Target start Target stop Mis- NO nM nM nM nM nM (?M) site site matches 304299 21 45 69 80 95 3.1 504 523 0 304309 53 66 79 85 93 <1.25 575 594 0 304311 75 78 82 86 90 <1.25 594 613 0 304312 37 53 65 75 80 2.3 595 614 0 420915 59 54 77 87 94 <1.25 505 524 0 420951 67 77 91 93 96 <1.25 578 597 0 425653 56 72 84 83 85 <1.25 593 612 0 425655 0 7 0 21 45 >20 478 497 2 425656 41 20 38 53 51 8.7 479 498 2 425679 68 74 88 94 98 <1.25 578 597 0 425695 42 29 41 49 65 25.8 478 497 2 425736 36 27 37 49 74 8.2 479 498 2 425737 76 78 89 95 97 <1.25 501 520 0 425755 79 80 92 94 97 <1.25 578 597 0 425757 68 74 88 95 96 <1.25 580 599 0
Example 10
In Vivo Inhibition of Human Transthyretin in Human Transthyretin-Transgenic Mice
[0510] Gapmers from Example 6, demonstrating significant inhibition of transthyretin mRNA, were tested in transgenic mice containing the human transthyretin gene and the efficacy of the gapmers was evaluated.
Treatment
[0511] Fifteen groups of four hTTR transgenic female mice each were administered subcutaneously twice a week for four weeks with 25 mg/kg of ISIS 304299, ISIS 304309, ISIS 304311, ISIS 304312, ISIS 420915, ISIS 420951, ISIS 425653, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, ISIS 425755, or ISIS 425757. Another group of four female hTTR transgenic mice was injected with 25 mg/kg of control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC, designated herein as SEQ ID NO: 165) twice a week for four weeks. Another group of four hTTR transgenic female mice were injected subcutaneously with PBS twice a week for four weeks. The mice injected with PBS served as a control group. Blood samples were collected from all groups on weeks 0, 1, 2, 3, and 4 for plasma transthyretin level analysis. The mice were sacrificed two days after the last dose and livers were harvested for target mRNA analysis.
RNA analysis
[0512] RNA was extracted from liver tissue for real-time PCR analysis of transthyretin using primer probe set RTS3029. Results are presented as percent inhibition of human transthyretin, relative to PBS control. As shown in Table 14, treatment with ISIS antisense oligonucleotides resulted in significant reduction of human transthyretin mRNA in comparison to the PBS control. Treatment with the control oligonucleotide, ISIS 141923 did not result in significant reduction of transthyretin, as expected.
TABLE-US-00014 TABLE 14 Inhibition of human transthyretin mRNA in the hTTR transgenic mice liver relative to the PBS control ISIS % NO inhibition 304299 79 304309 83 304311 63 304312 64 420915 82 420951 92 425653 66 425655 76 425656 76 425679 93 425695 82 425736 63 425737 76 425755 91 425757 91 141923 28
Protein Analysis
[0513] Human transthyretin protein levels were measured in transgenic mice plasma by ELISA using an anti-transthyretin polyclonal antibody (Abcam Ab37774) and a sheep anti-TTR horse radish peroxidase detection antibody (Abcam cat. no. 35217). The color reaction was developed by the ImmunoPure? TMB Substrate Kit and absorbance measured at 450 nm using a microtiter plate spectrophotometer. Plasma samples were taken predose and on days 7, 14 and 28. The results are presented in Table 15 expressed as percentage inhibition compared to the predose levels and demonstrate a time-dependent reduction in protein levels with treatment with ISIS oligonucleotides.
TABLE-US-00015 TABLE 15 Inhibition of human transthyretin protein in the hTTR transgenic mice plasma relative to predose levels ISIS ISIS ISIS ISIS ISIS ISIS ISIS ISIS PBS 304299 304309 420915 420951 425679 425695 425755 141923 Day 7 0 50 63 71 92 99 69 57 3 Day 14 3 76 78 90 98 100 80 72 3 Day 21 20 88 81 95 100 99 88 78 13 Day 28 13 89 83 98 100 100 91 79 8
Body Weight and Organ Weight
[0514] The body weights of the mice were measured predose and at the end of the treatment period. The body weights are presented in Table 16 and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 16 as a percent change over the respective organ weights of the PBS control. As shown in Table 16, there was no significant change in body or organ weights as a result of antisense oligonucleotide treatment.
TABLE-US-00016 TABLE 16 Percent change in body and organ weights of transgenic mice after antisense oligonucleotide treatment Body weight Liver Spleen Kidney PBS 1.1 1.0 1.0 1.0 ISIS 304299 1.1 1.1 1.0 0.8 ISIS 304309 1.1 1.1 1.0 1.0 ISIS 304311 1.1 1.2 1.0 1.2 ISIS 304312 1.1 1.3 1.0 0.8 ISIS 420915 1.1 1.1 1.0 1.1 ISIS 420951 1.1 1.2 1.0 1.5 ISIS 425653 1.1 1.1 0.9 1.0 ISIS 425655 1.1 1.3 1.0 1.2 ISIS 425656 1.2 1.3 1.0 1.3 ISIS 425679 1.2 1.2 1.0 1.6 ISIS 425695 1.1 1.3 1.0 1.0 ISIS 425736 1.2 1.2 1.0 1.0 ISIS 425737 1.1 1.2 1.1 1.2 ISIS 425755 1.2 1.3 1.1 1.3 ISIS 425757 1.1 1.9 1.0 1.5 ISIS 141923 1.1 1.1 1.0 0.8
Liver Function
[0515] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 17, expressed in IU/L. Plasma levels of bilirubin were also measured using the same clinical chemistry analyzer; results are also presented in Table 17 and expressed in mg/dL.
TABLE-US-00017 TABLE 17 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of transgenic mice ALT AST Bilirubin (IU/L) (IU/L) (mg/dL) PBS 31 78 0.23 ISIS 304299 40 121 0.19 ISIS 304309 38 119 0.20 ISIS 304311 34 60 0.16 ISIS 304312 43 67 0.17 ISIS 420915 34 75 0.26 ISIS 420951 75 124 0.17 ISIS 425653 35 78 0.20 ISIS 425655 131 109 0.16 ISIS 425656 68 110 0.19 ISIS 425679 119 180 0.20 ISIS 425695 43 69 0.15 ISIS 425736 23 58 0.16 ISIS 425737 35 64 0.19 ISIS 425755 109 162 0.16 ISIS 425757 1904 937 0.24 ISIS 141923 31 76 0.19
Kidney Function
[0516] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Table 18, expressed in mg/dL. The data indicates that antisense inhibition of transthyretin has no effect on BUN levels in these transgenic mice.
TABLE-US-00018 TABLE 18 Effect of antisense oligonucleotide treatment on BUN (mg/dL) in the kidney of transgenic mice BUN (mg/dL) PBS 26 ISIS 304299 24 ISIS 304309 29 ISIS 304311 28 ISIS 304312 26 ISIS 420915 25 ISIS 420951 25 ISIS 425653 24 ISIS 425655 28 ISIS 425656 25 ISIS 425679 26 ISIS 425695 28 ISIS 425736 25 ISIS 425737 23 ISIS 425755 24 ISIS 425757 25 ISIS 141923 23
Example 11
Tolerability of Antisense Oligonucleotides Targeting Human Transthyretin in CD1 Mice
[0517] CD1? mice (Charles River, Mass.) are a multipurpose model of mice, frequently utilized for safety and efficacy testing. The mice were treated with ISIS antisense oligonucleotides selected from studies described in Example 10 and evaluated for changes in the levels of various metabolic markers.
Treatment
[0518] Groups of eight CD1 mice each were injected subcutaneously twice a week with 50 mg/kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, and ISIS 425755. Four mice from each group were evaluated at week 2 and week 6 of the treatment period. Three days after the last dose at each time point, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.
Body and Organ Weights
[0519] The body weights of the mice were measured pre-dose and at the end of each treatment period (two weeks and six weeks). The body weights are presented in Tables 19 and 20, and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Tables 19 and 20 as a percentage change over the respective organ weights of the PBS control.
TABLE-US-00019 TABLE 19 Change in body and organ weights of CD1 mice after antisense oligonucleotide treatment (%) at week 2 Body weight Liver Spleen Kidney PBS 1.1 1.0 1.0 1.0 ISIS 304299 1.1 1.1 1.1 1.1 ISIS 304309 1.1 1.1 1.1 1.0 ISIS 420915 1.1 1.1 1.1 1.0 ISIS 420951 1.1 1.3 1.7 1.2 ISIS 425655 1.1 1.2 1.2 0.9 ISIS 425656 1.1 1.1 1.1 1.0 ISIS 425679 1.1 1.1 1.4 1.1 ISIS 425695 1.1 1.1 0.9 1.1 ISIS 425736 1.1 1.1 1.0 1.1 ISIS 425737 1.2 1.1 1.1 1.1 ISIS 425755 1.2 1.2 1.3 1.2
TABLE-US-00020 TABLE 20 Change in body and organ weights of CD1 mice after antisense oligonucleotide treatment (%) at week 6 Body weight Liver Spleen Kidney PBS 1.2 1.0 1.0 1.0 ISIS 304299 1.3 1.2 1.4 1.0 ISIS 304309 1.3 1.3 2.0 1.0 ISIS 420915 1.3 1.1 1.5 0.9 ISIS 420951 1.3 1.3 2.0 1.1 ISIS 425655 1.4 1.3 1.7 0.9 ISIS 425656 1.3 1.3 1.1 1.0 ISIS 425679 1.3 1.4 2.3 1.2 ISIS 425695 1.3 1.4 1.5 1.0 ISIS 425736 1.3 1.1 1.2 0.9 ISIS 425737 1.2 1.1 1.3 1.0 ISIS 425755 1.3 1.3 2.1 1.0
Liver Function
[0520] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Tables 21 and 22 expressed in IU/L. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and the results are also presented in Tables 21 and 22.
TABLE-US-00021 TABLE 21 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of CD1 mice at week 2 ALT AST Bilirubin Albumin (IU/L) (IU/L) (mg/dL) (g/dL) PBS 38 66 0.19 5.0 ISIS 304299 42 79 0.33 3.8 ISIS 304309 52 77 0.22 3.2 ISIS 420915 32 61 0.28 3.5 ISIS 420951 1184 804 0.17 3.7 ISIS 425655 60 70 0.20 3.9 ISIS 425656 37 53 0.31 3.5 ISIS 425679 88 147 0.23 3.7 ISIS 425695 25 50 0.23 3.6 ISIS 425736 31 79 0.23 3.2 ISIS 425737 39 43 0.23 3.1 ISIS 425755 104 85 0.29 3.6
TABLE-US-00022 TABLE 22 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of CD1 mice at week 6 ALT AST Bilirubin Albumin (IU/L) (IU/L) (mg/dL) (g/dL) PBS 31 67 0.20 5.6 ISIS 304299 54 71 0.20 5.2 ISIS 304309 1211 504 0.30 5.2 ISIS 420915 89 91 0.17 5.0 ISIS 420951 872 319 0.20 3.6 ISIS 425655 730 247 0.13 4.3 ISIS 425656 502 261 0.17 4.3 ISIS 425679 935 475 0.29 4.5 ISIS 425695 1627 563 0.16 4.0 ISIS 425736 41 47 0.15 4.1 ISIS 425737 32 55 0.16 4.1 ISIS 425755 233 176 0.16 4.3
Kidney Function
[0521] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Tables 23 and 24, expressed in mg/dL.
