HIGH THEBAINE POPPY AND METHODS OF PRODUCING THE SAME
20190169625 ยท 2019-06-06
Inventors
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
C12P17/18
CHEMISTRY; METALLURGY
C12N15/8257
CHEMISTRY; METALLURGY
International classification
Abstract
This disclosure relates to the production of opium poppy plants having high levels of thebaine. More particularly, the disclosure relates to the production of opium poppies having high levels of thebaine by simultaneously reducing the expression of genes encoding thebaine 6-0-demethylase (T60DM) and codeine 3-0-demethylase (CODM).
Claims
1. A method of increasing accumulation of thebaine in an opium poppy plant, the method comprising genetically modifying the genome of the plant to include one or more stable genetic modifications to simultaneously reduce the activity of thebaine 6-O-demethylase (T6ODM) and codeine 3-O-demethylase (CODM) in the poppy plant.
2. The method of claim 1, wherein T6ODM has the amino acid sequence of SEQ ID NO: 1, CODM has the amino acid sequence of SEQ ID NO: 3, or T6ODM has the amino acid sequence of SEQ ID NO: 1 and CODM has the amino acid sequence of SEQ ID NO: 3.
3. (canceled)
4. The method of claim 1, wherein genetically modifying the plant to simultaneously reduce the activity of T6ODM and CODM comprises: introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding T6ODM, optionally wherein the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding T6ODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4; genetically modifying the plant to introduce a loss of function mutation in an endogenous gene encoding T6ODM; introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding CODM optionally wherein the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding CODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4; genetically modifying the plant to introduce a loss of function mutation in an endogenous gene encoding CODM; introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding T6ODM, optionally wherein the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding T6ODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO 4, and introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding CODM, optionally wherein the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding CODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4; genetically modifying the plant to introduce a loss of function mutation in an endogenous gene encoding T6ODM and introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding CODM, optionally wherein the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding CODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO: 4; introducing an expression construct to reduce the accumulation of transcripts from an endogenous gene encoding T6ODM, optionally wherein the sequence of the expression construct to reduce the accumulation of transcripts from the endogenous gene encoding T6ODM comprises a portion of SEQ ID NO: 2 or SEQ ID NO 4, and genetically modifying the plant to introduce a loss of function mutation in an endogenous gene encoding CODM; or genetically modifying the plant to introduce a loss of function mutation in an endogenous gene encoding T6ODM and a loss of function mutation in an endogenous gene encoding CODM.
5.-9. (canceled)
10. A genetically modified opium poppy plant having reduced activity of thebaine 6-O-demethylase (T6ODM) and codeine 3-O-demethylase (CODM) relative to a wild type plant, wherein the genetically modified opium poppy plant comprises one or more stable genetic modifications to reduce expression of T6ODM, CODM, or both.
11. The plant of claim 10 comprising a first expression construct for reducing the expression of T6ODM, optionally wherein the first expression construct comprises a first nucleic acid molecule encoding a first hairpin RNA for reducing expression of an endogenous gene encoding T6ODM; and a second expression construct for reducing expression of CODM, optionally wherein the second expression construct comprises a second nucleic acid molecule encoding a second hairpin RNA for reducing expression of an endogenous gene encoding CODM.
12. (canceled)
13. The plant of claim 11, wherein the endogenous gene encoding T6ODM encodes an mRNA comprising the sequence of SEQ ID NO: 15 and the endogenous gene encoding CODM encodes an mnRNA comprising the sequence of SEQ ID NO: 16; or the endogenous gene encoding T6ODM encodes an mRNA comprising the sequence of SEQ ID NO: 15 and the endogenous gene encoding CODM encodes an mRNA comprising the sequence of SEQ ID NO: 16.
14. The plant of claim 13, wherein the nucleic acid molecule encoding the first hairpin RNA comprises a portion of SEQ ID NO: 2 and the nucleic acid molecule encoding the second hairpin RNA comprises a portion of SEQ ID NO: 4; or the nucleic acid molecule encoding the first hairpin RNA comprises a portion of SEQ ID NO: 2 and the nucleic acid molecule encoding the second hairpin RNA comprises a portion of SEQ ID NO: 4.
15.-17. (canceled)
18. The plant of claim 10, comprising an expression construct comprising a nucleic acid molecule for reducing the expression of T6ODM and CODM, optionally wherein the nucleic acid molecule encodes: a hairpin RNA for reducing expression of an endogenous gene encoding CODM; a hairpin RNA for reducing expression of an endogenous gene encoding T6ODM; or a single hairpin RNA sufficient to reduce expression of endogenous genes encoding T6ODM and CODM.
19.-21. (canceled)
22. The plant of claim 18, wherein the nucleic acid molecule comprises a portion of SEQ ID NO:2, SEQ ID NO:4, or both.
23. The plant of claim 18, wherein the expression construct comprises a first nucleic acid molecule encoding a first hairpin RNA for reducing expression of an endogenous gene encoding T6ODM and a second nucleic acid molecule encoding a second hairpin RNA for reducing expression of an endogenous gene encoding CODM, optionally wherein each of the first nucleic acid molecule and the second nucleic acid molecule comprise a portion of SEQ ID NO: 2, SEQ ID NO: 4, or both.
24. The plant of claim 23, wherein the endogenous gene encoding T6ODM encodes an mRNA comprising the sequence of SEQ ID NO: 15, the endogenous gene encoding T6ODM encodes a polypeptide having the sequence of SEQ ID NO 1, the endogenous gene encoding CODM encodes an mRNA comprising the sequence of SEQ ID NO: 16, the endogenous gene encoding CODM encodes a polypeptide having the sequence of SEQ ID NO 3, or any combination thereof.
25.-28. (canceled)
29. The plant of claim 18, wherein the nucleic acid molecule encoding the hairpin RNA comprises a portion of SEQ ID NO: 7 or SEQ ID NO: 8.
30. (canceled)
31. The plant of claim 11, wherein the first nucleic acid molecule comprises a portion of SEQ ID NO: 7 or SEQ ID NO: 8.
32. (canceled)
33. The plant of claim 11, wherein the second nucleic acid molecule comprises a portion of SEQ ID NO: 7 or SEQ ID NO: 8.
34. The plant of claim 31, wherein the second nucleic acid molecule comprises a portion of SEQ ID NO: 7 or SEQ ID NO: 8.
35. The plant of claim 10, wherein the plant is genetically modified to have reduced activity of T6ODM, and wherein reduced activity of CODM is conferred by a mutation in the endogenous gene encoding CODM that was not introduced by genetic modification of the plant, optionally wherein the mutation in the endogenous gene encoding CODM that was not introduced by genetic modification of the plant is the mutation present in seeds of the plant deposited under Patent Deposit Designation PTA-9109, or the plant is genetically modified to have reduced activity of CODM, and wherein reduced activity of T6ODM is conferred by a mutation in the endogenous gene encoding T6ODM that was not introduced by genetic modification of the plant, or the mutation in the endogenous gene encoding T6ODM that was not introduced by genetic modification of the plant is the mutation present in seeds of the plant deposited under Patent Deposit Designation PTA-9110.
36.-95. (canceled)
96. An isolated nucleic acid molecule, wherein the sequence of the nucleic acid molecule comprises SEQ ID NO:7.
97. An expression vector for simultaneously reducing the expression of endogenous genes encoding thebaine 6-O-demethylase (T6ODM) and codeine 3-O-demethylase (CODM) in an opium poppy plant, the expression vector comprising an isolated nucleic acid as defined in claim 96.
98. (canceled)
99. (canceled)
100. Poppy straw from a plant as defined in claim 10.
101. Latex from a plant as defined in claim 10.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0070] In drawings which illustrate embodiments of the invention,
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
DETAILED DESCRIPTION
[0078] This disclosure relates to a genetically modified opium poppy plants, seeds, cells, straw, progeny thereof, or produced latex thereof, which genetically modified plant produces a latex having increased levels of thebaine relative to wild type plants due to the combined reduction in the activity of the enzymes thebaine 6-O-demethylase (T6ODM) and codeine 3-O-demethylase (CODM) during opiate biosynthesis. The disclosure also relates to methods of obtaining such genetically modified opium poppy plants.
Definitions
[0079] Opium poppy plant or poppy plant as used herein refers to a plant of the species Papaver Somniferum.
[0080] A field of plants as used herein, refers to a plurality of opium plants cultivated together in close proximity.
[0081] Activity or as used herein refers to the level of a particularly enzymatic function in a plant cell. In the context of the present disclosure, reduced T6ODM activity refers to a reduction in O-demethylation activity at position 6, whereas reduced CODM activity refers to a reduction in O-demethylation activity at position 3. Reduction in activity can be the result of diminished functionality of the protein due to, for example, mutation, or the result of reduced expression of the protein, for example, due to reduced translation.
[0082] A genetic modification as used herein broadly refers to any a novel combination of genetic material obtained with techniques of modern biotechnology. Genetic modifications include, but are not limited to, transgenes in which the genetic material has been altered by the insertion of exogenous genetic material. However, genetic modifications also include alterations (e.g. insertions, deletions, or substitutions) in endogenous genes introduced in a targeted manner with techniques such as CRISPR/Cas9, TALENS, etc. as discussed below. However, for the purposes of this disclosure genetic modification is not intended to include novel combinations of genetic material resulting from mutations generated by traditional means of random mutagenesis following by traditional means of breeding.
[0083] Transgene as used herein refers to a recombinant gene or genetic material that has been transferred by genetic engineering techniques into the plant cell. Transgenic plants or transformed plants as used herein refers to plants that have incorporated or integrated exogenous nucleic acid sequences or DNA fragments into the plant cell. A transgene may include a homologous or heterologous promoter operably linked to a DNA molecule encoding the RNA or polypeptide of interest.
[0084] Operably linked refers to a functional linkage between a promoter and a second DNA sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second DNA sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous.
[0085] A genetically modified plant or plant cell as used herein broadly refers to any plant or plant cell that possesses a genetic modification as defined herein.
[0086] As used herein, the term polypeptide encompasses any chain of naturally or non-naturally occurring amino acids (either D- or L-amino acids), regardless of length (e.g., at least 5, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 100 or more amino acids) or post-translational modification (e.g., glycosylation or phosphorylation) or the presence of e.g. one or more non-amino acyl groups (for example, sugar, lipid, etc.) covalently linked to the peptide, and includes, for example, natural proteins, synthetic or recombinant polypeptides and peptides, hybrid molecules, peptoids, peptidomimetics, etc. As used herein, the terms polypeptide, peptide and protein may be used interchangeably.
[0087] Nucleotide sequence, polynucleotide sequence, nucleic acid or nucleic acid molecule as used herein refers to a polymer of DNA or RNA which can be single or double stranded and optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. Nucleic acid, nucleic acid sequence, polynucleotide sequence or nucleic acid molecule encompasses genes, cDNA, DNA and RNA encoded by a gene. Nucleic acids, nucleic acid sequences, polynucleotide sequence and nucleic acid molecule may comprise at least 3, at least 10, at least 100, at least 1000, at least 5000, or at least 10000 nucleotides or base pairs.
[0088] A fragment, a fragment thereof, gene fragment or a gene fragment thereof as used herein refers to a portion of a nucleotide sequence, polynucleotide sequence, nucleic acid or nucleic acid molecule that may still reduce expression of the gene(s) encoding CODM and/or T6ODM. In one embodiment, the fragment comprises at least 20, at least 40, at least 60, at least 80, at least 100, at least 150, at least 200, at least 150, at least 300, at least 350, at least 400, at least 450 or at least 500 contiguous nucleotides.
[0089] A non-natural variant as used herein refers to nucleic acid sequences native to an organism but comprising modifications to one or more of its nucleotides introduced by mutagenesis.
[0090] An allele or allelic variant as used herein refers to an alternate form of the same gene at a specific location of the genome.
[0091] Wildtype as used herein refers to a plant or plant material that was not transformed with a nucleic acid molecule or construct, genetically modified, or otherwise mutated as described herein. A wildtype may also refer to a plant or plant material in which T6ODM activity and CODM activity were not reduced.
[0092] The term identity as used herein refers to sequence similarity between two polypeptide or polynucleotide molecules. Identity can be determined by comparing each position in the aligned sequences. A degree of identity between amino acid or nucleic acid sequences is a function of the number of identical or matching amino acids or nucleic acids at positions shared by the sequences, for example, over a specified region. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, as are known in the art, including the Clustal W? program, available at http://clustalw.genome.ad.jp, the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wis., U.S.A.). Sequence identity may also be determined using the BLAST algorithm (e.g. BLASTn and BLASTp), described in Altschul et al., 1990, J. Mol. Biol. 215:403-10 (using the published default settings). Software for performing BLAST analysis is available through the National Center for Biotechnology Information (through the Internet at http://www.ncbi.nlm.nih.gov/). For instance, sequence identity between two nucleic acid sequences can be determined using the BLASTn algorithm at the following default settings: expect threshold 10; word size 11; match/mismatch scores 2, ?3; gap costs existence 5, extension 2. Sequence identity between two amino acid sequences may be determined using the BLASTp algorithm at the following default settings: expect threshold 10; word size 3; matrix BLOSUM 62; gap costs existence 11, extension 1. In another embodiment, the person skilled in the art can readily and properly align any given sequence and deduce sequence identity/homology by mere visual inspection.
