Human Leukocyte Antigen Restricted Gamma Delta T Cell Receptors and Methods of Use Thereof
20190169260 ยท 2019-06-06
Inventors
- J?rgen Herbert Ernst Kuball (Hilversum, NL)
- Guido Joris Jan Kierkels (Utrecht, NL)
- Zsolt Sebestyen (Amsterdam, NL)
Cpc classification
A61K39/4632
HUMAN NECESSITIES
A61K39/4611
HUMAN NECESSITIES
C07K2317/32
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N5/0638
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
A61K2239/38
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61P35/00
HUMAN NECESSITIES
Abstract
Disclosed herein are compositions and methods of treating a subject with cancer. The compositions and methods utilize immunoresponsive cells to effect killing of tumor cells.
Claims
1. A composition comprising a polypeptide construct that selectively binds a human leukocyte antigen (HLA) molecule or portion thereof on a target cell when said HLA molecule is complexed to at least one additional HLA molecule on said target cell, wherein said polypeptide construct does not bind an uncomplexed HLA molecule, and wherein said polypeptide construct is expressed on a cell or synthesized.
2. The composition of claim 1, wherein said HLA molecule is an HLA-A serotype or variant thereof.
3. The composition of claim 2, wherein said HLA-A serotype is HLA-A*24.
4. The composition of claim 3, wherein said HLA-A*24 is HLA-A*24:02.
5. The composition of any one of claims 1 to 4, wherein said complex comprises a clustering of said HLA molecule.
6. The composition of any one of claims 1 to 4, wherein said complex comprises a K-conformation.
7. The composition of claim 6, wherein said K-conformation comprises at least one of differential special distribution or differential clustering of said HLA molecule when compared to a comparable normal cell.
8. The composition of any one of claims 1 to 7, wherein said polypeptide construct binds at least one co-receptor.
9. The composition of claim 8, wherein said at least one co-receptor is selected from a group consisting of: CD8, CD4, CD28, CCR, and CXCR4.
10. The composition of claim 9, wherein said at least one co-receptor is CD8.
11. The composition of claim 10, wherein said at least one co-receptor comprises a least one of CD8 alpha or CD8beta.
12. The composition of any one of claims 1 to 11, wherein said target cell is a cancer cell.
13. The composition of claim 12, wherein said cancer cell aberrantly expresses said HLA molecule.
14. The composition of claim 13, wherein said aberrant expression comprises said K-conformation on said target cell and said aberrant expression and said complexing is not present on a comparable normal cell.
15. The composition of claim 13, wherein said aberrant expression comprises at least one of structure, mobility, flexibility, or compartmentalization as compared to a non-aberrantly expressed HLA on a comparable normal cell.
16. The composition of any one of claims 1 to 15, wherein said complexing is detected by flow cytometry or microscopy.
17. The composition of any one of claims 12 to 16, wherein said cancer cell overexpresses said HLA as compared to said comparable normal cell.
18. The composition of claim 17, wherein said overexpression comprises from about 1% to about 100% expression on a population of said cancer cell as detected by flow cytometry.
19. The composition of any one of claims 17 to 18, wherein said overexpression comprises a positive detection of said HLA molecule by immunohistochemistry (IHC) analysis.
20. The composition of any one of claims 1 to 19, wherein said polypeptide construct is expressed on immune cells.
21. The composition of claim 20, wherein said immune cells are from a myeloid or lymphoid lineage.
22. The composition of claim 21, wherein said immune cells are from a lymphoid lineage.
23. The composition of claim 22, wherein said immune cells from a lymphoid lineage are at least one of natural killer (NK) cells, B cells, or T cells.
24. The composition of any one of claims 20 to 23, wherein said immune cells are a plurality of T cells.
25. The composition of claim 24, wherein said plurality of T cells are engineered ?? T cells.
26. The composition of any one of claims 20 to 25, wherein said immune cells are virally modified to express said polypeptide construct.
27. The composition of any one of claims 20 to 26, wherein said immune cells are non-virally modified to express said polypeptide construct.
28. The composition of any one of claims 1 to 27, wherein said polypeptide construct encodes at least a portion of a T cell receptor (TCR), antibody, chimeric antigen receptor (CAR), B cell receptor, and any combination thereof.
29. The composition of claim 28, wherein said at least a portion of a TCR is an engineered TCR.
30. The composition of any one of claims 28 to 29, wherein said TCR is a ??TCR.
31. The composition of claim 30, wherein said ??TCR is a ?9?2TCR or ?5?1TCR.
32. The composition of any one of claims 30 to 31, wherein said ??TCR is exogenous to said immune cell.
33. The composition of any one of claims 20 to 32, wherein said immune cells are expanded.
34. The composition of any one of claims 20 to 33, wherein said immune cells are administered to a subject in need thereof.
35. The composition of claim 34, wherein said subject in need thereof received a lymphodepleting regime prior to said administration of said immune cells.
36. The composition of claim 35, wherein said lymphodepleting regime comprises an administration of cyclophosphamide, fludarabine, radiation, or a combination thereof.
37. The composition of any one of claims 1 to 36, wherein said polypeptide construct comprises at least one of a ?-TCR polypeptide sequence, a ?-TCR polypeptide sequence, variants and fragments thereof
38. The composition of any one of claims 1 to 37, wherein said polypeptide construct comprises a CDR3 region of a ?-TCR polypeptide sequence selected from the list in Tables 2 and 6, a CDR3 region of a ?-TCR polypeptide sequence selected from the list in Tables 2 and 5, variants, and fragments thereof.
39. The composition of any one of claims 1 to 38, wherein said polypeptide construct comprises a sequence with at least from about 80%, 90%, 95%, 98%, to about 99% sequence identity to a sequence selected from the sequences in the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, amino acids 19-309 of SEQ ID NO: 4, amino acids 21-293 of SEQ ID NO: 5 and SEQ ID NO: 6 to SEQ ID NO: 428.
40. The composition of any one of claims 1 to 39, wherein said composition is administered in combination with at least one additional therapeutic agent to said subject in need thereof.
41. The composition of any one of claims 1 to 40, wherein said composition is a pharmaceutical composition.
42. A pharmaceutical composition comprising: a. the composition of any one of claims 1 to 41; and b. at least one of: an excipient, a diluent, or a carrier.
43. The pharmaceutical composition of claim 40, wherein the pharmaceutical composition is administered in unit dosage form.
44. The pharmaceutical composition of any one of claims 42 to 43, wherein said pharmaceutical composition is in the form of a tablet, a liquid, a syrup, an oral formulation, an intravenous formulation, an intranasal formulation, a subcutaneous formulation, an inhalable respiratory formulation, a suppository, and any combination thereof.
45. The pharmaceutical composition of claim 44, wherein said pharmaceutical composition is administered in the form of an infusion.
46. The pharmaceutical composition of claim 45, wherein said administering of said pharmaceutical composition at least partially ameliorates a disease or condition in said subject in need thereof.
47. The pharmaceutical composition of claim 46, wherein said amelioration comprises a reduction in tumor size by at least about 30% as measured by computerized tomography (CT) scan.
48. The pharmaceutical composition of claim 47, wherein said amelioration comprises stabilizing tumor size as measured by a less than 10% change in a baseline measurement of a diameter of a tumor lesion as measured by computerized tomography (CT) scan.
49. A method of treating a subject in need thereof comprising administering to said subject: an effective amount of a pharmaceutical composition comprising a polypeptide construct that binds a human leukocyte antigen (HLA) molecule complexed to at least one additional HLA molecule, and wherein said polypeptide construct does not bind an uncomplexed HLA molecule.
50. The method of claim 49, wherein said HLA molecule is of an HLA-A serotype or variant thereof.
51. The method of claim 50, wherein said HLA-A is HLA-A*24.
52. The method of claim 51, wherein said HLA-A*24 is HLA-A*24:02.
53. The method of any one of claims 49 to 52, wherein said polypeptide construct comprises at least one of a ?-TCR polypeptide sequence, a ?-TCR polypeptide sequence, variants and fragments thereof
54. The method of any one of claims 49 to 53, wherein said polypeptide construct comprises a CDR3 region of a ?-TCR polypeptide sequence selected from the list in Tables 2 and 6, a CDR3 region of a ?-TCR polypeptide sequence selected from the list in Tables 2 and 5, variants, and fragments thereof.
55. The method of any one of claims 49 to 54, wherein said polypeptide construct comprises a sequence with from about 80%, 90%, 95%, 98%, to about 99% sequence identity to a sequence selected from the sequences in the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, amino acids 19-309 of SEQ ID NO: 4, amino acids 21-293 of SEQ ID NO: 5 and SEQ ID NO: 6 to SEQ ID NO: 428.
56. The method of any one of claims 49 to 55, further comprising administering at least one of a cytokine, chemotherapy, radiation, or a combination thereof to said subject in need thereof.
57. The method of claim 56, wherein said cytokine is interleukin-2.
58. The method of any one of claims 56 to 57, wherein said chemotherapy comprises at least one of cyclophosphamide or fludarabine.
59. The method of any one of claims 49 to 58, wherein said polypeptide construct is lyophilized.
60. The method of any one of claims 49 to 59, further comprising an adjuvant, diluent, carrier, or a combination thereof.
61. A method of treating a disease comprising aberrant HLA-A*24 expression comprising administering a first therapeutic agent that binds at least a portion of a human leukocyte antigen (HLA)-A*24, and at least one of: subsequently re-administering said first therapeutic agent, and administering a second therapeutic agent.
62. The method of claim 61, wherein said first therapeutic agent comprises at least a portion of a T cell receptor (TCR), antibody, chimeric antigen receptor (CAR), B cell receptor, and any combination thereof.
63. The method of claim 62, wherein said at least a portion of a TCR is an ??TCR or a ??TCR.
64. The method of claim 63, wherein said TCR is a ??TCR.
65. The method of any one of claims 61 to 64, wherein said first therapeutic agent is an engineered cell expressing said ??TCR.
66. The method of claim 65, wherein said engineered cell is from a lymphoid lineage or myeloid lineage.
67. The method of claim 66, wherein said engineered cell is from a lymphoid lineage and is selected from a natural killer (NK) cell, B cell, or T cell.
68. The method of claim 67, wherein said engineered cell is a T cell.
69. The method of any one of claims 61 to 68, wherein said first therapeutic agent binds a cancer cell when said HLA-A*24 is complexed to at least one additional HLA molecule.
70. The method of any one of claims 61 to 69, wherein said re-administration is performed from about 24 hours to about 1 year after said administering a first therapeutic agent.
71. The method of any one of claims 61 to 70, further comprising detecting a level of said first therapeutic agent by at least one of quantitative PCR (qPCR) or flow cytometry.
72. The method of any one of claims 61 to 71, wherein said second therapeutic agent is selected from the group consisting of: chemotherapeutic, radiotherapeutic, or immunotherapeutic.
73. The method of claim 72, wherein said second therapeutic agent is an immunotherapeutic.
74. An engineered cell comprising: a genomic alteration encoding a polypeptide construct that selectively binds a human leukocyte antigen (HLA) molecule or portion thereof on a target cell when said HLA molecule is complexed to at least one additional HLA molecule on said target cell, wherein said polypeptide construct does not bind an uncomplexed HLA molecule.
75. The engineered cell of claim 74, wherein said HLA comprises class I, class II, or a combination thereof.
76. The engineered cell of claim 75, wherein said HLA comprises class I (HLA-I).
77. The engineered cell of claim 76, wherein said HLA-I comprises HLA-A.
78. The engineered cell of claim 77, wherein said HLA-A is HLA-A*24.
79. The engineered cell of claim 78, wherein said HLA-A*24 allele comprises HLA-A*24:02.
80. The engineered cell of any one of claims 74 to 79, wherein said genomic alteration comprises a knock in comprising a viral introduction of said polypeptide construct.
81. The engineered cell of claim 80, wherein said viral introduction comprises a virus selected from the group consisting of a lentivirus, retrovirus, adenovirus, and any combination thereof.
82. The engineered cell of claim 81, wherein said viral introduction comprises a retrovirus.
83. The engineered cell of any one of claims 74 to 82, wherein said polypeptide construct comprises at least one ??TCR or fragment or variant thereof.
84. The engineered cell of claim 83, wherein said ??TCR comprises a ?-TCR polypeptide sequence selected from the list in Tables 2 and 6, a CDR3 region of a ?-TCR polypeptide sequence selected from the list in Tables 2 and 5, variants, and fragments thereof.
85. The engineered cell of any one of claims 74 to 84, wherein said polypeptide construct selectively binds said HLA on said target cell, in the presence of at least one additional peptide and/or at least one co-receptor.
86. The engineered cell of claim 85, wherein said at least one co-receptor is selected from a group consisting of: CD8, CD4, CD28, CCR, and CXCR4.
87. The engineered cell of claim 86, wherein said at least one co-receptor is CD8.
88. The engineered cell of claim 87, wherein said at least one co-receptor comprises at least one of CD8 alpha or CD8 beta.
89. A population of cells comprising the engineered cell of any one of claims 74 to 88.
90. The population of claim 89, wherein from about 60% to about 100% of said engineered cells express said polypeptide construct.
91. The population of any one of claims 89 to 90, wherein said engineered cells are a plurality of ?? T cells.
92. The population of any one of claims 89 to 91, wherein when said population is administered to a subject in need thereof a cancer is controlled, reduced, or eliminated.
93. The population of any one of claims 89 to 92, wherein when said population is administered to a subject in need thereof a viral infection is controlled, reduced, or eliminated.
94. The population of claim 93, wherein said administration is effective in reducing tumor size by at least 30% as measured by computerized tomography (CT) scan.
95. The population of claim 93, wherein said administration is effective in stabilizing tumor size as measured by a less than 10% change in a baseline measurement of a diameter of a tumor lesion as measured by computerized tomography (CT) scan.
96. The population of any one of claims 92 to 95, wherein from about 5?10.sup.4 to about 1?10.sup.12 cells are administered to said subject in need thereof.
97. The population of any one of claims 92 to 96, wherein said administration extends a life of said subject in need thereof from about 1 week to about 50 years as compared to an untreated subject.
98. The population of any one of claims 89 to 97, wherein said engineered cells are inhibited by a binding of an antibody.
99. The population of claim 98, wherein said binding of an antibody reduces toxicity associated with said administration of said engineered cells.
100. A polynucleic acid comprising a sequence that is at least 90%, 95%, 97% or 99% identical to a sequence encoding a polypeptide sequence of at least one of SEQ ID NO: 2, SEQ ID NO: 3, amino acids 19-309 of SEQ ID NO: 4, or amino acids 21-293 of SEQ ID NO: 5.
101. An engineered cell comprising a receptor sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NO: 2, SEQ ID NO: 3, amino acids 19-309 of SEQ ID NO: 4, or amino acids 21-293 of SEQ ID NO: 5.
102. An engineered cell comprising at least a portion of a receptor with a sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NO: 2, SEQ ID NO: 3, amino acids 19-309 of SEQ ID NO: 4, amino acids 21-293 of SEQ ID NO: 5 and SEQ ID NO: 6 to SEQ ID NO: 428.
103. The engineered cell of claim 102, wherein said engineered cell is expanded to a population of engineered cells.
104. The engineered cell of claim 103, wherein said population of engineered cells are formulated into a pharmaceutical composition.
105. A polypeptide that selectively binds a human leukocyte antigen (HLA) molecule or portion thereof on a target cell when said HLA molecule is complexed to at least one additional HLA molecule on said target cell, wherein said polypeptide does not bind an uncomplexed HLA molecule.
106. A polypeptide according to claim 105, wherein said HLA molecule is an HLA-A serotype or variant thereof, preferably wherein said HLA-A serotype is HLA-A*24, more preferably, wherein said HLA-A*24 is HLA-A*24:02.
107. A polypeptide according to claim 105 or 106, wherein said target cell is a cancer cell, preferably wherein said cancer cell aberrantly expresses said HLA molecule.
108. A polypeptide according to any one of claims 105 to 107, wherein the polypeptide is a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 3, amino acids 21-293 of SEQ ID NO: 5, or SEQ ID NOs: 6 to 237.
109. A polypeptide according to any one of claims 105 to 107, wherein the polypeptide is a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 2, amino acids 19-309 of SEQ ID NO: 4, or SEQ ID NOs: 238 to 428.
110. A T cell receptor (TCR), preferably an engineered TCR comprising: a. a ?T-cell receptor chain or part thereof as defined in claim 108 and b. a ?T-cell receptor chain or part thereof as defined in claim 109.
111. A nucleic acid molecule encoding the polypeptide as defined in any one of claims 105 to 109 or the TCR of claim 110.
112. A nucleic acid construct comprising the nucleic acid molecule of claim 111.
113. A cell comprising the nucleic acid construct of claim 112.
114. A polypeptide as defined in claims 105 to 109, a TCR as defined in claim 110, a nucleic acid molecule of claim 111, a nucleic acid construct of claim 112 or a cell of claim 113 for use as a medicament.
115. A polypeptide as defined in claims 105 to 109, a TCR as defined in claim 110, a nucleic acid molecule of claim 111, a nucleic acid construct of claim 112 or a cell of claim 113 for use as a medicament against cancer or an infection.
116. A method of reducing toxicity associated with the administration of the engineered cell of any one of claims 74 to 88, or the cell of claim 113, comprising administration of at least one antibody or portion thereof to a subject in need thereof.
117. The method of claim 116, wherein said antibody is a blocking antibody or neutralizing antibody.
118. The method of any one of claims 116 to 117, wherein said antibody or portion thereof inhibits binding of said engineered cell or said cell to a cell expressing HLA-A*24:02.
119. The method of claim 118, wherein said cell expressing HLA-A*24:02 is at least one of a cancer cell or a comparable normal cell.
120. The method of any one of claims 116 to 119, wherein said administration of at least one antibody or portion thereof reduces a level of at least one of cytokine release syndrome (CRS), B-Cell Aplasia, and Tumor Lysis Syndrome (TLS) in said subject in need thereof.
121. The method of any one of claims 116-120, wherein said at least one antibody binds said HLA-A*24:02 completely or partially.
122. The method of claim 121, wherein said antibody is a human antibody, a humanized antibody or fragment or variant thereof.
123. The method of claim 122, wherein said variant is an scFv, or scFab.
124. The composition or pharmaceutical composition of any one of claims 1-48, wherein said composition or pharmaceutical composition retains activity when stored in a sealed container at 25? C. or 4? C. for a predetermined amount of time in an atmosphere having a predetermined relative humidity.
125. The composition or pharmaceutical composition of claim 124, wherein said predetermined relative humidity is 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90% or 95% relative humidity.
126. The composition or pharmaceutical composition of any one of claims 124-125, wherein said predetermined time is at least 1 month, 2 months, 3 months, 6 months, 1 year, 1.5 years, 2 years, 2.5 years or 3 years.
127. The composition or pharmaceutical composition of any one of claims 124-126 said composition or pharmaceutical composition retains at least 50%, 60%, 70%, 80% or 90% activity as determined by binding to an HLA molecule which complexed to at least one additional HLA molecule.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure can be utilized, and the accompanying drawings of which:
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION OF THE DISCLOSURE
[0040] The following description and examples illustrate embodiments of the disclosure in detail. It is to be understood that this disclosure is not limited to the particular embodiments described herein and as such can vary. Those of skill in the art will recognize that there are numerous variations and modifications of the disclosure, which are encompassed within its scope. Unless otherwise indicated, any embodiment can be combined with any other embodiment.
[0041] All terms are intended to be understood as they would be understood by a person skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.
[0042] As used herein, unless otherwise indicated, some inventive embodiments herein contemplate numerical ranges. A variety of aspects of this invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range as if explicitly written out. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. When ranges are present, the ranges include the range endpoints.
[0043] The following definitions supplement those in the art and are directed to the current application and are not to be imputed to any related or unrelated case, e.g., to any commonly owned patent or application. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, the preferred materials and methods are described herein. Accordingly, the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Definitions
[0044] As used herein, unless otherwise indicated, the article a means one or more unless explicitly otherwise provided for.
[0045] As used herein, unless otherwise indicated, terms such as contain, containing, include, including, and the like mean comprising.
[0046] The term activation and its grammatical equivalents as used herein can refer to a process whereby a cell transitions from a resting state to an active state. This process can comprise a response to an antigen, migration, and/or a phenotypic or genetic change to a functionally active state.
[0047] Antigen as used herein means a substance that is recognized and bound specifically by an antigen binding unit. Antigens can include peptides, proteins, glycoproteins, polysaccharides, and lipids; portions thereof and combinations thereof Antigen can also refer to a molecule that provokes the immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.
[0048] The term autologous and its grammatical equivalents as used herein can refer to as originating from the same being. For example, a sample (e.g., cells) can be removed, processed, and given back to the same subject (e.g., patient) at a later time. An autologous process is distinguished from an allogenic process where the donor and the recipient are different subjects.
[0049] As used in this specification and claim(s), the words comprising (and any form of comprising, such as comprise and comprises), having (and any form of having, such as have and has), including (and any form of including, such as includes and include) or containing (and any form of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.
[0050] The term epitope and its grammatical equivalents as used herein can refer to a part or a portion or a fragment of an antigen that can be recognized by antibodies, B cells, T cells or engineered cells expressing polypeptide constructs described herein. For example, an epitope can be a cancer epitope that is recognized by a TCR, for instance a gamma delta TCR described herein. Multiple epitopes within an antigen can also be recognized. The epitope can also be mutated.
[0051] The term engineered and its grammatical equivalents as used herein can refer to one or more alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome or of a polypeptide. The term engineered can refer to alterations, additions, and/or deletion of genes or polypeptides. An engineered cell can also refer to a cell with an added, deleted and/or altered gene or polypeptide.
[0052] The term cell or engineered cell and their grammatical equivalents as used herein can refer to a cell of human or non-human animal origin. An engineered cell can also refer to an engineered effector cell. In certain cases, an engineered cell refers to an effector cell engineered to express a polypeptide construct described herein.