TABLE-US-00023 TABLE 23 Effect of antisense oligonucleotide treatment on metabolic markers (mg/dL) in the kidney of CD1 mice at week 2 BUN Creatinine PBS 32 0.23 ISIS 304299 26 0.21 ISIS 304309 30 0.19 ISIS 420915 30 0.22 ISIS 420951 24 0.17 ISIS 425655 29 0.22 ISIS 425656 25 0.19 ISIS 425679 28 0.19 ISIS 425695 29 0.19 ISIS 425736 24 0.19 ISIS 425737 24 0.16 ISIS 425755 27 0.17
TABLE-US-00024 TABLE 24 Effect of antisense oligonucleotide treatment on metabolic markers (mg/dL) in the kidney of CD1 mice at week 6 BUN Creatinine PBS 24 0.15 ISIS 304299 19 0.11 ISIS 304309 20 0.14 ISIS 420915 24 0.18 ISIS 420951 19 0.08 ISIS 425655 22 0.11 ISIS 425656 21 0.10 ISIS 425679 20 0.06 ISIS 425695 21 0.08 ISIS 425736 22 0.07 ISIS 425737 18 0.07 ISIS 425755 22 0.09
Hematology Assays
[0522] Blood obtained from all mice groups were sent to Antech Diagnostics for hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) measurements and analyses, as well as measurements of the differential blood cell counts, such as that of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content. The results are presented in Tables 25-28. Percentages given in the tables indicate the percent change in total blood cell count compared to the PBS control. Those antisense oligonucleotides which did not affect a decrease in platelet count less than 70% of the PBS control or an increase in monocyte count more than two-fold were selected for further studies.
TABLE-US-00025 TABLE 25 Effect of antisense oligonucleotide treatment on complete blood cell count (%) compared to the PBS control in CD1 mice at week 2 ISIS NO. WBC RBC Hemoglobin HCT MCV MCH MCHC 304299 ?15 ?3 ?2 0 +3 +1 ?1 304309 ?13 ?4 ?7 ?6 ?2 ?4 ?2 420915 +7 ?7 ?7 ?5 +2 +1 ?2 420951 +79 ?6 ?5 ?5 +1 +1 0 425655 +56 ?3 ?5 ?4 ?1 ?2 ?1 425656 +69 ?5 ?6 ?5 0 ?1 ?2 425679 +30 ?6 ?7 ?7 ?1 ?1 0 425695 +49 ?3 ?4 ?4 0 0 +1 425736 +15 ?6 ?6 ?4 +1 0 ?2 425737 +19 ?5 ?7 ?5 ?1 ?3 ?2 425755 +85 ?3 ?6 ?6 ?4 ?3 0
TABLE-US-00026 TABLE 26 Effect of antisense oligonucleotide treatment on complete blood cell count (%) compared to the PBS control in CD1 mice at week 6 ISIS NO. WBC RBC Hemoglobin HCT MCV MCH MCHC 304299 ?7 ?9 ?10 ?13 ?5 0 +4 304309 +10 ?12 ?11 ?15 ?5 +1 +6 420915 +11 ?7 ?8 ?10 ?4 ?2 +2 420951 +81 ?12 ?20 ?19 ?9 ?9 ?1 425655 +29 ?3 ?11 ?10 ?8 ?9 ?2 425656 +72 ?1 ?5 ?6 ?4 ?5 ?1 425679 +154 ?11 ?20 ?21 ?10 ?9 +2 425695 +118 +3 ?9 ?9 ?2 ?12 +3 425736 +51 +4 ?5 ?7 0 ?10 +1 425737 +30 +8 ?1 ?2 0 ?8 +1 425755 +54 ?1 ?11 ?12 ?8 ?10 0
TABLE-US-00027 TABLE 27 Effect of antisense oligonucleotide treatment on differential blood cell count (%) compared to the PBS control in CD1 mice at week 2 ISIS NO. Neutrophils Monocytes Lymphocytes Platelets 304299 11 ?3 20 17 304309 ?11 5 8 14 420915 1 4 ?24 41 420951 18 ?7 32 ?9 425655 18 ?5 20 18 425656 31 ?7 ?4 24 425679 2 ?1 24 ?19 425695 ?50 15 20 29 425736 8 ?1 0 10 425737 ?29 10 ?8 24 425755 ?13 7 ?4 9
TABLE-US-00028 TABLE 28 Effect of antisense oligonucleotide treatment on differential blood cell count (%) compared to the PBS control in CD1 mice at week 6 ISIS NO. Neutrophils Lymphocytes Monocytes Platelets 304299 ?60 +26 +10 ?16 304309 ?28 +12 +30 +2 420915 ?29 +6 +50 ?30 420951 ?26 +11 0 ?40 425655 ?16 +8 ?10 ?19 425656 ?22 +16 ?50 ?25 425679 ?36 +19 ?20 ?27 425695 ?25 +9 ?15 ?49 425736 ?41 +16 ?5 ?46 425737 ?53 +23 ?20 ?65 425755 ?20 +4 +25 ?41
Example 12
Measurement of Half-Life of Antisense Oligonucleotide in CD1 Mouse Liver
[0523] CD1 mice were treated with ISIS antisense oligonucleotides from studies described in Example 11 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver was evaluated.
Treatment
[0524] Groups of twelve CD1 mice each were injected subcutaneously twice per week for 2 weeks with 50 mg/kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, and ISIS 425755. Four mice from each group were sacrificed 3 days, 28 days and 56 days following the final dose. Livers were harvested for analysis.
Measurement of Oligonucleotide Concentration
[0525] The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 166) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ?g/g. Half-lives were then calculated using WinNonlin software (PHARSIGHT).
[0526] The results are presented in Tables 29 and 30, expressed as ?g/g liver tissue. The half-life of each oligonucleotide is presented in Table 31. Antisense oligonucleotides with half-lives within 11-34 days were chosen for further studies.
TABLE-US-00029 TABLE 29 Full-length oligonucleotide concentration (?g/g) in the liver of CD1 mice ISIS NO. 3 days 28 days 56 days 304299 180 56 8 304309 317 254 106 420915 248 126 34 420951 173 109 49 425655 191 113 33 425656 256 73 29 425679 201 73 27 425695 315 194 65 425736 219 110 47 425737 190 40 9 425755 211 120 47
TABLE-US-00030 TABLE 30 Total oligonucleotide concentration (?g/g) in the liver of CD1 mice ISIS NO. 3 days 28 days 56 days 304299 268 168 38 304309 389 354 152 420915 314 229 83 420951 262 196 131 425655 298 217 87 425656 328 135 85 425679 333 161 103 425695 364 263 143 425736 298 211 140 425737 266 117 31 425755 337 227 140
TABLE-US-00031 TABLE 31 Half-life of oligonucleotide (days) in the liver of CD1 mice ISIS NO. Half-life (days) 304299 12 304309 33 420915 19 420951 29 425655 21 425656 17 425679 18 425695 23 425736 24 425737 12 425755 24
Example 13
Tolerability of Antisense Oligonucleotides Targeting Human Transthyretin in Sprague-Dawley Rats
[0527] Sprague-Dawley rats were treated with ISIS antisense oligonucleotides selected from studies described in Examples 11 and 12 and evaluated for changes in the levels of various metabolic markers.
Treatment
[0528] The body weights, complete blood count and different blood count, as well as the urine protein/creatinine ratio of the rats were evaluated pre-dose. Groups of four Sprague-Dawley rats each were injected subcutaneously twice a week with 50 mg/kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, and ISIS 425755. Three days after the last dose at each time point, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.
Body and Organ Weights
[0529] The body weights of the rats were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 32, and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 32 as a percentage change over the respective organ weights of the PBS control.
TABLE-US-00032 TABLE 32 Change in body and organ weights of Sprague-Dawley rats after antisense oligonucleotide treatment (%) Body weight Liver Spleen Kidney PBS 1.6 1.0 1.0 1.0 ISIS 304299 1.2 1.7 4.9 1.6 ISIS 304309 1.1 1.6 4.3 1.4 ISIS 420915 1.4 1.4 3.3 1.3 ISIS 420951 1.1 1.4 5.0 1.5 ISIS 425655 1.2 1.5 3.4 1.3 ISIS 425656 1.2 1.5 2.9 1.2 ISIS 425679 1.0 1.9 6.4 1.7 ISIS 425695 1.2 1.6 3.3 1.3 ISIS 425736 1.3 1.5 2.9 1.2 ISIS 425737 1.2 1.7 4.0 1.5 ISIS 425755 1.0 1.5 5.4 1.5
[0530] As shown in Tables 32, certain compounds showed a less than a 4 -fold increase in spleen weight.
Liver Function
[0531] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 33 expressed in IU/L. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and the results are also presented in Table 33.
TABLE-US-00033 TABLE 33 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of Sprague-Dawley rats ALT AST Bilirubin Albumin (IU/L) (IU/L) (mg/dL) (g/dL) PBS 55 138 0.15 3.3 ISIS 304299 69 154 0.15 2.7 ISIS 304309 80 138 0.11 2.9 ISIS 420915 43 95 0.11 3.0 ISIS 420951 353 511 0.32 2.6 ISIS 425655 312 497 0.47 2.6 ISIS 425656 277 335 0.20 3.0 ISIS 425679 537 659 0.38 2.7 ISIS 425695 228 445 0.23 2.3 ISIS 425736 362 553 0.32 2.9 ISIS 425737 55 79 0.09 1.9 ISIS 425755 271 303 0.41 2.8
Kidney Function
[0532] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Table 34, expressed in mg/dL. The ratio of total urine protein to creatinine was also evaluated and presented in Table 35.
TABLE-US-00034 TABLE 34 Effect of antisense oligonucleotide treatment on metabolic markers (mg/dL) in the kidney of Sprague-Dawley rats BUN Creatinine PBS 20 0.26 ISIS 304299 30 0.40 ISIS 304309 24 0.33 ISIS 420915 20 0.26 ISIS 420951 37 0.47 ISIS 425655 28 0.40 ISIS 425656 25 0.34 ISIS 425679 46 0.42 ISIS 425695 30 0.37 ISIS 425736 26 0.37 ISIS 425737 30 0.36 ISIS 425755 29 0.36
TABLE-US-00035 TABLE 35 Effect of antisense oligonucleotide treatment on total urine protein/creatinine in the kidney of Sprague-Dawley rats Pre-dose Week 6 PBS 0.82 0.95 ISIS 304299 0.95 7.57 ISIS 304309 1.10 5.20 ISIS 420915 0.91 5.30 ISIS 420951 0.90 5.02 ISIS 425655 0.78 6.03 ISIS 425656 0.86 9.37 ISIS 425679 0.91 7.80 ISIS 425695 0.89 5.71 ISIS 425736 1.00 5.85 ISIS 425737 0.86 43.76 ISIS 425755 0.78 3.70
[0533] As shown in Tables 34 and 35, certain compounds demonstrated a less than 7-fold increase in the total urine protein/creatinine in the kidney of these rats. Furthermore, certain compounds demonstrated a less than 6-fold increase in the total urine protein/creatinine in the kidney of these rats.
