SINGLE-CHAIN ANTIBODY SPECIFICALLY BINDING MG7, HIGHLY GLYCOSYLATED CEA AND USE THEREOF IN DETECTION AND THERAPY
20190167721 ยท 2019-06-06
Inventors
- Daiming FAN (XI'AN, SHAANXI, CN)
- Yongzhan NIE (XI'AN, SHAANXI, CN)
- Kaichun WU (XI'AN, SHAANXI, CN)
- Yueqiong CAO (XI'AN, SHAANXI, CN)
- Jijun Yuan (Shanghai, CN)
- XUEJUN YU (SHANGHAI, CN)
Cpc classification
A61K39/4611
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
C07K2319/33
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
C07K14/70596
CHEMISTRY; METALLURGY
C07K14/70575
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
Abstract
The present invention provides a glycosylated CEA-specific single-chain antibody, and a chimeric antigen receptor (CAR) targeting a glycosylated CEA, which can be used in manufacture of an agent or a medicament for diagnosis or treatment of a tumor overexpressing glycosylated CEA.
Claims
1. A chimeric antigen receptor (CAR), wherein the CAR comprises: i) an antigen-binding domain targeting a glycosylated CEA; ii) a transmembrane domain, and iii) an intracellular signaling domain comprising a costimulatory domain, wherein the antigen-binding domain targeting the glycosylated CEA comprises a heavy chain variable region and a light chain variable region, characterized in that the heavy chain variable region and the light chain variable region are selected from any one of the following combinations: a. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 1, CDR-H2 set forth in SEQ ID NO: 2, or CDR-H3 set forth in SEQ ID NO: 3; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 4, CDR-L2 set forth in SEQ ID NO: 5, or CDR-L3 set forth in SEQ ID NO: 6; b. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO:7, CDR-H2 set forth in SEQ ID NO:8, or CDR-H3 set forth in SEQ ID NO:9; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 10, CDR-L2 set forth in SEQ ID NO: 11, or CDR-L3 set forth in SEQ ID NO: 12; c. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 13, CDR-H2 set forth in SEQ ID NO: 14, or CDR-H3 set forth in SEQ ID NO: 15; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 16, CDR-L2 set forth in SEQ ID NO: 17, or CDR-L3 set forth in SEQ ID NO: 18; d. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 19, CDR-H2 set forth in SEQ ID NO: 20, or CDR-H3 set forth in SEQ ID NO: 21; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 22, CDR-L2 set forth in SEQ ID NO: 23, or CDR-L3 set forth in SEQ ID NO: 24; or e. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 25, CDR-H2 set forth in SEQ ID NO: 26, or CDR-H3 set forth in SEQ ID NO: 27; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 28, CDR-L2 set forth in SEQ ID NO: 29, or CDR-L3 set forth in SEQ ID NO:30.
2. The chimeric antigen receptor according to claim 1, wherein the heavy chain variable region and the light chain variable region are selected from any one of the following combinations: a) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 31, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 32; b) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 33, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 34; c) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 35, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 36; d) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 37, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 38; or e) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 39, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO:40.
3. The chimeric antigen receptor according to claim 1, wherein the antigen-binding domain is a single-chain antibody that specifically recognizes a human glycosylated CEA, the amino acid sequence of the single-chain antibody is set forth in any one of SEQ ID NOs: 171-180.
4. The chimeric antigen receptor according to claim 1, further comprising a hinge region, wherein the transmembrane domain comprises CD8a and/or CD28, and the intracellular signaling domain comprises one or more of CD28, CD137, and CD3zeta.
5. A nucleic acid molecule encoding the chimeric antigen receptor according to claim 1.
6. A cell expressing the chimeric antigen receptor according to claim 1, wherein the cell is selected from the group consisting of a T cell, an NK cell and a B cell.
7. A single-chain antibody that specifically binds to a human glycosylated CEA, the single-chain antibody comprising a heavy chain variable region and a light chain variable region, characterized in that the heavy chain variable region and the light chain variable region are selected from any of the following combinations: a. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 1, CDR-H2 set forth in SEQ ID NO: 2, or CDR-H3 set forth in SEQ ID NO: 3; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 4, CDR-L2 set forth in SEQ ID NO: 5, or CDR-L3 set forth in SEQ ID NO: 6; b. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO:7, CDR-H2 set forth in SEQ ID NO:8, or CDR-H3 set forth in SEQ ID NO:9; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 10, CDR-L2 set forth in SEQ ID NO: 11, or CDR-L3 set forth in SEQ ID NO: 12; c. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 13, CDR-H2 set forth in SEQ ID NO: 14, or CDR-H3 set forth in SEQ ID NO: 15; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 16, CDR-L2 set forth in SEQ ID NO: 17, or CDR-L3 set forth in SEQ ID NO: 18; d. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 19, CDR-H2 set forth in SEQ ID NO: 20, or CDR-H3 set forth in SEQ ID NO: 21; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 22, CDR-L2 set forth in SEQ ID NO: 23, or CDR-L3 set forth in SEQ ID NO: 24; or e. the heavy chain variable region comprises one or more CDRs as described below: CDR-H1 set forth in SEQ ID NO: 25, CDR-H2 set forth in SEQ ID NO: 26, or CDR-H3 set forth in SEQ ID NO: 27; and the light chain variable region comprises one or more CDRs as described below: CDR-L1 set forth in SEQ ID NO: 28, CDR-L2 set forth in SEQ ID NO: 29, or CDR-L3 set forth in SEQ ID NO:30.