[0053] The term good manufacturing practices (GMP) and its grammatical equivalents as used herein can refer to products that are safe, effective, or pure according to the FDA. GMP can also sometimes be referred to as cGMP. The c stands for current. Manufacturers of a product can employ technologies and systems which are up-to-date in order to comply with regulation of GMP products. GMP compatible products are typically utilized in the clinical setting as opposed to the research setting.
[0054] The term transfection as used herein refers to the introduction of foreign nucleic acid into eukaryotic cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.
[0055] The term stable transfection or stably transfected refers to the introduction and integration of foreign nucleic acid, DNA or RNA, into the genome of the transfected cell. The term stable transfectant refers to a cell which has stably integrated foreign DNA into the genomic DNA.
[0056] Nucleic acids and/or nucleic acid sequences are homologous when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins (or polypeptides) and/or protein (polypeptide) sequences are homologous when their encoding DNAs are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence.
[0057] In the context of the invention, a polypeptide is represented by an amino acid sequence. Preferred polypeptides are ?T-cell and/or ?T-cell receptor chains or parts thereof which mediate an anti-tumor response as explained herein. In the context of the invention, a nucleic acid molecule as a nucleic acid molecule encoding such a ?T-cell and/or ?T-cell receptor chain or part thereof is represented by a nucleic acid or nucleotide sequence which encodes such a polypeptide. A nucleic acid molecule may comprise a regulatory region. It is to be understood that each nucleic acid molecule or polypeptide or construct as identified herein by a given Sequence Identity Number (SEQ ID NO) is not limited to this specific sequence as disclosed. Throughout this application, each time one refers to a specific nucleotide sequence SEQ ID NO (take SEQ ID NO: X as example) encoding a given polypeptide, one may replace it by an homologous nucleotide sequence defined as follows: i. a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity or similarity with SEQ ID NO: X; ii. a nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i); (iii). a nucleotide sequence the sequence of which differs from the sequence of a nucleic acid molecule of (i) or (ii) due to the degeneracy of the genetic code; or, (iv) a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity or similarity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: X. Throughout this application, each time one refers to a specific amino acid sequence SEQ ID NO (take SEQ ID NO: Y as example), one may replace it by: a polypeptide comprising an amino acid sequence that has at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: Y. Each nucleotide sequence or amino acid sequence described herein by virtue of its identity or similarity percentage (at least 60%) with a given nucleotide sequence or amino acid sequence respectively has in a further preferred embodiment an identity or a similarity of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more identity or similarity with the given nucleotide or amino acid sequence respectively. In a preferred embodiment, sequence identity or similarity is determined by comparing the whole length of the sequences as identified herein. Unless otherwise indicated herein, identity or similarity with a given SEQ ID NO means identity or similarity based on the full length of said sequence (i.e. over its whole length or as a whole).
[0058] The homologous molecules can be termed homologs. For example, any naturally occurring proteins, as described herein, can be modified by any available mutagenesis method. When expressed, this mutagenized nucleic acid encodes a polypeptide that is homologous to the protein encoded by the original nucleic acid. Homology is generally inferred from sequence identity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of identity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more can also be used to establish homology. Identity of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% are encompassed herein.
[0059] Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. The identity between two amino acid or two nucleic acid sequences is preferably defined by assessing their identity within a whole SEQ ID NO as identified herein or part thereof. Part thereof may mean at least 50% of the length of the SEQ ID NO, or at least 60%, or at least 70%, or at least 80%, or at least 90%. In the art, identity also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. Similarity between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Identity and similarity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215:403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity. Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the Ogap program from Genetics Computer Group, located in Madison, Wis. The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps). Preferred parameters for nucleic acid comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: matches=+10, mismatch=0; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons. Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called conservative amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg, Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.
[0060] As used herein, the terms nucleic acid molecule encoding, DNA sequence encoding, and DNA encoding refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The nucleic acid sequence thus codes for the amino acid sequence.
[0061] The term subject, as used herein, refers to any animal, e.g., a mammal or marsupial. Subjects of the present invention include but are not limited to humans, non-human primates (e.g., rhesus or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats and fowl of any kind.
[0062] The term recipient and their grammatical equivalents as used herein can refer to a human or non-human animal in receipt of a therapy or treatment.
[0063] The term peripheral blood lymphocytes (PBL) and its grammatical equivalents as used herein can refer to lymphocytes that circulate in the blood (e.g., peripheral blood). Peripheral blood lymphocytes can refer to lymphocytes that are not localized to organs. Peripheral blood lymphocytes can comprise T cells, NK cells, B cell, or any combinations thereof.
[0064] The term immunoresponsive cell can refer to a cell that can elicit an immune response, including but not limited to T cells, B cells, and NKT cells, their respective precursor cells and progeny thereof. An immunoresponsive cell can also refer to a cell of a lymphoid or myeloid lineage.
[0065] The term T cell and its grammatical equivalents as used herein can refer to a T cell from any origin. For example, a T cell can be a primary T cell, e.g., an autologous T cell, a cell line, etc. The T cell can also be human or non-human.
[0066] The term T cell activation or T cell triggering and its grammatical equivalents as used herein can refer to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation, cytokine production and/or detectable effector function. In some cases, full T cell activation can be similar to triggering T cell cytotoxicity. T cell activation can be measured using various assays known in the art. Said assays can be an ELISA to measure cytokine secretion, an ELISPOT, flow cytometry assays to measure intracellular cytokine expression (CD107), flow cytometry assays to measure proliferation, and cytotoxicity assays (51Cr release assay) to determine target cell elimination.
[0067] The term sequence and its grammatical equivalents when used to refer to a nucleotide sequence (SEQ ID NO in the sequence listing), that can encompass DNA or RNA, and can be either single-stranded or double stranded. A nucleic acid sequence can be mutated. A nucleic acid sequence can be of any length, for example, between 2 and 1,000,000 or more nucleotides in length (or any integer value there between or there above), e.g., between about 100 and about 10,000 nucleotides or between about 200 and about 500 nucleotides.
[0068] As defined herein a polypeptide construct is preferably an engineered polypeptide or a recombinant polypeptide which has been constructed by standard molecular biology techniques and which does not occur in nature. The expression polypeptide construct may be replaced by the word polypeptide.
[0069] The word about when used in association with an integer (about 10) preferably means that the value may be the given value of 10 more or less 1 of the value: about 10 preferably means from 9 to 11. The word about when used in association with a numerical value (about 10.6) preferably means that the value may be the given value of 10.6 more or less 1% of the value 10.6.
[0070] In the context of the invention reference is made to a healthy, normal, or non-cancerous or non-infected cell by comparison to a diseased, cancerous, aberrant, malignant or infected cell. Each of the terms healthy, normal, non-cancerous or non-infected is synonymous and may be interchangeably used. Each of the terms diseased, aberrant is synonymous and can be interchanged with cancerous, malignant or infected.
[0071] In the context of the invention, a part or a fragment or a portion of a nucleic acid or of a nucleic acid sequence or of a polypeptide or of a polypeptide sequence or of an epitope or of an epitope sequence, means at least 50% of the length of its sequence, or at least 60%, or at least 70%, or at least 80%, or at least 90%.
[0072] The term vector and its grammatical equivalents can refer to a composition of matter which comprises an isolated nucleic acid and which can be used to deliver isolated nucleic acid to an interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term vector includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
Targeting Compositions and Methods of Use Thereof
[0073] Disclosed herein are compositions of human leukocyte antigen (HLA)-specific receptors that mediate anti-tumor responses when an HLA receptor is detected on a cell surface. In certain embodiments is a composition comprising polypeptide constructs that encompass one or more HLA-specific receptors, for instance ?? TCRs fragments or variants thereof that can mediate anti-tumor responses. A polypeptide described herein can be utilized to selectively bind a conformationally constrained HLA molecule. In specific embodiments, a polypeptide construct described herein can bind an HLA molecule expressed on a cancer cell selectively as compared to corresponding HLA molecule on non-cancer cells. A polypeptide construct described herein can comprise at least one receptor comprising a sequence disclosed in any one of Table 2, Table 4 and Table 5 or a portion thereof. In some cases, provided herein can be a composition comprising polypeptide constructs that can encompass one or more HLA-specific receptors, for instance ?? TCR fragments or variants thereof that can mediate anti-tumor responses. A polypeptide disclosed herein can be utilized to selectively bind a conformationally constrained HLA molecule. For example, a polypeptide construct disclosed herein can selectively bind a HLA molecule or portion thereof on a target cell when said HLA molecule can be complexed to at least one additional HLA molecule on a target cell. In some cases, a polypeptide construct does not bind to an uncomplexed HLA molecule. In some embodiments, an uncomplexed HLA molecule is a HLA molecule which is not complexed to at least one additional HLA molecule. The polypeptide construct can be expressed in an engineered cell or synthesized.
[0074] In some cases is a method of making an engineered cell expressing a polypeptide construct comprising a HLA receptor described herein. For example, a method can include a step of providing cells; providing a nucleic acid sequence encoding ?? TCR chains or fragments or variants thereof, introducing the nucleic acid sequence into cells to provide for an engineered cell with a ?? TCR receptor, fragment or variant thereof, exhibiting specificity to HLA.
[0075] In some embodiments is a polypeptide construct that selectively binds a HLA molecule or portion thereof on a target cell when said HLA molecule is complexed to at least one additional HLA molecule on a target cell. In some cases, a polypeptide construct does not bind to an HLA molecule which is not complexed to at least one additional HLA molecule (also referred to herein in certain embodiments as an uncomplexed HLA molecule). In some cases, a polypeptide construct can be expressed in an engineered cell or synthesized.
[0076] Disclosed herein can be various forms of binding units comprised by polypeptide constructs described herein. For example, a binding unit comprised by a polypeptide construct described herein can be a ?? TCR, for instance comprising a sequence disclosed in at least one of Table 2, Table 4 and Table 5. A ?? TCR can directly recognize antigens in the form of intact proteins or non-peptidic compounds, unlike ?? TCRs which recognize peptide antigens bound to major histocompatibility complex molecules (MHC). Gamma-delta T cells (?? T cells) can express a unique T-cell receptor (TCR) composed in some cases of one ?-chain and one ?-chain. Each T cell receptor can be a dimer consisting of one alpha and one beta chain or one delta and one gamma chain. In a single cell, the T cell receptor loci are rearranged and expressed in the order delta, gamma, beta, and alpha. The gamma locus includes V (variable), J (joining), and C (constant) segments.
[0077] For example, in some cases ??T cell clones can recognize Class I or Class II MHCs, including HLA-DR7, HLA-A2, HLA-A*24 (see Spits et al., 1990, Cytotoxic activity and lymphokine production of T cell receptor (TCR)-??.sup.+ and TCR-??.sup.+ cytotoxic T lymphocyte (CTL) clones recognizing HLA-A2 and HLA-A2 mutants, The Journal of Immunology 144: 4156-4162, and Ciccone et al., 1989, Specificity of human T lymphocytes expressing a ?/? T cell antigen receptor. European Journal of Immunology 19: 1267-1271). However, in direct contrast to the aforementioned references, ??T cell compositions described herein recognize HLA-A*24:02 expressed by malignant cells and not healthy counterpart cells and the recognition can be inhibited by fixation of cells, which may suggest spatial and conformational changes during the recognition process which differs from also classical allo- or peptide-reactivitiy of ??T cells.
[0078] In embodiments described herein, a polypeptide construct comprises a ??TCR that can target a cancer. Examples of various cancers that can be targeted with engineered T cells, including ??TCR-engineered T cells, include but are not limited to liver cancer, stomach cancer, esophageal cancer, lung cancer, breast cancer, head and neck cancer, ovarian cancer, kidney cancer, bladder cancer, cervical cancer, pancreatic cancer, liposarcoma, testicular noneminomatous germ cell cancer, melanoma, adenoma, adrenal cancer, schwannoma, malignant, fibrous histiochytoma, or any combination thereof. Additionally immunoresponsive cells disclosed herein, such as ??TCR-expressing T cells disclosed herein, can be utilized to target ovarian carcinoma, cholangiocarcinoma, mesothelioma, breast cancer, squamous cell carcinoma of the lunch, cervical intraethithelial neoplasia, squamous cell carcinoma of the cervix, intrahepatic and extrahepatic cancer, gallbladder carcinoma, invasive ductal carcinoma, clear cell carcinoma, oncocytoma, papillary carcinoma, adenocarcinoma, papillary carcinoma, and lobular and medullary carcinoma of the breast.
[0079] In some cases, a ??TCR can target an antigen or portion thereof expressed on a tumor, such as HLA-A*24:02 without the need for HLA processing and presentation. A ?? TCR described herein can bind a germline-encoded receptor repertoire. For example, a ??TCR can recognize and bind stress-induced self-antigens, lipids, or pyrophosphates that can be secreted by some microbes, for instance a virus or can be overproduced in tumor cells. A ?? TCR can additionally bind a surface expressed protein of a cell or portion thereof. In some cases, a ?? TCR can also bind a protein or portion thereof that can be expressed due to a DNA damage pathway. In some cases, a ??TCR described herein can also bind a lipid or portion thereof expressed on a cancer cell.
[0080] In some cases, HLA-A*24:02 may be overexpressed on a cancer and have reduced or no expression on normal tissue. In some cases, specific antigens and epitopes thereof of a cancer can be targeted with a ??TCR or an endogenous or exogenous ??TCR. Antigens may be derived from a wide variety of tumor antigens such as those from tumors resulting from mutations, shared tumor specific antigens, differentiation antigens, and antigens overexpressed in tumors.
[0081] In some cases, a peptide can be any self-peptide in combination with spatial and/or conformational changes (target-conformation, short: T-conformation) in an HLA, such as HLA-A*24:02, which can differ from healthy, non-stressed, or non-transformed cells. In some cases, a cancer cell may aberrantly express an HLA-A protein in a K-confirmation. In some cases, complexing of an HLA-A can comprise a clustering of an HLA molecule on a tumor cell surface. In some cases, a complex comprises a K-conformation. A K-conformation can comprise at least one of differential special distribution or differential clustering of an HLA molecule on a tumor cell when compared to a comparable normal cell, such as a non-tumorous comparable cell.
[0082] In some cases, provided herein can be a method of identifying an antigen binding unit that can be immunoreactive with a desired antigen. Such a method can involve the following steps: (a) preparing a genetically diverse library of antigen binding units, wherein a library can comprise at least one subject antigen binding unit; (b) contacting a library of antigen binding units with a desired antigen; (c) detecting a specific binding between antigen binding units and an antigen, thereby identifying an antigen binding unit that can be immunoreactive with a desired antigen.
[0083] Tissue expression of an antigen or T-conformation (both can be a target or the target) may be measured by immunohistochemistry (IHC) analysis and/or flow cytometric analysis. Tissue expression may also be measured in terms of copy number by quantitative PCT (qPCR). In some cases, a target antigen may be expressed on a cell surface of a cancer. ??TCR may target cell surface antigens in a non-MHC restricted manner. Overexpression can be or can be about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or up to 100-fold over expression on a normal tissue as measured by IHC, qPCR, or flow cytometry.
[0084] The ability of an antigen binding unit to specifically bind to a desired antigen or target can be tested by a variety of procedures well established in the art. See Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Gherardi et al. (1990) J. Immunol. Meth. 126:61-68. Typically, antigen binding units exhibiting desired binding specificities can be detected directly by immunoassays, for example, by reacting labeled antigen binding units with the antigens that are immobilized on a solid support or substrate. In general, a substrate to which an antigen can adhere can be fabricated with material exhibiting a low level of non-specific binding during immunoassay. An example solid support can be made from one or more of the following types of materials: plastic polymers, glass, cellulose, nitrocellulose, semi-conducting material, and metal. In some examples, a substrate can be a petri dish, chromatography beads, magnetic beads, and the like.
[0085] For such solid-phase assays, unreacted antigen binding units can be removed by washing. In a liquid-phase assay, however, unreacted antigen binding units can be removed by some other separation technique, such as filtration or chromatography. After binding an antigen to labeled antigen binding units, an amount of bound label can be determined. A variation of this technique can be a competitive assay, in which an antigen can be bound to saturation with an original binding molecule. When a population of a subject antigen binding unit can be introduced to a complex, only those that exhibit higher binding affinity may be able to compete, and thus remain bound to an antigen.
[0086] Alternatively, specific binding to a given antigen or to a given target can be assessed by cell sorting, which involves presenting a desired antigen on cells to be sorted, then labeling target cells with antigen binding units that may be coupled to detectable agents, followed by separating labeled cells from unlabeled ones in a cell sorter. A sophisticated cell separation method can be fluorescence-activated cell sorting (FACS).
[0087] Subsequent analysis of eluted antigen or target binding units may involve protein sequencing for delineating amino acid sequences of the light chains and heavy chains. Based on the deduced amino acid sequences, a cDNA encoding antibody polypeptides can then be obtained by recombinant cloning methods including PCR, library screening, homology searches in existing nucleic acid databases, or any combination thereof. Commonly employed databases include but are not limited to GenBank, EMBL, DDBJ, PDB, SWISS-PROT, EST, STS, GSS, and HTGS.
[0088] Due to the degeneracy of the genetic code, there can be considerable variation in nucleotides of a polypeptide construct coding sequence, as well as sequences suitable for construction of a polynucleotide and vectors disclosed herein. Sequence variants may have modified DNA or amino acid sequences, one or more substitutions, deletions, or additions, the net effect of which can be to retain a desired binding activity. For instance, various substitutions can be made in a coding region that either do not alter amino acids encoded or result in conservative changes. These substitutions can be encompassed herein. Conservative amino acid substitutions can include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. While conservative substitutions may not effectively change one or more amino acid residues contained in a polypeptide to be produced, substitutions may not interfere with an antigen-binding activity of a resulting antigen binding unit to be produced. Nucleotide substitutions that may not alter amino acid residues encoded can be useful for optimizing gene expression in different systems. Suitable substitutions are known to those of skill in the art and are made, for instance, to reflect preferred codon usage in expression systems. In some cases, modifications to a binding unit can be made to alter binding activity of a target.
[0089] In some cases, a desired binding unit in a polypeptide construct may be an alpha beta TCR (??-TCR). In some embodiments, a T cell receptor (TCR) comprised by a polypeptide construct described herein is composed of multiple chains (?? or ??) that pair on the surface of the T cell to form a heterodimeric receptor.
[0090] An ?? TCR can be expressed on most T cells in the body and can be known to be involved in the recognition of specific MHC-restricted antigens. Each ? and ? chain are composed of two domains: a constant domain (C) which anchors the protein to the cell membrane and is associated with invariant subunits of the CD3 signaling apparatus; and a variable domain (V) that confers antigen recognition through six loops, referred to as complementarity determining regions (CDRs). Each of the V domains comprises three CDRs; e.g., CDR1, CDR2 and CDR3 with CDR3 as the hypervariable region. These CDRs interact with a complex formed between an antigenic peptide bound to a protein encoded by the major histocompatibility complex (pepMHC) (e.g., HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, or HLA-DRB1 complex). In some instances, the constant domain further comprises a joining region that connects the constant domain to the variable domain. In some cases, the beta chain further comprises a short diversity region which makes up part of the joining region.
[0091] In some cases, ??T cells can bind to ligands that can be different from those of ??T cells. For example, ??T cell recognition in some cases may not utilize antigen processing and in some cases ??T cells can recognize proteins directly (Chien et al., 1996, Recognition by ?/? T cells, Annual Review of Immunology 14: 511-532). In contrast to an ?? TCR, the ?? TCR is composed of one ? chain and one ? chain. Although much less abundant in the body than ?? Tcells, ?? T cells combine potent anti-tumor effector functions with the recognition of broadly expressed tumor-associated molecules, and therefore are strong candidates for clinical application in cancer immunotherapy. The majority of ?? T cells are activated in an MHC-independent manner and do not require antigen processing, which is in contrast to MHC-restricted ?? T cells. Instead, ?? T cells rely on cell-cell contact with antigen-presenting cells and directly recognize antigens in the form of intact proteins or non-peptidic compounds. Activation of ?? T cells by TCR-mediated antigen recognition on a target cell can lead to production of cytokines and chemokines as well as cytoloysis of the target cell (e.g., tumor cell).
[0092] In some cases, a difference between HLA-A*02 and HLA-A*24 can reside in a peptide binding cleft, ?1 and ?2 helices, or a combination thereof. In some cases, a residue that may be altered can be W107, A185, S207, or a combination thereof in an HLA-A*02 structure. In other cases, an HLA-A*24 protein may have substitutions of G, P and G at these locations, respectively. Polymorphisms can exist throughout an HLA-A*24 protein. For example, a polymorphism can be on a C-terminus, N-terminus, or a combination thereof.
[0093] In some cases, a polymorphism can be plotted in an HLA-A protein. For example, an HLA-A*02 can have a polymorphism on an alpha3 domain. In some cases a polymorphism can have effects on binding. In some cases polymorphisms on an HLA-A protein, such as HLA-A*24 can result in differences in binding at the CD4 vs CD8 binding site.
[0094] V?9V?2 T cells, the major ?? T cell subset in human peripheral blood, can express ?? TCRs composed of V?9 and V?2 chains, and are specifically activated by intermediates of the mammalian mevalonate pathway such as isopentenyl pyrophosphate (IPP) or the microbial 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. Intracellular phosphoantigen (pAg) levels accumulate in tumor cells due to dysregulation of the mevalonate pathway or upon microbial infection, allowing the targeting of transformed or infected cells by V?9V?2 cells. Similarly, intracellular pAg levels can be pharmaceutically increased by treating cells with mevalonate pathway inhibitors such as aminobisphosphonates (ABPs), thereby sensitizing cells toward recognition by V?9V?2 T cells. In some cases, a V?5V?1 TCR can be utilized in a composition provided herein.
[0095] Any V? V? TCR, preferably a V?5V?1 TCR or other V?2.sup.neg ?? TCR can be isolated and introduced into a T cell, preferably an ?? T cell. In some cases, an endogenous TCR of an ?? T cell remains present. In other cases, an endogenous ?? TCR is genomically distrupted before, concurrent with, or after introduction of a V?5V?1 TCR or other V?2.sup.neg ?? TCR.