Hematology Assays
[0534] Blood obtained from all rat groups were sent to Antech Diagnostics for hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) measurements and analyses, as well as measurements of the differential blood cell counts, such as that of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content. The results are presented in Tables 36 and 37. Percentages given in the tables indicate the percent change in total blood cell count compared to the PBS control.
TABLE-US-00036 TABLE 36 Effect of antisense oligonucleotide treatment on complete blood cell count (%) compared to the PBS control in Sprague-Dawley rats ISIS NO. WBC RBC Hemoglobin HCT MCV MCH MCHC 304299 +4 ?5 ?3 +2 +11 +5 ?5 304309 ?10 ?8 ?11 ?12 ?4 ?3 +1 420915 ?9 ?16 ?20 ?17 +1 ?3 ?3 420951 +5 ?5 ?8 ?5 +1 ?2 ?3 425655 +22 ?17 ?18 ?19 ?2 0 +2 425656 ?1 ?13 ?19 ?16 ?3 ?6 ?2 425679 +49 ?42 ?32 ?28 +26 +19 ?5 425695 ?2 ?25 ?31 ?29 ?4 ?8 ?3 425736 +18 +1 ?3 +2 0 ?4 ?4 425737 ?15 ?20 ?18 ?20 +2 +3 +1 425755 +35 ?31 ?27 ?23 +14 +8 ?4
TABLE-US-00037 TABLE 37 Effect of antisense oligonucleotide treatment on complete blood cell count (%) compared to the PBS control in Sprague-Dawley rats ISIS NO. Neutrophils Lymphocytes Monocytes Platelet 304299 ?61 +15 ?10 ?41 304309 ?35 +8 +10 ?37 420915 ?23 +6 0 ?29 420951 ?62 +15 +10 ?67 425655 +23 ?8 +80 ?13 425656 ?14 0 +70 ?15 425679 ?4 ?1 +60 ?75 425695 +68 ?20 +80 ?5 425736 0 ?2 +70 ?1 425737 ?6 +1 +20 ?21 425755 ?18 +3 +70 ?58
Example 14
Pharmacokinetic Studies of Antisense Oligonucleotide Concentration in Sprague-Dawley Rat Liver and Kidney
[0535] Sprague Dawley rats were treated with ISIS antisense oligonucleotides from studies described in Example 13 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver and kidney was evaluated.
Treatment
[0536] Groups of four Sprague Dawley rats each were injected subcutaneously twice a week for 2 weeks with 20 mg/kg of ISIS 304299, ISIS 304309, ISIS 420915, ISIS 420951, ISIS 425655, ISIS 425656, ISIS 425679, ISIS 425695, ISIS 425736, ISIS 425737, and ISIS 425755. Three days after the last dose, the rats were sacrificed and livers and kidneys were collected for analysis.
Measurement of Oligonucleotide Concentration
[0537] The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 166) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ?g/g. The results are presented in Tables 38 and 39, expressed as ?g/g liver or kidney tissue. The kidney to liver ratio of full length oligonucleotide was also calculated and presented in Table 38.
TABLE-US-00038 TABLE 38 Full-length oligonucleotide concentration (?g/g) and ratio in the liver and kidney of Sprague-Dawley rats Kidney/Liver ISIS NO. Liver Kidney Ratio 304299 165 487 2.9 304309 344 606 1.8 420915 171 680 4.0 420951 214 389 1.8 425655 242 466 1.9 425656 286 595 2.1 425679 290 334 1.2 425695 266 566 2.1 425736 245 571 2.3 425737 167 477 2.9 425755 218 379 1.7
TABLE-US-00039 TABLE 39 Total oligonucleotide concentration (?g/g) in the liver and kidney of Sprague-Dawley rats ISIS NO. Liver Kidney 304299 208 653 304309 409 803 420915 196 844 420951 348 879 425655 340 764 425656 329 703 425679 461 710 425695 369 843 425736 282 738 425737 195 587 425755 351 886
Example 15
In Vivo Dose-Dependent Inhibition of Human Transthyretin in Transgenic Mice
[0538] Transgenic mice containing the human transthyretin gene were dosed in increasing doses of ISIS oligonucleotides selected from studies described in Example 14 to evaluate the effect of dose-dependent inhibition of human transthyretin in these mice.
Treatment
[0539] Groups of four mice, two male and two female, each were injected subcutaneously twice a week for 4 weeks with 4 mg/kg, 10 mg/kg or 25 mg/kg of ISIS 304299, ISIS 420915, ISIS 420951, ISIS 425679, ISIS 425736, ISIS 425737, or ISIS 425755. One group of four mice, two male and two female, was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of the control oligonucleotide, ISIS 141923. One control group of four mice, two male and two female, was injected subcutaneously twice a week for 4 weeks with PBS. Plasma samples were taken from each group at days 0, 7, 14, 21 and 28. Two days after the last dose, the mice were euthanized and organs were harvested for further analysis.
RNA Analysis
[0540] RNA was extracted from liver tissue for real-time PCR analysis of transthyretin using primer probe set RTS3029. Results are presented as percent inhibition of human transthyretin, relative to PBS control. As shown in Table 40, treatment with ISIS antisense oligonucleotides resulted in significant dose-dependent reduction of human transthyretin mRNA in comparison to the PBS control. Treatment with the control oligonucleotide, ISIS 141923 did not result in significant reduction of transthyretin, as expected.
TABLE-US-00040 TABLE 40 Inhibition of human transthyretin mRNA in the hTTR transgenic mice liver relative to the PBS control ISIS NO. Dose (mg/kg) % inhibition 304299 25 73 10 60 4 9 420915 25 78 10 57 4 43 420951 25 91 10 85 4 52 425679 25 94 10 88 4 42 425736 25 49 10 54 4 15 425737 25 82 10 59 4 21 425755 25 91 10 79 4 24 141923 25 0
Protein Analysis
[0541] Human transthyretin protein levels were measured in transgenic mice plasma by ELISA using an anti-transthyretin polyclonal antibody (Abcam Ab37774) and a sheep anti-TTR horse radish peroxidase detection antibody (Abcam cat. no. 35217). The color reaction was developed by the ImmunoPure? TMB Substrate Kit and absorbance measured at 450 nm using a microtiter plate spectrophotometer. Plasma samples were taken predose and on days 7, 14, 21 and 28. The results are presented in Table 41 expressed as percentage inhibition compared to the predose levels and demonstrate a time-dependent and dose-dependent reduction in protein levels on treatment with ISIS oligonucleotides.
TABLE-US-00041 TABLE 41 Inhibition of human transthyretin protein in transgenic mice plasma relative to pre-dose levels ISIS Day Day Day Day Day NO. 0 7 14 21 28 141923 25 0 0 20 77 41 304299 25 0 44 85 100 88 10 0 0 8 93 78 4 0 0 0 57 0 420915 25 0 0 67 86 91 10 0 21 39 70 71 4 0 25 0 0 0 420951 25 0 83 96 100 100 10 0 35 66 91 86 4 0 7 26 0 0 425679 25 0 93 97 96 98 10 0 38 80 96 95 4 0 0 0 0 0 425736 25 0 56 76 82 92 10 0 0 33 37 66 4 0 0 0 0 0 425737 25 0 90 96 99 98 10 0 51 80 88 89 4 0 29 21 37 31 425755 25 0 88 96 98 99 10 0 52 76 90 88 4 0 29 22 36 26
Body Weight and Organ Weight
[0542] The body weights of the mice were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 42 and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 42 as a percentage change over the respective organ weights of the PBS control.
TABLE-US-00042 TABLE 42 Change in body and organ weights of transgenic mice after antisense oligonucleotide treatment (%) Dose (mg/kg) Body weight Liver Spleen Kidney PBS +13 0 0 0 ISIS 25 +17 +16 +3 ?2 304299 10 +14 +10 ?13 ?4 4 +17 +2 +17 ?2 ISIS 25 +18 +12 ?6 ?6 420915 10 +16 +6 ?4 ?5 4 +15 +4 +8 ?2 ISIS 25 +22 +23 +32 ?2 420951 10 +16 +11 +10 ?3 4 +24 +7 +19 +5 ISIS 25 +24 +33 +40 ?1 425679 10 +14 +5 +9 ?2 4 +19 +7 +10 0 ISIS 25 +16 +15 0 ?5 425736 10 +28 +8 ?12 ?6 4 +20 +10 ?9 ?2 ISIS 25 +16 +13 0 ?2 425737 10 +19 +6 +18 ?3 4 +19 +5 +4 +1 ISIS 25 +21 +25 +34 ?5 425755 10 +17 +10 +13 ?4 4 +22 +3 +27 +4 ISIS 25 +20 +8 ?3 ?4 141923
Liver function
[0543] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 43 expressed in IU/L. Plasma levels of bilirubin were also measured using the same clinical chemistry analyzer; results are also presented in Table 43 and expressed in mg/dL.
TABLE-US-00043 TABLE 43 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of transgenic mice Dose ALT AST TBIL (mg/kg) (IU/L) (IU/L) (mg/dL) PBS 48 112 0.20 ISIS 25 42 93 0.14 304299 10 37 56 0.18 4 35 71 0.15 ISIS 25 63 181 0.22 420915 10 46 132 0.22 4 35 114 0.22 ISIS 25 63 85 0.17 420951 10 42 107 0.21 4 31 74 0.19 ISIS 25 156 150 0.13 425679 10 93 148 0.23 4 38 119 0.22 ISIS 25 37 78 0.21 425736 10 33 62 0.20 4 46 228 0.23 ISIS 25 55 121 0.20 425737 10 41 94 0.18 4 32 73 0.14 ISIS 25 74 160 0.17 425755 10 31 80 0.16 4 45 122 0.21 ISIS 25 66 141 0.17 141923
Kidney Function
[0544] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Table 44, expressed in mg/dL.