8. The single-chain antibody according to claim 7, wherein the heavy chain variable region and the light chain variable region are selected from any one of the following combinations: a) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 31, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 32; b) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 33, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 34; c) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 35, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 36; d) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 37, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 38; or e) the heavy chain variable region comprises a polypeptide fragment set forth in SEQ ID NO: 39, and the light chain variable region comprises a polypeptide fragment set forth in SEQ ID NO:40.
9. The single-chain antibody according to claim 7, wherein its amino acid sequence is set forth in any one of SEQ ID NOs: 171-180.
10. A method for treating a digestive tract tumor selected from the group consisting of gastric cancer, colorectal cancer, and esophageal cancer, comprising administering an effective amount of the chimeric antigen receptor according to claim 1 to a subject in need thereof.
11. A method for treating a digestive tract tumor selected from the group consisting of gastric cancer, colorectal cancer, and esophageal cancer, comprising administering an effective amount of the cell according to claim 6 to a subject in need thereof.
12. A method for treating a digestive tract tumor selected from the group consisting of gastric cancer, colorectal cancer, and esophageal cancer, comprising administering an effective amount of the single chain antibody according to claim 7 to a subject in need thereof.
13. The chimeric antigen receptor according to claim 4, wherein the hinge region is encoded by the sequence set forth in SEQ ID NO: 52 or SEQ ID NO: 53, the transmembrane region is encoded by the sequence set forth in SEQ ID NO:54 or SEQ ID NO: 55, the intracellular signaling domain is encoded by the sequence set forth in SEQ ID NO:56 or SEQ ID NO: 57 or SEQ ID NO: 58.
14. The chimeric antigen receptor according to claim 3, wherein the amino acid sequence of the single-chain antibody is set forth in SEQ ID NO: 173 or SEQ ID NO: 178.
15. The single-chain antibody according to claim 9, wherein its amino acid sequence is set forth in SEQ ID NO: 173 or SEQ ID NO: 178.
16. The cell according to claim 6, wherein said cell is a T cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
SPECIFIC MODELS FOR CARRYING OUT THE INVENTION
[0052] Firstly, certain terms are defined so that the invention can be more readily understood. All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs, unless otherwise indicated. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references cited herein are hereby incorporated by reference in their entirety herein. In case of conflict, the present specification (including definitions) shall prevail. In addition, the materials, methods, and examples are illustrative only and not limiting.
[0053] Single-Chain Antibody
[0054] As used herein, the single-chain antibody (single-chain Fv, scFv) is a recombinant protein formed by linking a heavy chain variable region (VH) and a light chain variable region (VL) of an immunoglobulin through a ligation peptide, which is the smallest antibody fragment with a complete antigen binding site. Human immunoglobulin (Ig) comprises five subtypes of IgA, IgD, IgM, IgE and IgG, of which IgG accounts for 75% of human immunoglobulin; IgG is a Y type antibody structure formed by two heavy chain IgH and two light chain IgL via interchain disulfide bonds; wherein IgH comprises a heavy chain variable region (VH) and a constant region (Constant Region); IgL comprises a light chain variable region (VL) and a constant region (Constant Region). The diversity of VH and VL is the basis for the binding of immunoglobulins to antigens. VH and VL are composed of a frame region (FR) and a complementary determining region (CDR), the CDR regions are highly variable and determine the specific binding of antigens and antibodies; wherein VH comprises three CDR regions, designated CDRH1, CDRH2, CDRH3; VL comprises three CDR regions, designated CDRL1, CDRL2, CDRL3.
[0055] The invention also comprises the variants, derivatives and analogs of the single-chain antibodies. As used in the text, the terms variant, derivative and analog refer to a polypeptide that substantially retains the same biological function or activity of the single-chain antibody of the invention. The polypeptide variant, derivative or analog of the invention can be (i) a polypeptide in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by genetic codes, or (ii) a polypeptide in which one or more amino acid residues have substituent groups, or (iii) a polypeptide which is formed by fusing an additional amino acid sequence into the polypeptide sequence (such as a leader sequence or a secretory sequence or a sequence or polypeptide sequence used to purify the polypeptide, or a fusion polypeptide). These variants, derivatives and analogs are within the purview of those skilled in the art in accordance with the definitions herein.