[0096] In adult peripheral blood, a ??T cell subset can express TCRs comprising V?2 and V?9 gene segments and can be referred to as V?2.sup.pos ??T cells. In contrast, ?? T cells that reside in epithelial tissue express TCRs composed of mainly V?1 or V?3 chains paired with diverse V? chains, and a proportion of these ??-T cells expresses CD8?? or CD8??, which can be referred to as V?2.sup.neg ??-T cells. It has been demonstrated that CD8?? or CD8?? can play a co-stimulatory role for leukemia-reactive V?1 TCRs (Scheper et al., 2013, ?? T cells elicited by CMV reactivation after allo-SCT cross-recognize CMV and leukemia, Leukemia 27: 1328-1338). In some cases, V?2.sup.neg ??T cells may be used as a tool to tackle CMV infection and leukemia. In other cases, a CD8??, CD8??, or other molecules can play a co-stimulatory role for ??T cells that are reactive to HLA-A*24 expressed by cancer cells.
[0097] In some cases, a co-receptor may be involved in HLA interaction of a polypepetide construct described herein. For example, a co-receptor may be recruited or involved in a TCR-peptide binding in the context of HLA or independent of HLA. Various co-receptors may be involved. For example, at least one of CD8, CD4, CD28, CCR, and CXCR4 may be involved. A CD receptor may be a co-receptor for a TCR-HLA interaction. For example, CD4 acts as a co-receptor to the TCR when it can bind HLA-Class II. CD8 acts as a co-receptor to the TCR when it can bind HLA-Class I. A CD4 receptor in particular can interact with HLA class II following a ball-on-stick model, where a Phe-43 ball fits into the conserved hydrophobic ?2 and ?2 domain residues. During binding with class II, CD4 maintains independent structure and may not form any bonds with the TCR receptor. In some cases, a co-receptor can be CD8, such as CD8 alpha.
[0098] In some cases, a soluble binding unit can be generated and included as part of a polypeptide construct described herein. An affinity of a TCR ligand interaction can be relatively low as compared to an antibody. One of the reasons for this difference can be avidity. For example, antibodies can have 2 ligand binding sites on one molecule leading to enhanced binding. Antibodies can have from 1 to 10 ligand binding sites in some cases. For example, several TCR-antibody chimeras can be generated and tested before arriving at a desired chimera. For example, ??-variable domains can replace heavy and light chain variable domains of an antibody. In addition to enhanced binding, an Fc domain of an antibody can mediate cytotoxicity through Fc?-receptor positive immune cells and/or a complementary system. In some cases, TCR-antibody chimeras can be generated using HEK293 cells and subsequently purified using protein A affinity chromatography followed by size exclusion chromatography. A proper folding of chimeras can be probed using conformational-specific antibodies that can target ? and ? variable domains. Chimeras can be used in antibody dependent cell mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) assays to determine functional efficacy to HLA-A*24:02 tumor cells. After performing in vitro assays, functional efficacy of TCR-antibody chimeras can be tested in vitro and/or in vivo.
[0099] In some cases, a soluble form of a polypeptide construct can recognize a complexed HLA-A*24 or portion thereof. A polypeptide construct can include various forms to binding entities such as a TCR, antibody, scFv, BCR, or any combination thereof. In some cases, at least a portion of a TCR, such as a V?9V?2 or V?5V?1, can be generated and utilized in a pharmaceutical composition. A soluble form of a V?9V?2 or V?5V?1 can recognize and bind a complexed HLA-A. In some cases, a soluble form of a V?9V?2 or V?5V?1 can recognize and bind a complexed HLA-A*24 on a tumor cell. In some cases, a soluble form of V?9V?2 or V?5V?1 can recognize and bind a complexed HLA-A*24:02. A soluble form of a polypeptide can also recognize and bind an aberrant expression of an HLA-A*24 that may comprise at least one of an aberrant structure, aberrant mobility, aberrant flexibility, or aberrant compartmentalization as compared to a non-aberrantly expressed HLA-A*24 on a comparable healthy cell. In some cases, complexing can comprise a clustering of an HLA molecule. In some cases, a complex comprises a K-conformation. A K-conformation can comprise at least one of differential special distribution or differential clustering of said HLA molecule when compared to a comparable normal cell. In some cases, a composition disclosed herein can target and bind an HLA-A*24:02 in a K-conformation.
Human Leukocyte Antigen (HLA)
[0100] HLA-A belong to a HLA class I heavy chain paralogue. This class I molecule can be a heterodimer including a heavy chain and a light chain (beta-2 microglobulin). A heavy chain can be anchored in the membrane. Class I molecules can play a role in an immune system by presenting peptides derived from an endoplasmic reticulum lumen. They can be expressed in nearly all cells. A heavy chain can be approximately 45 kDa and its gene can contain 8 exons. Exon 1 can encode a leader peptide, exons 2 and 3 can encode alpha1 and alpha2 domains, which can both bind a peptide, exon 4 can encode an alpha3 domain, exon 5 can encode a transmembrane region, and exons 6 and 7 can encode a cytoplasmic tail. Polymorphisms within exon 2 and exon 3 can be responsible for the peptide binding specificity of each class one molecule. Hundreds of HLA-A alleles have been described. Provided herein are polypeptide constructs comprising, for instance, ?? TCR or fragment or variant thereof with a pre-defined specificity that can be introduced into a cell. In certain cases, a ?? TCR can be specific to HLA-A or a residue thereof of Table 1 and/or one or more of its polymorphisms. Preferably a ?? TCR can be specific to and bind the identity of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% of SEQ ID NO: 1.
TABLE-US-00001 TABLE1 HLA-A SEQ ID NCBINo: NO: Abbrev. Name GRCh38.p7 Genomicsequence 1 HLA-A major 3105 GAGAAGCCAATCAGTGTCGTCGCGGTCGCTGTTCTA histo- AAGTCCGCACGCACCCACCGGGACTCAGATTCTCCC compatibility CAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACC complex,class CTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACC I,A CAGACCTGGGCGGGTGAGTGCGGGGTCGGGAGGGAA ACCGCCTCTGCGGGGAGAAGCAAGGGGCCCTCCTGG CGGGGGCGCAGGACCGGGGGAGCCGCGCCGGGAGGA GGGTCGGGCAGGTCTCAGCCACTGCTCGCCCCCAGG CTCCCACTCCATGAGGTATTTCTTCACATCCGTGTC CCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGT GGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGA CAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGC GCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGA CCAGGAGACACGGAATATGAAGGCCCACTCACAGAC TGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTA CAACCAGAGCGAGGACGGTGAGTGACCCCGGCCCGG GGCGCAGGTCACGACCCCTCATCCCCCACGGACGGG CCAGGTCGCCCACAGTCTCCGGGTCCGAGATCCACC CCGAAGCCGCGGGACTCCGAGACCCTTGTCCCGGGA GAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGT TTAGGCCAAAAATCCCCCCGGGTTGGTCGGGGCGGG GCGGGGCTCGGGGGACTGGGCTGACCGCGGGGTCGG GGCCAGGTTCTCACACCATCCAGATAATGTATGGCT GCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGT ACCGGCAGGACGCCTACGACGGCAAGGATTACATCG CCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGG ACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGG CGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGG AGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGG AGAACGGGAAGGAGACGCTGCAGCGCACGGGTACCA GGGGCCACGGGGCGCCTCCCTGATCGCCTATAGATC TCCCGGGCTGGCCTCCCACAAGGAGGGGAGACAATT GGGACCAACACTAGAATATCACCCTCCCTCTGGTCC TGAGGGAGAGGAATCCTCCTGGGTTTCCAGATCCTG TACCAGAGAGTGACTCTGAGGTTCCGCCCTGCTCTC TGACACAATTAAGGGATAAAATCTCTGAAGGAGTGA CGGGAAGACGATCCCTCGAATACTGATGAGTGGTTC CCTTTGACACCGGCAGCAGCCTTGGGCCCGTGACTT TTCCTCTCAGGCCTTGTTCTCTGCTTCACACTCAAT GTGTGTGGGGGTCTGAGTCCAGCACTTCTGAGTCTC TCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGT TCCCTTCTCAGGGAATAGAAGATTATCCCAGGTGCC TGTGTCCAGGCTGGTGTCTGGGTTCTGTGCTCTCTT CCCCATCCCGGGTGTCCIGTCCATTCTCAAGATGGC CACATGCGTGCTGGTGGAGTGTCCCATGACAGATGC AAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACC CCCCCAAGACACATATGACCCACCACCCCATCTCTG ACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCT TCTACCCTGCGGAGATCACACTGACCTGGCAGCGGG ATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGG AGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGT GGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGA GATACACCTGCCATGTGCAGCATGAGGGTCTGCCCA AGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATG GGGGTGTCATGTCTCTTAGGGAAAGCAGGAGCCTCT CTGGAGACCTTTAGCAGGGTCAGGGCCCCTCACCTT CCCCTCTTTTCCCAGAGCTGTCTTCCCAGCCCACCA TCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCC TTGGAGCTGTGATCACTGGAGCTGTGGTCGCTGCCG TGATGTGGAGGAGGAAGAGCTCAGGTGGAGAAGGGG TGAAGGGTGGGGTCTGAGATTTCTTGTCTCACTGAG GGTTCCAAGCCCCAGCTAGAAATGTGCCCTGTCTCA TTACTGGGAAGCACCTTCCACAATCATGGGCCGACC CAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTTTG TAAAGCACCTGTTAAAATGAAGGACAGATTTATCAC CTTGATTACGGCGGTGATGGGACCTGATCCCAGCAG TCACAAGTCACAGGGGAAGGTCCCTGAGGACAGACC TCAGGAGGGCTATTGGTCCAGGACCCACACCTGCTT TCTTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGT CACACATTTCTGGAAACTTCTCTGGGGTCCAAGACT AGGAGGTTCCTCTAGGACCTTAAGGCCCTGGCTCCT TTCTGGTATCTCACAGGACATTTTCTTCCCACAGAT AGAAAAGGAGGGAGTTACACTCAGGCTGCAAGTAAG TATGAAGGAGGCTGATGCCTGAGGTCCTTGGGATAT TGTGTTTGGGAGCCCATGGGGGAGCTCACCCACCCC ACAATTCCTCCTCTAGCCACATCTTCTGTGGGATCT GACCAGGTTCTGTTTTTGTTCTACCCCAGGCAGTGA CAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTG TAAAGGTGAGAGCTTGGAGGGCCTGATGTGTGTTGG GTGTTGGGTGGAACAGTGGACACAGCTGTGCTATGG GGTTTCTTTGCGTTGGATGTATTGAGCATGCGATGG GCTGTTTAAGGTGTGACCCCTCACTGTGATGGATAT GAATTTGTTCATGAATATTTTTTTCTATAGTGTGAG ACAGCTGCCTTGTGTGGGACTGAGAGGCAAGAGTTG TTCCTGCCCTTCCCTTTGTGACTTGAAGAACCCTGA CTTTGTTTCTGCAAAGGCACCTGCATGTGTCTGTGT TCGTGTAGGCATAATGTGAGGAGGTGGGGAGAGCAC CCCACCCCCATGTCCACCATGACCCTCTTCCCACGC TGACCTGTGCTCCCTCTCCAATCATCTTTCCTGTTC CAGAGAGGTGGGGCTGAGGTGTCTCCATCTCTGTCT CAACTTCATGGTGCACTGAGCTGTAACTTCTTCCTT CCCTATTAAAATTAGAACCTGAGTATAAATTTACTT TCTCAAATTCTTGCCATGAGAGGTTGATGAGTTAAT TAAAGGAGAAGATTCCTAAAATTTGAGAGACAAAAT TAATGGAACGCATGAGAACCTTCCAGAGTCCA
[0101] Provided herein is a polypeptide construct comprising a ?? TCR or fragment or variant thereof that can bind HLA-A*24:02. In some cases, a ?? TCR or fragment or variant thereof described herein can be expressed in an engineered ?? T cell. In some cases, a polypeptide construct comprising a ?? TCR or fragment or variant thereof that is HLA-restricted may only bind HLA expressed on a cancer and not on a healthy tissue. A healthy or normal tissue that can express HLA-A can be an adrenal, appendix, bone marrow, brain, colon, duodenum, endometrium, esophagus, fat, gall bladder, heart, kidney, liver, lung, lymph node, ovary, pancreas, placenta, prostate, salivary gland, skin, small intestine, spleen, stomach, testis, thyroid, urinary bladder, or any combination thereof. In some cases, an HLA-A protein can be differentially expressed on a cancer relative to its expression on a healthy tissue. In some cases, HLA-A expression on a cancer can be an aberrant expression of HLA-A. An aberrant expression can include aberrations in terms of mobility, flexibility, folding, and/or compartimentalization as compared to HLA expressed on a comparable cell. For example, a cancer cell can have aberrant expression of HLA-A as compared to a non-cancerous comparable cell. An aberrant expression can include differences in mobility of an HLA-A on a cancer cell surface that can influence binding of a TCR. Similarly an aberrant expression can influence flexibility of an HLA protein, such as HLA-A, on a cancer cell. Aberrant expressions of HLA-A on target cells can create unique binding sites or unique binding comformations that may not be present on comparable cells. Compositions disclosed herein can include polypeptide constructs engineered to harness aberrant HLA-A expressions, or engineered cells expressing such polypeptide constructs, to provide tumor-targeted therapies with reduced off-target binding.
[0102] In some cases, a polypeptide construct disclosed herein can comprise a ?? TCR or fragment or variant thereof that can be specific to HLA-A and/or one or more of its polymorphisms expressed on a tumor and not on a healthy tissue. In some cases, a polypeptide construct disclosed herein can comprise a ?? TCR or fragment or variant thereof that can be specific to HLA-A*24:02 and any of its alleles expressed on a tumor and not on a healthy tissue. In some cases, a polypeptide construct described herein can be specific to one or more HLA-A configurations expressed on a tumor and not on a healthy tissue. In some cases, a polypeptide construct may be specific to HLA-A*24:02 expressed on a tumor and not on a healthy tissue. A polypeptide construct can recognize and bind a malignant transformed cell. In some cases, a malignant transformed cell can be HLA-A*24:02 positive. In some cases, a ?? TCR binds a CD8 binding site of an HLA-A*24 protein. In some cases, a residue that can be bound can be W107, A185, S207, and any combination thereof. In some cases, a residue that can be bound can be G, P and G, and any combination thereof. In some cases, a C-terminal residue of an HLA-A*24 protein can be bound. In other cases, an N-terminus residue of an HLA-A*24 protein can be bound. In some cases, a ?? TCR can bind a peptide binding cleft of an HLA-A*24 protein. In some cases, a ?? TCR can bind an A pocket of a peptide binding cleft.
[0103] A polypeptide construct described herein can comprise at least one receptor chain comprising or consisting of, or being derived from, a sequence disclosed in any one of Table 2, Table 4, Table 5, and Table 6 or a portion thereof. Disclosed herein can be an antigen binding unit, such as a ?? TCR or portion thereof, comprising at least one CDR. In some aspects, an antigen binding unit can comprise a light chain CDR. A light chain CDR can be a complementarity determining region of a light chain of an antigen binding unit. A light chain CDR can comprise a continuous sequence of amino acid residues, or two or more contiguous sequences of amino acid residues separated by, and optionally flanked by, non-complementarity determining regions, such as framework regions. In some examples, a light chain CDR comprises two or more light chain CDRs, which can be referred to as light chain CDR-1, CDR-2, and so on. In some aspects, an antigen binding unit can comprise a heavy chain CDR. A heavy chain CDR can be a complementarity determining region of a heavy chain of an antigen binding unit. A heavy chain CDR can comprise a continuous sequence of amino acid residues, or two or more contiguous sequences of amino acid residues separated by, and optionally flanked by, non-complementarity determining regions, such as framework regions. In some examples, a heavy chain CDR comprises two or more heavy chain CDRs, which can be referred to as heavy chain CDR-1, CDR-2, and so on. In some cases, a CDR3 sequence may be utilized. Disclosed herein can also be methods of generating CDR sequences, such as CDR3 sequences that can bind a target. For example, an FE11-like CDR3 sequence can be generated. An FE11 or FE11-like CDR3 sequence can be an antibody or binding portion thereof that can bind an HLA-A*24. An FE11-like CDR3 sequence can be an antibody or binding portion thereof that shares at least a portion of homology with an FE11 polypeptide or encoding nucleic acid molecule. In some cases, an FE11-like CDR3 sequence may have a difference in comformation, binding, amino acid sequence, or a difference in a portion of a sequence. An activity of a reference FE11 is retained to at least some extent in said FE11 or FE11-like CDR3 sequence. An activity of a reference FE11 may be the binding to HLA-A*24. Such a binding can be assessed using techniques known to a skilled person. Within this context at least some extent may mean at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100% or more. Another activity of an FE11 or FE11-like CDR3 sequence can an anti-tumor or anti-cancer or anti-infectious activity or response.
[0104] An anti-tumor response may be assessed by contacting T cells expressing a gamma and/or delta sequence as identified herein with tumor cells (i.e. so-called engineered T cells). It is clear to a skilled person that said T cells used should also express a ?T cell receptor chain in order to assess the biological relevance of a ?T cell receptor chain. In other words a ??TCR is preferably expressed in said T cells, the ?TCR being the one identified herein. Alternatively a ??TCR is preferably expressed in said T cells, the ?TCR being the one identified herein. Alternatively, a ??TCR is preferably expressed in said T cells, each of the TCR chains being the ones identified herein. In a preferred embodiment, the nucleic acid molecule encoding the ?T-cell (or ?T-cell) receptor chain or part thereof is provided in an expression vector or in a retroviral or lentiviral vector in a T cell. The T cells may be expanded before or after the transfer of the nucleic acids encoding the ?T-and/or ?T-cell receptor chain. Preferably, the expansion is after the transfer such that the amount of nucleic acids that needs to be transferred is as low as possible. This expansion of said T cells may be performed by stimulation with anti-CD3/CD28 Dynabeads in the presence of IL-2. The expanded cells comprising the engineered ?? T-cell receptor, may be selected e.g. via a selectable marker and may be further selected for the presence of the CD4 antigen and the CD8 antigen, e.g. using the MACS separating system as described in the examples. The engineered T-cells may be subsequently further expanded using the REP protocol as described by Riddel and Greenberg, 1990 J Immunol Methods. 128(2): 189-201, which is incorporated herein by reference, or using similar further expansion methods thereto. Briefly, the expansion method involves using antibodies directed against T cell activation molecules, such as TCR, CD3 and CD28 and/or feeder cells and/or stimulating cytokines.
[0105] The anti-tumor response of said T-cell expressing a ?T-cell (or ?T-cell) receptor chain may be assessed using any technique known to the skilled person. A ?T-cell receptor chain may be a ?2-T cell receptor chain. A ?T-cell receptor chain may be a ?9-T cell receptor chain. The step of determining an anti-tumor activity may include any assay in which an anti-tumor effect may be determined, such as having an effect on tumor cell division rate, i.e. the speed with which the tumor cells divide, cell death, binding to the tumor cells, induction of the production of a cytokine such as IFN?, IL-2 or TNF?. Tumor cells may be any kind of tumor cells. For example, primary tumor cells from a patient. The tumor cells may be tumor cells from cell lines, such as the cell lines listed in the examples named Daudi, RPMI8226/S, OPM2, LME1, K562, Saos2, MZ1851 RC, SCC9, Fadu, MDA-MB231, MCF7, BT549, SW480, which are well known in the art. Tumor cell lines may easily be obtained from the American Type Culture Collection (ATCC, Manassas, Va.) and the like.
[0106] In a preferred embodiment, determining the anti-tumor responses includes contacting said engineered T cell with a tumor cell and measuring its ability to lyse the tumor cell and/or induce the production of a cytokine such as IFN-?, IL-2 or TNF?. This contacting, culturing or incubation step may have a duration from 10 hours to 1, 2, 3, 4, 5 days. The ability to lyse the tumor cells include providing a fixed amount of tumor cells with which said T cell is contacted and after an incubation period the number of viable tumor cells is counted. An anti-tumor response may have been identified or determined when the number of viable tumor cells at the end of the incubation step is less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10% of the number of initial tumor cells at the onset of the incubation step. Alternatively, an anti-tumor response may have been identified or determined when the number of viable tumor cells at the end of the incubation step with the engineered T cells is lower than the number of tumor cells at the end of a similar incubation step with control T cells not engineered with sequences identified as shared. Lower in this context may mean at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower.
[0107] In addition or as alternative to the counting of the number of viable tumor cells at the end of the incubation step, one may also perform a .sup.51Chromium-release assay which is known to the skilled person. The amount of .sup.51Chromium release is a measure of the number of cells that have been lysed. Similarly, the production of a cytokine such as IFN-?, IL-2 or TNF? or the secretion or the expression of activation markers may also be determined, e.g. via antibody staining, ELISA and/or quantitative PCR for the expressed mRNA. Assays for determining the production of a cytokine such as IFN-?, IL-2 or TNF? are commercially widely available. When the production of a cytokine such as IL-2, TNF? or IFN? is detected, said T cell is said to exhibit an anti-tumor response. Alternatively and preferably, when the amount of IFN?, IL-2 or TNF? produced at the end of the contacting step with engineered T cells is higher (preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more) than the amount of IFN? IL-2 or TNF? produced when tumor cells are contacted with control T cells, the T cells is said to exhibit an anti-tumor response. Control T cells do not express a defined nucleic acid molecule encoding an amino acid comprising a ?T-cell (or ?T-cell) receptor chain identified herein. An anti-tumor response may also be determined by assessing the binding of the engineered T cells to the tumor cell at the end of the incubation step. When binding of the engineered T cell to the tumor cell is detected at the end of the contacting step, the T cell is said to exhibit an anti-tumor response. Alternatively and preferably, when the binding of the T cell at the end of the contacting step is higher (preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more) than the binding of control T cells (see earlier definition) to the same tumor cell, the T cells is said to exhibit an anti-tumor response. The contacting step may be carried out in the presence of a phosphoantigen, such as pamidronate.
