Method of Producing Lipid
20190169659 ยท 2019-06-06
Assignee
Inventors
Cpc classification
C12P7/6463
CHEMISTRY; METALLURGY
C12N9/0071
CHEMISTRY; METALLURGY
C12P7/64
CHEMISTRY; METALLURGY
C12Y114/19006
CHEMISTRY; METALLURGY
International classification
Abstract
A method of producing lipids, containing the steps of: culturing an alga belonging to the genus Nannochloropsis; and producing fatty acids or lipids containing the same as components;
wherein expressions of genes encoding a 12-desaturase and a 6-desaturase are enhanced in the alga; and a transformant of an alga belonging to the genus Nannochloropsis, wherein expressions of genes encoding a 12-desaturease and a 6-desaturease are enhanced.
Claims
1. A method of producing lipids, comprising the steps of: culturing an alga belonging to the genus Nannochloropsis; and producing fatty acids or lipids containing the same as components; wherein expression of genes encoding a 12-desaturase and a 6-desaturase are is enhanced in the alga.
2. A method of modifying the composition of fatty acids, comprising the steps of: enhancing expression of genes encoding a 12-desaturase and a 6-desaturase in an alga belonging to the genus Nannochloropsis, and increasing the proportion of long-chain polyunsaturated fatty acids in the total fatty acids to be produced in a cell of the alga.
3. The method according to claim 1, wherein the genes encoding the 12-desaturase and the 6-desaturase are introduced into the alga, to enhance the expression of the introduced genes encoding the 12-desaturase and the 6-desaturase.
4. The method according to claim 1, wherein the 12-desaturase is the following protein (A) or (B): (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and (B) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and having 12-desaturase activity.
5. The method according to claim 1, wherein the 6-desaturase is the following protein (E) or (F): (E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3; and (F) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (E), and having 6-desaturase activity.
6. The method according to claim 1, wherein, in the alga, expression of at least any enzyme selected from the group consisting of an 3-desaturase, a 5-desaturase, a 9-desaturase and a 6-elongase, or gene encoding the same is enhanced.
7. The method according to claim 6, wherein the gene is introduced into the alga, to enhance the expression of the gene introduced.
8. The method according to claim 6, wherein the 3-desaturase is the following protein (I) or (J): (I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5; and (J) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (I), and having 3-desaturase activity.
9. The method according to claim 6, wherein the 5-desaturase is the following protein (M) or (N): (M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7; and (N) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (M), and having 5-desaturase activity.
10. The method according to claim 6, wherein the 9-desaturase is the following protein (Q) or (R): (Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9; and (R) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (Q), and having 9-desaturase activity.
11. The method according to claim 6, wherein the 6-elongase is the following protein (U) or (V): (U) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 74; and (V) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (U), and having 6-elongase activity.
12. The method according to claim 1, wherein the fatty acids or lipids contain a dihomo--linolenic acid, arachidonic acid or eicosapentaenoic acid, or an ester thereof.
13. A transformant of an alga belonging to the genus Nannochloropsis, wherein expression of genes encoding a 12-desaturease and a 6-desaturease are is enhanced.
14. The transformant according to claim 13, wherein the 12-desaturase is the following protein (A) or (B): (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and (B) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and having 12-desaturase activity.
15. The transformant according to claim 13, wherein the 6-desaturase is the following protein (E) or (F): (E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3; and (F) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (E), and having 6-desaturase activity.
16. The transformant according to claim 13, wherein, in the alga, expression of at least any enzyme selected from the group consisting of an 3-desaturase, a 5-desaturase, a 9-desaturase and a 6-elongase, or gene encoding the same is enhanced.
17. The transformant according to claim 16, wherein the 3-desaturase is the following protein (I) or (J): (I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5; and (J) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (I), and having 3-desaturase activity.
18. The transformant according to claim 16, wherein the 5-desaturase is the following protein (M) or (N): (M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7; and (N) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (M), and having 5-desaturase activity.
19. The transformant according to claim 16, wherein the 9-desaturase is the following protein (Q) or (R): (Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9; and (R) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (Q), and having 9-desaturase activity.
20. The method according to claim 16, wherein the 6-elongase is the following protein (U) or (V): (U) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 74; and (V) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (U), and having 6-elongase activity.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
MODE FOR CARRYING OUT THE INVENTION
[0024] The present invention provides a method of producing lipids, which improves productivity of PUFA or lipids containing the same as components.
[0025] Further, the present invention provides a transformant in which the productivity of PUFA or lipids containing the same as components is improved.
[0026] The present inventor diligently conducted study on the aforesaid points.