[0056] A single-chain antibody of the invention refers to a polypeptide that specifically binds to a glycosylated CEA. The term also comprises variant forms having a polypeptide sequence capable of specifically binding a glycosylated CEA. These variants comprises (but are not limited to): deletion, insertion and/or substitution of several (usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, further more preferably 1-8 or 1-5) amino acids, and addition or deletion of one or more (usually within 20, preferably within 10, more preferably 5 or less) amino acids at C-terminal and/or N-terminal. For example, in the art, the substitution with an amino acid of close or similar property usually does not change the function of protein. As another example, the addition or deletion of one or more amino acids at the C-terminal and/or N-terminal generally does not change the function of protein as well.
[0057] The invention also provides analogs of the single-chain antibody. The difference between these analogs and the natural single-chain antibody may be a difference in amino acid sequence, a difference in modification form which does not affect the sequence, or a combination thereof. These polypeptides comprises natural or induced genetic variants. Induced variants can be obtained by a variety of techniques, such as random mutagenesis by irradiation or exposure to a mutagen, or site-directed mutagenesis or other known techniques of molecular biology. The analogs also comprise analogs having residues other than the native L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., -, -amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.
[0058] Furthermore, other amino acid sequences which do not substantially affect the activity, expression amount and stability of the single-chain antibody of the present invention may be added to the amino terminus or the carboxy terminus of the single-chain antibody. Preferably, these added amino acid sequences facilitate expression (e.g., signal peptides), facilitate purification (e.g., 6 His sequences), or other sequences that promote the activity, expression, or stability of the single-chain antibody.
[0059] The present invention also comprises DNA molecules encoding the single-chain antibodies of the present invention or variants, derivatives thereof. The DNA molecules can be all artificially synthesized or obtained by PCR amplification.
[0060] In order to further increase the expression level of the host cell, the coding sequence of the single-chain antibody of the present invention can be engineered, for example, using a host cell-preferred codon to eliminate sequences which are not conducive to gene transcription and translation.
[0061] Expression of Single-Chain Antibody
[0062] After obtaining the DNA sequence encoding the novel single-chain antibody of the present invention or a variant or derivative thereof, it is cloned into a suitable expression vector and transferred into a suitable host cell. Finally, the transformed host cell is cultured, and the novel single-chain antibody of the present invention is obtained by isolation and purification.
[0063] The term vector as used herein comprises plasmids, cosmids, expression vectors, cloning vectors, viral vectors, and the like.
[0064] In the present invention, various vectors known in the art can be used. For example, a commercially available vector is selected, and then a nucleotide sequence encoding a novel single-chain antibody of the present invention is operably linked to an expression regulatory sequence to form an expression vector.
[0065] In the present invention, the term host cell comprises prokaryotic cells and eukaryotic cells. Examples of commonly used prokaryotic host cells include Escherichia coli, Bacillus subtilis and the like. Host cells for expressing single-chain antibodies include Escherichia coli, yeast cells, insect cells, COS cells, CHO cells, and the like. Preferably, the host cell is a prokaryotic cell, more preferably an E. coli cell.
[0066] After obtaining the transformed host cell, the cell can be cultured under conditions suitable for expression of the single-chain antibody of the present invention to express a single-chain antibody; and then the expressed single-chain antibody can be isolated.
[0067] Linker Peptide
[0068] As used herein, the term linker peptide (linker) refers to a short peptide between a heavy chain variable region of antibody (or a variant thereof) and a light chain variable region of antibody (or a variant thereof), which acts as a linker and allows the heavy and light chain variable regions to fold freely, leaving the antigen binding site in an appropriate configuration without causing a change in molecular dynamics. In general, the linker peptide does not affect or not significantly affect the formation of correct folding and spatial conformation of the amino acid sequences of the heavy chain variable region (VH) and the light chain variable region (VL); alternatively, the linker peptide constitutes a flexible connection between the heavy chain variable region (VH) and the light chain variable region (VL), which facilitates their normal folding. The length of the linker peptide is not particularly limited as long as it allows the heavy and light chain variable regions to be freely folded, and the antigen binding site to be in an appropriate configuration without causing a change in molecular dynamics. For example, the length of the linker peptide can also be 4-30 aa. Preferably, the sequence of the linker peptide of the present invention is set forth in SEQ ID NO: 1.
[0069] Chimeric Antigen Receptor (CAR)
[0070] The single-chain antibody of the present invention can be used for detection and treatment of a tumor such as gastric cancer, colorectal cancer, and esophageal cancer. The single-chain antibody of the present invention can be specifically expressed on the surface of T cells to construct a chimeric antigen receptor T cell against glycosylated CEA, and specifically kill glycosylated CEA expression-positive cells and tissues. For each of the single-chain antibodies of the present invention, CAR-Ts of three structures are constructed separately and the functional differences of the three structures under each antibody are compared, and a suitable CAR-T structure is adopted for an appropriate target cell. The CAR-Ts of three structures separately are:
[0071] scFv-CD8-CD137-CD3zeta,
[0072] scFv-CD28-CD28-CD137-CD3zeta,
[0073] scFv-CD28-CD28-CD3zeta.