[0108] Methods of generating CDR sequences that can bind a target can include mutations, subsitutions, deletions, insertions, among other techniques. For example, an FE11-like CDR3 sequence can be generated by amino acid substitution. Any number of amino acids can be substituted. Amino acid subsitutations can include from about 1 to about 1000. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or up to about 1000 amino acids can be substituted. A number of amino acid substitutions may also be defined in one of the following ways: as having at least 1 substituted amino acid per 10, 15, 20, 25 amino acids present in the molecule considered, as having at least 1%, at least 5%, at least 10%, at least 15% of substituted amino acids.
[0109] Amino acid subsitutions can have various effects on a CDR region. In some cases, a subsitutions or mutation can affect a stability of a domain. In other cases, a subsitutions or mutation can affect a level of expression. A substitution or mutation of a CDR region, such as CDR3, can affect a structure. Changes to a CDR3 region can include a variable domain, a constant domain, or a combination thereof. In some cases, a substitution or mutation can affect ligand binding. A substitution, mutation, deletion, or insertion can be performed on at least a portion of a J?1 and/or J?1 segment. In some cases, a substitution or mutation can affect ligand binding. A substitution, mutation, deletion, or insertion can be performed on on a C terminus, N terminus, or both termini of an amino acid sequence. In some cases, a mutated polypeptide or a polypeptide with at least one substitution by comparison to a reference polypeptide, said mutated polypeptide can include any one of SEQ ID NO: 2 to SEQ ID NO: 428. In a preferred embodiment, there is provided a polypeptide which is represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any of amino acid sequence SEQ ID NO: 2, SEQ ID NO: 3, amino acids 19-309 of SEQ ID NO: 4, amino acids 21-293 of SEQ ID NO: 5, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 to SEQ ID NO: 428. Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.
[0110] In some cases, an engineered cell can comprise at least a portion or a part of a receptor that is encoded by a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NO: 6 to SEQ ID NO: 428. Preferably the identity is assessed over the whole length. In some cases, a mutant sequence can be found within a gamma or delta chain of a TCR.
[0111] In certain methods disclosed herein, a CDR3 region of a ?9T-cell receptor or ?9 negative ?T-cell receptor chain and the ?2T-cell receptor or ?2 negative ?T-cell receptor chain can be modified and combined to form a novel ?9?2TCR that selectively binds an HLA conformation disclosed herein. In a more preferred embodiment, there is provided a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 6 to 237. Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. In another more preferred embodiment, there is provided a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 238 to 428. Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.
[0112] In certain embodiments, are polypeptide constructs comprising a ?9 negative ?T-cell receptor chain, a ?2T-cell receptor, and/or, a ?2 negative ?T-cell receptor chain. The designed ??TCR can be provided and preferably integrated into T-cells, which can subsequently express a ??TCR at the cell surface. Accordingly the anti-tumor response of the CTE-engineered T-cells is determined. In this way multiple combinations can be tested, and for each combination the anti-tumor response can be determined. After determining an anti-tumor response, ?9?2T-cell receptors that mediate highly active anti-tumor responses can be identified. In certain methods disclosed herein, a CDR3 region of a ?5T-cell receptor chain and the ?1T-cell receptor chain can be modified and combined to form a novel ?5?1TCR that selectively binds an HLA conformation disclosed herein. In certain embodiments, are polypeptide constructs comprising ?5T-cell receptor chains and/or MT-cell receptor chains disclosed in one or more of Tables 2, 4 and 5. The designed ?5?1TCR can be provided and preferably integrated into T-cells, which subsequently express a ?5?1TCR at the cell surface. Accordingly the anti-tumor response of the CTE-engineered T-cells is determined. In this way multiple combinations can be tested, and for each combination the anti-tumor response can be determined. After determining an anti-tumor response, ?5?1T-cell receptors that mediate highly active anti-tumor responses can be identified. Accordingly, there is provided a TCR, preferably an engineered TCR comprising: a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 3, and 6 to 237 and a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 2, and 238 to 428. Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. In some aspects of any of the embodiments disclosed herein, a subject antigen binding unit specifically binds to at least a portion of HLA-A*24:02. HLA-A*24:02 as used herein can also refer to orthologues, homologues, codon-optimized forms, truncated forms, fragmented forms, mutated forms, or any other known derivative form of a known HLA-A*24:02 sequence. For example, HLA-A*24:02 can be human HLA-A*24:02. HLA-A*24:02 can be murine HLA-A*24:02. In some cases, an MHC can be from a mammal such as a chimpanzee, pig, gorilla, chicken, cow, goat, to name a few.
[0113] In some cases a ?? TCR can comprise homology to SEQ ID NO: 2, amino acids 19-309 of SEQ ID NO: 4, SEQ ID NO:4 or SEQ ID NOs: 238-428 from Table 6, from about or from 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%. In some cases a ?? TCR can comprise homology to SEQ ID NO: 3, amino acids 21-293 of SEQ ID NO: 5, SEQ ID NO: 5 or SEQ ID NOs: 6-237 from Table 5, from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%. In some cases, a ?? TCR can comprise both amino acids 19-309 of SEQ ID NO: 4 and amino acids 21-293 of SEQ ID NO: 5. In some cases, a ?? TCR can comprise sequences from Table 5 and Table 6.
[0114] A polypeptide described herein can be utilized to selectively bind a conformationally constrained HLA molecule. For example, a conformationally constrained HLA molecule can include an HLA with an aberrant conformation, an HLA expressed on a tumor cell, as compared to a normal HLA molecule on a comparable cell. In specific embodiments, a polypeptide construct described herein can bind an HLA molecule expressed on a cancer cell selectively as compared to corresponding HLA molecule on non-cancer cells. In some cases, an HLA expressed by a cancer can be conformationally different as compared to a HLA expressed on a healthy tissue. For example, a malignancy may cause HLA to form clustering on a tumor cell surface that may be recognized by a ?? TCR. Clustering on a tumor cell can induce a conformational change in an HLA that may make it detectable by a ?? TCR. Clustering on a cell surface may include contact of at least two HLA proteins. In some cases, clustering can include at least two HLA proteins that are adjacent to one another. In some cases, clustering can be measured by density of proteins on a cell surface.
[0115] A conformational change can create new binding sites on a HLA that may not be present when unclustered. In some cases, from 1 to 100 new binding sites may be present on a clustered HLA protein as compared to an unclustered protein. In some cases, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 new binding sites may be present. In some cases, a ?? TCR can bind a new binding site on a clustered HLA protein. In some cases, a ?? TCR can bind a clustered HLA-A. In some cases, a ?? TCR can bind a clustered HLA-A*24. In some cases, a ?? TCR can bind a clustered HLA-A*24:02.
[0116] In some cases, HLA clustering can be displayed at the surfaces of tumor cells characterized by interreceptor distances in a micrometer range as detected by scanning force microscopy of immunogold-labeled antigens. In some cases, electron microscopy can be used to detect and measure HLA clustering on a cellular surface. In some cases, scanning force microscopy can be used to detect and measure clustering. In some cases, 30- and 15-nm immunogold beads can be utilized in a microscopy technique to measure and detect clustering. A bead of any size can be used such as from about 5 nm, 10 nm, 15 nm, 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, or up to 100 nm in diameter. A bead can be substantially spherical in some cases. In some cases, clusterization of HLA can be detected by a distribution of antigens, beads, or peptides displayed therein as detected by a deviation of their spatial distribution from a Poissonian distribution representing a random case. Fluorescence resonance energy transfer (FRET) measurements can also be used to show clustering of HLA molecules at another hierarchical level. For example FRET characterized by from about 2- to 10-nm F?rster distance range can provide fine details of a molecular organization of receptors. In other cases, a F?rster distance range that can be used to detect an HLA cluster can be from about 0.5 nm, 1 nm, 1.5 nm, 2 nm, 2.5 nm, 3 nm, 3.5 nm, 4 nm, 4.5 nm, 5 nm, 5.5 nm, 6 nm, 6.5 nm, 7 nm, 7.5 nm, 8 nm, 8.5 nm, 9 nm, 9.5 nm, 10 nm, 10.5 nm, 11 nm, 11.5 nm, 12 nm, 12.5 nm, 13 nm, 13.5 nm, 14 nm, 14.5 nm, 15 nm, 15.5 nm, 16 nm, 16.5 nm, 17 nm, 17.5 nm, 18 nm, 18.5 nm, 19 nm, 19.5 nm, or up to about 20 nm.
Cellular Engineering
[0117] As part of a cellular engineering process or method a source of immune cells can be obtained from a subject. Immune cells can be from a myeloid or lymphoid origin. In some cases, T cells, B cells, or natural killer (NK) cells can be used. T cells may also be cell lines, such as SupT-1, Jurkat, or Raji cells or any other widely available cell line. Any cell type, being a primary cell or any other cell line can be utilized. In some cases, a cell that expresses a T cell receptor, i.e. such as being positive for an ??TCR in a FACS sorting may be contemplated. Also, any cell or cell population may be contemplated that, when provided with a ??TCR can be capable of forming a functional TCR complex and exerting e.g. a functional cytoxic response and/or cytokine production. A cell that can be provided may also be a progenitor cell, preferably a blood progenitor cell such as a thymocyte or a blood stem cell, which after it has been provided with the right stimuli can develop into T cells or engineered T cells. Hence it can be understood that providing a cell with a ??TCR may comprise providing progenitor cells, providing these with a ??TCR and stimulating these progenitor cells such that these develop into engineered T cells.
[0118] T cells can be obtained from a number of sources, including peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Any number of T cell lines available in the art, may be used. T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as Ficoll? separation. In some cases, cells from the circulating blood of an individual are obtained by apheresis. A apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets, in one embodiment, the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some cases, cells are washed with phosphate buffered saline (PBS). In some cases, a wash solution may lack calcium and may lack magnesium or may lack many if not all divalent cations. A washing step may be accomplished by methods known to those in the art, such as by using a semi-automated flow-through centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, isolated cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca.sup.3+-free, Mg.sup.2+-free PBS, PlasmaLyte A, or other saline solution with or without buffer. Alternatively, any undesirable components of a apheresis sample may be removed and the cells directly resuspended in culture media. In some cases, T cells can be isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL? gradient or by counterflow centrifugal elutriation. A specific subpopulation of T cells, such as CD3.sup.+, CD28.sup.+, CD4.sup.+, CD8.sup.+, CD45RA.sup.+, and CD45RO.sup.+T cells, can be further isolated by positive or negative selection techniques. For example, in one embodiment, T cells are isolated by incubation with anti-CD3/anti-CD28 (i.e., 3?28)-conjugated beads, such as DYNABEADS? M-450 CD3/CD28 T, for a time period sufficient for positive selection of the desired T cells. In one embodiment, a time period is about 30 minutes. In some cases, a time period ranges from about 30 minutes to 36 hours or longer and all integer values there between. In a further embodiment, a time period is at least 1, 2, 3, 4, 5, or 6 hours. In another case, a time period is from about 10 hours to about 24 hours. In some cases, a time period can be 24 hours. For isolation of T cells from patients with leukemia, use of longer incubation times, such as 24 hours, can increase cell yield. Longer incubation times may be used to isolate T cells in any situation where there are few T cells as compared to other cell types, such in isolating tumor infiltrating lymphocytes (TIL) from tumor tissue or from immune-compromised individuals. Further, use of longer incubation times can increase the efficiency of capture of CD8+ T cells. Thus, by simply shortening or lengthening the time T cells are allowed to bind to the CD3/CD28 beads and/or by increasing or decreasing the ratio of beads to T cells (as described further herein), subpopulations of T cells can be preferentially selected for or against at culture initiation or at other time points during the process, Additionally, by increasing or decreasing the ratio of anti-CD3 and/or anti-CD28 antibodies on the beads or other surface, subpopulations of T cells can be preferentially selected for or against at culture initiation or at other desired time points. The skilled artisan would recognize that multiple rounds of selection can also be used in the context of this invention.
[0119] In some cases, enrichment of a T cell population by negative selection can be accomplished with a combination of antibodies directed to surface markers unique to the negatively selected cells. One method can be cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry that may use a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4.sup.+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD 14, CD20, CD11b, CD 16, HLA-DR, and CD8, In certain embodiments, it may be desirable to enrich for or positively select for regulatory T cells which typically express CD4.sup.+, CD25.sup.+, CD62L+, GITR.sup.+, and FoxP3.sup.+. Alternatively, in certain embodiments, T regulatory cells can be depleted by anti-CD25 conjugated beads or other similar methods of selection.
[0120] For isolation of a desired population of cells by positive or negative selection, a concentration of cells and surface (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly decrease a volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml can be used. In one embodiment, a concentration of 1 billion cells/ml can be used. In a further embodiment, greater than 100 million cells/ml can be used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml can be used. In yet another embodiment, a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion. T cells for stimulation can also be frozen after a washing step.
[0121] A freeze and subsequent thaw step can provide a more uniform product by removing granulocytes and to some extent monocytes in a cell population. After a washing step that may remove plasma and platelets, cells may be suspended in a freezing solution, While many freezing solutions and parameters are known in the art and may be useful in this context, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or culture media containing 10% Dextran 40 and 5% Dextrose, 20% Human Serum Albumin and 7.5% DMSO, or 31.25% Plasmaiyte-A, 3 1.25% Dextrose 5%, 0.45% NaCl, 10% Dextran 40 and 5% Dextrose, 20% Human Serum Albumin, and 7.5% DMSO or other suitable ceil freezing media containing for example, Hespan and PlasmaLyte A, cells may then be frozen to ?80? C. at a rate of 1? per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at ?20? C. or in liquid nitrogen. In certain embodiments, cryopreserved cells may be thawed and washed as described herein and allowed to rest for one hour at room temperature prior to activation.
[0122] Also contemplated can be collection of blood samples or apheresis product from a subject at a time period prior to when the expanded cells as described herein might be needed. In one embodiment a blood sample or an apheresis can be taken from a generally healthy subject. In certain embodiments, a blood sample or an apheresis can be taken from a generally healthy subject who may be at risk of developing a disease, but who has not yet developed a disease and cells of interest can be isolated and frozen for later use. In some cases, T cells may be expanded, frozen, and used at a later time. In some cases, samples are collected from a patient shortly after diagnosis of a particular disease as described herein but prior to any treatments. In some cases, cells may be isolated from a blood sample or an apheresis from a subject prior to any number of relevant treatment modalities, including but not limited to treatment with agents such as natal izumab, efalizumab, antiviral agents, chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAMPATH, anti-CD3 antibodies, Cytoxan, fludarabine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, and irradiation. These drugs inhibit either the calcium dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit the p70S6 kinase that is important for growth factor induced signaling (rapamycin).
[0123] In some cases, cells can be isolated for a patient and frozen for later use in conjunction with (e.g., before, simultaneously or following) bone marrow or stem cell transplantation, T cell ablative therapy using either chemotherapy agents such as, fludarabine, external-beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another embodiment, cells can be isolated prior to and can be frozen for later use for treatment following B-cell ablative therapy such as agents that react with CD20, e.g., Rituxan.
[0124] In some cases, T cells can be obtained from a patient directly following treatment. In this regard, it has been observed that following certain cancer treatments, in particular treatments with drugs that damage the immune system, shortly after treatment during the period when patients would normally be recovering from the treatment, a quality of T cells obtained may be optimal or improved for their ability to expand ex vivo. Likewise, following ex vivo manipulation using the methods described herein, these cells may be in a preferred state for enhanced engraftment and in vivo expansion. Thus, it is contemplated within the context of the present invention to collect blood cells, including T cells, dendritic cells, or other cells of the hematopoietic lineage, during this recovery phase. Further, in certain embodiments, mobilization (for example, mobilization with GM-CSF) and conditioning regimens can be used to create a condition in a subject wherein repopulation, recirculation, regeneration, and/or expansion of particular cell types can be favored, especially during a defined window of time following therapy. Illustrative cell types include T cells, B cells, dendritic cells, and other cells of the immune system.
[0125] Following isolation of cells, immune cells, for instance T cells can be expanded by contact with a surface having attached thereto an agent that stimulates a CD3 TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on a surface of T cells. In particular, T cell populations may be stimulated as described herein, such as by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore, For co-stimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule is used. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells. To stimulate proliferation of either CD4.sup.+ T cells or CD8.sup.+ T cells, an anti-CD3 antibody and an anti-CD28 antibody. Examples of an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diacione, Besancon, France) can be used as can other methods commonly known in the art (Berg et al., Transplant Proc. 30(8):3975-3977, 1998; Haanen et al., J. Exp. Med. 190(9): 13191328, 1999; Garland et al., J. Immunol Meth. 227(1-2):53-63, 1999).
[0126] In certain embodiments, a primary stimulatory signal and a co-stimulatory signal for T cells may be provided by different protocols. For example, agents providing each signal may be in solution or coupled to a surface. When coupled to a surface, agents may be coupled to the same surface (i.e., in cis formation) or to separate surfaces (i.e., in trans formation). Alternatively, one agent may be coupled to a surface and the other agent in solution. In one embodiment, an agent providing a co-stimulatory signal can be bound to a cell surface and an agent providing a primary activation signal may be in solution or coupled to a surface. In certain embodiments, both agents can be in solution. In another embodiment, an agent may be in soluble form, and then cross-linked to a surface, such as a cell expressing Fc receptors or an antibody or other binding agent which will bind to the agents. In this regard, see for example, U.S. Patent Application Publication Nos. 20040101519 and 20060034810 for artificial antigen presenting cells (aAPCs) that are contemplated for use in activating and expanding T cells in the present invention.
[0127] In some cases, a culture media that can be used to grow cells described herein can include a number of addivites. In some instances, an additive can include chemokines, interferons, interleukins, colony-stimulating factors or tumor necrosis factors. In some cases, chemokines play a role as a chemoattractant to guide the migration of cells, and is classified into four subfamilies: CXC, CC, CX3C, and XC. Exemplary chemokines include chemokines from the CC subfamily: CCL1, CCL2 (MCP-1), CCL3, CCL4, CCL5 (RANTES), CCL6, CCL7, CCL8, CCL9 (or CCL10), CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, and CCL28; the CXC subfamily: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, and CXCL17; the XC subfamily: XCL1 and XCL2; and the CX3C subfamily CX3CL1. Interferons (IFNs) can comprise interferon type I (e.g. IFN-?, IFN-?, IFN-?, IFN-?, and IFN-?), interferon type II (e.g. IFN-?), and interferon type III. In some embodiments, IFN-? is further classified into about 13 subtypes including IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21. Interleukins can be expressed by leukocytes or white blood cells and they promote the development and differentiation of T and B lymphocytes and hematopoietic cells. Exemplary interleukines include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35, and IL-36. In some cases, a tumor necrosis factors (TNFs) can be introduced to a culture media. TNFs can be a group of cytokines that modulate apoptosis. In some instances, there are about 19 members within the TNF family, including, not limited to, TNF?, lymphotoxin-alpha (LT-alpha), lymphotoxin-beta (LT-beta), T cell antigen gp39 (CD40L), CD27L, CD30L, FASL, 4-1BBL, OX40L, and TNF-related apoptosis inducing ligand (TRAIL).Colony-stimulating factors (CSFs) can be secreted glycoproteins that interact with receptor proteins on the surface of hemopoietic stem cells, which subsequently modulates cell proliferation and differentiation into specific kind of blood cells. In some instances, a CSF comprises macrophage colony-stimulating factor, granulocyte macrophage colony-stimulating factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF) or promegapoietin.
[0128] In some cases, a polypeptide encoding a gamma-delta TCR can be introduced into an immune cell. Immune cells expressing exogenous gamma-delta TCRs can be expanded. In some cases, a method of engineering an immune cell can comprise providing a cell and expressing at the surface of a cell at least one exogenous gamma-delta TCR. Polynucleotides encoding a gamma-delta TCR may be introduced into a cell by for example, recombinant viral vectors (e.g. retroviruses, lentivimses, adenoviruses), liposome and the like. For example, transient transformation methods can include for example microinjection, electroporation or particle bombardment. A polynucleotide encoding a gamma-delta TCR can be introduced virally or nonvirally. Viral introductions can utilize retroviral vectors, lentiviral vectors, adenoviral vectors, or a combination thereof.
[0129] Provided herein can also be vectors in which a polynucleic acid can be inserted. Vectors derived from retroviruses such as the lentivirus are suitable tools to achieve long-term gene transfer since they can allow long-term, stable integration of a transgene and its propagation in daughter cells. Lentiviral vectors have the added advantage over vectors derived from onco-retroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity.
[0130] A polynucleotide vector useful for the methods and compositions described herein can be a good manufacturing practices (GMP) compatible vector. For example, a GMP vector can be purer than a non-GMP vector. In some cases, purity can be measured by bioburden. For example, bioburden can be the presence or absence of aerobes, anaerobes, sporeformers, fungi, or combinations thereof in a vector composition. In some cases, a pure vector can be endotoxin low or endotoxin free. Purity can also be measured by double-stranded primer-walking sequencing. Plasmid identity can be a source of determining purity of a vector. A GMP vector of the invention can be from 10% to 99% more pure than a non-GMP vector. A GMP vector can be from 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% more pure than a non-GMP vector as measured by the presence of bioburden, endotoxin, sequencing, or combinations thereof.
[0131] Provided can also be a nucleic acid sequence encoding a ?? TCR. A nucleic acid can be an isolated nucleic acid. A nucleic acid that can encode a ?? TCR can be in DNA or RNA form. For example, provided herein can be a DNA vector encoding a ?? TCR. Provided herein can also be a DNA minicircle encoding a ?? TCR. In some cases a ?? TCR can be in the form of mRNA. For example, cells can be electroporated with an mRNA encoding for a ?? TCR. A nucleic acid can be double stranded or single stranded. A single stranded nucleic acid can be short linear DNA (doggy bone) vector.