[0093] As used herein, heterologous, foreign and exogenous DNA and RNA are used interchangeably and refer to DNA or RNA that does not occur naturally as part of the plant genome in which it is present or which is found in a location or locations in the genome that differ from that in which it occurs in nature. Thus, heterologous or foreign DNA or RNA is nucleic acid that is not normally found in the host genome in an identical context (i.e. linked to identical 5 and 3 sequences). In one aspect, heterologous DNA may be the same as the host DNA but introduced into a different place in the host genome and/or has been modified by methods known in the art, where the modifications include, but are not limited to, insertion in a vector, linked to a foreign promoter and/or other regulatory elements, or repeated at multiple copies. In another aspect, heterologous DNA may be from a different organism, a different species, a different genus or a different kingdom, as the host DNA. Further, the heterologous DNA may be a transgene. As used herein, transgene refers to a segment of DNA containing a gene sequence that has been isolated from one organism and introduced into a different organism. In the context of the present disclosure, the nucleic acid molecules may comprise nucleic acid that is heterologous to the plant in which CODM and T6ODM activity is reduced.
[0094] Expression or expressing, as used herein refers to the process by which information from a gene is used in the synthesis of a functional gene product, and may relate to production of any detectable level of a product, or activity of a product, encoded by a gene. Gene expression may be modulated (i.e. initiated, increased, decreased, terminated, maintained or precluded) at many levels including transcription, RNA processing, translation, post-translational modification, protein degradation. Gene expression can also be modulated by the introduction of mutations that affect the activity of the gene product, e.g. the ability of a gene product to convert substrate. In the context of the present disclosure, reduced expression of the endogenous gene(s) encoding CODM and/or T6ODM, or reduced expression of the CODM and/or T6ODM polypeptides, can be effected by reduced transcription of the endogenous gene(s) encoding CODM and/or T6ODM, by reduced translation of mRNA transcripts coding for CODM and/or T6ODM, or by the introduction of mutations that either prevent the translation of functional polypeptides or result in the translation of polypeptides with reduced abilities to convert substrate. Such reduced expression of the endogenous genes may result from expression of transgenes comprising expression constructs designed to reduce expression of the endogenous genes.
[0095] Poppy straw as used herein refers to the straw material resulting from threshing of mature poppy capsules and the poppy capsule stems to remove the seeds.
[0096] Latex as used herein refer to the air-dried, milky exudation from lansed, unripe poppy capsules.
[0097] The term increased thebaine content or increased level of thebaine as used herein refers to a significantly increased levels of thebaine in one or more tissues as compared to the levels of thebaine in a corresponding wild type plant. The term increased also encompasses levels of thebaine that are significantly increased in one or more tissues compared to the same tissues of a wild type plant, while wild type levels of thebaine persist elsewhere in the plant.
[0098] The term reduced morphine content as used herein refers to a significantly decreased levels of morphine in one or more tissues as compared to the levels of morphine in a corresponding wild type plant. The term reduced also encompasses levels of morphine that are significantly reduced in one or more tissues compared to the same tissues of a wild type plant, while wild type levels of morphine persist elsewhere in the plant.
[0099] Decreasing expression, decreasing activity, reducing expression, and reducing activity are intended to encompass well known equivalent terms regarding expression and activity such as inhibiting, down-regulating, knocking out, silencing, etc.
[0100] substantially no when referring to alkaloid content means that the particular alkaloid or combination of alkaloids constitutes less than 0.6% by weight, preferably, less than 0.5% by weight, more preferably, less than 0.4% by weight, or less than 0.2% by weight of the alkaloid combination of the poppy straw, concentrate of poppy straw or opium.
[0101] Expression construct as used herein refers to any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest into, for example, an siRNA.
[0102] An expression construct of the disclosure nucleic acid molecule may further comprise a promoter and other regulatory elements, for example, an enhancer, a silencer, a polyadenylation site, a transcription terminator, a selectable marker or a screenable marker.
[0103] As used herein, a vector or a construct may refer to any recombinant polynucleotide molecule such as a plasmid, cosmid, virus, vector, autonomously replicating polynucleotide molecule, phage, or linear or circular single-stranded or double-stranded DNA or RNA polynucleotide molecule, derived from any source. A vector or a construct may comprise a promoter, a polyadenylation site, an enhancer or silencer and a transcription terminator, in addition to a nucleotide sequence encoding a gene or a gene fragment of interest. As used herein, a transformation vector may refer to a vector used in the transformation of, or in the introduction of DNA into, cells, plants or plant materials.
[0104] As used herein, a promoter refers to a nucleotide sequence that directs the initiation and rate of transcription of a coding sequence (reviewed in Roeder, Trends Biochem Sci, 16: 402, 1991). The promoter contains the site at which RNA polymerase binds and also contains sites for the binding of other regulatory elements (such as transcription factors). Promoters may be naturally occurring or synthetic (see Datla et al. Biotech Ann. Rev 3:269, 1997 for review of plant promoters). Further, promoters may be species specific (for example, active only in B. napus); tissue specific (for example, the napin, phaseolin, zein, globulin, dlec2, ?-kafirin seed specific promoters); developmentally specific (for example, active only during embryogenesis); constitutive (for example maize ubiquitin, rice ubiquitin, rice actin, Arabidopsis actin, sugarcane bacilliform virus, CsVMV and CaMV 35S, Arabidopsis polyubiquitin, Solanum bulbocastanum polyubiquitin, Agrobacterium tumefaciens-derived nopaline synthase, octopine synthase, and mannopine synthase gene promoters); or inducible (for example the stilbene synthase promoter and promoters induced by light, heat, cold, drought, wounding, hormones, stress and chemicals). A promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box or an lnr element, and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. A promoter may also refer to a nucleotide sequence that includes a minimal promoter plus DNA elements that regulates the expression of a coding sequence, such as enhancers and silencers. Thus in one aspect, the expression of the constructs of the present disclosure may be regulated by selecting a species specific, a tissue specific, a development specific or an inducible promoter.
[0105] Constitutive promoter as used herein refers to a promoter which drives the expression of the downstream-located coding region in a plurality of or all tissues irrespective of environmental or developmental factors.
[0106] The skilled person will understand that it would be important to use a promoter that effectively directs the expression of the construct in the tissue in which thebaine is being synthesized. For example, the endogenous T6ODM or CODM promoters could be used. Alternatively, constitutive, tissue-specific, or inducible promoters useful under the appropriate conditions to direct high level expression of the introduced expression construct during opioid biosynthesis can be employed.
[0107] Enhancers and silencers are DNA elements that affect transcription of a linked promoter positively or negatively, respectively (reviewed in Blackwood and Kadonaga, Science, 281: 61, 1998).
[0108] Polyadenylation site refers to a DNA sequence that signals the RNA transcription machinery to add a series of the nucleotide A at about 30 bp downstream from the polyadenylation site.
[0109] Transcription terminators are DNA sequences that signal the termination of transcription. Transcription terminators are known in the art. The transcription terminator may be derived from Agrobacterium tumefaciens, such as those isolated from the nopaline synthase, mannopine synthase, octopine synthase genes and other open reading frame from Ti plasmids. Other terminators may include, without limitation, those isolated from CaMV and other DNA viruses, dlec2, zein, phaseolin, lipase, osmotin, peroxidase, PinlI and ubiquitin genes, for example, from Solanum tuberosum.
[0110] In the context of the disclosure the nucleic acid construct may further comprise a selectable marker. Selectable markers may be used to select for plants or plant cells that contain the exogenous genetic material. The exogenous genetic material may include, but is not limited to, an enzyme that confers resistance to an agent such as a herbicide or an antibiotic, or a protein that reports the presence of the construct.
[0111] Numerous plant selectable marker systems are known in the art and are consistent with this invention. The following review article illustrates these well known systems: Miki and McHugh; Journal of Biotechnology 107: 193-232; Selectable marker genes in transgenic plants: applications, alternatives and biosafety (2004).
[0112] Examples of a selectable marker include, but are not limited to, a neo gene, which codes for kanamycin resistance and can be selected for using kanamycin, Nptll, G418, hpt etc.; an amp resistance gene for selection with the antibiotic ampicillin; an hygromycinR gene for hygromycin resistance; a BAR gene (encoding phosphinothricin acetyl transferase) which codes for bialaphos resistance including those described in WO/2008/070845; a mutant EPSP synthase gene, aadA, which encodes glyphosate resistance; a nitrilase gene, which confers resistance to bromoxynil; a mutant acetolactate synthase gene (ALS), which confers imidazolinone or sulphonylurea resistance, ALS, and a methotrexate resistant DHFR gene.
[0113] Further, screenable markers that may be used in the context of the invention include, but are not limited to, a ?-glucuronidase or uidA gene (GUS), which encodes an enzyme for which various chromogenic substrates are known, green fluorescent protein (GFP), and luciferase (LUX).
[0114] Alkaloid Production in Papaver somniferum
[0115]
[0116] The present inventor hypothesized that it may be possible to produce plants containing elevated levels of thebaine, and reduced levels of codeine and morphine, compared to parental plants by simultaneously reducing the activity of the T6ODM and CODM enzymes.
[0117] Wild type amino acid sequences of the T6ODM and CODM enzymes are presented in SEQ ID NOs: 1 and 3, respectively. The cDNA sequence corresponding to the endogenous gene coding for the T6ODM enzyme is presented as SEQ ID NO: 2, and the cDNA sequence corresponding to the endogenous gene coding for the CODM enzyme is presented as SEQ ID NO: 4. However, the skilled person will readily understand that naturally occurring variations in the T6ODM and CODM genes may exist between varieties, with slightly different nucleic acid sequences that encode the same functional protein.
[0118] Reduction of CODM and T6ODM Activity or Expression
[0119] CODM and T6ODM expression and/or activity in genetically modified plants of the present invention may be reduced by any method that results in reduced activity of these enzymes in the plant. This may be achieved by e.g. by altering CODM and T6ODM activity at the DNA, mRNA and/or protein levels.
[0120] As used herein, activity refers to the biochemical reaction of an enzyme with its cognate substrate. In the context of the invention, reduced T6ODM (or CODM) activity may result from reduced protein levels of T6ODM (or CODM) enzyme and/or the reduced rate at which a T6ODM (or CODM) enzyme catalyzes its reaction with thebaine.
[0121] Mutating Endogenous Genes Encoding CODM and T6ODM
[0122] In one aspect, the present disclosure relates to genetic modifications targeting the endogenous genes encoding CODM and T6ODM to alter CODM and T6ODM expression and/or activity. The endogenous CODM and T6ODM genes may be altered by, without limitation, knocking-out CODM and T6ODM genes; or knocking-in a heterologous DNA to disrupt CODM and T6ODM genes. The skilled person would understand that these approaches may be applied to the coding sequences, the promoter or other regulatory elements necessary for gene transcription. For example, technologies such as CRISPR/Cas9 and TALENS can be used to introduce loss of function mutations in both the endogenous genes encoding CODM and T6ODM. Plants having at least one allele of each gene comprising such loss of function mutations can then be self-fertilized to produce progeny homozygous for the loss of function alleles in the genes encoding CODM and T6ODM. In some embodiments, genetic modification of the endogenous gene encoding the CODM (or T6ODM) enzyme results in a polypeptide that differs in sequence by one or more amino acid insertions, deletions, or substitutions, and has diminished or no CODM (or T6ODM) activity.
[0123] Deletions involve lack one or more residues of the endogenous protein. For the purposes of this disclosure, a deletion variant includes embodiments in which no amino acids of the endogenous protein are translated, e.g. where the initial start methionine is substituted or deleted.
[0124] Insertional mutations typically involve the addition of material at a non-terminal point in the polypeptide, but may include fusion proteins comprising amino terminal and carboxy terminal additions. Substitutional variants typically involve a substitution of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide. Substitutions of this kind may, in some embodiments, be conservative, i.e. where one amino acid is replaced with one of similar shape, size, charge, hydrophobicity, hydrophilicity, etc. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
[0125] Accordingly, the CODM enzyme may have an amino acid sequence that possesses at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1. Accordingly, the T6ODM enzyme may have an amino acid sequence that possesses at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 2.
[0126] Expression of Transgenes Targeting the Endogenous Genes
[0127] In another aspect, the present disclosure relates to reducing the expression and/or activity of CODM and T6ODM by targeting their respective mRNA transcripts. In this regard, levels of CODM and T6ODM T mRNA transcripts may be reduced by methods known in the art including, but not limited to, co-suppression, antisense expression, small hair pin (shRNA) expression, interfering RNA (RNAi) expression, double stranded (dsRNA) expression, inverted repeat dsRNA expression, micro interfering RNA (miRNA), simultaneous expression of sense and antisense sequences, or a combination thereof.