[0074] In the chimeric antigen receptor structure of the invention:
[0075] The hinge region can be an extracellular region selected from the group consisting of CD8a, CD28, human IgG1 Fc, human IgG4 Fc, DAP10 and the like.
[0076] The transmembrane regions can be an transmembrane region selected from the group consisting of CD8a, CD28, DAP10 and the like.
[0077] The costimulatory domain can be an intracellular region selected from the group consisting of CD28, CD134 (OX40), CD137 (4-1BB), ICOS, DAP10 and the like.
[0078] The essential signal domain can be selected from: CD3zeta.
EXAMPLES
[0079] The invention is further described below in conjunction with the specific examples and the accompanying drawings, which are not intended to limit the invention. The experimental methods in the following examples which conditions are not specifically described are performed according to the conventional conditions such as those described by J. Sambrook et al., Molecular Cloning Experiment Guide, Science Press, 2002, or according to the manufacturer's recommended conditions. Percentages and parts are by weight unless otherwise stated.
Example 1: Construction of Single-Chain Antibody
[0080]
TABLE-US-00001 TABLE 1 Single-chain antibody Seq ID VH Seq ID VL Seq ID FM2.sub.(VH.sub.
[0081] Expression Method of Single-Chain Antibody
[0082] Each of the synthesized nucleotide sequences FM2, 3, 4, 5, and 6 was added with 8His (CACCATCACCATCACCATCACCAT) at 3-terminal, the amplified fragment was added with sfiI and NotI restriction sites at both ends thereof, and then inserted into a pCANTABSE vector (GE HealthCare). The constructed pCANTABSE (GE) vector was transformed into E. coli-HB2151 strain and induced by IPTG to express overnight. The cells were resuspended in PBS buffer, sonicated on ice for 10 min. After centrifugation, the supernatant was purified by His Trap Column (GE), washed with PBS buffer containing 20 mM imidazole for 5-10 column volumes, and then eluted with PBS containing 500 mM imidazole; the subsequent imidazole was desalted with Desalting G25 column (GE) to obtain a single-chain antibody dissolved in PBS.
Example 2: Construction of CAR Recombinant Lentiviral Vector
[0083] The virus constructed in the present invention is shown in Table 2:
TABLE-US-00002 TABLE 2 Virus Number Name Structure Seq ID 1 FM2.sub.(VH.sub.
[0084] 1. Construction of Lentiviral Plasmid Vector
[0085] 1) Whole Gene Synthesis of Gene Sequences
[0086] To construct the lentivirus of Table 2, the essential gene sequences were subjected to whole gene synthesis according to the structure shown in Table 2.
[0087] 2) Amplification of Nucleic Acid Fragments
[0088] The synthesized gene products numbered as SEQ ID NO. 69-78, 89-98, 109-118 were amplified with the upstream primers (SEQ ID NO. 159-168) and the downstream primer (SEQ ID NO. 169). The PCR amplification conditions were: pre-denaturation: 95 C. for 5 minutes; denaturation: 95 C. for 30 seconds; annealing: 55 C. for 30 seconds; extension 72 C. for 1 minute, 35 cycles; final extension: 72 C. for 10 minutes.
[0089] The synthesized gene products numbered as SEQ ID NO. 79-88, 99-108, 119-128 were amplified with the upstream primers (SEQ ID NO. 159-168) and the downstream primer (SEQ ID NO. 170). The PCR amplification conditions were the same as above.
[0090] 3) Construction of Viral Plasmid Vector
[0091] a) The amplified fragments of SEQ ID NO. 79-88, 99-108, 119-128 were subjected to restriction endonuclease digestion. The restriction enzymes used were BamHI and EcoRI, and the digestion system was as follows: 0.5 l of BamHI, 0.5 l of EcoRI, 2 l of Buffer, 2 l of BSA, 2 g of amplified fragment, supplemented with sterile water to 20 l. After being incubated for 2 hours at 37 C., the enzyme digestion system was subjected to DNA cleaning and recovery. The recovery method was as follows: after adding 80 l of Buffer PCR-A to the digestion system, the mixture was transferred to a preparation tube, and the preparation tube was placed in a 2 ml centrifuge tube, centrifuged at 12,000g for 1 min, and the filtrate was discarded. The preparation tube was placed back in a 2 ml centrifuge tube, added with 700 l of Buffer W2, centrifuged at 12,000g for 1 min, and the filtrate was discarded. The preparation tube was placed in a clean 1.5 ml centrifuge tube, and 25-30 l of Eluent or deionized water was added to the membrane center of the preparation tube, stood for 1 min at room temperature. The DNA was eluted by centrifugation at 12,000g for 1 min.