[0132] A nucleic acid can be cloned into a number of types of vectors. For example, a nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of can also include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. Further, an expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al, (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers.A number of viral based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of a subject either in vivo or ex vivo. A number of retroviral systems are known in the art. In some embodiments, adenovirus vectors are used. A number of adenovirus vectors are known in the art. In one embodiment, lentivirus vectors are used. Additional promoter elements, e.g., enhancers, can regulate a frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of a start site, although a number of promoters have recently been shown to contain functional elements downstream of a start site as well. The spacing between promoter elements frequently is flexible, so that promoter function can be preserved when elements are inverted or moved relative to one another. Depending on a promoter, individual elements can function either cooperatively or independently to activate transcription. One example of a suitable promoter can be the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Another example of a suitable promoter is Elongation Growth Factor-1 a (EF-1 a). However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, inducible promoters are also contemplated. An inducible promoter can provide a molecular switch capable of turning on expression of a polynucleotide sequence which it can operatively link when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metalothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. In order to assess the expression of a gamma-delta polypeptide or portions thereof, an expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors, in other aspects, a selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic-resistance genes, such as neomycin, green fluorescent protein (GFP), eGFP, luciferase, GUS, and the like.
[0133] Reporter genes are also used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene. Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5 flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to mod late promoter-driven transcription. Methods of introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art. For example, an expression vector can be transferred into a host cell by physical, chemical, or biological means. Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). A method for the introduction of a polynucleotide into a host cell can be calcium phosphate transfection. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
[0134] In some cases, a terminator sequence at the end of a first gene program can be used. A terminator sequence can ensure that a transcript is terminating prior to initiating a second gene program. For example, an expression vectors can contain sequences necessary for the termination of transcription and for stabilizing an mRNA. Such sequences are commonly available from the 5 and, occasionally 3, untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions can contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA. Cells comprising the expression vector are grown under conditions that provide for expression of the desired polypeptide, either in vivo or in vitro.
[0135] In some cases, a spacer sequence can be used at the end of a first polypeptide encoded by a polynucleotide in a vector. In other cases, a spacer sequence can be used at the end of a second gene in a vector. A spacer sequence can also be used following a first gene and a second gene in a vector.
[0136] These vectors can be used to express a polypeptide encoded by a gene, or portion of a gene of interest. A gene of portion or a gene can be inserted by using any method, viral or non-viral. For example; a method can be a non-viral based technique.
[0137] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to a polypeptide construct described herein, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
[0138] In some cases, an exogenous receptor, such as a gamma-delta TCR, can be expressed in a percentage of a population of cells. For example, from about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% of cells in a population may express a gamma-delta TCR. A measurement of expression of an exogenous receptor, such as a gamma-delta TCR, may be taken by flow cytometric analysis.
[0139] In some cases, a gamma-delta TCR can be introduced non-virally. Polynucleotides encoding a gamma-delta TCR can be introduced as DNA or RNA. In some cases, a gamma-delta TCR can be introduced as DNA. In other cases, a gamma-delta TCR can be introduced as RNA. A gamma-delta TCR can be introduced as mRNA. mRNA can be introduced directly into a cell, for example by electroporation. CytoPulse technology can be utilized for electroporation. CytoPulse technology can use pulsed electric fields, to transiently permeabilize living cells for delivery of material, such as a gamma-delta TCR. The technology can allow for control of pulse duration, intensity as well as the interval between pulses. All these parameters can be modified in order to reach ideal conditions for high transfection efficiency with minimal mortality. In some cases, an electroporation pulse voltage may be varied to optimize transfection efficiency and/or cell viability. In some cases, the number of electroporation pulses may be varied to optimize transfection efficiency and/or cell viability. In some cases, the starting cell density for electroporation may be varied to optimize transfection efficiency and/or cell viability.
[0140] Accordingly, a cell, preferably a T cell, more preferably an engineered T cell is provided comprising or expressing a TCR, preferably an engineered TCR said TCR or engineered TCR comprising: [0141] a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 3 and 6 to 237 and/or [0142] a ?T-cell receptor chain or part thereof comprising a CDR3 region, said ?T-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 60% sequence identity or similarity with any one of amino acid sequence SEQ ID NO: 2 and 238 to 428. Preferably, the identity is of at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%.
Treatment
[0143] Effective adoptive cell transfer-based immunotherapies (ACT) can be useful to treat cancer (e.g., metastatic cancer) patients. In some cases, ACT can also be utilized to treat viral infections. Described herein can be a method of treating a disease (e.g., cancer or viral infection) in a recipient comprising transplanting to the recipient one or more engineered T cells that express an exogenous TCR, such as a gamma-delta TCR. In some cases, a viral infection can lead to cancer, such as an human papilloma virus (HPV), cytomegalovirus (CMV), Epstein-barr virus (EBV), hepatis B (HBV) and hepatitis C (HCV), Kaposi sarcoma-associated herpes virus (KSHV), Human T-lymphotrophic virus-1 (HTLV), Merkel cellpolyoma virus (MCV), human immunodeficiency virus (HIV), to name a few. Compositions disclosed herein can be utilized to treat a subjected infected with any one of the aforementioned viral infections.
[0144] Subject anti-HLA-A*24:02 engineered T cells can be formulated into a pharmaceutical medicament and be used to treat a human or mammal, in need thereof, diagnosed with a disease, e.g., cancer. Subject anti-HLA-A*24 engineered T cells can be formulated into a pharmaceutical medicament and be used to treat a human or mammal, in need thereof, diagnosed with a viral infection. These pharmaceutical medicaments can be co-administered to a human or mammal, together with one or more chemotherapeutic agent or chemotherapeutic compound. The term pharmaceutical medicament could be replaced by the term pharmaceutical composition or medicament.
[0145] Populations of engineered T cells, such as ?? T cells engineered to express an HLA-A*24:02 specific ?? TCR, may be formulated for administration to a subject using techniques known to the skilled artisan. Formulations comprising populations of engineered cells may include pharmaceutically acceptable excipient(s). Excipients included in the formulations will have different purposes depending, for example, on the subpopulation of T cells used and the mode of administration. Examples of generally used excipients included, without limitation: saline, buffered saline, dextrose, water-for-injection, glycerol, ethanol, and combinations thereof, stabilizing agents, solubilizing agents and surfactants, buffers and preservatives, tonicity agents, bulking agents, and lubricating agents. The formulations comprising populations of engineered cells may be prepared and cultured in the absence of any non-human components, such as animal serum. A formulation may include one population of engineered cells, or more than one, such as two, three, four, five, six or more populations of engineered cells. For example, a formulation may include one population of engineered cells, or more than one, such as two, three, four, five, six or more populations of engineered cells. For example, more than one exogenous receptor may be expressed in a cell. In other cases, two populations of cells each expressing a different exogenous receptor are combined into a single formulation.
[0146] Formulations described herein may benefit from antioxidants, metal chelating agents, thiol containing compounds and other general stabilizing agents. Examples of such stabilizing agents, include, but are not limited to: (a) about 0.5% to about 2% w/v glycerol, (b) about 0.1% to about 1% w/v methionine, (c) about 0.1% to about 2% w/v monothioglycerol, (d) about 1 mM to about 10 mM EDTA, (e) about 0.01% to about 2% w/v ascorbic acid, (f) 0.003% to about 0.02% w/v polysorbate 80, (g) 0.001% to about 0.05% w/v. polysorbate 20, (h) arginine, (i) heparin, (j) dextran sulfate, (k) cyclodextrins, (l) pentosan polysulfate and other heparinoids, (m) divalent cations such as magnesium and zinc; or (n) combinations thereof.
[0147] In some cases, a binder may be used. Binders can impart cohesive qualities and include, e.g., alginic acid and salts thereof; cellulose derivatives such as carboxymethylcellulose, methylcellulose (e.g., Methocel?), hydroxypropylmethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose (e.g., Klucel?), ethylcellulose (e.g., Ethocel?), and microcrystalline cellulose (e.g., Avicel?); microcrystalline dextrose; amylose; magnesium aluminum silicate; polysaccharide acids; bentonites; gelatin; polyvinylpyrrolidone/vinyl acetate copolymer; crospovidone; povidone; starch; pregelatinized starch; tragacanth, dextrin, a sugar, such as sucrose (e.g., Dipac?), glucose, dextrose, molasses, mannitol, sorbitol, xylitol (e.g., Xylitab?), and lactose; a natural or synthetic gum such as acacia, tragacanth, ghatti gum, mucilage of isapol husks, polyvinylpyrrolidone (e.g., Polyvidone? CL, Kollidon? CL, Polyplasdone? XL-10), larch arabogalactan, Veegum?, polyethylene glycol, waxes, sodium alginate, and the like.
[0148] A carrier or carrier materials include any commonly used excipients in pharmaceutics and should be selected on the basis of compatibility with compounds disclosed herein, such as, compounds of ibrutinib and An anticancer agent, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials can include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 1975; Liberman, H. A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins1999).
[0149] Dispersing agents, and/or viscosity modulating agents include materials that control the diffusion and homogeneity of a drug through liquid media or a granulation method or blend method. In some embodiments, these agents also facilitate the effectiveness of a coating or eroding matrix. Exemplary diffusion facilitators/dispersing agents include, e.g., hydrophilic polymers, electrolytes, Tween? 60 or 80, PEG, polyvinylpyrrolidone (PVP; commercially known as Plasdone?), and the carbohydrate-based dispersing agents such as, for example, hydroxypropyl celluloses (e.g., HPC, HPC-SL, and HPC-L), hydroxypropyl methylcelluloses (e.g., HPMC K100, HPMC K4M, HPMC K15M, and HPMC K100M), carboxymethylcellulose sodium, methylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate stearate (HPMCAS), noncrystalline cellulose, magnesium aluminum silicate, triethanolamine, polyvinyl alcohol (PVA), vinyl pyrrolidone/vinyl acetate copolymer (S630), 4-(1,1,3,3-tetramethylbutyl)-phenol polymer with ethylene oxide and formaldehyde (also known as tyloxapol), poloxamers (e.g., Pluronics F68?, F88?, and F108?, which are block copolymers of ethylene oxide and propylene oxide); and poloxamines (e.g., Tetronic 908?, also known as Poloxamine 908?, which is a tetrafunctional block copolymer derived from sequential addition of propylene oxide and ethylene oxide to ethylenediamine (BASF Corporation, Parsippany, N.J.)), polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, polyvinylpyrrolidone/vinyl acetate copolymer (S-630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, polysorbate-80, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, carbomers, polyvinyl alcohol (PVA), alginates, chitosans and combinations thereof. Plasticizers such as cellulose or triethyl cellulose can also be used as dispersing agents. Dispersing agents particularly useful in liposomal dispersions and self-emulsifying dispersions are dimyristoyl phosphatidyl choline, natural phosphatidyl choline from eggs, natural phosphatidyl glycerol from eggs, cholesterol and isopropyl myristate.
[0150] Formulations comprising population(s) of engineered cells may be administered to a subject using modes and techniques known to the skilled artisan. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, without limitation, intratumoral, intradermal, subcutaneous (S.C., s.q., sub-Q, Hypo), intramuscular (i.m.), intraperitoneal (i.p.), intra-arterial, intramedullary, intracardiac, intra-articular (joint), intrasynovial (joint fluid area), intracranial, intraspinal, and intrathecal (spinal fluids). Any known device useful for parenteral injection of infusion of the formulations can be used to effect such administration.
[0151] In some cases, about 5?10.sup.10 engineered T cells can be administered to a subject. In some embodiments, about 5?10.sup.10 cells can represent a median amount of cells administered to a subject. In some embodiments, about 5?10.sup.10 cells are necessary to affect a therapeutic response in a subject. In some embodiments, at least about 1?10.sup.6cells, at least about 2?10.sup.6 cells, at least about 3?10.sup.6 cells, at least about 4?10.sup.6 cells, at least about 5?10.sup.6 cells, at least about 6?10.sup.6 cells, at least about 6?10.sup.6 cells, at least about 8?10.sup.6 cells, at least about 9?10.sup.6 cells, at least about 1?10.sup.7 cells, at least about 2?10.sup.7 cells, at least about 3?10.sup.7 cells, at least about 4?10.sup.7 cells, at least about 5?10.sup.7 cells, at least about 6?10.sup.8 cells, at least about 6?10.sup.7 cells, at least about 8?10.sup.8 cells, at least about 9?10.sup.8 cells, at least about 1?10.sup.8 cells, at least about 2?10.sup.8 cells, at least about 3?10.sup.8 cells, at least about 4?10.sup.8 cells, at least about 5?10.sup.8 cells, at least about 6?10.sup.8 cells, at least about 6?10.sup.8 cells, at least about 8?10.sup.8 cells, at least about 9?10.sup.8 cells, at least about 1?10.sup.9 cells, at least about 2?10.sup.9 cells, at least about 3?10.sup.9 cells, at least about 4?10.sup.9 cells, at least about 5?10.sup.9 cells, at least about 6?10.sup.9 cells, at least about 6?10.sup.9 cells, at least about 8?10.sup.9 cells, at least about 9?10.sup.9 cells, at least about 1?10.sup.10 cells, at least about 2?10.sup.10 cells, at least about 3?10.sup.10 cells, at least about 4?10.sup.10 cells, at least about 5?10.sup.10 cells, at least about 6?10.sup.10 cells, at least about 6?10.sup.10 cells, at least about 8?10.sup.10 cells, at least about 9?10.sup.10 cells, at least about 1?10.sup.11 cells, at least about 2?10.sup.11 cells, at least about 3?10.sup.11 cells, at least about 4?10.sup.11 cells, at least about 5?10.sup.11 cells, at least about 6?10.sup.11 cells, at least about 6?10.sup.11 cells, at least about 8?10.sup.11 cells, at least about 9?10.sup.11 cells, or at least about 1?10.sup.12 cells. For example, about 5?10.sup.10 cells may be administered to a subject. In another example, starting with 3?10.sup.6 cells, the cells may be expanded to about 5?10.sup.10 cells and administered to a subject. In some cases, cells are expanded to sufficient numbers for therapy. For example, 5?10.sup.7 cells can undergo rapid expansion to generate sufficient numbers for therapeutic use. In some cases, sufficient numbers for therapeutic use can be 5?10.sup.10. Any number of cells can be infused for therapeutic use. For example, a subject may be infused with a number of cells between 1?10.sup.6 to 5?10.sup.12 inclusive. In some embodiments, calculating the amount of engineered cells necessary to affect a therapeutic response comprises the viability of the cells and/or the efficiency with which a gamma-delta TCR has been integrated into the genome of a cell, such as an alpha-beta T cell. In some embodiments, in order to affect a therapeutic response in a subject, cells administered to a subject may be viable cells. In some embodiments, in order to effect a therapeutic response in a subject, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%, at least about 15%, at least about 10% of the cells are viable cells. In some embodiments, in order to affect a therapeutic response in a subject, the cells administered to a subject may be cells that have had one or more transgenes successfully integrated into the genome of the cell. In some embodiments, in order to effect a therapeutic response in a subject, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%, at least about 15%, at least about 10% of the cells have had one or more TCRs successfully integrated into a genome of a cell.
[0152] In some cases, a subject can be administered engineered T cells that express an exogenous gamma-delta TCR, wherein engineered T cells that express an exogenous gamma-delta TCR that can be administered may be about 1 to about 35 days old. For example, administered cells may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or up to about 40 days old. An age of an engineered T cell can be considered from a time of stimulation. An age of an engineered cell can be considered from a time of apheresis. An age of an engineered cell can be considered from a time of transduction. In some embodiments, engineered cells that can be administered to a subject are about 10 to about 14 or about 20 days old. In some cases, an age of an engineered cell can be determined by a length of a telomere. For example, a young cell can have a longer telomere length than an exhausted or old cell. Without being bound to a particular theory, it can be believed that immunoresponsive cells lose an estimated telomere length of about 0.8 kb per week in culture, and that young cell cultures can have telomeres that are about 1.4 kb longer than immunoresponsive cells that are about 44 days old. Without being bound to a particular theory, it is believed that longer telomere lengths can be associated with positive objective clinical responses in patients and persistence of the cells in vivo.
[0153] In some cases, cells are isolated from the subject organism, transfected with a nucleic acid (e.g., gene or cDNA), and re-infused back into a subject.
[0154] The methods disclosed herein can comprise transplanting. Transplantation can refer to adoptive transplantation of a cellular product including T cells expressing an exogenous ?? TCR. Transplanting can be autotransplanting, allotransplanting, xenotransplanting, or any other transplanting. For example, transplanting can be xenotransplanting. Transplanting can also be allotransplanting.
[0155] Cells (e.g., engineered cells or engineered primary T cells) before, after, and/or during transplantation can be functional. For example, transplanted cells can be functional for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 6, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or 100 days after transplantation. Transplanted cells can be functional for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months after transplantation. Transplanted cells can be functional for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 years after transplantation. In some cases, transplanted cells can be functional for up to the lifetime of a recipient.
[0156] Further, transplanted cells can function at 100% of their normal intended function. A normal intended function can be measured by comparing engineered cells to non-engineered control cells. For example, a level of a cytokine, such as IL-2, can be detected by ELISA assay and compared between an engineered population and a non-engineered population Transplanted cells can function 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or up to about 100% of their normal intended function. Transplanted cells can also function over 100% of their normal intended function. For example, transplanted cells can function 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, or up to about 5000% of their normal intended function. Transplanted cells that function over a normal intended function may have supraphysiological levels of cytokine production in some cases. In other cases, transplanted cells that function over a normal cell may have increased persistence or expansion.
[0157] Transplanting can be by any type of transplanting. Sites can include, but not limited to, liver subcapsular space, splenic subcapsular space, renal subcapsular space, omentum, gastric or intestinal submucosa, vascular segment of small intestine, venous sac, testis, brain, spleen, or cornea. For example, transplanting can be subcapsular transplanting. Transplanting can also be intramuscular transplanting. Transplanting can be intraportal transplanting. In some cases, engineered cells are directly injected into a tumor.
[0158] In some cases, a subject may receive immunosuppressive therapy. Immunosuppressive therapy may accompany an allogenic infusion of a cellular product. In other cases, immunosuppression may be performed to improve performance of a cellular product, such as engineered T cells.
[0159] In some cases, host lymphopenia can facilitate expansion of engineered cells. On the one hand, lymphopenia can create space for oncoming adoptively transferred cells and, on the other, it can induce their homeostatic expansion. The latter effect can be likely mediated through chemotherapeutic ablation of endogenous regulatory T cells, which can normally secrete inhibitory cytokines (e.g. TGF-? and IL-10) that can limit effector cell expansion, such as engineered T cells. In some cases, a lymphocyte reduction treatment can improve expansion of engineered T cells in vivo by about 1 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14 fold, 15 fold, 16 fold, 17 fold, 18 fold, 19 fold, or up to 20 fold over treatment with engineered cells without a lymphocyte reduction treatment.
[0160] Additionally, T-cell growth homeostatic cytokines, such as IL-7 and IL-15, which may ordinarily exist in limiting amounts, may become readily available due to less competition and increased production by lymphopoietic stromal cells. Thus, induction of lymphocyte reduction prior to infusion of an engineered cellular product may be performed to increase efficacy of engineered cells in treating a subject. In some cases, a lymphocyte reduction treatment may improve anti-tumor efficacy as measured by tumor reduction or control by about 10% to about 100% over treatment without a lymphocyte reduction treatment. For example a lymphocyte reduction treatment may improve anti-tumor efficacy from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or up to 100% over treatment without a lymphocyte reduction treatment.
[0161] Anti-HLA-A*24 cells can be administered in combination with other anti-tumor agents, including cytotoxic/antineoplastic agents and anti-angiogenic agents.
[0162] In some cases, interfering with an interaction between ??T cells and their cellular ligands can be used to diagnose and modulate inflammatory demyelinating disease (see Chien et al., 2005, US2005/0255105). A cellular ligand can include both non-classical and classical MHC molecules, non-protein ligands, and the like. Described herein can be a method of disrupting an interaction between a ??T cell and a target, such as an HLA-A*24-expressing cell to reduce a treatment associated toxicity. In some cases, a subject treated with a composition described herein may develop a toxicity. There are multiple modalities for abrogating and eliminating engineered cells that have been administred to a subject. For example, in some cases, an antibody may be introduced to bind to engineered cells. An antibody can inhibit binding of a polypeptide construct after an administration. For example, an antibody given to reduce treatment-related toxicity may be a neutralizing or blocking antibody. In other cases, nonspecific immune suppression or selective depletion of modified cells through suicide or elimination genes can be performed to abrogate treatment-related toxicity. For example, a polynucleic acid encoding an anti-HLA-A*24 may also encode for a suicide gene such as inducible Fas or caspase 9. A method of reducing toxicity can comprise administering an antibody or portion thereof. In other cases, an antibody may bind a ?? TCR on a cell and inhibit binding of that cell to a target. For example, a disease or infection can be treated by administration of an antibody or portion thereof that can bind a cellular receptor such as an FE11 or FE11-like receptor. In some cases, a binding of an antibody to a receptor can neutralize or block a receptor and may prevent toxicity associated with the binding of a receptor to it's ligand. In some cases, a toxicity in a subject can be at least one of cytokine release syndrome (CRS) B-Cell Aplasia, and Tumor Lysis Syndrome (TLS). CRS can be detected by a level of inflammatory symptoms resulting from cytokine elevations, such as IL-10, IL-6, and IFN-?, associated with T cell engagement and proliferation. In most subjects, CRS symptoms are mild and flulike, with fevers and myalgias. However, some subjects can experience a severe inflammatory syndrome, including vascular leak, hypotension, pulmonary edema, and coagulopathy, resulting in multiorgan system failure, and death. In some cases, a subject with CRS may also have elevated IL-6. In some cases, an anti-IL-6 treatment may be administered.
[0163] Efficacy of adoptive immunotherapy, such as administration of engineered T cells expressing exogenous ?? TCRs can be evaluated using multiple modalities. Efficacy can refer to anti-tumor efficacy that can be the extent to which a tumor, such as an HLA-A*24-positive tumor, is controlled, reduced, or eliminated. Treatment efficacy can also refer to engineered cell expansion, persistence, tumor-targeting, and any combination thereof.