[0027] Algae belonging to the genus Nannochloropsis are excellent in productivity of PUFA such as EPA. Moreover, production amount of total fatty acids is significantly increased in late culture phase of the algae (specifically, conditions in which a nutrient source such as nitrogen is exhausted). However, the present inventor conducted a detailed study on the PUFA productivity of algae belonging to the genus Nannochloropsis, and as a result, found that as culture period becomes longer and production amount of total fatty acids increases, ratio of production amount of PUFA to production amount of total fatty acids significantly decreases.
[0028] So the present inventor first conducted a study on a pathway of PUFA synthesis in the algae belonging to the genus Nannochloropsis in various ways, and tried to identify the synthesis pathway. The present inventor continued to conduct further studies on a rate-limiting reaction in synthesis of PUFA, and as a result, found that a series of steps in which linoleic acid (hereinafter, also denoted as C18:29,12) is formed from oleic acid (hereinafter, also denoted as C18:19) by action of 12-desaturase being one kind of desaturases, and -linolenic acid (hereinafter, also denoted as C18:36,9,12) is formed from C18:29,12 formed by action of 6-desaturase also being one kind of desaturase are rate-limiting steps in PUFA synthesis. Then, the present inventor found that the production amount of PUFA is significantly increased by enhancing expression of an enzyme that catalyzes a reaction in the rate-limiting step.
[0029] The present invention was completed based on these findings.
[0030] According to the present invention, the expression of the enzyme that catalyzes the reaction in the rate-limiting step of a PUFA synthetic pathway is enhanced, and the production amount of PUFA can be increased.
[0031] According to the method of producing the lipids of the present invention, the productivity of PUFA or lipids containing the same as components can be improved.
[0032] Moreover, a transformant of the present invention is enhanced in the expression of the enzyme that catalyzes the reaction in the rate-limiting step of the PUFA synthetic pathway, and is excellent in productivity of PUFA or lipids containing the same as components.
[0033] The term lipid(s) in the present specification, covers a simple lipid such as a neutral lipid (monoacylglycerol (MAG), diacylglycerol (DAG), triacylglycerol, or the like), wax, and a ceramide; a complex lipid such as a phospholipid, a glycolipid, and a sulfolipid; and a derived lipid obtained from the lipid such as a fatty acid (free fatty acid), alcohols, and hydrocarbons.
[0034] The fatty acids categorized into the derived lipid generally refer to the fatty acids per se and mean free fatty acids. In the present invention, a part of the fatty acids or a part of the acyl group in molecules of a simple lipid and a complex lipid is expressed as fatty acid residue. Then, unless otherwise specified, a term fatty acid is used as a generic term for free fatty acid and fatty acid residue.
[0035] Moreover, a term fatty acids or lipids containing the same as components in the present specification is generically used including free fatty acids and lipids having the fatty acid residues. Further, a term fatty acid composition in the present specification means a weight proportion of each fatty acid relative to the weight of whole fatty acids (total fatty acids) obtained by totaling the free fatty acids and the fatty acid residues described above regarding as fatty acids. The weight (production amount) of the fatty acids or the fatty acid composition can be measured according to the method used in Examples.
[0036] In the present specification, the description of Cx:y for the fatty acid or the acyl group constituting the fatty acid means that the number of carbon atoms is x and the number of double bonds is y. The description of Cx means a fatty acid or an acyl group having x as the number of carbon atoms.
[0037] In the present specification, the identity of the nucleotide sequence and the amino acid sequence is calculated through the Lipman-Pearson method (Science, 1985, vol. 227, p. 1435-1441). Specifically, the identity can be determined through use of a homology analysis (search homology) program of genetic information processing software Genetyx-Win with Unit size to compare (ktup) being set to 2.
[0038] It should be note that, in this description, the stringent conditions includes, for example, the method described in Molecular CloningA LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W. Russell, Cold Spring Harbor Laboratory Press], and examples thereof include conditions where hybridization is performed by incubating a solution containing 6SSC (composition of 1SSC: 0.15 M sodium chloride, 0.015 M sodium citrate, pH7.0), 0.5% SDS, 5Denhardt and 100 mg/mL herring sperm DNA together with a probe at 65 C. for 8 to 16 hours.
[0039] Furthermore, in the present specification, the term upstream of a gene means a region subsequent to a 5 side of a targeted gene or region, and not a position from a translational initiation site. On the other hand, the term downstream of the gene means a region subsequent to a 3 side of the targeted gene or region.