[0092] The amplified fragments of SEQ ID NO. 69-78, 89-98, 109-118 were subjected to restriction endonuclease digestion. The restriction endonuclease used was BamHI. The digestion system was as follows: 0.5 l of BamHI, 0.5 l of EcoRI, 2 l of Buffer, 2 l of BSA, 2 g of amplified fragment, supplemented with sterile water to 20 l. After being incubated for 2 hours at 37 C., the enzyme digestion system was subjected to DNA cleaning and recovery. The recycling method was the same as above.
[0093] b) The vector fragments were subjected to restriction endonuclease digestion, and the enzyme digestion system and method were the same as shown above. After the digestion, the system was subjected to DNA agarose gel electrophoresis, and the vector fragments (about 8 Kb) were recovered by gel. The recovery system was as follows: the DNA fragment of interest was separated from other DNA bands by agarose electrophoresis, and then the agarose gel block containing the DNA to be recovered was cut by a clean scalpel and placed in a pre-numbered 1.5 ml EP tube. The agarose gel block should be cut as thin as possible, and the time of ultraviolet light irradiation should be as short as possible. 500 l of the gel solution was added to each tube, and was incubated with a warm bath at 65 C. for 5 to 10 minutes, during which time the mixture was inverted every 2 minutes to completely melt the gel. The dissolved gel was taken out of the water bath and allowed to stand at room temperature for 2 min until it was cooled to room temperature. A UNIQ-10 recovery column was added with 500 l of an equilibration solution, centrifuged at 12,000 rpm for 1 min, and the collection solution was discarded, set aside. The liquid was transferred to a UNIQ-10 column and stood for 1 minute at room temperature, centrifuged at 8,000 rpm for 1 minute. The UNIQ-10 column was got down and the waste liquid in the collection tube was discarded (if the target strip was very light, the liquid in the collection tube can pass the UNIQ-10 column again), the UNIQ-10 column was placed in the same collection tube, added with 700 l of Wash buffer, centrifuged at 10,000 rpm for 30 seconds, and repeated once. The UNIQ-10 column was got down, the waste liquid in the collection tube was discarded, the UNIQ-10 column was placed in the same collection tube, and centrifuged at 12,000 rpm for 2 min. The UNIQ-10 column was placed in a new 1.5 ml EP tube, the lid of the UNIQ-10 column was opened, and placed in an oven at 65 C. for 10 min to allow the ethanol to evaporate sufficiently. 40 l of Elution Buffer was added to the column membrane center (note: the tip should be replaced to avoid contamination), the lid of the UNIQ-10 column was closed, and placed in an oven at 65 C. for 2 minutes. The DNA of interest was recovered by centrifugation at 12,000 rpm for 1 minute.
[0094] The EGFP expression vector was subjected to restriction endonuclease digestion, the restriction enzyme used was BamHI, and the enzyme digestion system and the gel recovery method were the same as described above.
[0095] c) Ligation of Plasmid Vector and Fragment of Interest
[0096] The digestion products of SEQ ID NO. 79-88, 99-108, 119-128 were ligated to the EGFP expression-free vector (CV185, Genechem); and the amplified digestion products of SEQ ID NO. 69-78, 89-98, 109-118 were ligated to the EGFP expression vector (CV178, Genechem).
[0097] The ligation system was as follows: 25 ng of insertion fragment, 100 ng of vector fragment, 2 l of T4 ligase buffer, 1 l of T4 ligase, supplemented with sterile water to 20 l, and ligated at 22 C. for 1 hour.
[0098] 2. Lentiviral Packaging
[0099] The third generation of lentiviral packaging system was used: Transfer plasmid: CV178 or CV185 (Genechem), Envelop plasmid: H1 (Genechem), Packaging plasmid: H2 (Genechem) (Zufferey et al., J Virol 72 (12): 9873-80, 1998).
[0100] HEK-293T cells were supplied according to the 24 h passage period, and the medium was exchanged before transfection. Each plate of cells was replaced with 5 ml of DMEM medium containing 2% FBS using an electric pipette. HBW, H1 (12 m/plate, the plate referred to a 10 cm cell culture dish, similarly hereinafter), recombinant H2 (10 g/plate), Vector (24 g/plate), CaCl.sub.2 (50 l/plate) were added in sequence, and finally oscillated on a vortex oscillator with an addition of 2HBS (500 l/disc) dropwise, and the transfection system was 1 ml/plate. Among them, the Vector was the vector constructed in the Step 1. The transfection system was carefully pipetted, 1000 l of the mixture was taken and added dropwise to 293T cells after mixing, and the operation was kept stable and the transfection system was evenly distributed on the 10 cm plate. The plate was kept level and the liquid in the plate was shaken ten times in each of the front, rear, left and right directions, and the mixing process should be sufficient, but no liquid could be spilled or flowed to the outside of the plate, and then placed in a 37 C., 5% CO.sub.2 incubator. Eight hours after transfection, the supernatant was discarded and the DMEM medium was replaced with an electric pipette. Between 28 and 30 hours after the end of transfection, the supernatant was collected for the first time, and 10 ml of DMEM medium was added for supplement. Between 48 to 50 hours after the end of transfection, the supernatant was collected for the second time. After ultracentrifugation, it was resuspended in 100 l of DMEM for later use.