[0164] A subject that can be administered an adoptive cell therapy, such as anti-HLA-A*24 T cell therapy, can be evaluated during an infusion, immediately after an infusion, or up to years following an infusion. For example, a treated subject can return to a clinic for evaluation for a period of about 1 day to the length of the subject's life. A treated subject can be evaluated from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, or up to 90 years after an initial administration of an engineered cellular product. In some cases, an evaluation schedule can include daily monitoring, weekly monitoring, monthly monitoring, or yearly monitoring. In some cases, a subject can be seen more frequently as clinically indicated. An evaluation can include a physical exam, chemistry evaluation, complete blood count, thyroid panel, toxicity assessment, computerized tomography (CT) scan of a bodily area, apheresis, and any combination thereof.
[0165] In some cases, apheresis may be performed prior to and from about 1 to about 10 weeks following administration of an engineered cell infusion. At other time points, a subject's peripheral blood lymphocytes (PBL) can be obtained from whole blood by purification using centrifugation on a Ficoll gradiant. Aliquots of peripheral blood mononuclear cells (PBMCs) can be cryopreserved for immunological monitoring of cell function. In some cases, a variety of tests can include evaluation of specific lysis and cytokine release, metabolomic and bioenergetic studies (using Seahorse), intracellular FACS of cytokine production, ELISA-spot assays, and lymphocyte subset analysis may be used to evaluate the immunological correlates of an engineered cellular product. In general, differences of about 2 to about 3 fold in these assays may be indicative of true biologic differences. In some cases, differences of about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, up to about 5 fold of in vitro assay activity, may be indicative of treatment efficacy when engineered cells are compared to non-engineered cells.
[0166] In some cases, an adoptive immunotherapy utilized engineered T cells, may reduce tumor size by at least 30% as measured by computerized tomography (CT) scan or an MRI. An engineered cellular treatment may reduce tumor size by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or up to about 100%. An engineered cellular treatment may eliminate a tumor as measured by CT scan. In some cases, an anti-HLA-A*24:02 immunoresponsive cell treatment may stabilize a tumor size as measured by a less than 10% change in a baseline measurement of a diameter of a tumor lesion as measured by computerized tomography (CT) scan. For example, a tumor may not expand in size after administration of anti-HLA-A24:02 immunoresponsive cells. In some cases, stabilization may be considered a less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% change in tumor size as compared to a pre-treatment measurement.
[0167] In some cases, anti-HLA-A*24:02 immunoresponsive cell efficacy can be considered in terms of subject survival time. For example, a subject that is treated with anti-HLA-A24 immunoresponsive cells, such as an anti-HLA-A24:02 T cells, can survive longer than an untreated subject or a subject treated with a different therapy.
[0168] Treatment response can be evaluated using the international criteria proposed by the revised Response Evaluation Criteria in Solid Tumors (RECIST) guideline (Version 1.1). Changes in the largest diameter (unidimensional measurement) of a tumor lesion and the shortest diameter in the case of malignant lymph nodes can be used in the RECIST criteria. For example, measurable lesions can be those defined as those that can be accurately measured in at least one dimension (longest diameter to be recorded) as >20 mm by chest x-ray, as >10 mm with CT scan, or >10 mm with calipers by clinical exam. To be considered pathologically enlarged and measurable, a lymph node can be >15 mm in short axis when assessed by CT scan. All other lesions (or sites of disease), including small lesions (longest diameter <10 mm or pathological lymph nodes with >10 to <15 mm short axis), can be considered non-measurable disease. Bone lesions, leptomeningeal disease, ascites, pleural/pericardial effusions, lymphangitis cutis/pulmonitis, inflammatory breast disease, can be considered as non-measurable.
[0169] All measurable lesions up to a maximum of 2 lesions per organ and 5 lesions in total, representative of all involved organs, can be identified as target lesions and recorded and measured at baseline. Target lesions can be selected on the basis of their size (lesions with the longest diameter), be representative of all involved organs, but in addition should be those that lend themselves to reproducible repeated measurements. It may be the case that, on occasion, the largest lesion does not lend itself to reproducible measurement in which circumstance the next largest lesion which can be measured reproducibly should be selected. A sum of the diameters (longest for non-nodal lesions, short axis for nodal lesions) for all target lesions can be calculated and reported as the baseline sum diameters. If lymph nodes are to be included in the sum, then only the short axis can be added into the sum. A baseline sum diameter will be used as reference to further characterize any objective tumor regression in the measurable dimension of the disease.
[0170] In some cases, a clinical lesion can be considered measurable when it can be superficial (e.g., skin nodules and palpable lymph nodes) and about 10 mm diameter as assessed using calipers (e.g., skin nodules). In cases, where a caliper cannot be used to measure a lesion, a CT scan or MRI can also be used. In some cases, a CT scan can yield slices of tissue from about 5 mm or less. A CT scan can have 5 mm, 4 mm, 3 mm, 2 mm, 1 mm or 0.5 mm scan thickness in some cases. If a CT scan has a slice thickness greater than 5 mm, a minimum size for a measurable lesion can be twice the slice thickness. In some cases, an MRI can also be performed to evaluate a subject. Ideally, the same type of scanner should be used and the image acquisition protocol should be followed as closely as possible to prior scans when determining treatment efficacy. Body scans should be performed with breath-hold scanning techniques, if possible. In some cases, a fluorodeoxyglucose (FDG)-positron emission tomography (PET) can be used to measure treatment efficacy.
[0171] Once a subject has been evaluated, target lesions can be grouped into stable disease (SD), progressive disease (PD), partial response (PR), and/or a complete response (CR). A SD can be considered neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD, taking as reference the smallest sum of diameters. A PD can be considered at least a 20% increase in the sum of the diameters of target lesions, taking as reference the smallest sum (this can include the baseline sum if that may be the smallest). In some cases, in addition to a relative increase of about 20%, a sum must also demonstrate an absolute increase of at least about 5 mm. A PR can be at least about 30% decrease in a sum of the diameters of target lesions, taking as reference the baseline sum of diameters. A CR can be elimination of target lesions.
Kits
[0172] Disclosed herein can be kits comprising compositions of polypeptide constructs described herein. Disclosed herein can also be kits for the treatment or prevention of a cancer, pathogen infection, immune disorder. A kit comprising a composition described herein can be used to treat a subject that has undergone a stem cell or solid organ transplantation. In one embodiment, a kit can include a therapeutic or prophylactic composition containing an effective amount of a composition of gamma-delta T cells in unit dosage form. In some embodiments, a kit comprises a sterile container which may contain a therapeutic composition of gamma-delta T cells; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments. In some cases, gamma-delta T cells, can be provided together with instructions for administering the cells to a subject having or at risk of developing a cancer, pathogen infection, immune disorder or allogeneic transplant. Instructions may generally include information about the use of the composition for the treatment or prevention of cancer, pathogen infection, immune disorder. In some cases, a kit can include from about 1?10.sup.4 cells to about 1?10.sup.12 cells. In some cases a kit can include at least about 1?10.sup.5 cells, at least about 1?10.sup.6 cells, at least about 1?10.sup.7 cells, at least about 4?10.sup.8 cells, at least about 5?10.sup.7 cells, at least about 6?10.sup.7 cells, at least about 6?10.sup.7 cells, at least about 8?10.sup.7 cells, at least about 9?10.sup.7 cells, at least about 1?10.sup.8 cells, at least about 2?10.sup.8 cells, at least about 3?10.sup.8 cells, at least about 4?10.sup.8 cells, at least about 5?10.sup.8 cells, at least about 6?10.sup.8 cells, at least about 6?10.sup.8 cells, at least about 8?10.sup.8 cells, at least about 9?10.sup.8 cells, at least about 1?10.sup.9cells, at least about 2?10.sup.9 cells, at least about 3?10.sup.9 cells, at least about 4?10.sup.9 cells, at least about 5?10.sup.9 cells, at least about 6?10.sup.9 cells, at least about 6?10.sup.9 cells, at least about 8?10.sup.9 cells, at least about 9?10.sup.9 cells, at least about 1?10.sup.10 cells, at least about 2?10.sup.10 cells, at least about 3?10.sup.10 cells, at least about 4?10.sup.10 cells, at least about 5?10.sup.10 cells, at least about 6?10.sup.10 cells, at least about 6?10.sup.10 cells, at least about 8?10.sup.10 cells, at least about 9?10.sup.10 cells, at least about 1?10.sup.11 cells, at least about 2?10.sup.11 cells, at least about 3?10.sup.11 cells, at least about 4?10.sup.11 cells, at least about 5?10.sup.11 cells, at least about 6?10.sup.11 cells, at least about 6?10.sup.11 cells, at least about 8?10.sup.11 cells, at least about 9?10.sup.11 cells, or at least about 1?10.sup.12 cells. For example, about 5?10.sup.10 cells may be included in a kit. In another example, a kit may include 3?10.sup.6 cells; the cells may be expanded to about 5?10.sup.10 cells and administered to a subject.
[0173] In some cases, a kit may include allogenic cells. In some cases, a kit may include cells that may comprise a genomic modification. In some cases, a kit may comprise off-the-shelf cells. In some cases, a kit may include cells that may be expanded for clinical use. In some cases, a kit may contain contents for a research purpose.
[0174] In some cases, the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of a neoplasia, pathogen infection, immune disorder or symptoms thereof; precautions; warnings; indications; counter-indications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. In some cases, instructions provide procedures for administering gamma-delta T cells at least about 1, 2, 3, 4, 5, 6, 7, 8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or up to 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days after administering a chemotherapeutic agent. In some cases, instructions provide procedures for administering gamma-delta T cells at least 24 hours after administering a chemotherapeutic agent. Engineered T cells can be formulated for intravenous injection. Engineered T cells can be formulated for infusion. In some cases a kit may contain products at a pediatric dosage.
EXAMPLES
[0175] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Example 1
Generation and Validation of Retroviral Supernatant
[0176] Phoenix Eco cell line (American Type Culture Collection SD3444) with a vector encoding a ??TCR transgene to generate a pseudotyped transient supernatant, which is used to transduce PG13 cells (gibbon ape leukemia virus pseudotyping packaging cell line; American Type Culture Collection CRL-10686). The ??TCR transgene is detected by FACS analysis on the transduced PG13 cells with an idiotypic antibody. After single-cell cloning, the highest-titer clone for each vector is used to establish a master cell bank. Clones for clinical use are released only after safety testing and vector sequencing; to ensure none produce replication-competent retrovirus. Final viral supernatant is stored at ?80 ? C. and tested before clinical release. Virus titers range from 6?10.sup.5 to 1.6?10.sup.6 virus particles per ml.
Example 2
Transduction of Cells to Express an Exogenous ??TCR
[0177] Isolation of Peripheral Blood Mononuclear Cells (PBMCs) from a LeukoPak
[0178] LeukoPaks collected from normal peripheral blood were used herein. Blood cells were diluted 3 to 1 with chilled 1? PBS. The diluted blood was added dropwise over 15 mLs of LYMPHOPREP (Stem Cell Technologies) in a 50 ml conical. Cells were spun at 400? G for 25 minutes with no brake. The buffy coat was slowly removed and placed into a sterile conical. The cells were washed with chilled 1? PBS and spun for 400? G for 10 minutes. The supernatant was removed, cells resuspended in media, counted and viably frozen in freezing media (45 mLs heat inactivated FBS and 5 mLs DMSO).
Isolation of CD3+ T Cells
[0179] PBMCs were thawed and plated for 1-2 hours in culturing media (RPMI-1640 (with no Phenol red), 20% FBS (heat inactivated), and 1? Gluta-MAX). Cells were collected and counted; the cell density was adjusted to 5?10.sup.7 cells/mL and transferred to sterile 14 mL polystyrene round-bottom tube. Using the EasySep Human CD3 cell Isolation Kit (Stem Cell Technologies), 50 uL/mL of the Isolation Cocktail was added to the cells. The mixture was mixed by pipetting and incubated for 5 minutes at room temperature. After incubation, the RapidSpheres were vortexed for 30 seconds and added at 50 uL/mL to the sample; mixed by pipetting. Mixture was topped off to 5 mLs for samples less than 4 mLs or topped off to 10 mLs for samples more than 4 mLs. The sterile polystyrene tube was added to the Big Easy magnet; incubated at room temperature for 3 minutes. The magnet and tube, in one continuous motion, were inverted, pouring off the enriched cell suspension into a new sterile tube.
Activation and Stimulation of CD3+ T Cells
[0180] Isolated CD3+ T cells were counted and plated out at a density of 2?10.sup.6 cells/mL in a 24 well plate. Dynabeads Human T-Activator CD3/CD28 beads (Gibco, Life Technologies) were added 3:1 (beads: cells) to the cells after being washed with 1? PBS with 0.2% BSA using a dynamagnet. IL-2 (Peprotech) was added at a concentration of 300 IU/mL. Cells were incubated for 48 hours and then the beads were removed using a dynamagnet. Cells were cultured for an additional 6-12 hours before electroporation or nucleofection.
Retroviral Transduction of CD3+ T Cells
[0181] Stimulated T cells are transduced by day 3 in 24-well plates precoated with a recombinant fibronectin fragment (FN CH-296, Retronectin Takara). After retroviral transduction, T cells are expanded ex vivo in the presence of rhIL-2 (50-100 U/ml) added twice weekly, without any additional stimulation with OKT3 antibody.
TABLE-US-00002 TABLE2 Sequencesdescribedherein SEQIDNO Construct Sequence 2 ?-TCRCDR CATWDRPEIYYKKLF 3 ?-TCRCDR CALGDSYGGGPLYTDKLIF 4 FE11?-TCR MGWALLVLLAFLSPASQKSSN includingsignal LEGGTKSVTRPTRSSAEITCDL peptide.Thesignal TVINAFYIHWYLHQEGKAPQR peptideisrepresented LLYYDVSNSKDVLESGLSPGKY byaminoacids1-18. YTHTPRRWSWILILRNLTENDS Thefunctionalprotein GVYYCATWDRPEIYYKKLFGS asexpressedonthe GTTLVVTDKQLDADVSPKPTI cellsurfacecomprises FLPSIAETKLQKAGTYLCLLEK aminoacids19-309 FFPDVIKIHWEEKKSNTILGSQ EGNTMKTNDTYMKFSWLTVPE KSLDKEHRCIVRHENNKNGVD QEIIFPPIKTDVITMDPKDNCSK DANDTLLLQLTNTSAYYMYLL LLLKSVVYFAIITCCLLRRTAF CCNGEKS 5 FE11?-TCR MVFSSLLCVFVAFSYSGSSVA includingsignal QKVTQAQSSVSMPVRKAVTLN peptide.Thesignal CLYETSWWSYYIFWYKQLPSK peptideisrepresented EMFLIRQGSDEQNAKSGRYSV byaminoacids1-20. NFKKAAKSVALTISALQLEDSA Thefunctionalprotein KYFCALGDSYGGGPLYTDKLI asexpressedonthe FGKGTRVTVEPRSQPHTKPSVF cellsurfacecomprises VMKNGTNVACLVKEFYPKDIR aminoacids21-293 INLVSSKKITEFDPAIVISPSGK YNAVKLGKYEDSNSVTCSVQH NDKTVHSTDFEVKTDSTDHVK PKETENTKQPSKSCHKPKAIVH TEKVNMMSLTVLGLRMLFAKT VAVNFLLTAKLFFL
Example 3
Immunophenotyping
[0182] ??-modified T lymphocytes are stained with monoclonal antibodies to CD3, CD4, CD8, CD62L, CD45RA, CD45RO, CCR7, and CD28 (Becton Dickinson). We analyzed the cells using a FACScan Flow Cytometer (Becton Dickinson) equipped with a filter set for 4 fluorescence signals.
Example 4
Cytotoxicity Assay
[0183] Target tumor cells are harvested, labeled with 50 ?Ci Na.sub.2.sup.51 CrO.sub.4 for 60 min at 37? C., washed three times, and added to various numbers of effector anti-FE11 ??-modified T lymphocytes in a final volume of 150 ?l IMDM supplemented with 10% FBS in 96-well U-bottomed microtiter plates. Tumor tumor cells expressing FE11-K562 (positive control) and K562 (negative control) are used. After 4 or 18 h of incubation of target and effector cells at 37? C. and 5% CO.sub.2, 25 ?l supernatant is harvested and measured in a luminescence counter (Topcount-NXT; Packard Instrument Co.). The mean percentage of specific lysis of triplicate wells was calculated as follows: specific lysis=[(experimental release?spontaneous release)/(maximal release?spontaneous release)]?100.
Example 5
Proliferation Assay
[0184] Proliferation of anti-FE11 T cells after exposure to target cells (FE11-K562, FE11+) or control cells (K562, FE11?) is determined by carboxyfluorescein succinimidyl ester dilution assays.
[0185] One week post-transduction, control T lymphocytes and anti-FE11?? T cells are labeled with 1.5?mol/L carboxyfluorescein diacetate succinimidyl ester (CFSE; Invitrogen) and plated with irradiated tumor targets (FE11-K562 and K562) at an effector-to-target (E:T) ratio of 5:1. CFSE dilution is measured on CD4.sup.+ and CD8.sup.+ T cells by flow cytometry on day 4 of co-culture.
Example 6
Generation of T Cell Clone Comprising a Polypeptide Construct that Binds HLA Conformation Described Herein
[0186] Bulk ??T cells were isolated from healthy donor PBMCs using the TCR?/?+ T Cell Isolation MACS Kit (Miltenyi Biotec), and expanded using a previously described rapid expansion protocol (Riddell S R, Greenberg P D. The use of anti-CD3 and anti-CD28 monoclonal antibodies to clone and expand human antigen-specific T cells. J Immunol Methods. 1990; 128(2):189-201). Briefly, ??T cells were stimulated for two weeks with 1 ?g/ml PHA-L (Sigma-Aldrich), 50 U/ml IL-2 (Novartis Pharma), 5 ng/ml IL-15 (R&D Systems), and irradiated allogeneic PBMCs, Daudi and EBV-LCLs. Fresh IL-2 was added twice per week. The ??T cell clone was generated from bulk ??T cells by limiting dilution, and expanded biweekly using the rapid expansion protocol.
[0187] Cloning of ??TCR Described Herein
[0188] Total RNA of desired ??T cell clone was isolated using the Nucleospin RNA-II kit (Macherey-Nagel) and reverse-transcribed using SuperScript-II reverse transcriptase (Invitrogen). TCR ? and ? chains were amplified by PCR using V?1 (5-GATCAAGTGTGGCCCAGAAG-3) (SEQ ID NO. 429) and V?2-5 (5-CTGCCAGTCAGAAATCTTCC-3) (SEQ ID NO. 430) sense primers, and C? (5-TTCACCAGACAAGCGACA-3) (SEQ ID NO. 431) and C? (5-GGGGAAACATCTGCATCA-3) (SEQ ID NO. 432) antisense primers. PCR products were sequenced, and codon-optimized sequences of the desired ??TCR were subsequently synthesized by Geneart? (Life Technologies) and subcloned into the retroviral pBullet vector.
[0189] Retroviral Transduction of TCRs and HLA
[0190] The V?5V?1-TCR clone described herein and an HLA-A*0201-restricted WT1 126-134-specific ??TCR were transduced into ??T cells. In brief Phoenix-Ampho packaging cells were transfected with gag-pol (pHIT60), env (pCOLT-GALV) and pBullet retroviral constructs containing TCR?/?-chain-IRES-neomycine or TCR?/?-chain-IRES-puromycin, using Fugene-HD (Promega). PBMCs preactivated with ?-CD3 (30 ng/ml ) (clone OKT3, Janssen-Cilag) and IL-2 (50 U/ml) were transduced twice with viral supernatant within 48 hours in the presence of 50 U/ml IL-2 and 4 ?g/ml polybrene (Sigma-Aldrich). Transduced T cells were expanded by stimulation with ?-CD3/CD28 Dynabeads (0.5?10.sup.6 beads/10.sup.6 cells) (Invitrogen) and IL-2 (50 U/ml) and selected with 800 ?g/ml geneticin (Gibco) and 5 ?g/ml puromycin (Sigma-Aldrich) for one week. CD4+ TCR-transduced T cells were isolated by MACS-sorting using CD4-microbeads (Miltenyi Biotec). Following transduction, transduced T cells were stimulated biweekly with 1 ?g/ml PHA-L (Sigma-Aldrich), 50 U/ml IL-2 (Novartis Pharma), 5 ng/ml IL-15 (R&D Systems), and irradiated allogeneic PBMCs, Daudi and LCL-TM cells. Fresh IL-2 was added twice per week. Where indicated, CD4+, CD8+, CD4+CD8??+ and CD4+CD8??+ TCR-transduced T-cells were sorted using a FACSAria II (BD) flow cytometry to >99% purity. Following selection, TCR-transduced T-cells were stimulated biweekly using the rapid expansion protocol. Expression levels of CD8? mutants were measured by flow cytometry using two different anti-CD8? antibody clones (clones RPA-T8 and G42-8). Transgenic TCR expression and purity of CD4+ populations were routinely assessed by flow cytometry.
[0191] Flow Cytometry
[0192] Antibodies used for flow cytometry included: ??TCR-PE (clone IMMU510, Beckman Coulter), CD4-PE-Cy7 (clone RPA-T4, BD), CD8?-APC (clone RPA-T8, BD), CD8?-PerCP-Cy5.5 (clone RPA-T8, Biolegend), CD8?-FITC (clone G42-8, BD), and CD8??-PE (clone 2ST8.5H7, BD). NY-ESO1 (HLA-A*02:0 SLLMWITQV) (SEQ ID NO: 433) R-PE labelled Pro5 MHC Pentamer (Proimmune) and CMV (HLA-A*24:02 QYDPVAALF) (SEQ ID NO: 434) R-PE labelled ProS MHC Pentamer (Proimmune) were used according to the manufacturer's instructions. Samples were measured with FACSCanto-II and LSRFortessa cytometers (BD) and analyzed with FACSDiva software (BD).