[0040] As stated above, the present inventor identified the main pathway of PUFA synthesis in algae belonging to the genus Nannochloropsis. The principal pathway of PUFA synthesis identified in this study, and the rate-limiting step in the synthesis of PUFA, are shown in
[0041] As shown in Examples described later, in wild type algae belonging to the genus Nannochloropsis, C20:4 is detected, but stearidonic acid (hereinafter, also denoted as C18:46,9,12,15) is hardly detected. From these results, main pathway of EPA synthesis in the algae belonging to the genus Nannochloropsis was identified as pathway through arachidonic acid (hereinafter, also denoted as C20:45,8,11,14) as shown in
[0042] Moreover, the present inventor identified various desaturases derived from the algae belonging to the genus Nannochloropsis. In addition, the present inventor enhanced the expression of each of the desaturases and measured production amount of PUFA such as EPA. The result was that no significant change in amount of PUFA was observed even if expression of each desaturase was enhanced individually.
[0043] Accordingly, the present inventor conducted a further study on the pathway of PUFA synthesis in algae belonging to the genus Nannochloropsis. As a result, the present inventor found that the series of steps in which a reaction is catalyzed by 12-desaturase (hereinafter, also referred to as 12-DES) and 6-desaturase (hereinafter, also referred to as 6-DES) (the reactions in which linoleic acid is formed from oleic acid, and -linolenic acid is formed from the formed linoleic acid) are the rate-limiting step of the pathway of PUFA synthesis in algae belonging to the genus Nannochloropsis. So the PUFA productivity of algae belonging to the genus Nannochloropsis is improved by enhancing the expression of the enzyme that catalyzes the reaction in the rate-limiting step. Further, with elapse of algae culture time, ratio of amount of PUFA to amount of total fatty acids is significantly improved in comparison with that in a wild type strain.
[0044] The term rate-limiting step in the present specification means a step which, when a dynamic process such as a chemical reaction or a complicated metabolic pathway is formed of several steps, progresses more slowly than other steps among the steps so as to substantially dominate progress of the entire process.
[0045] In the present specification, the term 12-DES means a protein (enzyme) that catalyzes a reaction of introducing an unsaturated bond into a 012-position of 018:19 to produce C18:2,9,12 being -6 fatty acid. Then, in the present specification, the term 12-desaturase activity (hereinafter, also referred to as 12-DES activity) means activity for introducing the unsaturated bond into the 12-position of C18:19.
[0046] It can be confirmed that the protein has the 12-DES activity by a system using a 12-DES gene deletion strain, for example. Alternatively, it can also be confirmed by examining formation of linoleic acid by introducing the DNA of which a gene encoding the above-described protein was ligated downstream of a promoter functioning inside a host cell, into the 12-DES gene deletion strain. Alternatively, it can also be confirmed by measuring a decrease of oleic acid amount or an increase of linoleic acid amount according to an ordinary method by preparing the 12-DES or cell lysate containing the same to react the resultant material with the reaction solution containing oleic acid, oleoyl-CoA, or the like.
[0047] Preferred examples of the 12-DES in the present invention include the following proteins (A) to (D): [0048] (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; [0049] (B) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and having 12-desaturase activity; [0050] (C) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 45; and [0051] (D) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (C), and having 12-desaturase activity.
[0052] The protein consisting of the amino acid sequence set forth in SEQ ID NO: 1 is a 12-DES derived from Nannochloropsis oculata strain NIES-2145 being algae belonging to the genus Nannochloropsis (hereinafter, also referred to as No12-DES). Further, the protein consisting of the amino acid sequence set forth in SEQ ID NO: 45 is a 12-DES derived from Nannochloropsis gaditana B-31 strain being algae belonging to the genus Nannochloropsis (hereinafter, also referred to as Ng12-DES).
[0053] Note that, identity of the amino acid sequence of the protein (A) with the amino acid sequence of the protein (C) is 86%.
[0054] All of the proteins (A) to (D) have 12-DES activity.
[0055] In the protein (B), the identity with the amino acid sequence of the protein (A) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 12-DES activity. Further, specific examples of the protein (B) include a protein in which 1 or several (for example 1 or more and 176 or less, preferably 1 or more and 154 or less, more preferably 1 or more and 132 or less, further preferably 1 or more and 110 or less, furthermore preferably 1 or more and 88 or less, furthermore preferably 1 or more and 66 or less, furthermore preferably 1 or more and 44 or less, furthermore preferably 1 or more and 36 or less, furthermore preferably 1 or more and 22 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (A).
[0056] In the protein (D), the identity with the amino acid sequence of the protein (C) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 12-DES activity. Further, specific examples of the protein (D) include a protein in which 1 or several (for example 1 or more and 181 or less, preferably 1 or more and 159 or less, more preferably 1 or more and 136 or less, further preferably 1 or more and 113 or less, furthermore preferably 1 or more and 91 or less, furthermore preferably 1 or more and 68 or less, furthermore preferably 1 or more and 46 or less, furthermore preferably 1 or more and 37 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (C).