TABLE-US-00044 TABLE 44 Effect of antisense oligonucleotide treatment on BUN (mg/dL) in the kidney of transgenic mice Dose (mg/kg) BUN PBS 22 ISIS 25 22 304299 10 22 4 22 ISIS 25 24 420915 10 25 4 20 ISIS 25 24 420951 10 25 4 26 ISIS 25 26 425679 10 24 4 22 ISIS 25 20 425736 10 22 4 22 ISIS 25 21 425737 10 19 4 23 ISIS 25 23 425755 10 21 4 20 ISIS 25 21 141923
Example 16
In Vivo Inhibition of Human Transthyretin in Human Transthyretin-Transgenic Mice
[0545] Antisense oligonucleotides with 5-10-5 MOE motifs, ISIS 304313, ISIS 420913, ISIS 420919, ISIS 420921, ISIS 420922, ISIS 420937, ISIS 420944, ISIS 420947, ISIS 420949, ISIS 420950, ISIS 420951, ISIS 420952, ISIS 420953, ISIS 420955, ISIS 420957, and ISIS 420959 from Table 4. These antisense oligonucleotides exhibited 65% inhibition or more of transthyretin mRNA were selected and tested in transgenic mice containing the human transthyretin gene. Additional oligonucleotides with overlapping sequences to ISIS 420951 (GTTTTATTGTCTCTGCCTGG (SEQ ID NO: 116)), and with various motifs were also designed to test in the transgenic mice. These additional oligonucleotides were ISIS 450518 (TTTTATTGTCTCTGCCTG (SEQ ID NO: 5-8-5 MOE (SEQ ID NO: 167)), ISIS 450519 (GTTTTATTGTCTCTGCCTGG, 6-8-6 MOE (SEQ ID NO: 116)), ISIS 450520 (GTTTTATTGTCTCTGCCTGG, 3-10-7 MOE (SEQ ID NO: 116)), ISIS 450521 (GTTTTATTGTCTCTGCCTGG, 7-10-3 MOE (SEQ ID NO: 116)), ISIS 450522 (GTTTTATTGTCTCTGCCTGG, 2-10-8 MOE (SEQ ID NO: 116)), and ISIS 450523 (GTTTTATTGTCTCTGCCTGG, 8-10-2 MOE (SEQ ID NO: 116)).
Treatment
[0546] Groups of four hTTR transgenic mice each, two male and two female, were administered subcutaneously twice per week for four weeks with 25 mg/kg of ISIS 304313, ISIS 420913, ISIS 420919, ISIS 420921, ISIS 420922, ISIS 420937, ISIS 420944, ISIS 420947, ISIS 420949, ISIS 420950, ISIS 420951, ISIS 420952, ISIS 420953, ISIS 420955, ISIS 420957, ISIS 420959, ISIS 425518, ISIS 425519, ISIS 425520, ISIS 425521, ISIS 425522, or ISIS 425523. A control group four hTTR transgenic mice, two male and two female, were injected subcutaneously with PBS twice per week for four weeks. Blood samples were collected from all groups on days 0, 14 and 28 for plasma transthyretin level analysis. The mice were sacrificed two days after the last dose and livers were harvested for target mRNA analysis.
RNA Analysis
[0547] RNA was extracted from liver tissue for real-time PCR analysis of transthyretin using primer probe set RTS3029. Results are presented as percent inhibition of human transthyretin, relative to PBS control. As shown in Table 45, treatment with ISIS antisense oligonucleotides resulted in significant reduction of human transthyretin mRNA in comparison to the PBS control.
TABLE-US-00045 TABLE 45 Inhibition of human transthyretin mRNA in the hTTR transgenic mice liver relative to the PBS control ISIS NO. % inhibition 304313 68 420913 83 420919 64 420921 70 420922 82 420937 46 420944 58 420947 62 420949 87 420950 94 420952 95 420953 93 420955 93 420957 90 420959 73 450518 80 450519 87 450520 85 450521 94 450522 73 450523 94 420951 94
Protein Analysis
[0548] Human transthyretin protein levels were measured in transgenic mice plasma by ELISA using an anti-transthyretin transthyretin polyclonal antibody (Abcam Ab37774) and a sheep anti-TTR horse radish peroxidase detection antibody (Abcam cat. no. 35217). The color reaction was developed by the ImmunoPure? TMB Substrate Kit and absorbance measured at 450 nm using a microtiter plate spectrophotometer. Plasma samples were taken predose and on days 7, 14 and 28. The results are presented in Table 46 expressed as percentage inhibition compared to the pre-dose levels and demonstrate a time-dependent reduction in protein levels on treatment with ISIS oligonucleotides.
TABLE-US-00046 TABLE 46 Inhibition of human transthyretin protein in the hTTR transgenic mice plasma relative to pre-dose levels Day 0 Day 14 Day 28 PBS 0 0 0 ISIS 304313 0 62 77 ISIS 420913 0 91 97 ISIS 420919 0 70 82 ISIS 420921 0 83 87 ISIS 420922 0 95 97 ISIS 420937 0 37 59 ISIS 420944 0 57 72 ISIS 420947 0 57 65 ISIS 420949 0 93 99 ISIS 420950 0 97 100 ISIS 420952 0 98 100 ISIS 420953 0 99 100 ISIS 420955 0 89 100 ISIS 420957 0 92 94 ISIS 420959 0 69 87 ISIS 450518 0 80 97 ISIS 450519 0 94 100 ISIS 450520 0 83 100 ISIS 450521 0 100 100 ISIS 450522 0 93 97 ISIS 450523 0 100 100 ISIS 420951 0 99 100
Liver Function
[0549] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 47 expressed in IU/L. Plasma levels of bilirubin were also measured using the same clinical chemistry analyzer; results are also presented in Table 47 and expressed in mg/dL.
TABLE-US-00047 TABLE 47 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of transgenic mice ALT AST Bilirubin (IU/L) (IU/L) (mg/dL) PBS 34 88 0.20 ISIS 304313 42 79 0.16 ISIS 420913 35 67 0.17 ISIS 420919 63 177 0.20 ISIS 420921 47 103 0.15 ISIS 420922 42 128 0.16 ISIS 420937 33 160 0.15 ISIS 420944 38 84 0.15 ISIS 420947 42 120 0.17 ISIS 420949 46 125 0.15 ISIS 420950 73 106 0.15 ISIS 420952 151 271 0.19 ISIS 420953 982 452 0.16 ISIS 420955 47 80 0.15 ISIS 420957 53 133 0.18 ISIS 420959 31 89 0.11 ISIS 450518 103 200 0.20 ISIS 450519 64 81 0.12 ISIS 450520 350 270 0.12 ISIS 450521 104 226 0.13 ISIS 450522 109 201 0.14 ISIS 450523 80 170 0.19 ISIS 420951 67 100 0.09
Kidney Function
[0550] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Table 48, expressed in mg/dL.
TABLE-US-00048 TABLE 48 Effect of antisense oligonucleotide treatment on BUN (mg/dL) in the kidney of transgenic mice PBS 35 ISIS 304313 29 ISIS 420913 30 ISIS 420919 29 ISIS 420921 29 ISIS 420922 27 ISIS 420937 29 ISIS 420944 27 ISIS 420947 26 ISIS 420949 25 ISIS 420950 34 ISIS 420952 23 ISIS 420953 34 ISIS 420955 24 ISIS 420957 23 ISIS 420959 29 ISIS 450518 28 ISIS 450519 25 ISIS 450520 29 ISIS 450521 24 ISIS 450522 29 ISIS 450523 27 ISIS 420951 25
Example 17
Tolerability of Antisense Oligonucleotides Targeting Human Transthyretin in CD1 Mice
[0551] CD1 mice were treated with ISIS antisense oligonucleotides from Example 16 and evaluated for changes in the levels of various metabolic markers.
Treatment
[0552] Groups of eight CD1 mice each were injected subcutaneously twice a week with 50 mg/kg of ISIS 304313, ISIS 420913, ISIS 420919, ISIS 420921, ISIS 420922, ISIS 420937, ISIS 420944, ISIS 420947, ISIS 420949, ISIS 420950, ISIS 420951, ISIS 420952, ISIS 420953, ISIS 420955, ISIS 420957, ISIS 420959, ISIS 425518, ISIS 425519, ISIS 425520, ISIS 425521, ISIS 425522, or ISIS 425523. Three days after the last dose at each time point, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.
Body and Organ Weights
[0553] The body weights of the mice were measured pre-dose and at the end of each treatment period (two weeks and six weeks). The body weights are presented in Table 49 and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 49 as a percentage change over the respective organ weights of the PBS control.
TABLE-US-00049 TABLE 49 Change in body and organ weights of CD1 mice after antisense oligonucleotide treatment (%) at week 6 Body weight Liver Spleen Kidney PBS 1.3 1.0 1.0 1.0 ISIS 304313 1.2 1.2 1.4 1.2 ISIS 420913 1.2 1.2 1.3 1.1 ISIS 420919 1.3 1.2 1.9 1.1 ISIS 420921 1.1 1.1 2.2 1.1 ISIS 420922 1.1 1.0 1.6 0.9 ISIS 420937 1.1 1.0 1.2 1.0 ISIS 420944 1.1 1.1 2.0 1.0 ISIS 420947 1.3 1.2 1.7 1.0 ISIS 420949 1.3 1.2 1.8 1.1 ISIS 420950 1.3 1.0 1.7 1.0 ISIS 420952 1.4 1.3 2.1 0.9 ISIS 420953 1.3 1.5 2.2 1.0 ISIS 420955 1.2 1.2 2.2 1.0 ISIS 420957 1.1 1.1 1.8 1.1 ISIS 420959 1.3 1.2 3.2 1.1 ISIS 450518 1.4 1.3 1.8 1.1 ISIS 450519 1.3 1.5 2.4 1.0 ISIS 450520 1.4 1.4 2.2 1.0 ISIS 450521 1.2 1.2 1.9 1.1 ISIS 450522 1.3 1.5 2.3 1.1 ISIS 450523 1.2 1.3 2.4 1.1 ISIS 420951 1.3 1.2 1.9 1.0
Liver Function
[0554] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 50 expressed in IU/L. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and the results are also presented in Table 50.
TABLE-US-00050 TABLE 50 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of CD1 mice ALT AST TBIL PBS 34 88 0.20 ISIS 304313 42 79 0.16 ISIS 420913 35 67 0.17 ISIS 420919 63 177 0.20 ISIS 420921 47 103 0.15 ISIS 420922 42 128 0.16 ISIS 420937 33 160 0.15 ISIS 420944 38 84 0.15 ISIS 420947 42 120 0.17 ISIS 420949 46 125 0.15 ISIS 420950 73 106 0.15 ISIS 420952 151 271 0.19 ISIS 420953 982 452 0.16 ISIS 420955 47 80 0.15 ISIS 420957 53 133 0.18 ISIS 420959 31 89 0.11 ISIS 450518 103 200 0.20 ISIS 450519 64 81 0.12 ISIS 450520 350 270 0.12 ISIS 450521 104 226 0.13 ISIS 450522 109 201 0.14 ISIS 450523 80 170 0.19 ISIS 420951 67 100 0.09
Kidney Function
[0555] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Table 51, expressed in mg/dL.
TABLE-US-00051 TABLE 51 Effect of antisense oligonucleotide treatment on BUN (mg/dL) in the kidney of CD1 mice BUN PBS 35 ISIS 304313 29 ISIS 420913 30 ISIS 420919 29 ISIS 420921 29 ISIS 420922 27 ISIS 420937 29 ISIS 420944 27 ISIS 420947 26 ISIS 420949 25 ISIS 420950 34 ISIS 420952 23 ISIS 420953 34 ISIS 420955 24 ISIS 420957 23 ISIS 420959 29 ISIS 450518 28 ISIS 450519 25 ISIS 450520 29 ISIS 450521 24 ISIS 450522 29 ISIS 450523 27 ISIS 420951 25
Hematology Assays
[0556] Blood obtained from all mice groups were sent to Antech Diagnostics for hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) measurements and analyses, as well as measurements of the differential blood cell counts, such as that of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content. The results are presented in Table 52 and 53. Percentages given in the tables indicate the percent change in total blood cell count compared to the PBS control.