[0128] In one embodiment, the present disclosure relates to the use of nucleic acid molecules that are complementary, or essentially complementary, to at least a portion of the molecules set forth in SEQ ID NO:2 or SEQ ID NO:4. Nucleic acid molecules that are complementary are those that are capable of base-pairing according to the standard Watson-Crick complementary rules. As used herein, the term complementary sequences means nucleic acid sequences that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:2 or SEQ ID NO:4 under relatively stringent conditions such as those described herein. Nucleic acid molecules may be substantially complementary (or are homologues/have identity) if the two sequences hybridize to each other under moderately stringent, or preferably stringent, conditions. Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65? C., and washing in 0.2?SSC/0.1% SDS at 42? C. (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65? C., and washing in 0.1?SSC/0.1% SDS at 68? C. (see Ausubel, et al. (eds), 1989, supra). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid Probes, Part I, Chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, N.Y.). Generally, stringent conditions are selected to be about 5? C. lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
[0129] The phenomenon of co-suppression in plants relates to the introduction of transgenic copies of a gene resulting in reduced expression of the transgene as well as the endogenous gene. The observed effect depends on sequence identity between the transgene and the endogenous gene.
[0130] The term RNA interference (RNAi) refers to well-known methods for down-regulating or silencing expression of a naturally occurring gene in a host plant. RNAi employs a double-stranded RNA molecule or a short hairpin RNA to change the expression of a nucleic acid sequence with which they share substantial or total homology. For a review, see e.g. Agrawal, N. et al (2003) Microbiol Mol Biol Rev. 67(4): 657-685. RNA is both an initiator and target in the process. This mechanism targets RNA from viruses and transposons and also plays a role in regulating development and genome maintenance. Briefly, double stranded RNA is cleaved by the enzyme dicer resulting in short fragments of 21-23 bp (siRNA). One of the two strands of each fragment is incorporated into the RNA-induced silencing complex (RISC). The RISC associated RNA strand pairs with mRNA and induces cleavage of the mRNA. Alternatively, RISC associated RNA strand pairs with genomic DNA resulting in epigenetic changes that affect gene transcription. Micro RNA (miRNA) is a type of RNA transcribed from the genome itself and works in a similar way. Similarly, shRNA may be cleaved by dicer and associate with RISC resulting in mRNA cleavage.
[0131] Specific examples of gene silencing in poppy have been reported using RNAi approaches. In 2008, Allen et al. reported suppression of the gene encoding the morphinan pathway enzyme salutaridinol 7-O-acetyltransferase (SalAT) in opium poppy. Hairpin RNA-mediated suppression of SalAT resulted in the accumulation of salutaridine to 23% of total alkaloids. As discussed above in the Description of Related Art, Allen et al. (2004) silenced codeinone reductase (COR) in opium poppy using a chimeric hairpin RNA construct designed to silence all members of the multigene COR family through RNAi.
[0132] Antisense suppression of gene expression does not involve the catalysis of mRNA degradation, but instead involves single-stranded RNA fragments binding to mRNA and blocking protein translation.
[0133] Both antisense and sense suppression are mediated by silencing RNAs (sRNAs) produced from either a sense-antisense hybrid or double stranded RNA (dsRNA) generated by an RNA-dependant RNA polymerase. Major classes of sRNAs include short-interfering RNAs (siRNAs) and microRNAs (miRNAs) which differ in their biosynthesis.
[0134] Processing of dsRNA precursors by Dicer-Like complexes yields 21-nucleotide siRNAs and miRNAs guide cleavage of target transcripts from within RNA-induced silencing complexes (RISC).
[0135] T6ODM and CODM expression may be suppressed using a synthetic gene(s) or an unrelated gene(s) that contain about 21 bp regions or longer of high homology (preferably 100% homology) to the endogenous coding sequences for T6ODM and CODM.
[0136] See, for example, Jorgensen R A, Doetsch N, Muller A, Que Q, Gendler, K and Napoli C A (2006) A paragenetic perspective on integration of RNA silencing into the epigenome and in the biology of higher plants. Cold Spring Harb. Symp. Quant. Biol. 71:481-485. For a further review, see for example, Ossowski S, Schwab R and Weigel D (2008) Gene silencing in plants using artificial microRNAs and other small RNAs. The Plant Journal 53:674-690.
[0137] Nucleic acid molecules that are substantially identical to portions of the endogenous coding sequences for CODM and T6ODM may also be used in the context of the disclosure. As used herein, one nucleic acid molecule may be substantially identical to another if the two molecules have at least 60%, at least 70%, at least 80%, at least 82.5%, at least 85%, at least 87.5%, at least 90%, at least 92.5%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity. Thus, a nucleic acid sequence comprising a nucleic acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 2 or SEQ ID NO: 4 may be suitable for use in the context of this disclosure. In one embodiment, the two nucleic acid molecules each comprise at least 20 identical contiguous nucleotides.
[0138] Fragments of nucleic acid sequences encoding CODM or T6ODM may be used. Such fragments may have lengths of at least 20, at least 50, at least 100, at least 150, at least 200, at least 300 or at least 400 contiguous nucleotides of a nucleic acid sequence encoding a CODM or T6ODM as the case may be. Alternatively such fragments may have a minimum length of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 contiguous nucleotides and a maximum length less than 3000, less than 2000, less than 1750, less than 1500, less than 1250, less than 1000, less than 750 or less than 500 contiguous nucleotides or any combination of such minimum and maximum lengths of a nucleic acid sequence encoding CODM or T6ODM as the case may be.
[0139] In one embodiment, a genetically modified opium poppy plant of the disclosure comprises, stably integrated into its genome a first nucleic acid molecule heterologous to the plant. The first nucleic acid molecule encodes an RNA, e.g. a hairpin RNA, for reducing expression of the CODM enzyme. The genetically modified opium poppy plant further comprises and a second nucleic acid molecule heterologous to the plant. The second nucleic acid molecule encodes an RNA, e.g. a hairpin RNA, for reducing expression of the T6ODM enzyme.
[0140] The first and second nucleic acid molecules may be present in a single genetic construct or in multiple constructs. In one embodiment, the first and/or second nucleic acid molecules may be arranged in the sense orientation relative to a promoter. In another embodiment, the first and/or second nucleic acid molecules may be arranged in the anti-sense orientation relative to a promoter. In a further embodiment, a genetic construct may comprise at least two nucleic acid molecules in both the sense and anti-sense orientations, relative to a promoter. A genetic construct comprising nucleic acids in both the sense and anti-sense orientations may result in mRNA transcripts capable of forming stem-loop (hairpin) structures.
[0141] One or both of the nucleic acid molecules may be under transcriptional control of the same promoter.
[0142] In various instances, the first and second heterologous nucleic acid molecules respectively comprise: [0143] at least 20, at least 50, at least 100, at least 150, at least 200, at least 300 or at least 400 contiguous nucleotides of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4; [0144] at least 20, at least 50, at least 100, at least 150, at least 200, at least 300 or at least 400 contiguous nucleotides of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2.
[0145] In various instances, the first and second nucleic acid molecules respectively comprise: [0146] a nucleic acid molecule with a minimum length of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 contiguous nucleotides and a maximum length less than 1750, less than 1500, less than 1250, less than 1000, less than 750 or less than 500 contiguous nucleotides or any combination of such minimum and maximum lengths of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:4; and a nucleic acid molecule with a minimum length of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 contiguous nucleotides and a maximum length less than 1750, less than 1500, less than 1250, less than 1000, less than 750 or less than 500 contiguous nucleotides or any combination of such minimum and maximum lengths of a nucleic acid sequence possessing at least 80%, at least 90% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2.
[0147] The skilled person will also appreciate that the reduction in activity of CODM and T6ODM may not be limited by the number of different nucleic acid molecules introduced into a plant or plant cell. In one embodiment, one nucleic acid molecule may target one or both endogenous genes encoding the enzymes. Accordingly, in another embodiment, a genetically modified opium poppy plant of the disclosure comprises, stably integrated into its genome a nucleic acid molecule heterologous to the plant. The nucleic acid molecule encodes a single transcript comprising an RNA (e.g., a hairpin RNA) for reducing expression of the CODM enzyme and an RNA (e.g. a hairpin RNA) for reducing expression of the T6ODM enzyme. In the working embodiment specifically exemplified in this disclosure, the nucleic acid molecule encodes a single transcript comprising a single hairpin RNA for reducing expression of both the CODM enzyme and the T6ODM enzyme.
[0148] In one aspect, a nucleic acid molecule may comprise a portion(s) of the coding sequence for CODM (SEQ ID NO: 4); T6ODM (SEQ ID NO: 2); an allelic variant thereof; a non-natural variant thereof; a fragment thereof; or any combination thereof.
[0149] In one embodiment, a fragment of the coding sequence for T6ODM (SEQ ID NO: 2) is suitable for the production of an expression construct coding for an RNAi hairpin that targets expression of the endogenous coding sequences of both CODM and T6ODM. In the working embodiment specifically exemplified in this disclosure, such fragment comprises SEQ ID NO: 7. In the working embodiment specifically exemplified in this disclosure, such expression construct comprises SEQ ID NO: 5. In the working embodiment specifically exemplified in this disclosure, the RNAi hairpin is encoded by a nucleic acid comprising SEQ ID NO: 6.
[0150] An expression construct comprising nucleic acids in both orientations relative to a promoter may further comprise a spacer to separate the nucleic acid molecules in sense orientation and those in the anti-sense orientation. As used herein, a spacer may comprise at least 2, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 75, at least 100, at least 150, or at least 200 nucleotides.
[0151] The skilled person will also readily understand that although in the foregoing illustrative examples partial CODM and T6ODM coding sequences were suggested for constructing the CODM and T6ODM constructs, complete CODM and T6ODM coding sequences, alternative CODM and/or T6ODM coding sequences, 5UTR and/or 3UTR, or mutated derivatives of these sequences can also be used. The maximum number of nucleic acid molecules that may be used in the context of the invention may be limited only by the maximum size of the construct that may be delivered to a target plant or plant cell using a given transformation method.
[0152] In various embodiments, genetically modified plants of the present disclosure may further comprise a third nucleic acid molecule heterologous to the plant. The third nucleic acid molecule is for increasing expression of Cyp80B3 to increase the total level of morphinans.
[0153] Expression of Transgenes Targeting the Endogenous CODM and T6ODM Polypeptides
[0154] In a further aspect, the disclosure relates to reducing CODM and/or T6ODM activity by targeting CODM and T6ODM at the protein level. For example, CODM (or T6ODM) activity may be reduced by affecting the post-translational modification of the enzyme; or by the introduction of a heterologous protein (e.g. a mutated form of CODM or (T6ODM) may be expressed such that it associates with the wildtype enzyme and alters its activity or outcompetes the wildtype enzyme for substrate without being able to convert the substrate; or an antibody that binds specifically to the CODM (or T6ODM) enzyme.
[0155] The skilled person would also appreciate that a nucleic acid molecule comprising the sequence of a CODM or T6ODM gene promoter and/or other regulatory elements may be used in the context of the invention. In an embodiment, a heterologous nucleic acid molecule comprising sequences of a CODM (or T6ODM as the case may be) gene promoter and/or regulatory element may be used to bias the cellular machinery away from an endogenous CODM (or T6ODM as the case may be) gene promoter thus resulting in reduced CODM (or T6ODM) expression.
[0156] The size or length of the nucleic acid construct or elements thereof, are not limited to the specific embodiments described herein. For example, the skilled person would appreciate that the size of a transgene element may be defined instead by transgene element function; and that the promoter element may be determined instead as one that was capable of driving transcription at a sufficient level and in the desired tissues. Similarly, the stem loop structure formed by the mRNA transcribed by a nucleic acid construct of the invention, may comprise a number of gene segments which may vary in length. For example, the stem loop may comprise 3 gene segments of about 21-30 basepairs each, in addition to a spacer, such as an intron (126 bp plus intron).
[0157] The skilled person would appreciate that the size of the gene segments may be established by the sum of the element sizes combined and may depend on the transformation method used to deliver the transgene into the target organism. For example, each transformation method (Agrobacterium, biolistics, VIGS-based delivery systems) may be limited to theoretical maximum transgene sizes.
[0158] Plant Transformation
[0159] The introduction of DNA into plant cells by Agrobacterium mediated transfer is well known to those skilled in the art. If, for example, the Ti or Ri plasmids are used for the transformation of the plant cell, at least the right border, although more often both the right and the left border of the T-DNA contained in the Ti or Ri plasmid must be linked to the genes to be inserted as flanking region. If agrobacteria are used for the transformation, the DNA to be integrated must be cloned into special plasmids and specifically either into an intermediate or a binary vector. The intermediate vectors may be integrated into the Ti or Ri plasmid of the agrobacteria by homologous recombination due to sequences, which are homologous to sequences in the T-DNA. This also contains the vir-region, which is required for T-DNA transfer. Intermediate vectors cannot replicate in agrobacteria. The intermediate vector can be transferred to Agrobacterium tumefaciens by means of a helper plasmid (conjugation). Binary vectors are able to replicate in E. coli as well as in agrobacteria. They contain a selection marker gene and a linker or polylinker framed by the right and left T-DNA border region. They can be transformed directly into agrobacteria. The agrobacterium acting as host cell should contain a plasmid carrying a vir-region. The vir-region is required for the transfer of the T-DNA into the plant cell. Additional T-DNA may be present. Such a transformed agrobacterium is used for the transformation of plant cells. The use of T-DNA for the transformation of plant cells has been intensively studied and has been adequately described in standard review articles and manuals on plant transformation. Plant explants cultivated for this purpose with Agrobacterium tumefaciens or Agrobacterium rhizogenes can be used for the transfer of DNA into the plant cell.