[0057] In general, it is known that an amino acid sequence encoding an enzyme protein does not necessarily exhibit enzyme activity unless the sequence in the whole region is conserved, and there exists a region in which the enzyme activity is not influenced even if the amino acid sequence is changed. In such a region which is not essential to the enzyme activity, even if the mutation of the amino acid, such as deletion, substitution, insertion and addition thereof is introduced thereinto, the activity inherent to the enzyme can be maintained. Also in the present invention, such a protein can be used in which the desired activity is kept and a part of the amino acid sequence is subjected to mutation.
[0058] A method of introducing the mutation into an amino acid sequence includes a method of, for example, introducing a mutation into a nucleotide sequence encoding the amino acid sequence. A method of introducing the mutation includes a method of introducing a site-specific mutation. Specific examples of the method of introducing the site-specific mutation include a method of utilizing the SOE-PCR reaction, the ODA method, and the Kunkel method. Further, commercially available kits such as Site-Directed Mutagenesis System Mutan-Super Express Km kit (Takara Bio), Transformer TM Site-Directed Mutagenesis kit (Clontech Laboratories), and KOD-Plus-Mutagenesis Kit (TOYOBO) can also be utilized. Furthermore, an objective gene can also be obtained by introducing a genetic mutation at random, and then performing an evaluation of the enzyme activities and a gene analysis thereof by an appropriate method.
[0059] The proteins (A) to (D) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata or Nannochloropsis gaditana. In addition, the proteins (A) to (D) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 1 or 45. Alternatively, as recombinant proteins, proteins (A) to (D) may also be prepared by gene recombination technologies. In the case of preparing a recombinant protein, a gene encoding the 12-DES described below can be used.
[0060] Note that the algae such as Nannochloropsis oculata can be obtained from culture collection such as private or public research institutes or the like. For example, Nannochloropsis oculata strain NIES-2145 can be obtained from National Institute for Environmental Studies (NIES).
[0061] An example of the gene encoding the 12-DES (preferably, any one of the proteins (A) to (D)) (hereinafter, also referred to as 12-DES gene) includes a gene consisting of any one of the following DNAs (a) to (d). [0062] (a) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2; [0063] (b) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (a), and encoding a protein having 12-DES activity; [0064] (c) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 46; and [0065] (d) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (c), and encoding a protein having 12-DES activity.
[0066] The nucleotide sequence set forth in SEQ ID NO: 2 is a nucleotide sequence of a gene encoding the protein (No12-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 1 (hereinafter, also referred to as No12-DES gene).
[0067] The nucleotide sequence set forth in SEQ ID NO: 46 is a nucleotide sequence of a gene encoding the protein (Ng12-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 45 (hereinafter, also referred to as Ng12-DES gene).
[0068] In the DNA (b), the identity with the nucleotide sequence of the DNA (a) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 12-DES activity.
[0069] Further, the DNA (b) is also preferably a DNA in which 1 or several (for example 1 or more and 527 or less, preferably 1 or more and 461 or less, more preferably 1 or more and 396 or less, further preferably 1 or more and 330 or less, further preferably 1 or more and 264 or less, further preferably 1 or more and 198 or less, further preferably 1 or more and 132 or less, further preferably 1 or more and 106 or less, further preferably 1 or more and 66 or less, further preferably 1 or more and 27 or less, and furthermore preferably 1 or more and 14 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (a), and encoding a protein having 12-DES activity.
[0070] Furthermore, the DNA (b) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (a) under a stringent condition, and encoding a protein having 12-DES activity.
[0071] In the DNA (d), the identity with the nucleotide sequence of the DNA (c) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 12-DES activity.
[0072] Further, the DNA (d) is also preferably a DNA in which 1 or several (for example 1 or more and 544 or less, preferably 1 or more and 476 or less, more preferably 1 or more and 408 or less, further preferably 1 or more and 340 or less, further preferably 1 or more and 272 or less, further preferably 1 or more and 204 or less, further preferably 1 or more and 136 or less, further preferably 1 or more and 109 or less, further preferably 1 or more and 68 or less, further preferably 1 or more and 28 or less, and furthermore preferably 1 or more and 14 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (c), and encoding a protein having 12-DES activity.
[0073] Furthermore, the DNA (d) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (c) under a stringent condition, and encoding a protein having 12-DES activity.