TABLE-US-00052 TABLE 52 Effect of antisense oligonucleotide treatment on complete blood cell count (%) compared to the PBS control in CD1 mice WBC RBC Hemoglobin HCT MCV MCH MCHC ISIS 304313 +80 ?5 ?7 ?9 ?4 ?2 +4 ISIS 420913 ?10 ?1 ?3 ?5 ?4 ?2 +3 ISIS 420919 +26 ?2 ?7 ?9 ?7 ?5 +4 ISIS 420921 +60 ?9 ?12 ?15 ?6 ?3 +5 ISIS 420922 +18 ?6 ?11 ?16 ?11 ?6 +6 ISIS 420937 +42 ?3 ?4 ?7 ?5 ?1 +5 ISIS 420944 +49 ?5 ?9 ?13 ?8 ?4 +6 ISIS 420947 +36 ?2 ?2 ?5 ?3 0 +4 ISIS 420949 +61 ?4 ?6 ?9 ?7 ?3 +5 ISIS 420950 +56 ?14 ?16 ?19 ?7 ?3 +6 ISIS 420952 +36 ?20 ?24 ?25 ?7 ?5 +4 ISIS 420953 +105 ?21 ?24 ?26 ?6 ?4 +4 ISIS 420955 +107 ?14 ?19 ?21 ?9 ?5 +6 ISIS 420957 +79 ?5 ?10 ?13 ?9 ?6 +5 ISIS 420959 +92 ?8 ?14 ?18 ?11 ?7 +6 ISIS 450518 +138 ?5 ?10 ?12 ?7 ?4 +4 ISIS 450519 +118 ?17 ?21 ?24 ?9 ?5 +6 ISIS 450520 +151 ?18 ?21 ?23 ?7 ?4 +4 ISIS 450521 +118 ?15 ?21 ?23 ?11 ?7 +5 ISIS 450522 +63 ?22 ?28 ?31 ?12 ?8 +6 ISIS 450523 +116 ?22 ?27 ?29 ?11 ?7 +6 ISIS 420951 +54 ?15 ?21 ?24 ?10 ?6 +5
TABLE-US-00053 TABLE 53 Effect of antisense oligonucleotide treatment on differential blood cell count (%) compared to the PBS control in CD1 mice Neutrophils Lymphocytes Monocytes Platelets ISIS 304313 ?54 +49 ?45 +36 ISIS 420913 ?46 +39 ?21 ?2 ISIS 420919 ?57 +49 ?21 +19 ISIS 420921 ?55 +47 ?24 +25 ISIS 420922 ?53 +46 ?31 +24 ISIS 420937 ?63 +57 ?48 +20 ISIS 420944 ?40 +37 ?28 +18 ISIS 420947 ?55 +49 ?38 ?9 ISIS 420949 ?30 +24 +7 +17 ISIS 420950 ?50 +40 0 +6 ISIS 420952 ?34 +33 ?28 +13 ISIS 420953 ?37 +35 ?34 +11 ISIS 420955 ?37 +34 ?21 +30 ISIS 420957 ?71 +61 ?28 +16 ISIS 420959 ?52 +45 ?24 ?1 ISIS 450518 ?56 +49 ?28 +18 ISIS 450519 ?18 +11 +41 +55 ISIS 450520 ?41 +34 0 +7 ISIS 450521 ?41 +36 ?14 +21 ISIS 450522 ?41 +31 +17 +58 ISIS 450523 ?28 +19 +31 +51 ISIS 420951 ?28 +24 0 +26
Example 18
Tolerability of Antisense Oligonucleotides Targeting Human Transthyretin in Sprague-Dawley Rats
[0557] ISIS oligonucleotides selected from studies described in Example 17 were also tested in Sprague-Dawley rats and evaluated for changes in the levels of various metabolic markers.
Treatment
[0558] The body weights, complete blood count and different blood count, as well as the urine protein/creatinine ratio of the rats were evaluated pre-dose. Groups of four Sprague-Dawley rats each were injected subcutaneously twice a week with 50 mg/kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, and ISIS 420959. Three days after the last dose at each time point, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.
Body and Organ Weights
[0559] The body weights of the rats were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 54, and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 54 as a percentage change over the respective organ weights of the PBS control.
TABLE-US-00054 TABLE 54 Change in body and organ weights of Sprague-Dawley rats after antisense oligonucleotide treatment (%) Body weight Liver Spleen Kidney PBS 2.1 1.0 1.0 1.0 ISIS 420913 1.5 1.5 4.7 1.1 ISIS 420921 1.6 1.5 4.2 1.3 ISIS 420922 1.3 1.5 4.4 1.4 ISIS 420950 1.4 1.5 6.4 1.7 ISIS 420955 1.5 1.6 5.9 1.4 ISIS 420957 1.4 1.4 6.8 1.3 ISIS 420959 1.5 1.4 5.5 1.4
[0560] As shown in Table 54, the compounds demonstrated a less than 10-fold increase in organ weight of these rats. Furthermore, certain compounds demonstrated a less than 7-fold increase in organ weight of these rats. While certain compounds demonstrated a less than 6-fold increase in organ weight of these rats. Certain compounds demonstrated a less than 5-fold increase in organ weight of these rats.
Liver Function
[0561] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 55 expressed in IU/L. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and the results are also presented in Table 55.
TABLE-US-00055 TABLE 55 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of Sprague-Dawley rats ALT AST TBIL Albumin (IU/L (IU/L) (mg/dL) (g/dL) PBS 26 66 0.09 4.5 ISIS 420913 38 95 0.08 3.3 ISIS 420921 65 151 0.11 3.2 ISIS 420922 40 121 0.11 4.0 ISIS 420950 398 327 0.19 4.0 ISIS 420955 78 241 0.18 4.1 ISIS 420957 84 244 0.14 3.7 ISIS 420959 82 405 0.17 4.6
Kidney Function
[0562] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Table 56, expressed in mg/dL. The ratio of total urine protein to creatinine was also evaluated and presented in Table 56.
TABLE-US-00056 TABLE 56 Effect of antisense oligonucleotide treatment on metabolic markers (mg/dL) in the kidney of Sprague-Dawley rats BUN Creatinine PBS 14 0.05 ISIS 420913 22 0.09 ISIS 420921 23 0.07 ISIS 420922 21 0.08 ISIS 420950 20 0.11 ISIS 420955 22 0.06 ISIS 420957 23 0.18 ISIS 420959 24 0.17
TABLE-US-00057 TABLE 57 Effect of antisense oligonucleotide treatment on total urine protein/creatinine in the kidney of Sprague-Dawley rats Urine protein/creatinine ratio PBS 1.50 ISIS 420913 19.51 ISIS 420921 5.07 ISIS 420922 4.72 ISIS 420950 5.61 ISIS 420955 5.57 ISIS 420957 5.40 ISIS 420959 4.39
Hematology Assays
[0563] Blood obtained from all rat groups were sent to Antech Diagnostics for hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) measurements and analyses, as well as measurements of the differential blood cell counts, such as that of WBC (neutrophils, lymphocytes, and monocytes), RBC, and platelets, and total hemoglobin content. The results are presented in Tables 58 and 59. Percents given in the tables indicate the percent change in total blood cell count compared to the PBS control.
TABLE-US-00058 TABLE 58 Effect of antisense oligonucleotide treatment on complete blood cell count (%) compared to the PBS control in Sprague-Dawley rats WBC RBC Hemoglobin HCT MCV MCH MCHC PBS 1.0 1.0 1.0 1.0 1.0 1.0 1.0 ISIS 420913 1.7 0.9 0.9 0.9 0.9 0.9 1.0 ISIS 420921 1.6 0.9 0.9 0.9 1.0 1.0 1.0 ISIS 420922 1.6 0.9 0.9 0.8 1.0 1.0 1.0 ISIS 420950 2.2 0.7 0.7 0.7 1.0 1.0 1.0 ISIS 420955 1.9 0.7 0.8 0.7 1.1 1.2 1.0 ISIS 420957 3.1 0.8 0.8 0.8 1.0 1.0 1.0 ISIS 420959 2.2 0.8 0.8 0.8 1.0 1.0 1.0
TABLE-US-00059 TABLE 59 Effect of antisense oligonucleotide treatment on differential blood cell count (%) compared to the PBS control in Sprague-Dawley rats Neutrophils Lymphocytes Monocytes Platelet PBS 1.0 1.0 1.0 1.0 ISIS 420913 0.5 1.1 1.7 0.7 ISIS 420921 0.7 1.0 1.6 0.6 ISIS 420922 0.5 1.1 1.3 0.7 ISIS 420950 0.8 1.0 2.3 0.7 ISIS 420955 0.5 1.0 2.4 0.7 ISIS 420957 0.7 1.0 1.6 0.3 ISIS 420959 0.5 1.1 1.3 n.d.
Example 19
Pharmacokinetic Studies of Half-Life of Antisense Oligonucleotide Concentration in Sprague-Dawley Rat Liver and Kidney
[0564] Sprague Dawley rats were treated with ISIS antisense oligonucleotides targeting from studies described in Example 18 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver and kidney was evaluated.
Treatment
[0565] Groups of four Sprague Dawley rats each were injected subcutaneously twice a week for 2 weeks with 20 mg/kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, and ISIS 420959. Three days after the last dose, the rats were sacrificed and livers and kidneys were collected for analysis.
Measurement of Oligonucleotide Concentration
[0566] The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 166) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ?g/g. The results are presented in Tables 60 and 61, expressed as ?g/g liver or kidney tissue. The kidney to liver ratio of oligonucleotide concentration was also calculated and presented in Tables 60 and 61.
TABLE-US-00060 TABLE 60 Full-length oligonucleotide concentration (?g/g) and ratio in the liver and kidney of Sprague-Dawley rats Kidney/Liver ISIS NO. Liver Kidney ratio 420913 154 285 1.9 420921 147 293 2.0 420922 226 497 2.2 420950 161 411 2.6 420955 152 383 2.5 420957 235 453 1.9 420959 187 513 2.7
TABLE-US-00061 TABLE 61 Total oligonucleotide concentration (?g/g) in the liver and kidney of Sprague-Dawley rats Kidney/Liver ISIS NO. Liver Kidney ratio 420913 180 310 1.7 420921 159 305 1.9 420922 238 544 2.3 420950 168 466 2.8 420955 156 442 2.8 420957 244 551 2.3 420959 202 534 2.6
Example 20
In Vivo Dose-Dependent Inhibition of Human Transthyretin in Transgenic Mice
[0567] ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420957 and ISIS 420959, which exhibited good efficacy and tolerability, as demonstrated in Examples 16-19, were chosen for the study of dose-dependent target knockdown in transgenic mice containing the human transthyretin gene. ISIS 420950 and ISIS 420955, which demonstrated 90% or more target knockdown, but which also demonstrated toxicity in CD1 mice (Examples 16-19) were also chosen for this study for comparison.