[0160] Agrobacterium transformation can be used to transform opium poppy plants (Chitty et al. (Meth. Molec. Biol, 344:383-391; Chitty et al. (Functional Plant Biol, 30: 1045-1058); Facchini et al. (Plant Cell Rep., 27(4):719-727)). Facchini et al. (2008) disclosed A. tumefaciens-mediated genetic transformation protocol via somatic embryogenesis for the production of fertile, herbicide-resistant opium poppy plants. Transformation was mediated using pCAMBIA3301, a transformation vector that harbors the phosphinothricin acetyltransferase (pat) gene driven by the cauliflower mosaic virus (CaMV) 35S promoter and the ?-glucuronidase (GUS) gene also driven by the CaMV 35S promoter. Explants were co-cultivated with A. tumefaciens in the presence of 50 1M ATP and 50 1M MgCl2. Root explants pre-cultured on callus induction medium were then used for transformation. Herbicide-resistant, proliferating callus was obtained from explants on a medium containing both 2,4-dichlorophenoxyacetic acid (2,4-D) and 6-benzyladenine (BA). Globular embryo genie callus was induced by removal of the BA from the medium, and placed on a hormone-free medium to form somatic embryos. The somatic embryos were converted to plantlets under specific culture conditions and transferred to soil. Plants were allowed to mature and set seed. PAT and GUS transcripts and enzyme activities were detected in the transgenic lines tested.
[0161] Nevertheless, the present invention is not limited to any particular method for transforming plant cells, and the skilled person will readily understand that any other suitable method of DNA transfer into plant may be used. Methods for introducing nucleic acids into cells (also referred to herein as transformation) are known in the art and include, but are not limited to: Viral methods (Clapp. Clin Perinatol, 20: 155-168, 1993; Lu et al. J Exp Med, 178: 2089-2096, 1993; Eglitis and Anderson. Biotechniques, 6: 608-614, 1988; Eglitis et al, Avd Exp Med Biol, 241: 19-27, 1988); physical methods such as microinjection (Capecchi. Cell, 22: 479-488, 1980), electroporation (Wong and Neumann. Biochim Biophys Res Commun, 107: 584-587, 1982; Fromm et al, Proc Natl Acad Sci USA, 82: 5824-5828, 1985; U.S. Pat. No. 5,384,253) and the gene gun (Johnston and Tang. Methods Cell Biol, 43: 353-365, 1994; Fynan et al. Proc Natl Acad Sci USA, 90: 11478-11482, 1993); chemical methods (Graham and van der Eb. Virology, 54: 536-539, 1973; Zatloukal et al. Ann NY Acad Sci, 660: 136-153, 1992); and receptor mediated methods (Curie) et al. Proc Natl Acad Sci USA, 88: 8850-8854, 1991; Curie! et al. Hum Gen Ther, 3: 147-154, 1992; Wagner et al. Proc Natl Acad Sci USA, 89: 6099-6103, 1992).
[0162] Another method for introducing DNA into plant cells is by biolistics. This method involves the bombardment of plant cells with microscopic particles (such as gold or tungsten particles) coated with DNA. The particles are rapidly accelerated, typically by gas or electrical discharge, through the cell wall and membranes, whereby the DNA is released into the cell and incorporated into the genome of the cell. This method is used for transformation of many crops, including corn, wheat, barley, rice, woody tree species and others. Biolistic bombardment has been proven effective in transfecting a wide variety of animal tissues as well as in both eukaryotic and prokaryotic microbes, mitochondria, and microbial and plant chloroplasts (Johnston. Nature, 346: 776-777, 1990; Klein et al. Bio/Technol, 10: 286-291, 1992; Pecorino and Lo. Curr Biol, 2: 30-32, 1992; Jiao et al, Bio/Technol, 11: 497-502, 1993).
[0163] Another method for introducing DNA into plant cells is by electroporation. This method involves a pulse of high voltage applied to protoplasts/cells/tissues resulting in transient pores in the plasma membrane which facilitates the uptake of foreign DNA. The foreign DNA enter through the holes into the cytoplasm and then to the nucleus.
[0164] Plant cells may be transformed by liposome mediated gene transfer. This method refers to the use of liposomes, circular lipid molecules with an aqueous interior, to deliver nucleic acids into cells. Liposomes encapsulate DNA fragments and then adhere to the cell membranes and fuse with them to transfer DNA fragments. Thus, the DNA enters the cell and then to the nucleus.
[0165] Other well-known methods for transforming plant cells which are consistent with the present invention include, but are not limited to, pollen transformation (See University of Toledo 1993 U.S. Pat. No. 5,177,010); Whiskers technology (See U.S. Pat. Nos. 5,464,765 and 5,302,523).
[0166] The nucleic acid constructs of the present invention may be introduced into plant protoplasts. Plant protoplasts are cells in which its cell wall is completely or partially removed using either mechanical or enzymatic means, and may be transformed with known methods including, calcium phosphate based precipitation, polyethylene glycol treatment and electroporation (see for example Potrykus et al., Mol. Gen. Genet., 199: 183, 1985; Marcotte et al., Nature, 335: 454, 1988). Polyethylene glycol (PEG) is a polymer of ethylene oxide. It is widely used as a polymeric gene carrier to induce DNA uptake into plant protoplasts. PEG may be used in combination with divalent cations to precipitate DNA and effect cellular uptake. Alternatively, PEG may be complexed with other polymers, such as poly(ethylene imine) and poly L lysine.
[0167] A nucleic acid molecule of the present invention may also be targeted into the genome of a plant cell by a number of methods including, but not limited to, targeting recombination, homologous recombination and site-specific recombination (see review Baszcynski et al. Transgenic Plants, 157: 157-178, 2003 for review of site-specific recombination systems in plants). Homologous recombination and gene targeting in plants (reviewed in Reiss. International Review of Cytology, 228: 85-139, 2003) and mammalian cells (reviewed in Sorrell and Kolb. Biotechnology Advances, 23: 431-469, 2005) are known in the art.
[0168] As used herein, targeted recombination refers to integration of a nucleic acid construct into a site on the genome, where the integration is facilitated by a construct comprising sequences corresponding to the site of integration.
[0169] Homologous recombination relies on sequence identity between a piece of DNA that is introduced into a cell and the cell's genome. Homologous recombination is an extremely rare event in higher eukaryotes. However, the frequency of homologous recombination may be increased with strategies involving the introduction of DNA double-strand breaks, triplex forming oligonucleotides or adeno-associated virus.
[0170] As used herein, site-specific recombination refers to the enzymatic recombination that occurs when at least two discrete DNA sequences interact to combine into a single nucleic acid sequence in the presence of the enzyme. Site-specific recombination relies on enzymes such as recombinases, transposases and integrases, which catalyse DNA strand exchange between DNA molecules that have only limited sequence homology. Mechanisms of site specific recombination are known in the art (reviewed in Grindley et al. Annu Rev Biochem, 75: 567-605, 2006). The recognition sites of site-specific recombinases (for example Cre and att sites) are usually 30-50 bp. The pairs of sites between which the recombination occurs are usually identical, but there are exceptions e.g. attP and attB of ? integrase (Landy. Ann Rev Biochem, 58: 913-949, 1989).
[0171] Additional methods might be selected from the resent years of development of methods and compositions to target and cleave genomic DNA by site specific nucleases e.g. Zinc Finger Nucleases, ZFNs, Meganucleases, Transcription Activator-Like Effector Nucleases, TALENS and Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRISPR/Cas) with an engineered crRNA/tracr RNA), to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination of an exogenous donor DNA polynucleotide within a predetermined genomic locus. Current methods for targeted insertion of exogenous DNA typically involve co-transformation of plant tissue with a donor DNA polynucleotide containing at least one transgene and a site specific nuclease, e.g., ZFN, which is designed to bind and cleave a specific genomic locus of an actively transcribed coding sequence. This causes the donor DNA polynucleotide to stably insert within the cleaved genomic locus resulting in targeted gene addition at a specified genomic locus comprising an actively transcribed coding sequence.
[0172] As used herein the term zinc fingers, defines regions of amino acid sequence within a DNA binding protein binding domain whose structure is stabilized through coordination of a zinc ion.
[0173] A zinc finger DNA binding protein (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be engineered to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for engineering zinc finger proteins are design and selection. A designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. (U.S. Pat. No. 6,453,242; see also WO 98/53058).
[0174] A TALE DNA binding domain or TALE is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence. A single repeat unit, also referred to as a repeat, is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. (U.S. Patent Publication No. 2011/0301073).
[0175] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR Associated) nuclease system. Briefly, a CRISPR DNA binding domain is a short stranded RNA molecule that acting in concert with the CAS enzyme can selectively recognize, bind, and cleave genomic DNA. The CRISPR/Cas system can be engineered to create a double-stranded break (DSB) at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair. (Jinek et al (2012) Science 337, p. 816-821).
[0176] Zinc finger, CRISPR and TALE binding domains can be engineered to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger. Similarly, TALEs can be engineered to bind to a predetermined nucleotide sequence, for example by engineering of the amino acids involved in DNA binding (the repeat variable diresidue or RVD region). Therefore, engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non-naturally occurring. Non-limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and/or TALE designs and binding data. (U.S. Pat. No. 6,453,242; see also WO 98/53058; and U.S. Publication Nos. 2011/0301073).
[0177] A selected zinc finger protein, CRISPR or TALE is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection.
[0178] In one embodiment, the polynucleotide encodes a zinc finger protein that binds to a gene encoding a T6ODM or a CODM polypeptide, resulting in reduced expression of the gene. In particular embodiments, the zinc finger protein binds to a regulatory region of a gene encoding T6ODM or CODM. In other embodiments, the zinc finger protein binds to a messenger RNA encoding a T6ODM or a CODM polypeptide and prevents its translation. Methods of selecting sites for targeting by zinc finger proteins have been described, for example, in U.S. Pat. No. 6,453,242, and methods for using zinc finger proteins to inhibit the expression of genes in plants are described, for example, in US2003/0037355, each of which is herein incorporated by reference. Methods of selecting sites for targeting by TALE proteins have been described in e.g. Moscou M J, Bogdanove A J, 2009, A simple cipher governs DNA recognition by TAL effectors. Science 326:1501.
[0179] The nucleic acid molecule becomes stably integrated into the plant genome such that it is heritable to daughter cells in order that successive generations of plant cells have reduced CODM and T6ODM expression. This may involve the nucleic acid molecules of the present invention integrating, for instance integrating randomly, into the plant cell genome. Alternatively, the nucleic acid molecules of the present invention may remain as exogenous, self-replicating DNA that is heritable to daughter cells. As used herein, exogenous, self-replicating DNA that is heritable to daughter cells is also considered to be stably integrated into the plant genome.
[0180] Testing for Reduction of CODM and T6ODM Activity or Expression
[0181] Disruption of endogenous genes encoding CODM and T6ODM, their expression, or CODM and T6ODM enzymatic activity may be confirmed by methods known in the art of molecular biology. For example, disruption of endogenous genes may be assessed by PCR followed by Southern blot analysis. CODM and T6ODM mRNA levels may, for example, be measured by real time PCR, RT-PCR, Northern blot analysis, micro-array gene analysis, and RNAse protection. CODM and T6ODM protein levels may, without limitation, be measured by enzyme activity assays, ELISA and Western blot analysis. CODM and T6ODM expression, or lack thereof, may be used as a predictor of increased thebaine accumulation. CODM and/or T6ODM enzymatic activity may be assessed biochemically or functionally.
[0182] For example, CODM (and/or T6ODM) activity may be measured biochemically by methods known in the art including, but not limited to, the detection of products formed by the enzyme in the presence of any number of heterologous substrates, for example, thebaine. CODM (and/or T6ODM) activity may also be measured functionally, for example, by assessing thebaine levels in the poppy tissues.
[0183] A genetically modified opium poppy plant of the present disclosure may result in the reduction of CODM and/or T6ODM activity in said plant or its seed, seedling, straw, capsules, or progeny thereof, by at least 57%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% relative to a wild type seed, seedling, straw, capsules, or progeny thereof.
[0184] Targeted Screening for Loss of Function Mutations in CODM and/or T6ODM.
[0185] This disclosure further relates to methods of generating opium poppy plants with high levels of thebaine that involve targeted screening for loss of function mutations in the endogenous genes encoding CODM and/or T6ODM and subsequent breeding of plants to combine the mutations to obtain plants homozygous for the loss of function mutations at both loci. Opium poppy breeders have used a variety of selection techniques in the development of improved cultivars. However, the most successful breeding method involving the hybridization of parents with a variety of different desired characteristics. Such approach has been used successfully to increase capsule numbers, seed and opium yield, morphine content, and lodging resistance.