Example 3: Infection of T Lymphocytes with Recombinant Lentivirus
[0101] Infection experiments were performed according to conventional methods known to those skilled in the art. The infection steps were briefly described as follows:
[0102] 1. Peripheral blood mononuclear lymphocytes (PBMC) were obtained, and >110.sup.7 cells were obtained by the blood apheresis system.
[0103] 2. Experimental anti-human CD3/CD28 antibody treatment of cell culture dishes. Anti-human CD3 antibody (OKT3 clone, MACS) and anti-human CD28 antibody (15E8 clone, MACS) were diluted with PBS to a final concentration of 1 g/ml, and the diluted antibody mixtures were added to a cell culture dish to spread the culture in the dish. After incubation for 2 hours at room temperature, the dish was washed once with PBS, set aside.
[0104] 3. Activation of T Lymphocytes
[0105] The isolated PBMCs were resuspended in T lymphocyte culture medium (TexMACS medium+10% FBS+30 IU/recombinant human IL-2) to a final concentration of 1*10.sup.6 cells/ml, placed and cultured in the dish treated in the Step 2. The culture condition was 37 C.+5% CO.sub.2 and the culture time was 24 hours.
[0106] 4. Infection of the Activated T Lymphocytes
[0107] 1) Preparation of Infection Reagents
[0108] A certain amount of T cell culture medium was taken, added with synperonic F108 to reach a final concentration of 1 mg/ml, mixed well, and heated to 37 C. in a water bath, set aside.
[0109] 2) Treatment of Culture Plate
[0110] 1 mg/ml CD3 and 0.5 mg/ml CD28 antibodies were taken and diluted at a 1:1000 volume ratio to an appropriate amount of PBS buffer, and retronectin reagent (takara, Cat. No. T100A) was taken and diluted to the PBS buffer at a volume ratio of 1:40. After well mixing, the buffer was spread evenly to cell dishes and incubated for 2 hours at room temperature. After 2 hours, the dishes were washed with PBS and set aside.
[0111] 3) Infection of T Lymphocytes with Lentivirus and Maintaining T Lymphocytes
[0112] The infection reagents prepared in 1) was used to dilute the activated T lymphocytes, lentivirus was added according to MOI=3, and mixed. The mixture was spread evenly in the dish as treated in 2).
[0113] The cell density was monitored after infection to maintain the cells at 1*10.sup.6 cells/ml; typically, after 14 days, the cells were amplified for 30-100 folds.
Example 4: Detection of Glycosylated CEA Expression in Cancer Cell Lines of Digestive Tract Source
[0114] Flow cytometry was used to detect the expression level of glycosylated CEA in various target cells. The specific detection method was as follows:
[0115] 1. 6*10.sup.5 cells/group as shown in Table 3, were taken, centrifuged at 200 g for 5 minutes, and the supernatant was discarded;
[0116] 2. After being resuspended in 200 l PBS, the resuspended cells were divided into two groups, one of which was added with 1 g of the single-chain antibody against glycosylated CEA of the present invention, and incubated at 4 C. for 2 hours;
[0117] 3. 1 ml of PBS was added to each group, mixed and centrifuged at 200 g for 5 min, the supernatant was discarded; After the cells were resuspended with 100 l of PBS, 5 l of goat anti-mouse IgG1 FITC-labeled secondary antibody was added to the cell suspension, and incubated at 4 C. for 1 hour;
[0118] 4. The cells were washed three times with PBS, measured and analyzed with flow cytometry.
[0119] The results are shown in Table 3. The expression of glycosylated CEA antigen was not detected in SW620, while the glycosylated CEA expression in different degrees was detected in KATO3, CRYPT as well as SW620-CEA and LOVO cell lines overexpressing CEA.