[0074] In the present specification, the term 6-DES means a protein (enzyme) that catalyzes a reaction of introducing an unsaturated bond into a 6-position of C18:29,12 to produce C18:36,9,12. Then, in the present specification, the term 6-desaturase activity (hereinafter, also referred to as 6-DES activity) means activity for introducing the unsaturated bond into the 6-position of C18:29,12.
[0075] It can be confirmed that the protein has the 6-DES activity by a system using a 6-DES gene deletion strain, for example. Alternatively, it can also be confirmed by examining formation of -linolenic acid by introducing the DNA of which a gene encoding the above-described protein was ligated downstream of a promoter functioning inside a host cell, into the 6-DES gene deletion strain. Alternatively, it can also be confirmed by measuring a decrease of linoleic acid amount or an increase of -linolenic acid amount according to an ordinary method by preparing the 6-DES or cell lysate containing the same to react the resultant material with the reaction solution containing linoleic acid, linoleoyl-CoA, or the like.
[0076] Preferred examples of the 6-DES in the present invention include the following proteins (E) to (H): [0077] (E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3; [0078] (F) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (E), and having 6-desaturase activity; [0079] (G) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 47; and [0080] (H) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (G), and having 6-desaturase activity.
[0081] The protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 is a 6-DES derived from Nannochloropsis oculata strain NIES-2145 (hereinafter, also referred to as No6-DES). Further, the protein consisting of the amino acid sequence set forth in SEQ ID NO: 47 is a 6-DES derived from Nannochloropsis gaditana B-31 strain (hereinafter, also referred to as Ng6-DES).
[0082] Note that, identity of the amino acid sequence of the protein (E) with the amino acid sequence of the protein (G) is 89%.
[0083] All of the proteins (E) to (H) have 6-DES activity.
[0084] In the protein (F), the identity with the amino acid sequence of the protein (E) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 6-DES activity. Further, specific examples of the protein (F) include a protein in which 1 or several (for example 1 or more and 190 or less, preferably 1 or more and 166 or less, more preferably 1 or more and 143 or less, further preferably 1 or more and 119 or less, furthermore preferably 1 or more and 95 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 48 or less, furthermore preferably 1 or more and 38 or less, furthermore preferably 1 or more and 24 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (E).
[0085] In the protein (H), the identity with the amino acid sequence of the protein (G) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 6-DES activity. Further, specific examples of the protein (H) include a protein in which 1 or several (for example 1 or more and 190 or less, preferably 1 or more and 166 or less, more preferably 1 or more and 143 or less, further preferably 1 or more and 119 or less, furthermore preferably 1 or more and 95 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 48 or less, furthermore preferably 1 or more and 38 or less, furthermore preferably 1 or more and 24 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (G).
[0086] Specific examples of a method for introducing the mutation into the amino acid sequence include the above-mentioned method with regard to the 12-DES.
[0087] The proteins (E) to (H) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata or Nannochloropsis gaditana. In addition, the proteins (E) to (H) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 3 or 47. Alternatively, as recombinant proteins, proteins (E) to (H) may also be prepared by gene recombination technologies. In the case of preparing a recombinant protein, a gene encoding the 6-DES described below can be used.
[0088] An example of the gene encoding the 6-DES (preferably, any one of the proteins (E) to (H)) (hereinafter, also referred to as 6-DES gene) includes a gene consisting of any one of the following DNAs (e) to (h). [0089] (e) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 4; [0090] (f) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (e), and encoding a protein having 6-DES activity; [0091] (g) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 48; and [0092] (h) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (g), and encoding a protein having 6-DES activity.
[0093] The nucleotide sequence set forth in SEQ ID NO: 4 is a nucleotide sequence of a gene encoding the protein (No6-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 3 (hereinafter, also referred to as No6-DES gene).
[0094] The nucleotide sequence set forth in SEQ ID NO: 48 is a nucleotide sequence of a gene encoding the protein (Ng6-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 47 (hereinafter, also referred to as Ng6-DES gene).
[0095] In the DNA (f), the identity with the nucleotide sequence of the DNA (e) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 6-DES activity.
[0096] Further, the DNA (f) is also preferably a DNA in which 1 or several (for example 1 or more and 570 or less, preferably 1 or more and 499 or less, more preferably 1 or more and 428 or less, further preferably 1 or more and 357 or less, further preferably 1 or more and 285 or less, further preferably 1 or more and 214 or less, further preferably 1 or more and 143 or less, further preferably 1 or more and 114 or less, further preferably 1 or more and 72 or less, further preferably 1 or more and 29 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (e), and encoding a protein having 6-DES activity.
[0097] Furthermore, the DNA (f) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (e) under a stringent condition, and encoding a protein having 6-DES activity.