[0186] The term T-DNA insertion refers to methods utilizing transfer-DNA (T-DNA) for disrupting genes via insertional mutagenesis. Down-regulating or silencing expression of the endogenous gene(s) encoding CODM and/or T6ODM in an opium poppy plant can thus be achieved by T-DNA mutagenesis, wherein the T-DNA is used to randomly inserting in the plant genome to introduce mutations. Subsequently, plants can be screen for T-DNA insertions in the genes encoding CODM and/or T6ODM by PCR, using a primer pair comprising one primer specific for the T-DNA and one primer specific for the gene encoding CODM (or T6ODM as the case may be), or other high-throughput technologies. For a review of T-DNA as an insertional mutagen, see e.g. Krysan, P. J. et al. (1999) Plant Cell, 11: 2283-2290. Insertional mutagenesis using transposons could also be employed.
[0187] Mutations (including deletions, insertions, and point mutations) can also be introduced randomly into the genome of a plant cell by various forms of mutagenesis to produce non-natural variants. Methods for mutagenesis of plant materials, including seeds, and subsequent screening or selection for desired phenotypes are well known, as described in WO2009109012. Mutagenized plants and plant cells can also be specifically screened for mutations in the genes encoding CODM and/or T6ODM, for example, by TILLING (Targeting Induced Local Lesions IN Genomes). Loss of function mutations present in natural plant populations can be identified by EcoTILLING.
[0188] Once the loss of function mutations in the endogenous genes encoding CODM and T6ODM have been identified, they can be combined through traditional breeding processes to produce plants homozygous for the loss of function mutations at both loci. Alternatively, a loss of function mutation identified in the endogenous gene encoding CODM can be combined with mutations in the endogenous gene encoding T6ODM that are introduced by genetic modification, and vice versa. Alternatively, a loss of function mutation identified in the endogenous gene encoding CODM can be combined with genetic modification comprising an expression construct designed to reduce expression of T6ODM as described above, and vice versa.
[0189] Alkaloid Collection and Analysis
[0190] Opium poppy cultivation and opium harvesting traditionally involved the processes of manually lancing the seed capsule and collecting the latex. However, methods to extract morphine and related compounds from opium poppy straw circumvented the traditional technique and makes it possible to obtain high quality seeds and pharmaceutically valuable raw materials simultaneously. Recovering thebaine from poppy straw or latex of an opium poppy plant is well known in the art as discussed in WO2009109012. IN addition to the particular methods described below, methods of analyzing alkaloid extracts from opium poppy straw or latex are also discussed in WO2009109012.
Examples
[0191] Referring to
[0192] Referring to
[0193] The sequence of the nucleic acid molecule to be transcribed to produce a hairpin RNA is provided as SEQ ID NO: 6. The T6ODM sequences are underlined, whereas the intervening hairpin sequence between the T6ODM sequences is derived from coding sequences for ?-glucuronidase.
[0194] The complete expression construct comprising SEQ ID NO: 6 along with the Cauliflower Mosaic Virus 35S promoter and transcription and translation termination sequences from octopine synthase was cloned into a TDNA transfer vector. The sequences between the left and right boarders of the vector are provided as provided as SEQ ID NO: 5. The sequence 5 to the first underlined region (i.e. the sense T6ODM-specific sequence) comprises the 35S promoter sequence, whereas the sequences 3 to the second underlined region (i.e. the antisense T6ODM-specific sequence) comprises the transcription and translation termination sequences from octopine synthase.
[0195] While this expression construct was generated using a combination of traditional polymerase chain reaction (PCR) and cloning techniques (e.g. with restriction enzymes and ligations), the skilled person will understand that various conventional techniques could be used to produce the construct, including overlap extension PCR cloning or direct synthesis.
[0196] The sequence of the entire T-DNA comprising SEQ ID NO:6, from Right Border to Left Border, is provided as SEQ ID NO: 4.
[0197] Virus-induced gene silencing (VIGS) was used to transiently test the ability of the gene cassette to silence the endogenous genes encoding T6ODM and CODM. VIGS is a plant RNA-silencing technique that uses viral vectors carrying a fragment of a gene of interest to generate double-stranded RNA, which initiates the silencing of the target gene. pTRV1 (helper plasmid) and pTRV2 (binary vector) TRV-based VIGS vectors to express the expression construct. Tissues were taken in 48 hrs, 72 hrs, 5 day, 7 days, and 2 weeks after infiltration. As indicated in
[0198] T6ODM at 48 h post transformation (first bar from the right in both
[0199] Plants stably transformed with the expression construct were then generated according to the following protocol.
Transformation Protocol
Transformation of Poppy Hypocotyls/Roots
[0200] Media Required:
[0201] LB
[0202] Agrobacterium Suspension Medium
[0203] B5 salts and vitamins containing 20 g/l sucrose, pH 5.6 5.8?0.2.
[0204] Shoot Germination Medium
[0205] Half strength Murashige and Skoog basal medium supplemented with 20 g/l sucrose, 8 g/l agar. pH 5.8?0.2.
[0206] Primary Callus Induction Medium
[0207] B5 medium containing 30 g/l sucrose, 2.0 mg/l NAA, and 0.1 mg/l BAP, 8 g/l agar.
[0208] Somatic Embryo Induction Medium
[0209] B5 medium containing 1.0 mg/l NAA, 0.5 mg/l BAP, 50 mg/l paromomycin, 300 mg/l timentin and 8 g/l agar.
[0210] Embryo Induction Medium
[0211] Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 1 mg/l 2,4-D, 2.5 mg/l AgNO.sub.3, 8 g/l agar. pH 5.6?0.2. (Plus antibioticTimentin 300 mg/l)
[0212] Embryo Maturation and Germination
[0213] Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 1 mg/l Benzyl adenine, 1 mg/l Zeatin, 2.5 mg/l AgNO.sub.3, 8 g/l agar. pH 5.6?0.2. (Plus antibioticTimentin 300 mg/l)
[0214] Phytohormone-Free Plant Regeneration Medium
[0215] B5 medium containing 50 mg/L paromomycin, 300 mg/L timentin, and 8 g/L agar
[0216] Shoot Elongation Medium
[0217] Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 0.5 mg/l Benzyl adenine, 2.5 mg/l AgNO.sub.3, 8 g/l agar. pH 5.6?0.2. (Plus antibioticTimentin 300 mg/l)
[0218] Rooting Medium
[0219] Murashige and Skoog basal medium supplemented with 30 g/l sucrose, 0.25 g/l MES, 0.2 g/l myo-inositol, 2.5 mg/l AgNO.sub.3, 8 g/l agar. pH 5.6?0.2. (Plus antibiotic Timentin 300 mg/l)
[0220] Seed Sterilization and Germination
[0221] The seeds were surface-sterilized with 70% (vv-.sup.1) ethanol for 30 s and 1% (vv-.sup.1) sodium hypochlorite solution for 2 min each three times, then rinsed five times in sterile water. Approximately 50 seeds were placed on 25 ml of agar-solidified culture medium in jars. The basal medium consisted of ? Murashige and Skoog basal medium supplemented with 30 g/l sucrose (Gamborg et al. 1968) and solidified with 0.8% (wv-.sup.1) agar. The medium was adjusted to pH 5.6-5.8 before adding the agar, and then sterilized by autoclaving. The seeds were germinated in a growth chamber at 25? C. under standard cool white fluorescent tubes and a 16-h photoperiod.
[0222] Preparation of Agrobacterium tumefaciens
[0223] The binary vector pORE::ALM-MIRMAC was mobilized by electroporation in Agrobacterium tumefaciens strain EHA105. A. tumefaciens cultures were grown at 28? C. on a gyratory shaker at 180 rpm in liquid Luria-Bertani medium [1% tryptone, 0.5% yeast extract, and 1% NaCl, pH 7.0] containing 50 mg/l kanamycin and rifampicin 100 mg/l, to A.sub.600=0.8. The bacterial cells were collected by centrifugation for 10 min at 4000 rpm and resuspended at a cell density of A.sub.600=0.5 in liquid inoculation medium (B5 salts and vitamins containing 20 g/l sucrose).
[0224] Production of Transgenic Plants
[0225] Excised cotyledons from 12-day-old seedlings, line 118, were isolated by longitudinal bisection of the hypocotyl. The hypocotyls were dipped into the A. tumefaciens culture in liquid inoculation medium for 15 min, blotted dry on sterile filter paper, and incubated in the dark at 25? C. on primary callus induction medium. After 2 days of co-cultivation with A. tumefaciens, the hypocotyls were transferred to fresh primary callus induction medium containing 50 mg/L paromomycin and 300 mg/L timentin. After 4-5 weeks of incubation, primary calli were subcultured on somatic embryo induction medium. After 3 weeks of cultivation on induction medium, somatic embryos were transferred to phytohormone-free plant regeneration medium. Mature embryos were placed on phytohormone-free medium and immature embryos were transferred to embryo maturation and germination medium. Then, when first cotyledons appeared they were transplanted onto shoot elongation medium. Finally, when shoots were about 0.5-1 cm, they were placed on rooting medium. Regenerated putative transgenic plantlets were grown in a growth chamber at 25? C. under standard cool-white conditions and a 16-h photoperiod. Rooted plantlets were then transferred to pots containing autoclaved soil, covered with polyethylene bags for 1 week to sustain high humidity, and maintained in the growth chamber at 25? C. for 1-2 weeks before the plants were transferred to the greenhouse.
[0226] Method: [0227] 1. Pick a single colony of the desired construct in Agrobacterium and inoculate it in 2 ml LB liquid medium containing appropriate antibiotics; culture overnight at 28? C. to prepare a starter culture. [0228] 2. Inoculate 100 ml LB liquid medium containing appropriate antibiotics with the starter culture and incubate overnight at 28? C. Incubate cells until a desired OD.sub.600=0.5-0.8 is attained. [0229] 3. Pellet the cells by centrifugation at 4000 rpm for 10 mins. [0230] 4. Resuspend the cells in Agrobacterium suspension medium to a final OD.sub.600=0.5. [0231] 5. Roots and hypocotyl segments from 12 day old seedlings were cut into ?5 mm segments while dipping in the Agrobacterium suspension. [0232] 6. Incubate the roots and hypocotyl segments on Petri dish for 15 mins in the Agrobacterium suspension with occasional swirling. [0233] 7. Blot dry the roots and hypocotyl segments on a sterile filter paper and transfer to plates containing primary callus induction medium. Incubate the plates for 2 days at 22?2? C. in a growth cabinet under dark (covered with aluminium foil). [0234] 8. After 2 days of co-cultivation, wash the root and hypocotyl segments with sterile distilled water, blot dry on a sterile filter paper and transfer to plates containing primary callus induction medium (antibiotic paromomycin was added). [0235] 9. Incubate the plates in growth chamber at standard conditions (16/8 h photoperiod) in dark (covered with aluminium foil) for approximately 4-5 weeks. [0236] 10. After 4-5 weeks of incubation, primary calli were subcultured on somatic embryo induction medium (antibiotic paromomycin was added). [0237] 11. After 3 weeks of cultivation on induction medium, mature somatic embryos were transferred to phytohormone free medium (no antibiotic). Immature embryos were placed to another round of selection on embryo maturation and germination medium (no antibiotic) and incubated at 22?2? C. in a growth cabinet under 16/8 h photoperiod until embryos matured and started germinating. [0238] 12. Transfer the germinating embryos to plates containing shoot elongation medium until shoots appear and subsequently transfer to rooting medium. [0239] 13. Transfer ?0.5-1.0 cm shoots to rooting medium. [0240] 14. Rooted plantlets are washed under tap water to remove the entire adhering agar and then are transferred to sterile soil in small pots, covered with saran wrap and incubated in a growth cabinet for acclimatization. [0241] 15. Obtained putative transformants are analysed for transgene presence and expression.
[0242] Notes:no antibiotic in rooting media.
[0243] Chemicals [0244] 1. 50 mg/ml Paromomycin sulfate stock: Prepare by dissolving powder in water and sterilize by filtration, aliquot, and store at ?20 C. [0245] 2. 50 mg/ml Kanamycin stock: Prepare by dissolving powder in water and sterilize by filtration, aliquot, and store at ?20 C. [0246] 3. 100 mg/ml Rifampicin stock: Prepare by dissolving powder in DMSO, aliquot, and store at ?20 C. [0247] 4. 300 mg/ml Timentin stock: Prepare by dissolving powder in water and sterilize by filtration, aliquot, and store at ?20 C. [0248] 5. 2.0 mg/ml NAA stock: Prepare by dissolving powder in 1N NaOH, adjust volume with water and sterilize by filtration, aliquot, and store at ?20 C. [0249] 6. 2.0 mg/ml BAP stock: Prepare by dissolving powder in 1N NaOH, adjust volume with water and sterilize by filtration, aliquot, and store at ?20 C. [0250] 7. 5 mg/ml AgNO3 stock: Prepare by dissolving powder in water and sterilize by filtration, and store at +4 C. [0251] 8. 1.0 mg/ml Zeatin stock: Prepare by dissolving powder in 1N NaOH, adjust volume with water and sterilize by filtration, aliquot, and store at ?20 C. [0252] 9. All the chemicals used for media are added to autoclaved medium once it has cooled to about 50 C. Swirl to mix thoroughly the medium before pouring into 90?25-mm Petri dishes.