Treatment
[0568] Groups of four mice, two male and two female, each were injected subcutaneously twice a week for 4 weeks with 4 mg/kg, 10 mg/kg or 25 mg/kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS 420959. One group of four mice, two male and two female, was injected subcutaneously twice a week for 4 weeks with 25 mg/kg of the control oligonucleotide, ISIS 141923. One control group of four mice, two male and two female, was injected subcutaneously twice a week for 4 weeks with PBS. Plasma samples were taken from each group at days 0, 14 and 28. Two days after the last dose, the mice were euthanized and organs were harvested for further analysis.
RNA Analysis
[0569] RNA was extracted from liver tissue for real-time PCR analysis of transthyretin using primer probe set RTS3029. Results are presented as percent inhibition of human transthyretin, relative to PBS control. As shown in Table 62, treatment with ISIS antisense oligonucleotides resulted in significant dose-dependent reduction of human transthyretin mRNA in comparison to the PBS control. Treatment with the control oligonucleotide, ISIS 141923 did not result in significant reduction of transthyretin, as expected.
TABLE-US-00062 TABLE 62 Inhibition of human transthyretin mRNA in the hTTR transgenic mice liver relative to the PBS control ISIS NO. Dose (mg/kg) % inhibition 420913 25 78 10 65 4 32 420921 25 76 10 64 4 13 420922 25 80 10 53 4 21 420950 25 92 10 77 4 57 420955 25 88 10 56 4 23 420957 25 85 10 72 4 32 420959 25 75 10 26 4 11 141923 25 0
Protein Analysis
[0570] Human transthyretin protein levels were measured in transgenic mice plasma by ELISA using an anti-transthyretin transthyretin polyclonal antibody (Abcam Ab37774) and a sheep anti-TTR horse radish peroxidase detection antibody (Abcam cat. no. 35217). The color reaction was developed by the ImmunoPure? TMB Substrate Kit and absorbance measured at 450 nm using a microtiter plate spectrophotometer. Plasma samples were taken predose and on days 7, 14, 21 and 28. The results are presented in Table 63 expressed as percentage inhibition compared to the predose levels and demonstrate a time-dependent and dose-dependent reduction in protein levels on treatment with ISIS oligonucleotides.
TABLE-US-00063 TABLE 63 Inhibition of human transthyretin protein in the hTTR transgenic mice plasma relative to predose levels ISIS NO. Dose (mg/kg) d 0 d 14 d 28 420913 25 0 73 93 10 0 27 96 4 0 25 54 420921 25 0 73 90 10 0 63 79 4 0 42 67 420922 25 0 63 96 10 0 57 89 4 0 38 77 420950 25 0 95 97 10 0 71 96 4 0 29 53 420955 25 0 84 96 10 0 53 91 4 0 20 30 420957 25 0 83 93 10 0 51 66 4 0 32 49 420959 25 0 74 80 10 0 31 58 4 0 0 0 141923 25 0 22 0
Body Weight and Organ Weight
[0571] The body weights of the mice were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 64 and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 64 as a percentage change over the respective organ weights of the PBS control.
TABLE-US-00064 TABLE 64 Change in body and organ weights of transgenic mice after antisense oligonucleotide treatment (%) Body weight Liver Spleen Kidney PBS 6.4 0.0 0.0 0.0 ISIS 25 8.1 0.3 11.4 4.1 420913 10 10.6 ?8.6 14.3 13.6 4 7.4 3.7 5.0 12.0 ISIS 25 10.5 8.8 25.6 ?0.1 420921 10 9.7 5.7 10.8 4.0 4 8.7 ?4.4 16.0 11.0 ISIS 25 8.4 5.6 18.0 1.7 420922 10 9.2 ?1.7 27.1 6.3 4 8.1 ?2.1 ?11.4 5.1 ISIS 25 12.8 14.3 22.8 1.7 420950 10 8.4 4.3 ?2.8 0.6 4 9.1 0.4 14.2 1.5 ISIS 25 10.1 14.6 17.7 ?4.4 420955 10 11.8 5.6 ?0.3 1.4 4 7.9 4.7 ?12.3 4.5 ISIS 25 12.8 6.4 33.1 2.8 420957 10 14.5 13.9 ?6.3 9.7 4 7.4 ?5.4 12.2 6.2 ISIS 25 10.0 2.4 72.7 23.3 420959 10 7.2 ?5.4 40.2 9.8 4 4.1 ?4.4 27.8 ?6.6 ISIS 25 9.2 ?1.3 20.4 ?5.5 141923
Liver Function
[0572] To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 65 expressed in IU/L. Plasma levels of bilirubin were also measured using the same clinical chemistry analyzer; results are also presented in Table 65 and expressed in mg/dL.
TABLE-US-00065 TABLE 65 Effect of antisense oligonucleotide treatment on metabolic markers in the liver of transgenic mice Dose ALT AST TBIL (mg/kg) (IU/L) (IU/L) (mg/dL) PBS 47 63 0.16 ISIS 25 42 69 0.13 420913 10 49 90 0.17 4 42 59 0.18 ISIS 25 56 96 0.12 420921 10 51 68 0.22 4 42 75 0.14 ISIS 25 50 76 0.12 420922 10 40 170 0.14 4 37 48 0.13 ISIS 25 74 116 0.14 420950 10 37 67 0.13 4 34 64 0.11 ISIS 25 46 117 0.15 420955 10 54 76 0.16 4 50 153 0.17 ISIS 25 40 73 0.13 420957 10 36 63 0.20 4 37 61 0.12 ISIS 25 51 92 0.19 420959 10 48 69 0.13 4 37 67 0.13 ISIS 25 44 79 0.12 141923
Kidney Function
[0573] To evaluate the effect of ISIS oligonucleotides on kidney function, plasma concentrations of blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Results are presented in Table 66, expressed in mg/dL.
TABLE-US-00066 TABLE 66 Effect of antisense oligonucleotide treatment on BUN (mg/dL) in the kidney of transgenic mice Dose (mg/kg) BUN PBS 23 ISIS 25 24 420913 10 22 4 20 ISIS 25 24 420921 10 22 4 23 ISIS 25 23 420922 10 22 4 24 ISIS 25 22 420950 10 26 4 23 ISIS 25 23 420955 10 24 4 25 ISIS 25 20 420957 10 22 4 20 ISIS 25 25 420959 10 22 4 22 ISIS 25 19 141923
Example 21
Dose Response Confirmation of Antisense Oligonucleotides Targeting Human Transthyretin in Cynomolgus Monkey Primary Hepatocytes
[0574] Gapmers showing tolerability in CD1 mice and Sprague Dawley rats (studies described in Examples 17-19) as well as potency in transgenic mice (studies described in Examples 16 and 20) were selected and tested at various doses in primary hepatocytes of cynomolgus monkeys. Cells were plated at a density of 35,000 cells per well and transfected using electroporation with 156.25 nM, 312.5 nM, 625 nM, 1,250 nM 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM concentrations of antisense oligonucleotide, as specified in Table 67. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS1396 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN?. Results are presented as percent inhibition of transthyretin, relative to untreated control cells. As illustrated in Table 67, transthyretin mRNA levels were reduced in a dose-dependent manner in hepatocytes treated with all the ISIS oligonucleotides, which are cross-reactive with rhesus monkey transthyretin gene, designated herein as SEQ ID NO: 4 (exons 1-4 extracted from GENBANK Accession No. NW_001105671.1).
TABLE-US-00067 TABLE 67 Dose-dependent antisense inhibition of human transthyretin in cynomolgus monkey primary hepatocytes using electroporation Target ISIS 156.25 312.5 625 1250 2500 5000 10000 20000 IC.sub.50 Start No. nM nM nM nM nM nM nM nM (?M) Site 304299 0 0 25 42 89 95 98 99 1.4 504 420913 0 0 42 49 84 96 98 98 1.2 502 420915 0 8 46 58 84 94 97 99 1 505 420921 0 0 26 30 53 74 94 97 2 512 420922 4 0 13 29 38 69 87 97 2.9 513 420950 23 27 60 71 88 94 98 98 0.6 577 420955 19 0 25 50 74 86 93 97 1.4 582 420957 0 0 15 34 65 72 87 94 2.2 584 420959 3 12 10 37 71 88 94 94 1.5 586
Example 22
Measurement of Viscosity of ISIS Antisense Oligonucleotides Targeting Human Transthyretin
[0575] The viscosity of antisense oligonucleotides from studies described in Example 21 was measured with the aim of screening out antisense oligonucleotides which have a viscosity more than 40 cP. Oligonucleotides having a viscosity greater than 40 cP would be too viscous to be administered to any subject.
[0576] ISIS oligonucleotides (32-35 mg) were weighed into a glass vial, 120 ?L of water was added and the antisense oligonucleotide was dissolved into solution by heating the vial at 50? C. Part of (75 ?L) the pre-heated sample was pipetted to a micro-viscometer (Cambridge). The temperature of the micro-viscometter was set to 25? C. and the viscosity of the sample was measured. Another part (20 ?L) of the pre-heated sample was pipetted into 10 mL of water for UV reading at 260 nM at 85? C. (Cary UV instrument). The results are presented in Table 68 and indicate that all the antisense oligonucleotides solutions are optimal in their viscosity under the criterion stated above.
TABLE-US-00068 TABLE 68 Viscosity and concentration of ISIS antisense oligonucleotides targeting human transthyretin ISIS No. Viscosity (cP) Concentration (mg/mL) 304299 9.9 169 420913 6.5 178 420915 8.4 227 420921 8.2 234 420922 5.3 191 420950 12.5 297 420955 15.7 259 420957 12.9 233 420959 18.7 276
Example 23
Measurement of Half-Life of Antisense Oligonucleotide in CD1 Mouse Liver
[0577] CD1 mice were treated with ISIS antisense oligonucleotides from studies described in Example 22 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver was evaluated.
Treatment
[0578] Groups of twelve CD1 mice each were injected subcutaneously twice per week for 2 weeks with 50 mg/kg of ISIS 420913, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, and ISIS 420959. Four mice from each group were sacrificed 3 days, 28 days and 56 days following the final dose. Livers were harvested for analysis.
Measurement of Oligonucleotide Concentration
[0579] The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 166) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ?g/g. Half-lives were then calculated using WinNonlin software (PHARSIGHT).
[0580] The results are presented in Tables 69, expressed as ?g/g liver tissue. The half-life of each oligonucleotide is presented in Table 70.
TABLE-US-00069 TABLE 69 Full-length oligonucleotide concentration (?g/g) in the liver of CD1 mice ISIS No. 3 days 28 days 56 days 420913 243 109 33 420921 225 49 6 420922 310 129 53 420950 254 88 62 420955 308 137 79 420957 325 129 49 420959 258 97 37
TABLE-US-00070 TABLE 70 Half-life of oligonucleotide (days) in the liver of CD1 mice ISIS No. Half-life (days) 420913 18.5 420921 10.0 420922 20.7 420950 26.4 420955 27.2 420957 19.5 420959 18.9
Example 24
Effect of ISIS Antisense Oligonucleotides Targeting Human Transthyretin in Cynomolgus Monkeys
[0581] Cynomolgus monkeys were treated with ISIS antisense oligonucleotides from studies described in Examples 21, 22 and 23. Antisense oligonucleotide efficacy and tolerability, as well as their pharmacokinetic profile in the liver and kidney, were evaluated.