[0098] In the DNA (h), the identity with the nucleotide sequence of the DNA (g) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 6-DES activity.
[0099] Further, the DNA (h) is also preferably a DNA in which 1 or several (for example 1 or more and 572 or less, preferably 1 or more and 500 or less, more preferably 1 or more and 429 or less, further preferably 1 or more and 357 or less, further preferably 1 or more and 286 or less, further preferably 1 or more and 215 or less, further preferably 1 or more and 143 or less, further preferably 1 or more and 115 or less, further preferably 1 or more and 72 or less, further preferably 1 or more and 29 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (g), and encoding a protein having 6-DES activity.
[0100] Furthermore, the DNA (h) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (g) under a stringent condition, and encoding the protein having 6-DES activity.
[0101] In the present invention, it is preferred to also enhance expression of an 3-desaturase (hereinafter, also referred to as 3-DES), in addition to the 12-DES and the 6-DES.
[0102] In the present specification, the term 3-DES means a protein (enzyme) that catalyzes a reaction of introducing an unsaturated bond into an 3-position of C20:45,8,11,14 to form EPA (hereinafter, also denoted as C20:55,8,11,14,17) being -3 fatty acid, as shown in
[0103] As shown in Examples described later, in the algae belonging to the genus Nannochloropsis, in which expressions of the 12-DES and the 6-DES are enhanced, introduction of an unsaturated bond into the 3-position of C20:45,8,11,14 is accelerated by enhancing expression of the 3-DES also, and production amount of C20:55,8,11,14,17 is further increased.
[0104] It can be confirmed that the protein has the 3-DES activity by a system using an 3-DES gene deletion strain, for example. Alternatively, it can also be confirmed by examining formation of EPA by introducing the DNA of which a gene encoding the above-described protein was ligated downstream of a promoter functioning inside a host cell, into the 3-DES gene deletion strain. Alternatively, it can also be confirmed by measuring a decrease of arachidonic acid amount or an increase of EPA amount according to an ordinary method by preparing the 3-DES or cell lysate containing the same to react the resultant material with the reaction solution containing arachidonic acid derivatives (the thioester compound with CoA, the ester compound with glycerol, or the like).
[0105] Preferred examples of the 3-DES in the present invention include the following proteins (I) to (L): [0106] (I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5; [0107] (J) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (I), and having 3-desaturase activity; [0108] (K) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 49; and [0109] (L) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (K), and having 3-desaturase activity.
[0110] The protein consisting of the amino acid sequence set forth in SEQ ID NO: 5 is an 3-DES derived from Nannochloropsis oculata strain NIES-2145 (hereinafter, also referred to as No3-DES). Further, the protein consisting of the amino acid sequence set forth in SEQ ID NO: 49 is an 3-DES derived from Nannochloropsis gaditana CCMP526 strain (hereinafter, also referred to as Ng3-DES).
[0111] Note that, identity of the amino acid sequence of the protein (I) with the amino acid sequence of the protein (K) is 82%.
[0112] All of the proteins (I) to (L) have 3-DES activity.
[0113] In the protein (J), the identity with the amino acid sequence of the protein (I) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 3-DES activity. Further, specific examples of the protein (J) include a protein in which 1 or several (for example 1 or more and 164 or less, preferably 1 or more and 144 or less, more preferably 1 or more and 123 or less, further preferably 1 or more and 103 or less, furthermore preferably 1 or more and 82 or less, furthermore preferably 1 or more and 62 or less, furthermore preferably 1 or more and 41 or less, furthermore preferably 1 or more and 33 or less, furthermore preferably 1 or more and 21 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (I).
[0114] In the protein (L), the identity with the amino acid sequence of the protein (K) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 3-DES activity. Further, specific examples of the protein (L) include a protein in which 1 or several (for example 1 or more and 163 or less, preferably 1 or more and 143 or less, more preferably 1 or more and 123 or less, further preferably 1 or more and 102 or less, furthermore preferably 1 or more and 82 or less, furthermore preferably 1 or more and 62 or less, furthermore preferably 1 or more and 41 or less, furthermore preferably 1 or more and 33 or less, furthermore preferably 1 or more and 21 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (K).
[0115] Specific examples of a method for introducing the mutation into the amino acid sequence include the above-mentioned method with regard to the 12-DES.
[0116] The proteins (I) to (L) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata or Nannochloropsis gaditana. In addition, the proteins (I) to (L) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 5 or 49. Alternatively, as recombinant proteins, proteins (I) to (L) may also be prepared by gene recombination technologies. In the case of preparing a recombinant protein, a gene encoding the 3-DES described below can be used.