Example 7
Generation of HLA Monoclonal Antibodies
[0193] Monoclonal antibodies (mAbs) were generated by immunization of C57BL/6 mice with SW480 and LCL-TM after which standard fusion of spleen cells was performed to generate hybridomas. Monoclonality was achieved by cloning by limiting dilution twice after which isotype determination was determined by flow cytometry using ?-mIgG1 APC (Pierce), ?-mIgG2b RPE (Jackson), ?-mIgG2c dylight 405 (Jackson), and ?-mIgG3 PerCP (Jackson). For mAb production, hybridoma's were cultured from about 5?10.sup.5 to about 8?10.sup.5 cells/mL for 1 week in serum-free hybridoma medium. mAbs were purified using protein G HP SpinTrap columns (GE healthcare) following the manufacturer's instructions.
[0194] Protein Separation and Digestion
[0195] Samples were run on a 4-12% Bis-Tris 1D SDS-PAGE gel (BioRad) for 2.5 h and stained with colloidal coomassie dye G-250 (Gel Code Blue Stain Reagent, Thermo Scientific). The lane was cut as three bands, which were treated with 6.5 mM dithiothreitol (DTT) for 1 h at 60? C. for reduction and 54 mM iodoacetamide for 30 min for alkylation. The proteins were digested overnight with trypsin (Promega) at 37? C. The peptides were extracted with 100% acetonitrile and dried in a vacuum concentrator.
[0196] Mass Spectrometry: RP-nanoLC-MS/MS
[0197] Samples were reconstituted in 10% formic acid and analyzed by nano-LC-MS/MS on a Orbitrap Q-Exactive Plus (ThermoFisher Scientific, Bremen) coupled to an Agilent 1290 Infinity System (Agilent Technologies) operating in reverse phase (C18) equipped with a Reprosil pur C18 trap column (100 ?m?2 cm, 3 ?m) and a Poroshell 120 EC C18 (Agilent Technologies) analytical column (75 ?m?50 cm, 2.7 ?m). After trapping with 100% solvent A (0.1% FA in H2O) for 10 min, peptides were eluted with an step gradient consisting of 35 min from 13% to 40% and, 3 min from 40% to 100% solvent B (0.1% FA, 80% ACN). The Q-Exactive Plus was operated in data-dependent acquisition mode using the following settings: full-scan automatic gain control (AGC) target 3e6 at 35 000 resolution; scan range 375-1600 m/z; Orbitrap full-scan maximum injection time 10 ms; MS2 scan AGC target 5e4 at 17 500 resolution; maximum injection 120 ms; normalized collision energy 25; dynamic exclusion time 10 s; isolation window 1.5 m/z; 10 MS2 scans per full scan.
[0198] Mass Spectrometry Data Analysis
[0199] Raw files were processed using Proteome Discoverer 1.4 (version 1.4.1.14, Thermo Scientific, Bremen, Germany). Raw files of the 3 bands per sample were combined in one search against a Uniprot database (Homo Sapiens, April 2015). The following parameters were used: carbamidomethylation of cysteines was set as a fixed modification and oxidation of methionine was set as a variable modification. Trypsin was specified as enzyme and up to two miss cleavages were allowed. A false discovery rate of 0.01 was used. Datasets processed by Proteome Discoverer were submitted to the Contaminant Repository for Affinity Purification (CRAPome) and proteins identified were sorted by Significance Analysis of INTeractome (SAINT) score, and the fold change scores FC-A or FC-B. The controls used were taken from the control immunoprecipitations performed with unspecific antibodies in each cell line. Proteins with SAINT probability greater than 0.9 were considered high-scoring interactions. Final selection of best interactors was based on known response of cell lines to the specific antibodies (Mellacheruvu D, Wright Z, Couzens A L, Lambert J P, St-Denis N A, Li T, et al. The CRAPome: a contaminant repository for affinity purification-mass spectrometry data. Nat Methods. 2013; 10(8):730-6.).
Example 8
Clinical Expansion of Anti-HLA-A*24:02 Engineered ?? T Cells
[0200] In order to generate a large number of transduced T cells, the cells are induced to proliferate using a rapid expansion protocol (REP). Prior to being used in REPs, T cells are started in culture with anti-CD3, anti-CD28 and IL-2 and transduced on the second day after the initiation of culture as detailed above. The cells are cultured in a 75 cm.sup.2 flask at 37? C. and 5% CO.sub.2. The cells are counted and suspended at a concentration of 0.5?10.sup.6 cells/mL in fresh T cell medium with 300 IU/mL of IL-2 every two days for the remainder of the time they will be kept in culture.
Example 9
ELISPOT Assays
Introduction of ??TCR Described Herein in ?? T Cells Re-Established Tumor Cell Recognition
[0201] To analyze the antigen-specific response specifically triggered by tumor cells, ??TCR engineered T cells or mock transduced T cells were initially tested for specific IFN-? release against DAUDI, SW480, EBV-LCL, or PBMC cells by ELISPOT assay. Briefly, 15,000 FE11 TCR-transduced or mock-transduced T cells and 50,000 target cells (ratio 0.3:1) were cocultured for 18 hours in nitrocellulose-bottomed 96-well plates (Millipore) precoated with ?-IFN? antibody (clone 1-D1K) (Mabtech). Plates were washed and incubated with a second biotinylated anti-IFN? antibody (clone 7-B6-1) (Mabtech) followed by streptavidin-HRP (Mabtech). IFN? spots were visualized with TMB substrate (Sanquin) and the number of spots was quantified using ELISPOT Analysis Software (Aelvis). After incubation with tumor cells, ??TCR engineered T cells secreted large amount of IFN-? cytokine in an antigen-specific manner,
[0202] For testing stimulation of WT1 ??TCR-transduced T cells, the HLA-A2+ cell lines T2, SW480 and K562 HLA-A*02:01 were pulsed with 10 ?M WT1 126-134 (RMFPNAPYL) (SEQ ID NO: 435) peptide.
HLA-A*24:02 Dependent Tumor Cell Recognition
[0203] To analyze the HLA-A*24:02-specific response specifically triggered by tumor cells, ??TCR engineered T cells were tested for specific IFN-y release against LCL-TM, DAUDI, U266 OPM2 or SW480 by ELISPOT assay. After incubation with tumor cells, ??TCR engineered T cells secreted large amount of IFN-? cytokine in an HLA-A*24:02-specific manner,
TABLE-US-00003 TABLE 3 HLA-A expression on various cell lines Cell line IFN? Killing HLA-A HLA-A LCL-18 No ND A*0201 A*24:03 LCL-22 Yes ND A*2402 A*0101 LCL-48 No ND A*2902 A*0201 LCL-66 No ND A*0201 A*0201 LCL-68 No ND A*0201 A*0201 LCL-69 Yes ND A*2402 A*0201 LCL-71 No ND A*2501 A*1101 LCL-82 Yes ND A*0301 A*2402 LCL-86 No ND A*0301 A*0301 LCL-87 Yes ND A*0101 A*2402 LCL-89 Yes ND A*2402 A*2402 LCL-93 Yes Yes A*2402 A*2501 LCL-TM Yes Yes A*24:02:01:01 A*03:01:01:01 SW480 Yes Yes A*02:01:01:01 A*24:02:01:01 Daudi No No K562 No ND Hep-2 No No A*68:02:01:01 HepG2 Yes Yes A*24 A*02 MZ1851RC No No HeLa No ND Cal27 No No T2 ND No HEK293FT ND No A*03:01 A*02:01 COS-7 Trans. Yes ND A*24:02 COS-7 Trans. No ND A*02 K562 Trans. Yes ND A*24:02 K562 Trans. No ND A*02 OPM2 Yes ND A*24:02:01:01 A*24:02:01:01 U266 No ND A*02+ A*24?
Example 10
ELISA Assay
Blocking Actin Polymerization Blocks COS7 HLA-A*24:02 Target Cell Recognition
[0204] To evaluate whether recognition of target tumor cells is mediated via clustering of HLA-A*24:02 on the tumor cell surface a blocking actin polymerization assay was performed. Tumor cells COS7-A*02, COS7-A*24, K562-A*02, K562-A*24, K562-WT and PBMC were treated with cytochalasin D (CytoD), a widely used inhibitor of actin dynamics, prior to incubation with ??TCR-FE11. Results show that blocking actin polymerization blocks COS7 recognition by ??TCR-FE11,
Paraformaldehyde Fixing of Target Cells Inhibits Recognition
[0205] To evaluate whether recognition of target tumor cells is mediated via clustering of HLA-A*24:02 on the tumor cell surface a paraformaldehyde fixing of tumor cells was performed prior to a cocultured assay. Tumor cells COS7-A*02, COS7-A*24, K562-A*02, K562-A*24, K562-WT and PBMC were treated with paraformaldehyde prior to incubation with ??TCR-FE11. Results show that fixing tumor cells prior to coculture with ??TCR-FE11 inhibits recognition by ??TCR-FE11,
Example 11
Clinical Administration and Evaluation of Engineered Cells Expressing Polypeptide Constructs Described Herein
[0206] Patients with evaluable cancer undergo apheresis to isolate peripheral blood mononuclear cells. Lymphocytes are isolated, virally transduced with a polypeptide construct comprising a TCR described herein, expanded, and aliquots taken for immunologic testing. On days ?7 and ?6 before T cell administration, patients undergo a preparative regime of cyclophosphamide at 60 mg/kg/day?2 days IV over 1 hr. On days ?7 and ?3 before cellular administration, patients undergo a preparative regime of fludarabine 25 mg/m.sup.2/day IVPB daily over 30 minutes for 5 days. During the preparative regimen, patients undergo daily complete blood count (CBC) testing.
[0207] In the first part of a phase I study a dose escalation is initiated utilizing one patient per group starting at 10.sup.9 engineered T cells per patient. Individual patients are treated at half log increments. Thus the following doses will be utilized: 10.sup.9, 3?10.sup.9 cells, 10.sup.10 cells, 3?10.sup.10 cells, and up to 1?10.sup.11 cells. Autologous T cells expressing a polypeptide construct described herein are administered intravenously over 20 to 30 minutes via non-filtered tubing.
[0208] All patients return to the clinic for evaluation 6 weeks following administration of the cellular product.
Example 12
Quantitative PCR
[0209] Q-PCR is used to quantify retroviral integrants for ??-modified T lymphocytes by detecting the ??TCR transgene in PBMCs collected before and at different time points after T cell infusion. After DNA extraction with the QIAamp DNA Blood Mini Kit (Qiagen), DNA is amplified in triplicate with primers and TaqMan probes (Applied Biosystems) specific for the ??TCR transgene, using the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). The baseline range is set at cycles 6 to 15, with the threshold at 10 SDs above the baseline fluorescence. To generate DNA standards, serial dilution of DNA plasmids encoding ??TCR transgene cassettes are used.
Example 13
Tumor Clustering Detection
[0210] Freshly harvested tumor cells are labeled before or after gentle fixation with 0.5% paraformaldehyde for 1 hr at 4? C. After washing the cell suspension twice in phosphate-buffered saline (PBS, pH 7.4), the cell pellet is resuspended in 100 ?l of PBS and incubated with 100 ?g/ml of FITC- or TRITC-conjugated mAb for 40 min at 4? C. Using FITC-conjugated antibodies as first antibodies before immunogold labeling is useful for checking antibody binding. Labeled cells are washed twice in cold PBS and fixed at this point of preparation. For scanning force microscopic (SFM) and transmission electron microscopic (TEM) measurements the cell suspension is further incubated with 10 ?l of Aurogamig G-30 (Amersham; diameter, 30?3 nm) or 10 ?l of gold-labeled goat-anti-mouse-Ig (Sigma Aldrich; diameter, 15 ?m?2 nm) carrying polyclonal goat anti-mouse antibodies directed against IgG Fc and the whole molecule, respectively. In some experiments Aurogamig G-15 (Amersham; diameter, 15?1 nm) against IgG Fc can also be used. After 40 min incubation on ice, the cells are washed and stored at 4? C. The excess valences of gold beads are neutralized by adding mouse IgG in large quantity before applying the second mAb and the second gold beads. The possibility of artefactual clustering of receptors by the labeling procedure with bivalent antibodies is excluded by testing Fab fragments of every applied antibody. Furthermore, fixing the cells in 0.5% paraformaldehyde before or after the labeling does not influence the results.
Example 14
Flow Cytometric Energy Transfer Measurements
[0211] To study dimerization of HLA, cells were labelled with Alexa594-conjugated ?-HLA-A (donor) and Alexa647-conjugated ?-HLA-A (acceptor), respectively. The donor fluorescence was measured using a FACS LSRFortessa flow cytometer (BD) where donor fluorescence of the double-labeled healthy samples was compared with that of the double-labeled malignant samples. FRET efficiency was calculated from the fractional decrease of the donor fluorescence in the presence of the acceptor. FRET efficiency was calculated with equations according to Sebestyen and colleagues (Sebestyen Z, Nagy P, Horvath G, Vamosi G, Debets R, Gratama J W, et al. Long wavelength fluorophores and cell-by-cell correction for autofluorescence significantly improves the accuracy of flow cytometric energy transfer measurements on a dual-laser benchtop flow cytometer. Cytometry. 2002; 48(3):124-35.) where donor fluorescence was excited at 488 nm and detected at 576?26 nm, acceptor fluorescence was excited at 635 nm and detected at 780?60 nm, whereas FRET intensity was excited at 488 nm and detected at 780?60 nm. Correction factors for the spectral overlap between the different fluorescence channels were obtained from data measured on unlabeled and single-labeled cells.
Example 15
CRISPR Genome Editing
[0212] HEK293FT cells were transfected using Fugene-HD (Promega) with lentiviral constructs containing ?2m (Sigma-Aldrich) together with lentiviral helper constructs VSVG and pspax2. LCL-TM cells were transduced with viral supernatants, knockdown was confirmed by flow cytometry. The ?2m gene-specific regions of the gRNA sequence (GAGTAGCGCGAGCACAGCTA) (SEQ ID NO: 436) was designed by the CRISPR design tool from the Zhang lab (http://crispr.mit.edu/). As control gRNA, the eGFP gene (GGAGCGCACCATCTTCTTCA) (SEQ ID NO: 437) was targeted.
Example 16
Role of ??TCR-Like Antibodies and Classical HLA Molecules
[0213] To identify a TCR ligand, TCR-like antibodies, i.e. antibodies recognizing the same epitope as the ??TCR, were generated and were used identify a ligand by immunoprecipitation and mass spectrometry. To raise these antibodies, C57BL/6 mice were immunized with complete cell lines SW480 and LCL-TM that were recognized by the ??TCR, after which hybridomas were produced by fusing mice B-cells to myeloma cells. These hybridomas were cloned by limiting dilution from which clones were isolated that produced antibodies that specifically bound ??TCR reactive tumor cells in an antibody binding screen (
TABLE-US-00004 TABLE 4 Immunoprecipitation with antibodies indicates that HLA molecules are part of the ligand. Sample Accession ID Gene LCL-12 P30498 HLA-B LCL-12 Q29963 HLA-C LCL-12 P04439 HLA-A LCL-12 P30508 HLA-C LCL-12 Q95604 HLA-C LCL-12 P30499 HLA-C LCL-12 P05534 HLA-A LCL-12 P18463 HLA-B LCL-12 P04222 HLA-C LCL-12 P01892 HLA-A LCL-12 P61769 B2M LCL-12 P30511 HLA-F LCL-6 P05534 HLA-A LCL-6 P01892 HLA-A LCL-6 P04439 HLA-A LCL-6 Q95604 HLA-C LCL-6 P30508 HLA-C LCL-6 Q29963 HLA-C SW-12 P05534 HLA-A SW-12 P01892 HLA-A SW-12 P10321 HLA-C SW-12 P01889 HLA-B SW-12 P18464 HLA-B SW-12 Q95604 HLA-C SW-12 P04222 HLA-C SW-12 P17693 HLA-G SW-12 P30511 HLA-F SW-12 P16403 HIST1H1C SW-12 P10412 HIST1H1E SW-6 P05534 HLA-A
Target Cell Recognition by a Polypeptide Construct Described Herein Comprising a ??TCR Depends on HLA-A*24:02.
[0214] To further narrow down the type of HLA recognized by ??TCR described herein, a large collection of EBV-transformed B cell lines (EBV-LCLs) were obtained from several family pedigrees with a large variety of HLA haplotypes. TEG011 were co-incubated with 7 different CEPH EBV-LCLs, covering multiple possible HLA molecules as suggested by the LABScreen beads (
[0215] In order to test whether density of the ligand is important of the recognition of a target by a ??TCR described herein, we compared activity of TEG011 against LCL cell lines homozygous or heterozygous for HLA-A*24:02. In line with the assumption that density of ligand at a cell surface enhances functional avidity, indeed a higher reactivity of TEG001 was observed against cell lines homozygous for HLA-A*24:02 (
Example 17
Polypeptide Constructs Comprising ??TCR Described Herein Selectively Recognizes HLA-A*24:02 Expressed in Malignant but Not Healthy Cells
[0216] To assess if recognition is limited to HLA-A*24:02 positive transformed cells TEG011 were co-incubated with healthy primary T cells which were either positive or negative for HLA-A*24:02. In contrast to HLA-A*24:02 positive COS-7 or K562 tumor cells, healthy primary cells were not recognized by TEG011 even when they were positive for HLA-A*24:02 (
Binding-Site of Polypeptide Constructs Comprising ??TCR Described Herein
[0217] To further map the putative binding site of polypeptide structural non-homologies between HLA-A*24:02 and HLA-A*02:01, which are classified within different HLA-supertypes as well as HLA-types with more homology to HLA-A*24:02 and functional activity of TEG011 against a range of EBV-LCLs from the CEPH library covering these different HLA-types (
Involvement of a Peptide in HLA-A*24:02 Recognition by Polypeptide Constructs Comprising ??TCR Described Herein
[0218] Due to the close proximity of the putative binding site to the peptide binding groove (
[0219] To further show that endogenously processed peptides are utilized for reactivity of the cellular peptide processing machinery, the machinery was impeded by inhibiting the proteasome. To achieve this we pre-treated recognized cells with the proteasome inhibitor Bortezomib and assessed the influence on TCR T cell reactivity. Bortezomib treatment lead to a significant decrease in recognition of both HLA-A*24:02 transduced COS-7 and K562 (
Compartmentalization as a Factor for Recognition
[0220] F?rster resonance energy transfer (FRET) using flow cytometry as previously described. The FRET data indicate that HLA homodimerizes on non-recognized cells like PBMCs while no homo-dimerization can be observed on HLA-A24:02 positive K562 (
Example 18
??TCR Described Herein Selectively Recognizes HLA-A*24:02 Expressed in Malignant but Not Healthy Cells
[0221] In order to show that the ??TCR-HLA interaction differs substantially from classical HLA ??TCR interactions the potential role of co-receptors were evaluated. One candidate due to HLA-I restriction was CD8??. First, CD8 expression of the original clone in line with previous reports (
[0222] These data have also been confirmed by comparing CD8 positive and CD8 negative Jurma cells expressing ??TCR described herein (
Example 19
Related Sequences for Polypeptides Described Herein
[0223] To generate additional sequences that can be useful for polypeptides described herein that selectively bind a desired HLA conformation, site-directed mutagenesis is performed by overlap extension PCR, Ho, S. N., et al., Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene, 1989. 77(1): p. 51-9., or whole-plasmid mutagenesis, Miyazaki, K., MEGAWHOP cloning: a method of creating random mutagenesis libraries via megaprimer PCR of whole plasmids. Methods Enzymol, 2011. 498: p. 399-406, using a proofreading polymerase (Phusion; Woke). Mutations are preformed on both the CDR3? and CDR3? regions including the entire J?1 and J?1 segments. Mutated ?- or ?-TCR chains are ligated into the retroviral vector pBullet and sequenced.