Treatment
[0582] Prior to the study, the monkeys were kept in quarantine for a 30-day time period, during which standard panels of serum chemistry and hematology, examination of fecal samples for ova and parasites, and a tuberculosis test, were conducted to screen out abnormal or ailing monkeys. Nine groups of four randomly assigned male cynomolgus monkeys each were injected subcutaneously thrice per week for the first week, and subsequently twice a week for the next 11 weeks, with 25 mg/kg of ISIS 304299, ISIS 420915, ISIS 420921, ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS 420959. A control group of 4 cynomolgus monkeys was injected with PBS subcutaneously thrice per week for the first week, and subsequently twice a week for the next 11 weeks. Blood samples were collected 5 days before the treatment as well as on various days of the study period and analyzed. The animals were fasted for at least 13 hours (overnight) prior to blood collection. Terminal sacrifices of all groups were conducted on day 86, which was 48 hours after the last dose.
[0583] During the study period, the monkeys were observed daily for signs of illness or distress. Any animal showing adverse effects to the treatment was removed and referred to the veterinarian and Study Director. All the animals treated with ISIS 420955 were removed from the study on day 31 due to symptoms of illness displayed by 2 monkeys in the group. Similarly, one monkey each from groups treated with ISIS 420957 and ISIS 420950 was removed from the study on days 44 and 76, respectively, due to signs of illness.
Inhibition Studies
RNA Analysis
[0584] On day 86, RNA was extracted from liver tissue for real-time PCR analysis of transthyretin using primer probe set RTS3029. Results are presented as percent inhibition of transthyretin, relative to PBS control, normalized to cyclophilin. Similar results were obtained on normalization with RIBOGREEN?. As shown in Table 71, treatment with ISIS antisense oligonucleotides resulted in significant reduction of transthyretin mRNA in comparison to the PBS control. Specifically, treatment with ISIS 420915 caused greater inhibition of TTR mRNA than treatment with ISIS 304299, even though the two oligonucleotides differ from each other by a single base-pair shift. The data for animals treated with ISIS 420955 was taken at day 31.
TABLE-US-00071 TABLE 71 Inhibition of transthyretin mRNA in the cynomolgus monkey liver relative to the PBS control ISIS No % inhibition 304299 59 420915 78 420921 54 420922 61 420950 91 420955* 79 420957 64 420959 55 (*Data of day 31)
Protein Analysis
[0585] The monkeys were fasted overnight prior to blood collection. Approximately 1 mL of blood was collected from all available animals and placed in tubes containing the potassium salt of EDTA. The tubes were centrifuged (3000 rpm for 10 min at room temperature) to obtain plasma. Transthyretin protein levels were measured in the plasma using a clinical analyzer. Plasma samples were taken predose (on day ?5) and on days 1, 9, 16, 23, 30, 44, 58, 72, and 86. The results are presented in Table 72 expressed as percentage inhibition compared to the predose levels and demonstrate a time-dependent reduction in protein levels with treatment with ISIS oligonucleotides. The final plasma TTR levels are presented in Table 73 and demonstrate the strong correlation between TTR protein level reduction and TTR mRNA inhibition (Table 71). Specifically, treatment with ISIS 420915 caused greater inhibition of TTR plasma protein than treatment with ISIS 304299 (76% inhibition vs. 47% inhibition), even though the two oligonucleotides differ from each
TABLE-US-00072 TABLE 72 Time course of transthyretin protein level reduction in the cynomolgus monkey plasma relative to predose levels ISIS Day Day Day Day Day Day Day Day Day No. 0 9 16 23 30 44 58 72 86 304299 4 15 21 23 26 27 31 38 47 420915 2 8 23 34 42 54 63 70 76 420921 5 11 21 31 23 27 30 40 50 420922 0 17 37 42 49 49 50 49 54 420950 0 39 63 68 72 79 85 82 87 420955 0 42 63 80 81 n/a n/a n/a n/a 420957 2 18 28 26 26 35 35 41 50 420959 0 25 29 28 32 38 42 43 50 n/a = study was terminated on day 31 for animals treated with ISIS 420955; therefore data for subsequent days is not available.
TABLE-US-00073 TABLE 73 Day 86 transthyretin protein level reduction in the cynomolgus monkey plasma relative to predose levels ISIS No. % reduction 304299 47 420915 76 420921 50 420922 54 420950 87 420957 50 420959 50
[0586] RBP4 protein levels were also measured in the plasma using an ELISA kit. Plasma samples were taken predose (on day ?5) and on days 9, 16, 23, 30, 44, 58, 72, and 86. The results are presented in Table 74 expressed as percentage inhibition compared to the predose levels. Some of the ISIS oligonucleotides (ISIS 420915, ISIS 420922, ISIS 420950, ISIS 420955 and ISIS 420959) demonstrate a time-dependent reduction in protein levels, concomitant with TTR reduction. The final plasma RBP4 levels are presented in Table 75 and also demonstrate the strong correlation between RBP4 and TTR protein level reductions (Table 73) on treatment with the above-mentioned oligonucleotides. Specifically, treatment with ISIS 420915 caused greater inhibition of RBP4 plasma protein than treatment with ISIS 304299 (63% inhibition vs. 19% inhibition), even though the two oligonucleotides differ from each other by a single base-pair shift.
TABLE-US-00074 TABLE 74 Time course of RBP4 protein level reduction in the cynomolgus monkey plasma relative to predose levels ISIS Day Day Day Day Day Day Day Day No. 9 16 23 30 44 58 72 86 304299 0 6 10 4 1 9 13 19 420915 5 22 22 30 38 47 54 63 420921 0 0 0 0 0 0 6 24 420922 4 19 16 34 33 29 15 32 420950 30 44 46 47 52 54 47 48 420955 6 36 53 65 n/a n/a n/a n/a 420957 0 10 0 0 0 0 3 27 420959 18 22 14 17 19 25 22 34 n/a = study was terminated on day 31 for animals treated with ISIS 420955; therefore data for subsequent days is not available.
TABLE-US-00075 TABLE 75 Day 86 RBP4 protein level reduction in the cynomolgus monkey plasma relative to predose levels ISIS No. % reduction 304299 19 420915 63 420921 24 420922 32 420950 48 420957 27 420959 34
Tolerability Studies
Body and Organ Weight Measurements
[0587] To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body and organ weights were measured at day 86. The data for animals treated with ISIS 420955 was taken at day 31. Body weights were measured and compared to that at pre-dose levels. Organ weights were measured and treatment group weights were compared to the corresponding PBS control weights. The data is presented in Table 76.
TABLE-US-00076 TABLE 76 Final body and organ weight % changes in the cynomolgus monkey relative to predose levels Body Liver Kidney Spleen ISIS No. weight weight weight weight 304299 +6 +27 +37 +53 420915 +6 +37 +26 +41 420921 +4 +42 +43 +22 420922 +4 +45 +39 +63 420950 0 +204 +166 +297 420955* ?3 +36 +81 +70 420957 ?6 +55 +184 +109 420959 0 +57 +101 +112 (*Data of day 31)
Liver Function
[0588] To evaluate the effect of ISIS oligonucleotides on hepatic function, blood samples were collected from all the study groups. The blood samples were collected in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Concentrations of transaminases were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured on day 86 and the results are presented in Table 77, expressed in IU/L. Alkaline phosphatase, which is synthesized in increased amounts by damaged liver cells, is also a marker of liver disease and was similarly measured. C-reactive protein (CRP), which is synthesized in the liver and which serves as a marker of inflammation, was also similarly measured on day 86. Both alkaline phosphatase and CRP data are also presented in Table 77. Bilirubin is also a liver metabolic marker and was similarly measured and is presented in Table 77, expressed in mg/dL.
TABLE-US-00077 TABLE 77 Effect of antisense oligonucleotide treatment on liver metabolic markers in cynomolgus monkey plasma AST ALT ALP CRP Bilirubin (IU/L) (IU/L) (IU/L) (mg/L) (mg/dL) PBS 60 54 955 2.4 0.24 ISIS 304299 81 101 747 3.3 0.17 ISIS 420915 68 62 672 1.6 0.15 ISIS 420921 98 107 832 3.2 0.14 ISIS 420922 94 96 907 2.4 0.15 ISIS 420950 132 94 1032 12.9 0.11 ISIS 420957 100 73 868 23.5 0.15 ISIS 420959 70 63 811 16.0 0.13
Kidney Function
[0589] To evaluate the effect of ISIS oligonucleotides on kidney function, blood samples were collected from all the study groups. The blood samples were collected in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Concentrations of BUN and creatinine were measured at day 86 using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Results are presented in Table 78, expressed in mg/dL.
[0590] Urine samples were collected by drainage from special stainless-steel cage pans on day 5 before the study, and subsequently on days 25 and 84. Urine total protein to creatinine ratio was measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan) and the results are presented in Table 79.
TABLE-US-00078 TABLE 78 Effect of antisense oligonucleotide treatment on plasma BUN and creatinine levels (mg/dL) in cynomolgus monkeys BUN Creatinine PBS 28 0.86 ISIS 304299 27 0.85 ISIS 420915 25 0.90 ISIS 420921 33 0.99 ISIS 420922 28 0.86 ISIS 420950 36 0.97 ISIS 420957 35 0.86 ISIS 420959 27 0.89
TABLE-US-00079 TABLE 79 Effect of antisense oligonucleotide treatment on urine protein to creatine ratio in cynomolgus monkeys Day ?5 Day 25 Day 84 PBS 0.003 0.01 0.00 ISIS 304299 0.000 0.01 0.00 ISIS 420915 0.003 0.00 0.00 ISIS 420921 0.033 0.13 0.09 ISIS 420922 0.010 0.05 0.02 ISIS 420950 0.008 0.29 0.21 ISIS 420955 0.000 0.61 n/a ISIS 420957 0.000 0.48 0.36 ISIS 420959 0.005 0.08 0.03 n/a = study was terminated on day 31 for animals treated with ISIS 420955; therefore data for subsequent days is not available.
Hematology
[0591] To evaluate any inflammatory effect of ISIS oligonucleotides in cynomolgus monkeys, blood samples were approximately 0.5 mL of blood was collected from each of the available study animals in tubes containing the potassium salt of EDTA. Samples were analyzed for red blood cell (RBC) count, white blood cells (WBC) count, individual white blood cell percentages, such as that of monocytes, neutrophils, lymphocytes, as well as for platelet count and hematocrit (%), using an ADVIA120 hematology analyzer (Bayer, USA). The data is presented in Table 80.