[0253] Characterization of Regenerated Transgenic Plants
[0254] The T-DNA comprising the expression construct included the nptll gene, which confers resistance to paromycin. Six plantlets (AM1 to AM6) were identified as resistant to paromomycin, suggesting that these plants were transformed with the expression construct. Polymerase chain reaction on genomic DNA isolated from these plantlets using primers specific for the hairpin expression construct (SEQ ID NO: 9, TAACCGACTTGCTGCCCCGA; SEQ ID NO: 10, AAATAGAGATGCTTGCAGAAGATCCCG) showed that plants AM1, AM2 and AM3 contain amplicon from genomic DNA. Primers for actin (SEQ ID NO: 11, CGTTTGAATCTTGCTGGCCGTGAT; SEQ ID NO: 12, TAGACGAGCTGCCTTTGGAAGTGT) were used as a positive control to confirm that the samples contained genomic DNA from Papaver somniferum.
[0255] Referring to
[0256] RT-PCR was performed on the RNA extracts from plants AM1 to AM6 using primers specific for endogenous transcripts encoding CODM and T6ODM. Referring to
[0257] Alkaloid Analysis
[0258] Acidic extraction: 0.100 g of ground capsule or stems (from poppy) was mixed with 5 ml of a solution of 10% acetic acid, 10% water and 80% methanol followed by agitation for 30 minutes, and then filtered. The filtrate was directly injected into the HPLC.
[0259] All samples were run on an HPLC Gradient System having an Kinetex 2.6 um C18, 50?2.1 mm column, with a 2 microliter injection volume, operating at 280 nm at a temperature of 45? C. and a flow rate of 0.8 ml/min. Eluent A was 10 mM Ammonium acetate Buffer, pH 5.5, whereas Eluent B was Acetonitrile (100%). The gradient profile is as follows
TABLE-US-00001 Step No. Time (min) Pct A Pct B 1 0 95 5 2 0.25 85 15 3 2.00 60 40 4 2.01 95 5 5 3.00 20 80 6 4.00 10 90 7 5.00 0 100
[0260] The reported figures are percent by weight of the dry starting material.
[0261] Referring to
TABLE-US-00002 TABLE 1 Concentration of alkaloids in transgenic plants per 100 mg dry capsule. Codeine Thebaine (Conc. wt %) (Conc. wt %) AM1 0.23 3.87 AM2 0.11 4.82 AM3 0.12 3.13
[0262] The progeny of the self-fertilized AM1, AM2, and AM3 transformants appear to segregate 3:1, indicating that the transgenes are stably integrated and inherited.
[0263] Six additional individual transformants that carry the expression construct, and in which the endogenous CODM and T6ODM transcripts could not be detected, were isolated (AM12, AM13, AM16, AM17, and AM19). Analysis in the capsules of these additional plants showed that thebaine accumulated to as much as 8.28% of alkaloids in the capsules (see Table 2).
TABLE-US-00003 TABLE 2 Concentration of thebaine in transgenic plants per 100 mg dry capsule. Thebaine (Conc. wt %) AM12 5.87 AM13 6.20 AM16 8.28 AM17 7.18 AM19 4.95
[0264] Plants were grown from progeny seed of AM1 that contained the expression construct. The concentration of morphine, oripavine, codeine, and morphine in poppy straw from six AM1 progeny carrying the expression construct are provided in Table 3.
TABLE-US-00004 TABLE 3 Concentration of thebaine, codeine, oripavine, and morphine in poppy straw of progeny of AM1. Amount of Each Component (% w/w) Individual Morphine Oripavine Codeine Thebaine AM1-1 0.07 0.01 0.09 4.94 AM1-13 0.05 0.20 0.10 4.46 AM1-28 0.10 0.01 0.08 3.69 AM1-30 0.07 0.02 0.14 6.68 AM1-38 0.05 0.01 0.07 3.20 AM1-82 0.06 0.03 0.13 5.31
[0265] Operation
[0266] While specific embodiments of the invention have been described and illustrated, such embodiments should be considered illustrative of the invention only and not as limiting the invention as construed in accordance with the accompanying claims.
[0267] This description contains a sequence listing in electronic form in ASCII text format. The sequences in the sequence listing are reproduced in the following Table.
TABLE-US-00005 Sequence Table SEQ ID NO: 1 (T6ODM) Met Glu Lys Ala Lys Leu Met Lys Leu Gly Asn Gly Met Glu Ile Pro 151015 Ser Val Gln Glu Leu Ala Lys Leu Thr Leu Ala Glu Ile Pro Ser Arg 202530 Tyr Val Cys Ala Asn Glu Asn Leu Leu Leu Pro Met Gly Ala Ser Val 354045 Ile Asn Asp His Glu Thr Ile Pro Val Ile Asp Ile Glu Asn Leu Leu 505560 Ser Pro Glu Pro Ile Ile Gly Lys Leu Glu Leu Asp Arg Leu His Phe 65707580 Ala Cys Lys Glu Trp Gly Phe Phe Gln Val Val Asn His Gly Val Asp 859095 Ala Ser Leu Val Asp Ser Val Lys Ser Glu Ile Gln Gly Phe Phe Asn 100105110 Leu Ser Met Asp Glu Lys Thr Lys Tyr Glu Gln Glu Asp Gly Asp Val 115120125 Glu Gly Phe Gly Gln Gly Phe Ile Glu Ser Glu Asp Gln Thr Leu Asp 130135140 Trp Ala Asp Ile Phe Met Met Phe Thr Leu Pro Leu His Leu Arg Lys 145150155160 Pro His Leu Phe Ser Lys Leu Pro Val Pro Leu Arg Glu Thr Ile Glu 165170175 Ser Tyr Ser Ser Glu Met Lys Lys Leu Ser Met Val Leu Phe Asn Lys 180185190 Met Glu Lys Ala Leu Gln Val Gln Ala Ala Glu Ile Lys Gly Met Ser 195200205 Glu Val Phe Ile Asp Gly Thr Gln Ala Met Arg Met Asn Tyr Tyr Pro 210215220 Pro Cys Pro Gln Pro Asn Leu Ala Ile Gly Leu Thr Ser His Ser Asp 225230235240 Phe Gly Gly Leu Thr Ile Leu Leu Gln Ile Asn Glu Val Glu Gly Leu 245250255 Gln Ile Lys Arg Glu Gly Thr Trp Ile Ser Val Lys Pro Leu Pro Asn 260265270 Ala Phe Val Val Asn Val Gly Asp Ile Leu Glu Ile Met Thr Asn Gly 275280285 Ile Tyr His Ser Val Asp His Arg Ala Val Val Asn Ser Thr Asn Glu 290295300 Arg Leu Ser Ile Ala Thr Phe His Asp Pro Ser Leu Glu Ser Val Ile 305310315320 Gly Pro Ile Ser Ser Leu Ile Thr Pro Glu Thr Pro Ala Leu Phe Lys 325330335 Ser Gly Ser Thr Tyr Gly Asp Leu Val Glu Glu Cys Lys Thr Arg Lys 340345350 Leu Asp Gly Lys Ser Phe Leu Asp Ser Met Arg Ile 355360 SEQ ID NO: 2 (T6ODM) gttcttaatt cattaattaa tttagaaaaa tcatggagaa agcaaaactt atgaagctag 60 gtaatggtat ggaaatacca agtgttcaag aattggctaa actcacgctt gccgaaattc 120 catctcgata cgtatgcgcc aatgaaaacc ttttgttgcc tatgggtgca tctgtcataa 180 atgatcatga aaccattcct gtcatcgata tagaaaattt attatctcca gaaccaataa 240 tcggaaagtt agaattagat aggcttcatt ttgcttgcaa agaatggggt ttttttcagg 300 tagtgaacca tggagtcgac gcttcattgg tggatagtgt aaaatcagaa attcaaggtt 360 tctttaacct ttctatggat gagaaaacta aatatgaaca ggaagatgga gatgtggaag 420 gatttggaca aggctttatt gaatcagagg accaaacact tgattgggca gatatattta 480 tgatgttcac tcttccactc catttaagga agcctcactt attttcaaaa ctcccagtgc 540 ctctcaggga gacaatcgaa tcctactcat cagaaatgaa aaagttatcc atggttctct 600 ttaataagat ggaaaaagct ctacaagtac aagcagccga gattaagggt atgtcagagg 660 tgtttataga tgggacacaa gcaatgagga tgaactatta tcccccttgt cctcaaccaa 720 atctcgccat cggtcttacg tcgcactcgg attttggcgg tttgacaatc ctccttcaaa 780 tcaacgaagt ggaaggatta cagataaaaa gagaggggac atggatttca gtcaaacctc 840 tacctaatgc gttcgtagtg aatgttggag atattttgga gataatgact aatggaattt 900 accatagtgt cgatcaccgg gcagtagtaa actcaacaaa tgagaggctc tcaatcgcaa 960 catttcatga ccctagtcta gagtcggtaa taggcccaat atcaagcttg attactccag 1020 agacacctgc tttgtttaaa agtggatcta catatgggga tcttgtggag gaatgtaaaa 1080 caaggaagct cgatggaaaa tcatttcttg actccatgag gatttgaaaa ctcaagaaaa 1140 aataatacga cgtgattgca tgtcagattc aactatcctt ttgtcgtttt ttggtgctcg 1200 agtccttaat tgttttgatc attgcttttg attctaatta ataagacttt tctcaagaac 1260 cacatgtaat gtacctttac tttcagaaaa taaaaagtat tgaggcacaa atgagaaaat 1320 tgagagagtg cttgagaagt gtaatttctc gaaagtgcgt tgtgtttgaa aaaaaaaaaa 1380 aaaaaa 1386 SEQ ID NO: 3 (CODM) Met Glu Thr Pro Ile Leu Ile Lys Leu Gly Asn Gly Leu Ser Ile Pro 151015 Ser Val Gln Glu Leu Ala Lys Leu Thr Leu Ala Glu Ile Pro Ser Arg 202530 Tyr Thr Cys Thr Gly Glu Ser Pro Leu Asn Asn Ile Gly Ala Ser Val 354045 Thr Asp Asp Glu Thr Val Pro Val Ile Asp Leu Gln Asn Leu Leu Ser 505560 Pro Glu Pro Val Val Gly Lys Leu Glu Leu Asp Lys Leu His Ser Ala 65707580 Cys Lys Glu Trp Gly Phe Phe Gln Leu Val Asn His Gly Val Asp Ala 859095 Leu Leu Met Asp Asn Ile Lys Ser Glu Ile Lys Gly Phe Phe Asn Leu 100105110 Pro Met Asn Glu Lys Thr Lys Tyr Gly Gln Gln Asp Gly Asp Phe Glu 115120125 Gly Phe Gly Gln Pro Tyr Ile Glu Ser Glu Asp Gln Arg Leu Asp Trp 130135140 Thr Glu Val Phe Ser Met Leu Ser Leu Pro Leu His Leu Arg Lys Pro 145150155160 His Leu Phe Pro Glu Leu Pro Leu Pro Phe Arg Glu Thr Leu Glu Ser 165170175 Tyr Leu Ser Lys Met Lys Lys Leu Ser Thr Val Val Phe Glu Met Leu 180185190 Glu Lys Ser Leu Gln Leu Val Glu Ile Lys Gly Met Thr Asp Leu Phe 195200205 Glu Asp Gly Leu Gln Thr Met Arg Met Asn Tyr Tyr Pro Pro Cys Pro 210215220 Arg Pro Glu Leu Val Leu Gly Leu Thr Ser His Ser Asp Phe Ser Gly 225230235240 Leu Thr Ile Leu Leu Gln Leu Asn Glu Val Glu Gly Leu Gln Ile Arg 245250255 Lys Glu Glu Arg Trp Ile Ser Ile Lys Pro Leu Pro Asp Ala Phe Ile 260265270 Val Asn Val Gly Asp Ile Leu Glu Ile Met Thr Asn Gly Ile Tyr Arg 275280285 Ser Val Glu His Arg Ala Val Val Asn Ser Thr Lys Glu Arg Leu Ser 290295300 Ile Ala Thr Phe His Asp Ser Lys Leu Glu Ser Glu Ile Gly Pro Ile 305310315320 Ser Ser Leu Val Thr Pro Glu Thr Pro Ala Leu Phe Lys Arg Gly Arg 325330335 Tyr Glu Asp Ile Leu Lys Glu Asn Leu Ser Arg Lys Leu Asp Gly Lys 340345350 Ser Phe Leu Asp Tyr Met Arg Met 355360 SEQ ID NO: 4 (CODM) gtaaagattg atatatgatc tgaagatctg acaagaaagt tcatcaaata tagagttcat 60 ggagacacca atacttatca agctaggcaa tggtttgtca ataccaagtg ttcaggaatt 120 ggctaaactc acgcttgcag aaattccatc tcgatacaca tgcaccggtg aaagcccgtt 180 gaataatatt ggtgcgtctg taacagatga tgaaacagtt cctgtcatcg atttgcaaaa 240 tttactatct