[0120] Construction method of SW620-CEA cell line: SW620 cells were maintained and cultured in 1640 medium which was added with 10% FBS; CEA gene (CEACAMS, NM-004363) in full length was obtained by whole gene synthesis; after being cloned into GV348 vector (Genechem), the gene with two helper plasmids transfected 293T cells by calcium phosphate and were packaged to form lentiviruses. SW620 cells were inoculated to a 24-well plate, 10.sup.5/well, and cultured overnight; the SW620 was infected with CEA-expressing lentivirus according to MOI=3, and puromycin was added to reach a final concentration of 1 g/ml 24 hours after infection; the cells were screened by puromycin to obtain monoclone. The CEA expression was detected by FACS. The results are shown in
TABLE-US-00003 TABLE 3 Name of cell Source Property SW620 ATCC CCL-227 Not expressing CEA SW620-CEA Constructed and preserved in the Expressing CEA inventors' laboratory LOVO ATCC CCL-229 Expressing CEA KATO3 ATCC HTB103 Expressing glycosylated CEA antigen CRYPT Fan Daiming Laboratory, Fourth Expressing glycosylated Military Medical University CEA antigen
Example 4a: Detection of CEA Expression in Tumor Samples Using FM4 Single-Chain Antibody and CEA Antibody
[0121] The patient's gastric cancer tumor tissue samples were embedded in liquid paraffin and frozen, the sections were fixed on glass slides; after dewaxing with xylene, antigen recovery was performed using citric acid buffer; the repaired samples were blocked with 5% FBS in PBS buffer for half an hour, 2 g/ml of the FM4 single-chain antibody of the present invention or CEA antibody (clone CB30) (ebioscience, Cat. No. 14-0669-82) was added to the refrigerator at 4 C. overnight; the tissue slides were washed 3 times with PBS, added with second antibody and subjected to color development.
[0122] The FM4 single-chain antibody showed higher sensitivity and tissue specificity (as shown in Table 4).
TABLE-US-00004 TABLE 4 Antibody Gastric cancer Para-carcinoma FM4 73% 24% CEA antibody 51% 20%
Example 5: Study on Specificity of CAR-T on Glycosylated CEA Positive Cells
[0123] In order to investigate whether CAR-T specifically recognizes and produces specific functions in glycosylated CEA-positive cells (LoVo, KATO3, CRYPT, and SW620-CEA with low-level expression of antigen), the present laboratory detected the specific cytokine release and target cell-specific killing of the four constructed CAR-Ts, i.e., FM2.sub.(VL.sub.
[0124] 1. Flow Detection of CAR-T Infection Efficiency
[0125] Since EGFP protein and CAR protein were co-expressed in CAR-T cells, the percentage of EGFP-positive cells detected by flow cytometry could represent CAR-positive cells. The T cells not infected with CAR virus were used as control, and the test results were shown in the following table (Table 5):
TABLE-US-00005 TABLE 5 CD3 + T lymphocyte Name EGFP positive rate Mock T cell 0% FM2.sub.(VL.sub.
[0126] 2. Cytokine Secretion Levels after Interaction of CAR-T with Target Cells
[0127] The target cells were SW620, SW620-CEA, LoVo, and KATO3 cells. The effector cells were the five cells mentioned in Table 5, and the cytokine secretion was detected 10 days after the CAR virus infection.
[0128] The method was as follows: 1*10.sup.5 target cells were separately mixed with effector cells at a ratio of 1:1 in 100 l of RPMI 1640+2% FBS medium, and incubated for about 16 hours in a 37 C. 5% CO.sub.2 incubator. After 16 hours, centrifugation was carried out for 5 minutes at 200 g, and the supernatant was taken to measure the level of cytokine secretion in the supernatant. The cytokine content was measured by HU TH1-TH2 CBA KIT produced by BD Company. The mechanism of the measurement was that the cytokines in the reaction solution could bind to the antibodies on the corresponding beads, and the beads corresponding to each cytokine had APC fluorescence labels with different intensity; after the cytokines bound to the beads, the cytokines bound to the beads were further labeled with another PE fluorescence labeled antibody, and the content of cytokines was determined by measuring the fluorescence intensity of PE, and different cytokine species were distinguished by the differences in APC fluorescence intensities. In this study, the secretion levels of three cytokines, i.e., IL-2, IFN- and TNF-, were detected. The specific test methods referred to the kit instructions. The test results were analyzed by FCAP Array v3 software, and the results are shown in
[0129] The results showed that IL-2, TNF-, IFN- and other cytokines increased significantly after FM2.sub.(VL.sub.
[0130] 3. In Vitro Killing Toxicity to Target Cells after Interaction of CAR-T with Target Cells
[0131] In order to verify the killing effect of CAR-T on glycosylated CEA-positive target cells, the antigen expression-positive cells LoVo, KATO3 and CRYPT, as well as SW620-CEA with low level of antigen expression were used in this study. The used kits were Cytotox96 non-radioactive cytotoxicity assay kit (Promega). The mechanism of this method was that the traditional radioactive elements were replaced with lactate dehydrogenase (LDH) which was stably expressed in the cells and was not secreted; when apoptosis of the cells occurred, LDH was released extracellularly, the content of formazan oxidized by LDH was detected to determine the level of enzyme in the supernatant, thereby determining the level of apoptosis. The effector cells were FM4.sub.(VL.sub.