[0117] An example of the gene encoding the 3-DES (preferably, any one of the proteins (I) to (L)) (hereinafter, also referred to as 3-DES gene) includes a gene consisting of any one of the following DNAs (i) to (l). [0118] (i) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 6; [0119] (j) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (i), and encoding a protein having 3-DES activity; [0120] (k) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 50; and [0121] (l) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (k), and encoding a protein having 3-DES activity.
[0122] The nucleotide sequence set forth in SEQ ID NO: 6 is a nucleotide sequence of a gene encoding the protein (No3-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 5 (hereinafter, also referred to as No3-DES gene).
[0123] The nucleotide sequence set forth in SEQ ID NO: 50 is a nucleotide sequence of a gene encoding the protein (Ng3-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 49.
[0124] In the DNA (j), the identity with the nucleotide sequence of the DNA (i) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 3-DES activity.
[0125] Further, the DNA (j) is also preferably a DNA in which 1 or several (for example 1 or more and 494 or less, preferably 1 or more and 432 or less, more preferably 1 or more and 370 or less, further preferably 1 or more and 309 or less, further preferably 1 or more and 247 or less, further preferably 1 or more and 185 or less, further preferably 1 or more and 124 or less, further preferably 1 or more and 99 or less, further preferably 1 or more and 62 or less, further preferably 1 or more and 25 or less, and furthermore preferably 1 or more and 13 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (i), and encoding a protein having 3-DES activity.
[0126] Furthermore, the DNA (j) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (i) under a stringent condition, and encoding a protein having 3-DES activity.
[0127] In the DNA (l), the identity with the nucleotide sequence of the DNA (k) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99 or more, in view of 3-DES activity.
[0128] Further, the DNA (l) is also preferably a DNA in which 1 or several (for example 1 or more and 490 or less, preferably 1 or more and 429 or less, more preferably 1 or more and 368 or less, further preferably 1 or more and 306 or less, further preferably 1 or more and 245 or less, further preferably 1 or more and 184 or less, further preferably 1 or more and 123 or less, further preferably 1 or more and 98 or less, further preferably 1 or more and 62 or less, further preferably 1 or more and 25 or less, and furthermore preferably 1 or more and 13 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (k), and encoding a protein having 3-DES activity.
[0129] Furthermore, the DNA (l) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (k) under a stringent condition, and encoding a protein having 3-DES activity.
[0130] In the present invention, it is preferred to also enhance expression of a 5-desaturase (hereinafter, also referred to as 5-DES), in addition to the 12-DES and the 6-DES, as with the 3-DES.
[0131] In the present specification, the term 5-DES means a protein (enzyme) that catalyzes a reaction of introducing an unsaturated bond into a 5-position of dihomo--linolenic acid (hereinafter, also denoted as C20:38,11,14) to form C20:45,8,11,14, as shown in
[0132] In the algae belonging to the genus Nannochloropsis, in which the expressions of the 12-DES and the 6-DES are enhanced, production amount of C18:36,9,12 and C20:38,11,14 synthesized by elongating a carbon chain in C18:36,9,12 by two chains is increased by a sequential reaction catalyzed by the 12-DES and the 6-DES. Accordingly, in the algae belonging to the genus Nannochloropsis, in which the expressions of the 12-DES and the 6-DES are enhanced, introduction of an unsaturated bond into the 5-position of C20:308,11,14 is accelerated by also enhancing expression of the 5-DES, and production amount of C20:45,8,11,14 serving as a substrate of synthesis of C20:55,8,11,14,17 is further increased.
[0133] It can be confirmed that the protein has the 5-DES activity by a system using a 5-DES gene deletion strain, for example. Alternatively, it can also be confirmed by examining formation of arachidonic acid by introducing the DNA of which a gene encoding the above-described protein was ligated downstream of a promoter functioning inside a host cell, into the 5-DES gene deletion strain. Alternatively, it can also be confirmed by measuring a decrease of dihomo--linolenic acid amount or an increase of arachidonic acid amount according to an ordinary method by preparing the 5-DES or cell lysate containing the same to react the resultant material with the reaction solution containing dihomo--linolenic acid derivatives (the thioester compound with CoA, the ester compound with glycerol, or the like).
[0134] Preferred examples of the 5-DES in the present invention include the following proteins (M) to (P): [0135] (M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7; [0136] (N) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (M), and having 5-desaturase activity; [0137] (O) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 51; and [0138] (P) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (O), and having 5-desaturase activity.
[0139] The protein consisting of the amino acid sequence set forth in SEQ ID NO: 7 is a 5-DES derived from Nannochloropsis oculata strain NIES-2145 (hereinafter, also referred to as No5-DES). Further, the protein consisting of the amino acid sequence set forth in SEQ ID NO: 51 is a 5-DES derived from Nannochloropsis gaditana B-31 strain (hereinafter, also referred to as Ng5-DES).