ccagaacccg tagttggaaa gttagaattg gataagcttc attctgcttg 300 caaagaatgg ggtttctttc agctggttaa ccatggagtc gacgctttac tgatggacaa 360 tataaaatca gaaattaaag gtttctttaa ccttccaatg aatgagaaaa ctaaatacgg 420 acagcaagat ggagattttg aaggatttgg acaaccctat attgaatcgg aggaccaaag 480 acttgattgg actgaagtgt ttagcatgtt aagtcttcct ctccatttaa ggaagcctca 540 tttgtttcca gaactccctc tgcctttcag ggagacactg gaatcctacc tatcaaaaat 600 gaaaaaacta tcaacggttg tctttgagat gttggaaaaa tctctacaat tagttgagat 660 taaaggtatg acagacttat ttgaagatgg gttgcaaaca atgaggatga actattatcc 720 tccttgtcct cgaccagagc ttgtacttgg tcttacgtca cactcggatt ttagcggttt 780 gacaattctc cttcaactta atgaagttga aggattacaa ataagaaaag aagagaggtg 840 gatttcaatc aaacctctac ctgatgcgtt catagtgaat gttggagaca ttttggagat 900 aatgactaat gggatttacc gtagcgtcga gcaccgggca gtagtaaact caacaaagga 960 gaggctctca atcgcgacat ttcatgactc taaactagag tcagaaatag gcccaatttc 1020 gagcttggtc acaccagaga cacctgcttt gttcaaaaga ggtaggtatg aggatatttt 1080 gaaggaaaat ctttcaagga agcttgatgg aaaatcattt ctcgactaca tgaggatgtg 1140 agaaagtgtg aacatatatt atactccaca ttgtgtttaa tatatgatga aataagttgc 1200 ttttgaagta tgatgaaata agttggtttt gaagaattca tattgtgctt aaatttcgtg 1260 gatgactgag agatttatta tgtaataata atgtattggt ttgaagattc tcgtctcact 1320 atatgtaaga ctctgtttgg gtcaagtgat gtaatcacgg ttgaaataag ttgcttttga 1380 agaattcata tggtgcttaa tattatgtaa taaataatgt attggattga aaaaaaaaaa 1440 aaaaaaaaaa aa 1452 SEQ ID NO: 5 tcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattct aataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcggga aacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcggaaagcttgctagccaatt ggggcccaacgttctcgagaacgtggatacttggcagtggttacttggcttttcctttattttcttttggacggaa gcggtggttactttgtcacacatttaaaaaaacacgtgtttctcacttttttctattcccgtcacaaacaatttta agaaagatccatctatcgtgatctttctatcaaacaaaagaaaaaaggtcttcatagtaacgctacaacatcaaat atgtggttgctctgacatcagtcgggaaaataaggatatggcggcattggccacatctattggggtcccaacttcc tttcacaaaaaaattaaattgggtgtcccaacttttatctttgatatagtgacatgagtatcgggagcattggaca atggataaaatgagaactaaaaaaattctggttaatttttgatcattgttatttaaaaggttattttatctataat ctacccatattgatcagttttatttaaatttgtttagctaccgctccacgagagagatcctcatcttaaaaatgga atatggaaattacacacgaccccaaaagtatattttttctctggagaatgctatttagagctttgactatatggtc tgaattagaaagacgggaaataaaatctgctaagtgatataagctctaagtaggcgatgtgtgatggagaacacct tttctttaacagtcttcatgttttacagattcgcgaacttcgaatatccctatacggtctgtctaaccctcgtgtg tcttttgagtccaagataaaggccattattgagtaacatagacatgctggaatccaaccattgaagtcacaactgt ccatgtagattctttggagaatctgaaaagtcttaataaaggtggtgtttcaaagaaaacaaaacaaatgagttaa gaaaaaaaaatatcatgtagtggtcgagtattatgttatttattgtgtagctaccaatctttattctttaaatctg acataaaatgctacaaactttttacctcgtctatagccccaaaaaacctaaccacggttctaaaaccacacacagt gattttggttgacgacaatgcctctccttcctcaaaacgatttatttacattttttaaatcaaatgttacatttta taccataattaagtctttttacagaatacttagatggaagagatgtataaaaaaggaggaaattgtaaaaaacata tttcgatcaattaaaccaggattcataaaaatataagtatatatataaatgatgtttcgtttagcgatgaacttca ctcatatgataatacttaacaatataagtacataaaaaataaaataaaattaattgtttacgaaaagtctacaaat actgcatgtataattaatgttctctttatttatttatttataccttaccaagatatatctataaccgcatagaaat agaaggcgaagagataatttccaaaaacaagaaaaacctctaagctcaaaagtctagaaggccttggatccaccca tggaggttgtcacagtatcacttgtagcagttgtgatcactactttcttatacttaatcttcagagattcaagtcc taaaggtttgccaccaggtccaaaaccctggccaatagttggaaaccttcttcaacttggtgagaaacctcattct cagtttgctcagcttgctgaaacctatggtgatctcttttcactgaaactaggaagtgaaacggttgttgtagctt caactccattagcagctagcgagattctaaagacgcatgatcgtgttctctctggtcgatacgtgtttcaaagttt ccgggtaaaggaacatgtggagaactctattgtgtggtctgaatgtaatgaaacatggaagaaactgcggaaagtt tgtagaacggaactttttacgcagaagatgattgaaagtcaagctgaagttagagaaagtaaggctatggaaatgg tggagtatttgaagaaaaatgtaggaaatgaagtgaaaattgctgaagttgtatttgggacgttggtgaatatatt cggtaacttgatattttcacaaaatattttcaagttgggtgatgaaagtagtggaagtgtagaaatgaaagaacat ctatggagaatgctggaattggggaactcgacaaatccagctgattattttccatttttgggtaaattcgatttgt ttggacaaagaaaagatgttgctgattgtctgcaagggatttatagtgtttggggtgctatgctcaaagaaagaaa aatagccaagcagcataacaacagcaagaagaatgattttgttgagattttgctcgattccggactcgatgaccag cagattaatgccttgctcatggaaatatttggtgcgggaacagagacaagtgcatctacaatagaatgggcgttgt ctgagctcacaaaaaaccctcaagtaacagccaatatgcggttggaattgttatctgtggtagggaagaggccggt taaggaatccgacataccaaacatgccttatcttcaagcttttgttaaagaaactctacggcttcatccagcaact cctctgctgcttccacgtcgagcacttgagacctgcaaagttttgaactatacgatcccgaaagagtgtcagatta tggtgaacgcctggggcattggtcgggatccaaaaaggtggactgatccattgaagttttcaccagagaggttctt gaattcgagcattgatttcaaagggaacgacttcgagttgataccatttggtgcagggagaaggatatgtcctggt gtgcccttggcaactcaatttattagtcttattgtgtctagtttggtacagaattttgattggggattaccgaagg gaatggatcctagccaactgatcatggaagagaaatttgggtgacactgcaaaaggaaccacctctgtatattgtt cctaaaactcgggattaagggagaattcgtcgactttgcggccgcatcgatactgcaggagctcggtaccttttac tagtgatatccctgtgtgaaattgttatccgctacgcgtgatcgttcaaacatttggcaataaagtttcttaagat tgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacat gtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaa aacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcccatgggaagtt cctattccgaagttcctattctctgaaaagtataggaacttcagcgatcgctccaatcccacaaaaatctgagctt aacagcacagttgctcctctcagagcagaatcgggtattcaacaccctcatatcaactactacgttgtgtataacg gtccacatgccggtatatacgatgactggggttgtacaaaggcggcaacaaacggcgttcccggagttgcacacaa gaaatttgccactattacagaggcaagagcagcagctgacgcgtacacaacaagtcagcaaacagacaggttgaac ttcatccccaaaggagaagctcaactcaagcccaagagctttgctaaggccctaacaagcccaccaaagcaaaaag cccactggctcacgctaggaaccaaaaggcccagcagtgatccagccccaaaagagactcctttgccccggagatt acaatggacgatttcctctatctttacgatctaggaaggaagttcgaaggtgaaggtgacgacactatgttcacca ctgataatgagaaggttagcctcttcaatttcagaaagaatgctgacccacagatggttagagaggcctacgcagc aggtctcatcaagacgatctacccgagtaacaatctccaggagatcaaataccttcccaagaaggttaaagatgca gtcaaaagattcaggactaattgcatcaagaacacagagaaagacatatttctcaagatcagaagtactattccag tatggacgattcaaggcttgcttcataaaccaaggcaagtaatagagattggagtctctaaaaaggtagttcctac tgaatctaaggccatgcatggagtctaagattcaaatcgaggatctaacagaactcgccgtgaagactggcgaaca gttcatacagagtcttttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacactctggtc tactccaaaaatgtcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaaggataatttcgg gaaacctcctcggattccattgcccagctatctgtcacttcatcgaaaggacagtagaaaaggaaggtggctccta caaatgccatcattgcgataaaggaaaggctatcattcaagatctctctgccgacagtggtcccaaagatggaccc ccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgacatct ccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttca tttggagaggacacgctcgagtataagagctctatttttacaacaattaccaacaacaacaaacaacaaacaacat tacaattacatttacaattaccatggggcgcgccccttgtcctcaaccaaatctcgccatcggtcttacgtcgcac tcggattttggcggtttgacaatcctccttcaaatcaacgaagtggaaggattacagataaaaagagaggggacat ggatttcagtcaaacctctacctaatgcgttcgtagtgaatgttggagatattttggagataatgactaatggaat ttaccatagtgtcgatcaccgggcagtagtaaactcaacaaatgagaggctctcaatcgcaacatttcatgaccct agtctagagtcggtaataggcccaatatcaagcttgattactccagagacacctgctttgtttaaaagtggaattt aaatccccagatgaacatggcatcgtggtgattgatgaaactgctgctgtcggctttaacctctctttaggcattg gtttcgaagcgggcaacaagccgaaagaactgtacagcgaagaggcagtcaacggggaaactcagcaagcgcactt acaggcgattaaagagctgatagcgcgtgacaaaaaccacccaagcgtggtgatgtggagtattgccaacgaaccg gatacccgtccgcaaggtgcacgggaatatttcgcgccactggcggaagcaacgcgtaaactcgacccgacgcgtc cgatcacctgcgtcaatgtaatgttctgcgacgctcacaccgataccatcagcgatctctttgatggggatcctcc acttttaaacaaagcaggtgtctctggagtaatcaagcttgatattgggcctattaccgactctagactagggtca tgaaatgttgcgattgagagcctctcatttgttgagtttactactgcccggtgatcgacactatggtaaattccat tagtcattatctccaaaatatctccaacattcactacgaacgcattaggtagaggtttgactgaaatccatgtccc ctctctttttatctgtaatccttccacttcgttgatttgaaggaggattgtcaaaccgccaaaatccgagtgcgac gtaagaccgatggcgagatttggttgaggacaaggactagtccctagagtcctgctttaatgagatatgcgagacg cctatgatcgcatgatatttgctttcaattctgttgtgcacgttgtaaaaaacctgagcatgtgtagctcagatcc ttaccgccggtttcggttcattctaatgaatgaatatatcacccgttactatcgtatttttatgaataatattctc cgttcaatttactgattgtaccctactacttatatgtacaatattaaaatgaaaacaatatattgtgctgaatagg tttatagcgacatctatgatagagcgccacaataacaaacaattgcgttttattattacaaatccaattttaaaaa aagcggcagaaccggtcaaacctaaaagactgattacataaatcttattcaaatttcaaaagtgccccaggggcta gtatctacgacacaccgagcggcgaactaataacgctcactgaagggaactccggttccccgccggcgcgcatggg tgagattccttgaagttgagtattggccgtccgctctaccgaaagttacgggcaccattcaacccggtccagcacg gcggccgggtaaccgacttgctgccccgagaattatgcagcatttttttggtgtatgtgggccccaaatgaagtgc aggtcaaaccttgacagtgacgacaaatcgttgggcgggtccagggcgaattttgcgacaacatgtcgaggctcag cagggcgatcgcagacgtcgggatcttctgcaagcatctctatttcctgaaggtctaacctcgaagatttaagatt taattacgtttataattacaaaattgattctagtatctttaatttaatgcttatacattattaattaatttagtac tttcaatttgttttcagaaattattttactattttttataaaataaaagggagaaaatggctatttaaatactagc ctattttatttcaattttagcttaaaatcagccccaattagccccaatttcaaattcaaatggtccagcccaattc ctaaataacccacccctaacccgcccggtttccccttttgatccatgcagtcaacgcccagaatttccctatataa ttttttaattcccaaacacccctaactctatcccatttctcaccaaccgccacatagatctatcctcttatctctc aaactctctcgaaccttcccctaaccctagcagcctctcatcatcctcacctcaaaacccaccggggccggccatg attgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaac agacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggaggccggttctttttgtcaagaccga cctgtccggtgccctgaatgaacttcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgc gcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcc tgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatcc ggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtc gatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgc ccgacggcgaggatctcgtcgtgactcatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttc tggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgct gaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcg ccttctatcgccttcttgacgagttcttctgaggcgcgccgatcgttcaaacatttggcaataaagtttcttaaga ttgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaaca tgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgataga aaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagt tcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggcc accggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaat ttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccac tcgatacaggcagcccatcagtcc SEQ ID NO: 6 gcgatcgctccaatcccacaaaaatctgagcttaacagcacagttgctcctctcagagcagaatcgggtattcaac accctcatatcaactactacgttgtgtataacggtccacatgccggtatatacgatgactggggttgtacaaaggc ggcaacaaacggcgttcccggagttgcacacaagaaatttgccactattacagaggcaagagcagcagctgacgcg tacacaacaagtcagcaaacagacaggttgaacttcatccccaaaggagaagctcaactcaagcccaagagctttg ctaaggccctaacaagcccaccaaagcaaaaagcccactggctcacgctaggaaccaaaaggcccagcagtgatcc agccccaaaagagactcctttgccccggagattacaatggacgatttcctctatctttacgatctaggaaggaagt tcgaaggtgaaggtgacgacactatgttcaccactgataatgagaaggttagcctcttcaatttcagaaagaatgc tgacccacagatggttagagaggcctacgcagcaggtctcatcaagacgatctacccgagtaacaatctccaggag atcaaataccttcccaagaaggttaaagatgcagtcaaaagattcaggactaattgcatcaagaacacagagaaag acatatttctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcataaaccaaggcaagtaat agagattggagtctctaaaaaggtagttcctactgaatctaaggccatgcatggagtctaagattcaaatcgagga tctaacagaactcgccgtgaagactggcgaacagttcatacagagtcttttacgactcaatgacaagaagaaaatc ttcgtcaacatggtggagcacgacactctggtctactccaaaaatgtcaaagatacagtctcagaagaccaaaggg ctattgagacttttcaacaaaggataatttcgggaaacctcctcggattccattgcccagctatctgtcacttcat cgaaaggacagtagaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggctatcattcaagat ctctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaacca cgtcttcaaagcaagtggattgatgtgacatctccactgacgtaagggatgacgcacaatcccactatccttcgca agacccttcctctatataaggaagttcatttcatttggagaggacacgctcgagtataagagctctatttttacaa caattaccaacaacaacaaacaacaaacaacattacaattacatttacaattaccatggggcgcgccccttgtcct caaccaaatctcgccatcggtcttacgtcgcactcggattttggcggtttgacaatcctccttcaaatcaacgaag tggaaggattacagataaaaagagaggggacatggatttcagtcaaacctctacctaatgcgttcgtagtgaatgt tggagatattttggagataatgactaatggaatttaccatagtgtcgatcaccgggcagtagtaaactcaacaaat gagaggctctcaatcgcaacatttcatgaccctagtctagagtcggtaataggcccaatatcaagcttgattactc cagagacacctgctttgtttaaaagtggaatttaaatccccagatgaacatggcatcgtggtgattgatgaaactg ctgctgtcggctttaacctctctttaggcattggtttcgaagcgggcaacaagccgaaagaactgtacagcgaaga ggcagtcaacggggaaactcagcaagcgcacttacaggcgattaaagagctgatagcgcgtgacaaaaaccaccca agcgtggtgatgtggagtattgccaacgaaccggatacccgtccgcaaggtgcacgggaatatttcgcgccactgg cggaagcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctgcgacgctcacaccga taccatcagcgatctctttgatggggatcctccacttttaaacaaagcaggtgtctctggagtaatcaagcttgat attgggcctattaccgactctagactagggtcatgaaatgttgcgattgagagcctctcatttgttgagtttacta ctgcccggtgatcgacactatggtaaattccattagtcattatctccaaaatatctccaacattcactacgaacgc attaggtagaggtttgactgaaatccatgtcccctctctttttatctgtaatccttccacttcgttgatttgaagg aggattgtcaaaccgccaaaatccgagtgcgacgtaagaccgatggcgagatttggttgaggacaaggactagtcc ctagagtcctgctttaatgagatatgcgagacgcctatgatcgcatgatatttgctttcaattctgttgtgcacgt tgtaaaaaacctgagcatgtgtagctcagatccttaccgccggtttcggttcattctaatgaatgaatatatcacc cgttactatcgtatttttatgaataatattctccgttcaatttactgattgtaccctactacttatatgtacaata ttaaaatgaaaacaatatattgtgctgaataggtttatagcgacatctatgatagagcgccacaataacaaacaat tgcgttttattattacaaatccaattttaaaaaaagcggcagaaccggtcaaacctaaaagactgattacataaat cttattcaaatttcaaaagtgccccaggggctagtatctacgacacaccgagcggcgaactaataacgctcactga agggaactccggttccccgccggcgcgcatgggtgagattccttgaagttgagtattggccgtccgctctaccgaa agttacgggcaccattcaacccggtccagcacggcggccgggtaaccgacttgctgccccgagaattatgcagcat ttttttggtgtatgtgggccccaaatgaagtgcaggtcaaaccttgacagtgacgacaaatcgttgggcgggtcca gggcgaattttgcgacaacatgtcgaggctcagcagggcgatcgca SEQ ID NO: 7 ccccttgtcctcaaccaaatctcgccatcggtcttacgtcgcactcggattttggcggtttgacaatcctccttca aatcaacgaagtggaaggattacagataaaaagagaggggacatggatttcagtcaaacctctacctaatgcgttc gtagtgaatgttggagatattttggagataatgactaatggaatttaccatagtgtcgatcaccgggcagtagtaa actcaacaaatgagaggctctcaatcgcaacatttcatgaccctagtctagagtcggtaataggcccaatatcaag cttgattactccagagacacctgctttgtttaaaagtggaatttaaatccccagatgaacatggcatcgtggtgat tgatgaaactgctgctgtcggctttaacctctctttaggcattggtttcgaagcgggcaacaagccgaaagaactg tacagcgaagaggcagtcaacggggaaactcagcaagcgcacttacaggcgattaaagagctgatagcgcgtgaca aaaaccacccaagcgtggtgatgtggagtattgccaacgaaccggatacccgtccgcaaggtgcacgggaatattt cgcgccactggcggaagcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctgcgac gctcacaccgataccatcagcgatctctttgatggggatcctccacttttaaacaaagcaggtgtctctggagtaa tcaagcttgatattgggcctattaccgactctagactagggtcatgaaatgttgcgattgagagcctctcatttgt tgagtttactactgcccggtgatcgacactatggtaaattccattagtcattatctccaaaatatctccaacattc actacgaacgcattaggtagaggtttgactgaaatccatgtcccctctctttttatctgtaatccttccacttcgt tgatttgaaggaggattgtcaaaccgccaaaatccgagtgcgacgtaagaccgatggcgagatttggttgaggaca agg SEQ ID NO: 8 ccttgtcctcaaccaaatctcgccatcggtcttacgtcgcactcggattttggcggtttgacaatcctccttcaaa tcaacgaagtggaaggattacagataaaaagagaggggacatggatttcagtcaaacctctacctaatgcgttcgt agtgaatgttggagatattttggagataatgactaatggaatttaccatagtgtcgatcaccgggcagtagtaaac tcaacaaatgagaggctctcaatcgcaacatttcatgaccctagtctagagtcggtaataggcccaatatcaagct tgattactccagagacacctgctttgtttaaaagtgga SEQ ID NO: 9 TAACCGACTTGCTGCCCCGA SEQ ID NO: 10 AAATAGAGATGCTTGCAGAAGATCCCG SEQ ID NO: 11 CGTTTGAATCTTGCTGGCCGTGAT SEQ ID NO: 12 TAGACGAGCTGCCTTTGGAAGTGT SEQ ID NO: 13: CGTCTTGCGCACTGATTTGAA SEQ ID NO 14: CGTTTGAATCTTGCTGGCCGTGAT SEQ ID NO: 15 (T6ODM) guucuuaauu cauuaauuaa uuuagaaaaa ucauggagaa agcaaaacuu augaagcuag 60 guaaugguau ggaaauacca aguguucaag aauuggcuaa acucacgcuu gccgaaauuc 120 caucucgaua cguaugcgcc aaugaaaacc uuuuguugcc uaugggugca ucugucauaa 180 augaucauga aaccauuccu gucaucgaua uagaaaauuu auuaucucca gaaccaauaa 240 ucggaaaguu agaauuagau aggcuucauu uugcuugcaa agaauggggu uuuuuucagg 300 uagugaacca uggagucgac gcuucauugg uggauagugu aaaaucagaa auucaagguu 360 ucuuuaaccu uucuauggau gagaaaacua aauaugaaca ggaagaugga gauguggaag 420 gauuuggaca aggcuuuauu gaaucagagg accaaacacu ugauugggca gauauauuua 480 ugauguucac ucuuccacuc cauuuaagga agccucacuu auuuucaaaa cucccagugc 540 cucucaggga gacaaucgaa uccuacucau cagaaaugaa aaaguuaucc augguucucu 600 uuaauaagau ggaaaaagcu cuacaaguac aagcagccga gauuaagggu augucagagg 660 uguuuauaga ugggacacaa gcaaugagga ugaacuauua ucccccuugu ccucaaccaa 720 aucucgccau cggucuuacg ucgcacucgg auuuuggcgg uuugacaauc cuccuucaaa 780 ucaacgaagu ggaaggauua cagauaaaaa gagaggggac auggauuuca gucaaaccuc 840 uaccuaaugc guucguagug aauguuggag auauuuugga gauaaugacu aauggaauuu 900 accauagugu cgaucaccgg gcaguaguaa acucaacaaa ugagaggcuc ucaaucgcaa 960 cauuucauga cccuagucua gagucgguaa uaggcccaau aucaagcuug auuacuccag 1020 agacaccugc uuuguuuaaa aguggaucua cauaugggga ucuuguggag gaauguaaaa 1080 caaggaagcu cgauggaaaa ucauuucuug acuccaugag gauuugaaaa cucaagaaaa 1140 aauaauacga cgugauugca ugucagauuc aacuauccuu uugucguuuu uuggugcucg 1200 aguccuuaau uguuuugauc auugcuuuug auucuaauua auaagacuuu ucucaagaac 1260 cacauguaau guaccuuuac uuucagaaaa uaaaaaguau ugaggcacaa augagaaaau 1320 ugagagagug cuugagaagu guaauuucuc gaaagugcgu uguguuugaa aaaaaaaaaa 1380 aaaaaa 1386 SEQ ID NO: 16 (CODM) guaaagauug auauaugauc ugaagaucug acaagaaagu ucaucaaaua uagaguucau 60 ggagacacca auacuuauca agcuaggcaa ugguuuguca auaccaagug uucaggaauu 120 ggcuaaacuc acgcuugcag aaauuccauc ucgauacaca ugcaccggug aaagcccguu 180 gaauaauauu ggugcgucug uaacagauga ugaaacaguu ccugucaucg auuugcaaaa 240 uuuacuaucu ccagaacccg uaguuggaaa guuagaauug gauaagcuuc auucugcuug 300 caaagaaugg gguuucuuuc agcugguuaa ccauggaguc gacgcuuuac ugauggacaa 360 uauaaaauca gaaauuaaag guuucuuuaa ccuuccaaug aaugagaaaa cuaaauacgg 420 acagcaagau ggagauuuug aaggauuugg acaacccuau auugaaucgg aggaccaaag 480 acuugauugg acugaagugu uuagcauguu aagucuuccu cuccauuuaa ggaagccuca 540 uuuguuucca gaacucccuc ugccuuucag ggagacacug gaauccuacc uaucaaaaau 600 gaaaaaacua ucaacgguug ucuuugagau guuggaaaaa ucucuacaau uaguugagau 660 uaaagguaug acagacuuau uugaagaugg guugcaaaca augaggauga acuauuaucc 720 uccuuguccu cgaccagagc uuguacuugg ucuuacguca cacucggauu uuagcgguuu 780 gacaauucuc cuucaacuua augaaguuga aggauuacaa auaagaaaag aagagaggug 840 gauuucaauc aaaccucuac cugaugcguu cauagugaau guuggagaca uuuuggagau 900 aaugacuaau gggauuuacc guagcgucga gcaccgggca guaguaaacu caacaaagga 960 gaggcucuca aucgcgacau uucaugacuc uaaacuagag ucagaaauag gcccaauuuc 1020 gagcuugguc acaccagaga caccugcuuu guucaaaaga gguagguaug aggauauuuu 1080 gaaggaaaau cuuucaagga agcuugaugg aaaaucauuu cucgacuaca ugaggaugug 1140 agaaagugug aacauauauu auacuccaca uuguguuuaa uauaugauga aauaaguugc 1200 uuuugaagua ugaugaaaua aguugguuuu gaagaauuca uauugugcuu aaauuucgug 1260 gaugacugag agauuuauua uguaauaaua auguauuggu uugaagauuc ucgucucacu 1320 auauguaaga cucuguuugg gucaagugau guaaucacgg uugaaauaag uugcuuuuga 1380 agaauucaua uggugcuuaa uauuauguaa uaaauaaugu auuggauuga aaaaaaaaaa 1440 aaaaaaaaaa aa 1452