TABLE-US-00005 TABLE5 DeltaTCRfunctionalregionsequencesforuse inpolypeptidesdescribedherein SEQIDNO: PolypeptideSequence 6 CALGDSYGGGPLYTDKLIF 7 CALGESYGGGPLYTDKLIF 8 CALGNSYGGGPLYTDKLIF 9 CALGQSYGGGPLYTDKLIF 10 CALGDTYGGGPLYTDKLIF 11 CALGETYGGGPLYTDKLIF 12 CALGNTYGGGPLYTDKLIF 13 CALGQTYGGGPLYTDKLIF 14 CALGDSFGGGPLYTDKLIF 15 CALGESFGGGPLYTDKLIF 16 CALGNSFGGGPLYTDKLIF 17 CALGQSFGGGPLYTDKLIF 18 CALGDTFGGGPLYTDKLIF 19 CALGETFGGGPLYTDKLIF 20 CALGNTFGGGPLYTDKLIF 21 CALGQTFGGGPLYTDKLIF 22 CALGDSYAGGPLYTDKLIF 23 CALGESYAGGPLYTDKLIF 24 CALGNSYAGGPLYTDKLIF 25 CALGQSYAGGPLYTDKLIF 26 CALGDTYAGGPLYTDKLIF 27 CALGETYAGGPLYTDKLIF 28 CALGNTYAGGPLYTDKLIF 29 CALGQTYAGGPLYTDKLIF 30 CALGDSYGAGPLYTDKLIF 31 CALGESYGAGPLYTDKLIF 32 CALGNSYGAGPLYTDKLIF 33 CALGQSYGAGPLYTDKLIF 34 CALGDTYGAGPLYTDKLIF 35 CALGETYGAGPLYTDKLIF 36 CALGNTYGAGPLYTDKLIF 37 CALGQTYGAGPLYTDKLIF 38 CALGDSYGGAPLYTDKLIF 39 CALGESYGGAPLYTDKLIF 40 CALGNSYGGAPLYTDKLIF 41 CALGQSYGGAPLYTDKLIF 42 CALGDTYGGAPLYTDKLIF 43 CALGETYGGAPLYTDKLIF 44 CALGNTYGGAPLYTDKLIF 45 CALGQTYGGAPLYTDKLIF 46 CALGDSYGGGPIYTDKLIF 47 CALGESYGGGPIYTDKLIF 48 CALGNSYGGGPIYTDKLIF 49 CALGQSYGGGPIYTDKLIF 50 CALGDTYGGGPIYTDKLIF 51 CALGETYGGGPIYTDKLIF 52 CALGNTYGGGPIYTDKLIF 53 CALGQTYGGGPIYTDKLIF 54 CALGDSFGGGPIYTDKLIF 55 CALGESFGGGPIYTDKLIF 56 CALGNSFGGGPIYTDKLIF 57 CALGQSFGGGPIYTDKLIF 58 CALGDSYGGGPLFTDKLIF 59 CALGESYGGGPLFTDKLIF 60 CALGNSYGGGPLFTDKLIF 61 CALGQSYGGGPLFTDKLIF 62 CALGDTYGGGPLFTDKLIF 63 CALGETYGGGPLFTDKLIF 64 CALGNTYGGGPLFTDKLIF 65 CALGQTYGGGPLFTDKLIF 66 CALGDSFGGGPLFTDKLIF 67 CALGESFGGGPLFTDKLIF 68 CALGNSFGGGPLFTDKLIF 69 CALGQSFGGGPLFTDKLIF 70 CALGDSYGGGPIYSDKLIF 71 CALGESYGGGPIYSDKLIF 72 CALGNSYGGGPIYSDKLIF 73 CALGQSYGGGPIYSDKLIF 74 CALGDTYGGGPIYSDKLIF 75 CALGETYGGGPIYSDKLIF 76 CALGNTYGGGPIYSDKLIF 77 CALGQTYGGGPIYSDKLIF 78 CALGDSFGGGPIYSDKLIF 79 CALGESFGGGPIYSDKLIF 80 CALGNSFGGGPIYSDKLIF 81 CALGQSFGGGPIYSDKLIF 82 CALGDSYGGGPLFSDKLIF 83 CALGESYGGGPLFSDKLIF 84 CALGNSYGGGPLFSDKLIF 85 CALGQSYGGGPLFSDKLIF 86 CALGDTYGGGPLFSDKLIF 87 CALGETYGGGPLFSDKLIF 88 CALGNTYGGGPLFSDKLIF 89 CALGQTYGGGPLFSDKLIF 90 CALGDSFGGGPLFSDKLIF 91 CALGESFGGGPLFSDKLIF 92 CALGNSFGGGPLFSDKLIF 93 CALGQSFGGGPLFSDKLIF 94 CALGDSYGGGPIYTEKLIF 95 CALGESYGGGPIYTEKLIF 96 CALGNSYGGGPIYTEKLIF 97 CALGQSYGGGPIYTEKLIF 98 CALGDTYGGGPIYTEKLIF 99 CALGETYGGGPIYTEKLIF 100 CALGNTYGGGPIYTEKLIF 101 CALGQTYGGGPIYTEKLIF 102 CALGDSFGGGPIYTEKLIF 103 CALGESFGGGPIYTEKLIF 104 CALGNSFGGGPIYTEKLIF 105 CALGQSFGGGPIYTEKLIF 106 CALGDSYGGGPLFTEKLIF 107 CALGESYGGGPLFTEKLIF 108 CALGNSYGGGPLFTEKLIF 109 CALGQSYGGGPLFTEKLIF 110 CALGDTYGGGPLFTEKLIF 111 CALGETYGGGPLFTEKLIF 112 CALGNTYGGGPLFTEKLIF 113 CALGQTYGGGPLFTEKLIF 114 CALGDSFGGGPLFTEKLIF 115 CALGESFGGGPLFTEKLIF 116 CALGNSFGGGPLFTEKLIF 117 CALGQSFGGGPLFTEKLIF 118 CALGDSYGGGPIYTNKLIF 119 CALGESYGGGPIYTNKLIF 120 CALGNSYGGGPIYTNKLIF 121 CALGQSYGGGPIYTNKLIF 122 CALGDTYGGGPIYTNKLIF 123 CALGETYGGGPIYTNKLIF 124 CALGNTYGGGPIYTNKLIF 125 CALGQTYGGGPIYTNKLIF 126 CALGDSFGGGPIYTNKLIF 127 CALGESFGGGPIYTNKLIF 128 CALGNSFGGGPIYTNKLIF 129 CALGQSFGGGPIYTNKLIF 130 CALGDSYGGGPLFTNKLIF 131 CALGESYGGGPLFTNKLIF 132 CALGNSYGGGPLFTNKLIF 133 CALGQSYGGGPLFTNKLIF 134 CALGDTYGGGPLFTNKLIF 135 CALGETYGGGPLFTNKLIF 136 CALGNTYGGGPLFTNKLIF 137 CALGQTYGGGPLFTNKLIF 138 CALGDSFGGGPLFTNKLIF 139 CALGESFGGGPLFTNKLIF 140 CALGNSFGGGPLFTNKLIF 141 CALGQSFGGGPLFTNKLIF 142 CALGDSYGGGPIYSEKLIF 143 CALGESYGGGPIYSEKLIF 144 CALGNSYGGGPIYSEKLIF 145 CALGQSYGGGPIYSEKLIF 146 CALGDTYGGGPIYSEKLIF 147 CALGETYGGGPIYSEKLIF 148 CALGNTYGGGPIYSEKLIF 149 CALGQTYGGGPIYSEKLIF 150 CALGDSFGGGPIYSEKLIF 151 CALGESFGGGPIYSEKLIF 152 CALGNSFGGGPIYSEKLIF 153 CALGQSFGGGPIYSEKLIF 154 CALGDSYGGGPLFSEKLIF 155 CALGESYGGGPLFSEKLIF 156 CALGNSYGGGPLFSEKLIF 157 CALGQSYGGGPLFSEKLIF 158 CALGDTYGGGPLFSEKLIF 159 CALGETYGGGPLFSEKLIF 160 CALGNTYGGGPLFSEKLIF 161 CALGQTYGGGPLFSEKLIF 162 CALGDSFGGGPLFSEKLIF 163 CALGESFGGGPLFSEKLIF 164 CALGNSFGGGPLFSEKLIF 165 CALGQSFGGGPLFSEKLIF 166 CALGDSYGGGPIYSNKLIF 167 CALGESYGGGPIYSNKLIF 168 CALGNSYGGGPIYSNKLIF 169 CALGQSYGGGPIYSNKLIF 170 CALGDTYGGGPIYSNKLIF 171 CALGETYGGGPIYSNKLIF 172 CALGNTYGGGPIYSNKLIF 173 CALGQTYGGGPIYSNKLIF 174 CALGDSFGGGPIYSNKLIF 175 CALGESFGGGPIYSNKLIF 176 CALGNSFGGGPIYSNKLIF 177 CALGQSFGGGPIYSNKLIF 178 CALGDSYGGGPLFSNKLIF 179 CALGESYGGGPLFSNKLIF 180 CALGNSYGGGPLFSNKLIF 181 CALGQSYGGGPLFSNKLIF 182 CALGDTYGGGPLFSNKLIF 183 CALGETYGGGPLFSNKLIF 184 CALGNTYGGGPLFSNKLIF 185 CALGQTYGGGPLFSNKLIF 186 CALGDSFGGGPLFSNKLIF 187 CALGESFGGGPLFSNKLIF 188 CALGNSFGGGPLFSNKLIF 189 CALGQSFGGGPLFSNKLIF 190 CALGDSYGGGPIYTDRLIF 191 CALGESYGGGPIYTDRLIF 192 CALGNSYGGGPIYTDRLIF 193 CALGQSYGGGPIYTDRLIF 194 CALGDTYGGGPIYTDRLIF 195 CALGETYGGGPIYTDRLIF 196 CALGNTYGGGPIYTDRLIF 197 CALGQTYGGGPIYTDRLIF 198 CALGDSFGGGPIYTDRLIF 199 CALGESFGGGPIYTDRLIF 200 CALGNSFGGGPIYTDRLIF 201 CALGQSFGGGPIYTDRLIF 202 CALGDSYGGGPLFTDRLIF 203 CALGESYGGGPLFTDRLIF 204 CALGNSYGGGPLFTDRLIF 205 CALGQSYGGGPLFTDRLIF 206 CALGDTYGGGPLFTDRLIF 207 CALGETYGGGPLFTDRLIF 208 CALGNTYGGGPLFTDRLIF 209 CALGQTYGGGPLFTDRLIF 210 CALGDSFGGGPLFTDRLIF 211 CALGESFGGGPLFTDRLIF 212 CALGNSFGGGPLFTDRLIF 213 CALGQSFGGGPLFTDRLIF 214 CALGDSYGGGPIYSDRLIF 215 CALGESYGGGPIYSDRLIF 216 CALGNSYGGGPIYSDRLIF 217 CALGQSYGGGPIYSDRLIF 218 CALGDTYGGGPIYSDRLIF 219 CALGETYGGGPIYSDRLIF 220 CALGNTYGGGPIYSDRLIF 221 CALGQTYGGGPIYSDRLIF 222 CALGDSFGGGPIYSDRLIF 223 CALGESFGGGPIYSDRLIF 224 CALGNSFGGGPIYSDRLIF 225 CALGQSFGGGPIYSDRLIF 226 CALGDSYGGGPLFSDRLIF 227 CALGESYGGGPLFSDRLIF 228 CALGNSYGGGPLFSDRLIF 229 CALGQSYGGGPLFSDRLIF 230 CALGDTYGGGPLFSDRLIF 231 CALGETYGGGPLFSDRLIF 232 CALGNTYGGGPLFSDRLIF 233 CALGQTYGGGPLFSDRLIF 234 CALGDSFGGGPLFSDRLIF 235 CALGESFGGGPLFSDRLIF 236 CALGNSFGGGPLFSDRLIF 237 CALGQSFGGGPLFSDRLIF
TABLE-US-00006 TABLE6 GammaTCRfunctionalregionsequencesforuse inpolypeptidesdescribedherein SEQIDNO: Mutant(FE11gamma) 238 CATWDRPEIYYKKLF 239 CATWERPEIYYKKLF 240 CATWNRPEIYYKKLF 241 CATWQRPEIYYKKLF 242 CATWDKPEIYYKKLF 243 CATWEKPEIYYKKLF 244 CATWNKPEIYYKKLF 245 CATWQKPEIYYKKLF 246 CATWDRPDIYYKKLF 247 CATWERPDIYYKKLF 248 CATWNRPDIYYKKLF 249 CATWQRPDIYYKKLF 250 CATWDKPDIYYKKLF 251 CATWEKPDIYYKKLF 252 CATWNKPDIYYKKLF 253 CATWQKPDIYYKKLF 254 CATWDRPNIYYKKLF 255 CATWERPNIYYKKLF 256 CATWNRPNIYYKKLF 257 CATWQRPNIYYKKLF 258 CATWDKPNIYYKKLF 259 CATWEKPNIYYKKLF 260 CATWNKPNIYYKKLF 261 CATWQKPNIYYKKLF 262 CATWDRPQIYYKKLF 263 CATWERPQIYYKKLF 264 CATWNRPQIYYKKLF 265 CATWQRPQIYYKKLF 266 CATWDKPQIYYKKLF 267 CATWEKPQIYYKKLF 268 CATWNKPQIYYKKLF 269 CATWQKPQIYYKKLF 270 CATWDRPELYYKKLF 271 CATWERPELYYKKLF 272 CATWNRPELYYKKLF 273 CATWQRPELYYKKLF 274 CATWDKPELYYKKLF 275 CATWEKPELYYKKLF 276 CATWNKPELYYKKLF 277 CATWQKPELYYKKLF 278 CATWDRPDLYYKKLF 279 CATWERPDLYYKKLF 280 CATWNRPDLYYKKLF 281 CATWQRPDLYYKKLF 282 CATWDKPDLYYKKLF 283 CATWEKPDLYYKKLF 284 CATWNKPDLYYKKLF 285 CATWQKPDLYYKKLF 286 CATWDRPNLYYKKLF 287 CATWERPNLYYKKLF 288 CATWNRPNLYYKKLF 289 CATWQRPNLYYKKLF 290 CATWDKPNLYYKKLF 291 CATWEKPNLYYKKLF 292 CATWNKPNLYYKKLF 293 CATWQKPNLYYKKLF 294 CATWDRPQLYYKKLF 295 CATWERPQLYYKKLF 296 CATWNRPQLYYKKLF 297 CATWQRPQLYYKKLF 298 CATWDKPQLYYKKLF 299 CATWEKPQLYYKKLF 300 CATWNKPQLYYKKLF 301 CATWQKPQLYYKKLF 302 CATWDRPEIFYKKLF 303 CATWERPEIFYKKLF 304 CATWNRPEIFYKKLF 305 CATWQRPEIFYKKLF 306 CATWDKPEIFYKKLF 307 CATWEKPEIFYKKLF 308 CATWNKPEIFYKKLF 309 CATWQKPEIFYKKLF 310 CATWDRPDIFYKKLF 311 CATWERPDIFYKKLF 312 CATWNRPDIFYKKLF 313 CATWQRPDIFYKKLF 314 CATWDKPDIFYKKLF 315 CATWEKPDIFYKKLF 316 CATWNKPDIFYKKLF 317 CATWQKPDIFYKKLF 318 CATWDRPNIFYKKLF 319 CATWERPNIFYKKLF 320 CATWNRPNIFYKKLF 321 CATWQRPNIFYKKLF 322 CATWDKPNIFYKKLF 323 CATWEKPNIFYKKLF 324 CATWNKPNIFYKKLF 325 CATWQKPNIFYKKLF 326 CATWDRPQIFYKKLF 327 CATWERPQIFYKKLF 328 CATWNRPQIFYKKLF 329 CATWQRPQIFYKKLF 330 CATWDKPQIFYKKLF 331 CATWEKPQIFYKKLF 332 CATWNKPQIFYKKLF 333 CATWQKPQIFYKKLF 334 CATWDRPELFYKKLF 335 CATWERPELFYKKLF 336 CATWNRPELFYKKLF 337 CATWQRPELFYKKLF 338 CATWDKPELFYKKLF 339 CATWEKPELFYKKLF 340 CATWNKPELFYKKLF 341 CATWQKPELFYKKLF 342 CATWDRPDLFYKKLF 343 CATWERPDLFYKKLF 344 CATWNRPDLFYKKLF 345 CATWQRPDLFYKKLF 346 CATWDKPDLFYKKLF 347 CATWEKPDLFYKKLF 348 CATWNKPDLFYKKLF 349 CATWQKPDLFYKKLF 350 CATWDRPNLFYKKLF 351 CATWERPNLFYKKLF 352 CATWNRPNLFYKKLF 353 CATWQRPNLFYKKLF 354 CATWDKPNLFYKKLF 355 CATWEKPNLFYKKLF 356 CATWNKPNLFYKKLF 357 CATWQKPNLFYKKLF 358 CATWDRPQLFYKKLF 359 CATWERPQLFYKKLF 360 CATWNRPQLFYKKLF 361 CATWQRPQLFYKKLF 362 CATWDKPQLFYKKLF 363 CATWEKPQLFYKKLF 364 CATWNKPQLFYKKLF 365 CATWQKPQLFYKKLF 366 CATWERPEVFYKKLF 367 CATWNRPEVFYKKLF 368 CATWQRPEVFYKKLF 369 CATWDKPEVFYKKLF 370 CATWEKPEVFYKKLF 371 CATWNKPEVFYKKLF 372 CATWQKPEVFYKKLF 373 CATWDRPDVFYKKLF 374 CATWERPDVFYKKLF 375 CATWNRPDVFYKKLF 376 CATWQRPDVFYKKLF 377 CATWDKPDVFYKKLF 378 CATWEKPDVFYKKLF 379 CATWNKPDVFYKKLF 380 CATWQKPDVFYKKLF 381 CATWDRPNVFYKKLF 382 CATWERPNVFYKKLF 383 CATWNRPNVFYKKLF 384 CATWQRPNVFYKKLF 385 CATWDKPNVFYKKLF 386 CATWEKPNVFYKKLF 387 CATWNKPNVFYKKLF 388 CATWQKPNVFYKKLF 389 CATWDRPQVFYKKLF 390 CATWERPQVFYKKLF 391 CATWNRPQVFYKKLF 392 CATWQRPQVFYKKLF 393 CATWDKPQVFYKKLF 394 CATWEKPQVFYKKLF 395 CATWNKPQVFYKKLF 396 CATWQKPQVFYKKLF 397 CATWERPEVYYKKLF 398 CATWNRPEVYYKKLF 399 CATWQRPEVYYKKLF 400 CATWDKPEVYYKKLF 401 CATWEKPEVYYKKLF 402 CATWNKPEVYYKKLF 403 CATWQKPEVYYKKLF 404 CATWDRPDVYYKKLF 405 CATWERPDVYYKKLF 406 CATWNRPDVYYKKLF 407 CATWQRPDVYYKKLF 408 CATWDKPDVYYKKLF 409 CATWEKPDVYYKKLF 410 CATWNKPDVYYKKLF 411 CATWQKPDVYYKKLF 412 CATWDRPNVYYKKLF 413 CATWERPNVYYKKLF 414 CATWNRPNVYYKKLF 415 CATWQRPNVYYKKLF 416 CATWDKPNVYYKKLF 417 CATWEKPNVYYKKLF 418 CATWNKPNVYYKKLF 419 CATWQKPNVYYKKLF 420 CATWDRPQVYYKKLF 421 CATWERPQVYYKKLF 422 CATWNRPQVYYKKLF 423 CATWQRPQVYYKKLF 424 CATWDKPQVYYKKLF 425 CATWEKPQVYYKKLF 426 CATWNKPQVYYKKLF 427 CATWQKPQVYYKKLF 428 ATWDRPEIYYKKL
Example 20
Murine Model of Solid or Hematological Malignancy
[0224] The NOD.Cg-Prkcd.sup.scid IL2rg.sup.tm1Wjt/SzJ (NSG) mice were obtained from The Jackson Laboratory (Bar Harbor, Me., USA) and the NOD.Cg-Prkdc Il2rg Tg(HLA-A24)3Dvs/Sz (NSG-A24) mice were kindly provided by Leonard D. Shultz (The Jackson Laboratory). All mice are housed in the specific pathogen-free (SPF) breeding unit of the Central Animal Facility of Utrecht University. Experiments are conducted according to institutional guidelines after acquiring permission from the local ethical committee and in accordance with current Dutch laws on animal experimentation. Mice receive sublethal total body irradiation followed injection of human hematological tumor cells or implantation of human solid tumor cells after which they are treated with TEGs or Mock TCR transduced T cells. Luciferase positive tumors are visualized in vivo by bioluminescent imaging. Mice are anesthetized by isoflurane before they receive an i.p. injection of Luciferin (Promega). Bioluminescence images are acquired by using a third generation cooled GaAs intensified charge-coupled device camera, controlled by the Photo Vision software and analyzed with M.sup.3Vision software (all from Photon Imager; Biospace Laboratory, Paris, France). Tumor growth, tumor free survival and overall survival are used to assess TEG anti-tumor activity compared to Mock TCR T cells. TEG persistence in peripheral blood is measured weekly by flow cytometry. Two times a week clinical symptoms are scored including weight measurements. In case the pre-defined human point is reached or the experiment is ended mice are euthanized for a necropsy and pathological screening.
Example 21
V?1 ??TCR Library Generation
[0225] RNA is extracted from ??T cells obtained by MACS isolation from PBMC of healthy donors using RNeasy kit (Qiagen). Specific cDNA for ?TCR and ?TCR is synthesized with Superscript? II Reverse Transcriptase (Thermofisher), using a specific primer at the 3 constant region of ?TCR or ?TCR. V?1 TCR DNA is amplified using a V?1 gene specific 5 primer and the 3 constant region primer. This DNA is ligated in a retroviral expression plasmid containing a puromycin resistance gene under the same promotor as the ?TCR gene. A similar strategy is done for ?TCR gene. Gene specific 5 primers for V?2/4, V?3/5 and V?8 and the 3 constant region primer is used to amplify these ?TCR genes. The PCR product is ligated in retroviral expression plasmid containing a neomycin resistance gene under the same promotor as the ?TCR gene. The ligation mixes are used to transform chemical competent E. coli DH5? cells using a heat shock protocol. The transformed E. coli are used to inoculate an overnight culture for the extraction of plasmid DNA.
Transduction of Jurkat Cells Using the V?1-V? TCR Library
[0226] Phoenix ampho cells are transfected with the retroviral expression plasmids containing V?1 TCR genes and the V? genes as well as retroviral helper plasmids pHit60 and pColtGalV. 48 hours post transfection the virus containing culture media is used for the transduction of Jurkat cells. This process is repeated once more. Successfully transduced Jurkat cells are selected using 800 ?g/ml G418 and 1 ?g/ml puromycin. An additional ??TCR MACS isolation is done to include Jurkat cells expressing paired ? and ? TCR chains.
Screening for K562-HLA-A *24:02 Reactive V?1 ??TCRs
[0227] Jurkat cells transduced with the V?1 ??TCR library are incubated overnight with K562 cells at a 1:3 ratio. The cells are stained with anti-CD69-APC and anti-CD3-PE and sorted using flow cytometry. The sorted non-activated Jurkat cells (CD3.sup.+CD69.sup.?) are rested and expanded for one week before overnight simulation with HLA-A*24:02 transduced K562 cells. The cells are again stained with anti-CD69-APC and anti-CD3-PE and CD3.sup.+CD69.sup.+ cells are single cell sorted in a 96 well plates. The V?1 ??TCR Jurkat clones are again assessed for reactivity for K562-HLA-A*24:02 and non-reactivity for K562 cells. The truly K562-HLA-A*24:02 reactive V?1 ??TCR Jurkat clones are sequenced to determine ? and ? TCR sequences.
Example 22
Stability Testing
[0228] A composition or pharmaceutical composition described herein containing at least one polypeptide described herein or a cell, such as an engineered cell expressing a polypeptide described herein is stored in a sealed container at 25? C. or 4? C. and the container is placed in an atmosphere having 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90% or 95% relative humidity. After 1 month, 2 months, 3 months, 6 months, 1 year, 1.5 years, 2 years, 2.5 years or 3 years, at least 50%, 60%, 70%, 80% or 90% of the pharmaceutical composition shall remain as determined by standard protocols.
[0229] While specific embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.