TABLE-US-00080 TABLE 80 Effect of antisense oligonucleotide treatment on hematologic parameters in cynomolgus monkeys WBC RBC Platelet Hematocrit Lymphocytes Neutrophil Monocytes (?10.sup.3/?L) (?10.sup.6/?L) (?1000/?L) (%) (%) (%) (%) PBS 9.6 5.3 415 40 62 35 1.8 ISIS 304299 11.6 5.2 395 38 68 26 3.1 ISIS 420915 10.3 5.1 382 36 72 22 3.5 ISIS 420921 9.8 5.2 385 36 60 34 2.5 ISIS 420922 11.6 5.2 396 37 62 29 5.4 ISIS 420950 13.7 4.4 260 33 51 34 7.8 ISIS 420957 18.6 4.7 298 33 52 35 9.1 ISIS 420959 7.7 4.8 306 32 62 29 5.5
Analysis of Factors of Inflammation
[0592] To evaluate the effect of ISIS oligonucleotides on factors involved in inflammation, blood was collected on day 86 from all available animals for complement C3 analysis, as well as for measurement of cytokine levels. For complement C3 analysis, the blood samples were collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Complement C3 was measured using an automatic analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co., Japan). The data is presented in Table 81, expressed in mg/dL.
[0593] For cytokine level analyses, blood was collected in tubes containing EDTA for plasma separation. The tubes were then centrifuged (3000 rpm for 10 min at room temperature) to obtain plasma. Plasma samples were sent to Aushon Biosystems Inc. (Billerica, Mass.) for measurement of chemokine and cytokine levels. Levels of TNF-? were measured using the respective primate antibodies and levels of MIP-1?, MCP-1, and MIP-1? were measured using the respective cross-reacting human antibodies. Measurements were taken 5 days before the start of treatment and on days 3 and 86. The results are presented in Tables 82-85.
TABLE-US-00081 TABLE 81 Effect of antisense oligonucleotide treatment on complement C3 (mg/dL) in cynomolgus monkeys C3 PBS 133 ISIS 304299 96 ISIS 420915 104 ISIS 420921 91 ISIS 420922 102 ISIS 420950 70 ISIS 420957 69 ISIS 420959 95
TABLE-US-00082 TABLE 82 Effect of antisense oligonucleotide treatment on MCP-1 (pg/mL) in cynomolgus monkeys Day ?5 Day 3 Day 86 PBS 232 362 206 ISIS 304299 219 292 427 ISIS 420915 204 342 400 ISIS 420921 281 407 2120 ISIS 420922 215 482 838 ISIS 420950 170 370 3355 ISIS 420957 208 308 3485 ISIS 420959 237 715 2035
TABLE-US-00083 TABLE 83 Effect of antisense oligonucleotide treatment on TNF-? (pg/mL) in cynomolgus monkeys Day ?5 Day 3 Day 86 PBS 60 46 16 ISIS 304299 46 35 24 ISIS 420915 113 83 30 ISIS 420921 57 50 56 ISIS 420922 30 59 46 ISIS 420950 48 54 266 ISIS 420957 29 33 87 ISIS 420959 22 77 74
TABLE-US-00084 TABLE 84 Effect of antisense oligonucleotide treatment on MIP-1? (pg/mL) in cynomolgus monkeys Day ?5 Day 3 Day 86 PBS 6 7 7 ISIS 304299 6 7 9 ISIS 420915 5 5 10 ISIS 420921 8 11 9 ISIS 420922 9 8 5 ISIS 420950 7 9 5 ISIS 420957 6 6 6 ISIS 420959 9 6 5
TABLE-US-00085 TABLE 85 Effect of antisense oligonucleotide treatment on MIP-1? (pg/mL) in cynomolgus monkeys Day ?5 Day 3 Day 86 PBS 13 19 42 ISIS 304299 17 23 54 ISIS 420915 15 27 72 ISIS 420921 23 43 112 ISIS 420922 9 41 70 ISIS 420950 8 25 126 ISIS 420957 16 27 182 ISIS 420959 36 46 117
Coagulation Tests
[0594] To evaluate the effect of ISIS oligonucleotides on factors involved in the coagulation pathway, the standard tests for coagulation were employed. PT and aPTT were measured using platelet poor plasma (PPP) from the monkeys over a period of 48 hrs. PT and aPTT values are provided in Tables 86 and 87 and expressed in seconds. Fibrinogen levels on the plasma were also quantitated over a period of 48 hrs and the data is presented in Table 88. As shown in Tables 86-88, PT, aPTT and fibrinogen were not significantly altered in monkeys treated with ISIS oligonucleotides compared to the PBS control.
TABLE-US-00086 TABLE 86 Effect of antisense oligonucleotide treatment on PT (sec) 0 hr 1 hr 4 hr 8 hr 24 hr 48 hr PBS 10.08 10.38 10.10 10.33 9.83 9.40 ISIS 304299 10.38 10.30 10.48 10.20 9.95 9.53 ISIS 420915 10.15 10.13 10.38 9.93 9.75 9.48 ISIS 420921 10.28 10.13 10.43 10.18 9.80 9.55 ISIS 420922 9.95 10.00 10.05 9.70 9.48 9.28 ISIS 420950 10.30 10.47 10.57 10.27 9.63 9.50 ISIS 420957 10.63 10.47 10.60 10.77 10.33 10.27 ISIS 420959 10.08 10.10 10.20 10.15 9.80 9.55
TABLE-US-00087 TABLE 87 Effect of antisense oligonucleotide treatment on aPTT (sec) 0 hr 1 hr 4 hr 8 hr 24 hr 48 hr PBS 19.40 19.70 20.13 20.20 19.43 17.30 ISIS 304299 21.83 24.35 27.05 25.73 22.40 18.78 ISIS 420915 20.05 22.83 23.83 24.00 21.78 17.90 ISIS 420921 24.15 26.68 31.78 31.90 27.80 22.15 ISIS 420922 25.28 29.48 34.83 33.90 29.13 25.08 ISIS 420950 28.13 31.40 35.40 35.40 31.40 28.37 ISIS 420957 29.13 33.27 39.13 37.40 36.50 29.93 ISIS 420959 22.45 24.73 29.18 28.38 25.50 20.65
TABLE-US-00088 TABLE 88 Effect of antisense oligonucleotide treatment on fibrinogen (mg/dL) 0 hr 1 hr 4 hr 8 hr 24 hr 48 hr PBS 212 203 240 247 282 272 ISIS 304299 175 172 198 207 227 200 ISIS 420915 213 196 204 258 257 215 ISIS 420921 208 209 230 237 301 249 ISIS 420922 278 277 335 338 400 304 ISIS 420950 293 295 348 376 390 296 ISIS 420957 280 299 344 330 434 328 ISIS 420959 276 277 354 326 414 320
Thyroid Panel Analysis
[0595] To evaluate the effect of ISIS oligonucleotides on thyroid hormones, monkeys were fasted overnight and 3.5 mL of blood was drawn from each of the available study animals 5 days prior to the start of treatment and on days 51 and 86. Collected blood samples were kept in tubes without anticoagulant for serum separation. The tubes were kept for 90 min at room temperature, after which they were centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Serum samples were sent to the Biomarkers Core Laboratory of Emory University (Atlanta, Ga.) for thyroid panel analysis. The results for thyroid stimulating hormone (TSH) are provided in Table 89 and expressed ?L/mL. The results for total and free T3 hormone are provided in Tables 90 and 91.The results for total and free T4 hormone are provided in Tables 92 and 93. Overall, the thyroid panel analysis showed that all the animals remained within acceptable hormone levels even though transthyretin expression levels were reduced, demonstrating that the transthyretin antisense oligonucleotides did not affect hormone levels.
TABLE-US-00089 TABLE 89 Effect of antisense oligonucleotide treatment on TSH (?L/mL) Day ?5 Day 51 Day 86 PBS 0.8 0.7 1.0 ISIS 304299 1.4 1.0 2.2 ISIS 420915 1.4 1.5 2.5 ISIS 420921 0.7 0.6 1.0 ISIS 420922 1.0 1.2 1.9 ISIS 420950 0.6 2.2 5.4 ISIS 420957 0.6 2.6 4.9 ISIS 420959 0.9 1.6 4.7
TABLE-US-00090 TABLE 90 Effect of antisense oligonucleotide treatment on total T3 (ng/dL) Day ?5 Day 51 Day 86 PBS 177 248 140 ISIS 304299 202 226 176 ISIS 420915 156 206 156 ISIS 420921 217 204 137 ISIS 420922 188 177 131 ISIS 420950 260 208 105 ISIS 420957 266 160 78 ISIS 420959 299 219 137
TABLE-US-00091 TABLE 91 Effect of antisense oligonucleotide treatment on free T3 (pg/mL) Day ?5 Day 51 Day 86 PBS 7.7 5.8 5.2 ISIS 304299 9.2 6.0 4.7 ISIS 420915 8.9 5.6 4.5 ISIS 420921 10.2 4.8 4.0 ISIS 420922 8.9 5.4 3.7 ISIS 420950 7.2 3.8 2.1 ISIS 420957 8.8 4.0 2.4 ISIS 420959 8.3 4.9 3.3
TABLE-US-00092 TABLE 92 Effect of antisense oligonucleotide treatment on total T4 (ng/dL) Day ?5 Day 51 Day 86 PBS 5.8 4.9 4.4 ISIS 304299 8.1 5.5 6.1 ISIS 420915 8.3 5.7 5.5 ISIS 420921 7.6 6.1 5.6 ISIS 420922 7.3 6.1 5.8 ISIS 420950 6.1 6.3 5.7 ISIS 420957 6.3 4.4 5.0 ISIS 420959 7.9 5.9 8.1
TABLE-US-00093 TABLE 93 Effect of antisense oligonucleotide treatment on free T4 (pg/mL) Day ?5 Day 51 Day 86 PBS 3.4 2.4 1.7 ISIS 304299 3.2 2.5 1.7 ISIS 420915 5.0 1.8 1.7 ISIS 420921 2.6 1.5 1.5 ISIS 420922 3.5 1.6 1.5 ISIS 420950 2.5 1.2 1.1 ISIS 420957 2.4 1.2 1.2 ISIS 420959 3.8 1.4 1.5
Pharmacokinetic Studies
Measurement of Oligonucleotide Concentration
[0596] The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 166) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ?g/g. The ratio of the concentrations in the kidney versus the liver was calculated. The results are presented in Tables 94 and 95, expressed as ?g/g tissue.
TABLE-US-00094 TABLE 94 Full-length oligonucleotide concentration (?g/g) in the liver of cynomolgus monkey Kidney/Liver ISIS No. Kidney Liver ratio 304299 2179 739 2.9 420915 2439 1064 2.3 420921 4617 1521 3.0 420922 3957 1126 3.5 420950 3921 1082 3.6 420955 2444 1111 2.2 420957 3619 1230 2.9 420959 3918 1158 3.4
TABLE-US-00095 TABLE 95 Total oligonucleotide concentration (?g/g) in the liver of cynomolgus monkey Kidney/Liver ISIS No. Kidney Liver ratio 304299 3098 992 3.1 420915 3024 1266 2.4 420921 6100 1974 3.1 420922 4861 1411 3.4 420950 6003 1553 3.9 420955 2763 1208 2.3 420957 5420 1582 3.4 420959 5498 1501 3.7