[0132] Among them, each of the experimental groups and the control groups were set as follows: Experimental groups: CAR-T cells with different ratios of effector cells to target cells and different target cells;
[0133] Control group 1: group with maximum release of LDH in those of target cells;
[0134] Control group 2: group with spontaneous release of LDH in those of target cells;
[0135] Control group 3: group with spontaneous release in those of effector cells;
[0136] The specific experimental methods referred to the kit instructions. The cytotoxicity was calculated by the formula of:
Specific lysis=(experimental groupcontrol group 2control group 3)/(control group 1control group 2).
[0137] The results showed that FM4.sub.(VL.sub.
[0138] This study demonstrates that FM4.sub.(VL.sub.
Example 6: Effect of CAR-T on Glycosylated CEA-Positive PDX Tumor Model
[0139] NCG mice (purchased from the Institute of Model Biology of Nanjing University) were subcutaneously injected with glycosylated CEA antigen-positive patient-derived tumor cells. After the patient's tumor tissue was removed, the connective tissue and blood vessels on the surface were removed; the tumor mass was cut along the midline, and the necrotic tissues, the large calcification points and the secretions were removed, and after careful cleaning, tumor tissues with good quality and toughness were transferred to fresh, ice-cold RPMI-1640 medium. The tumor tissues were cut into small tumor masses of about 33 mm.sup.2 and transplanted unilaterally into the NSG mice. When the average tumor volume reached 160-180 mm.sup.3, the model animals were intratumorally injected with effector cells.
[0140] The effector cells used in this study were FM4.sub.(VL.sub.
[0141] The research contents of this study included:
[0142] Mouse body weight and tumor volume/3 days/time;
[0143] Mouse peripheral blood cytokine detection/7 days/time;
[0144] Mouse peripheral blood CAR copy number/7 days/time.
[0145] The tumor volume results are shown in
[0146] The cytokine secretion trend in peripheral blood is shown in
Example 6a: Mouse Tumor Model
[0147] NSG mice (NOD scid IL2Rnull) were inoculated subcutaneously with 1E7/mouse of Lovo cells (CCL229, ATCC) to form tumors with volume of 200 mm.sup.3-300 mm.sup.3. The tumors were injected with PBMC as control and FM4.sub.(VL.sub.
TABLE-US-00006 Group (5NSG/groups) Treatment PBMC 3E6 PBMC/100 l PBS, intratumoral injection FM4BBz high-dose 3E6 FM4BBz/100 l PBS, intratumoral injection FM4BBz low-dose 1E6 FM4BBz/100 l PBS, intratumoral injection
[0148] NSG mice that were transfused with PBMC or FM4BBz T cells were bled 40 l (day 3 and day 7) through tail vein, the samples were resuspended in equal volume of PBS and centrifuged, the supernatant was used for cytokine release assay (BD Cytometric Bead Array). The results are shown in
[0149] As shown in
[0150] As shown in
Example 7: Infection of NK92 Cells with FM4.SUB.(VL..SUB.
[0151] NK92 cells were cultured in 1640 medium containing 20% FBS, 150 IU/ml hIL-2. According to the method of Example 3, the NK92 cell line was infected with FM4.sub.(VL.sub.
Example 8: Antibody-Cell Binding Assay
[0152] The antibodies FM2, FM4, FM5, and FM6 were diluted with PBS buffer containing 1% BSA, and incubated with SW620-CEA or CRYPT cells (final concentrations: 50 g/ml, 5 g/ml, 0.5 g/ml, 0.05 g/ml, 0.005 g/ml, 0.0005 g/ml) for 1 hour at room temperature; the cells were washed twice with PBS buffer containing 1% BSA, and then incubated with Goat Anti Mouse IgG-APC for 1 hour; the cells were washed twice with PBS buffer containing 1% BSA and resuspended in PBS buffer; the APC fluorescence values of the cells were read using BD Accuri C6 FACS.
[0153] Using the median fluorescence value (MFI) as the ordinate and the antibody concentration (g/ml) as the abscissa, the S-curve was fitted using a logistic equation to calculate the antibody binding EC50, the results are shown in the following table:
TABLE-US-00007 TABLE 6 EC50-SW620-CEA EC50-CRYPT Antibody g/ml g/ml FM2 0.8 0.02 FM4 >50 0.51 FM5 0.2 0.04 FM6 0.3 0.02
CONCLUSIONS
[0154] SW620-CEA is CEA overexpressed in the SW620 cell line (CEACAMS), and its surface CEA is in a non-glycosylated state; CRYPT is a tumor cell line expressing glycosylated CEA.
[0155] It can be concluded from the EC50 values of antibody calculated according to the antibody-cell binding assay that the antibody FM4 specifically binds to the glycosylated CEA and has high specificity (selective >100-fold).