[0140] Note that, identity of the amino acid sequence of the protein (M) with the amino acid sequence of the protein (O) is 81%.
[0141] All of the proteins (M) to (P) have 5-DES activity.
[0142] In the protein (N), the identity with the amino acid sequence of the protein (M) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 5-DES activity. Further, specific examples of the protein (N) include a protein in which 1 or several (for example 1 or more and 211 or less, preferably 1 or more and 185 or less, more preferably 1 or more and 158 or less, further preferably 1 or more and 132 or less, furthermore preferably 1 or more and 106 or less, furthermore preferably 1 or more and 79 or less, furthermore preferably 1 or more and 53 or less, furthermore preferably 1 or more and 43 or less, furthermore preferably 1 or more and 27 or less, furthermore preferably 1 or more and 11 or less, and furthermore preferably 1 or more and 6 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (M).
[0143] In the protein (P), the identity with the amino acid sequence of the protein (0) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 5-DES activity. Further, specific examples of the protein (P) include a protein in which 1 or several (for example 1 or more and 206 or less, preferably 1 or more and 181 or less, more preferably 1 or more and 155 or less, further preferably 1 or more and 129 or less, furthermore preferably 1 or more and 103 or less, furthermore preferably 1 or more and 78 or less, furthermore preferably 1 or more and 52 or less, furthermore preferably 1 or more and 42 or less, furthermore preferably 1 or more and 26 or less, furthermore preferably 1 or more and 11 or less, and furthermore preferably 1 or more and 6 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (O).
[0144] Specific examples of a method for introducing the mutation into the amino acid sequence include the above-mentioned method with regard to the 12-DES.
[0145] The proteins (M) to (P) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata or Nannochloropsis gaditana. In addition, the proteins (M) to (P) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 7 or 51. Alternatively, as recombinant proteins, proteins (M) to (P) may also be prepared by gene recombination technologies. In the case of preparing a recombinant protein, a gene encoding the 5-DES described below can be used.
[0146] An example of the gene encoding the 5-DES (preferably, any one of the proteins (M) to (P)) (hereinafter, also referred to as 5-DES gene) includes a gene consisting of any one of the following DNAs (m) to (p). [0147] (m) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 8; [0148] (n) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (m), and encoding a protein having 5-DES activity; [0149] (o) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 52; and [0150] (p) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (o), and encoding a protein having 5-DES activity.
[0151] The nucleotide sequence set forth in SEQ ID NO: 8 is a nucleotide sequence of a gene encoding the protein (No5-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 7 (hereinafter, also referred to as No5-DES gene).
[0152] The nucleotide sequence set forth in SEQ ID NO: 52 is a nucleotide sequence of a gene encoding the protein (Ng5-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 51 (hereinafter, also referred to as Ng5-DES gene).
[0153] In the DNA (n), the identity with the nucleotide sequence of the DNA (m) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 5-DES activity.
[0154] Further, the DNA (n) is also preferably a DNA in which 1 or several (for example 1 or more and 633 or less, preferably 1 or more and 554 or less, more preferably 1 or more and 475 or less, further preferably 1 or more and 396 or less, further preferably 1 or more and 317 or less, further preferably 1 or more and 238 or less, further preferably 1 or more and 159 or less, further preferably 1 or more and 127 or less, further preferably 1 or more and 80 or less, further preferably 1 or more and 32 or less, and furthermore preferably 1 or more and 16 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (m), and encoding a protein having 5-DES activity.
[0155] Furthermore, the DNA (n) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (m) under a stringent condition, and encoding a protein having 5-DES activity.
[0156] In the DNA (p), the identity with the nucleotide sequence of the DNA (o) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99 or more, in view of 5-DES activity.
[0157] Further, the DNA (p) is also preferably a DNA in which 1 or several (for example 1 or more and 620 or less, preferably 1 or more and 542 or less, more preferably 1 or more and 465 or less, further preferably 1 or more and 387 or less, further preferably 1 or more and 310 or less, further preferably 1 or more and 233 or less, further preferably 1 or more and 155 or less, further preferably 1 or more and 124 or less, further preferably 1 or more and 78 or less, further preferably 1 or more and 31 or less, and furthermore preferably 1 or more and 16 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (o), and encoding a protein having 5-DES activity.
[0158] Furthermore, the DNA (p) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (o) under a stringent condition, and encoding a protein having 5-DES activity.
[0159] In the present invention, it is preferred to also enhance expression of a 9-desaturase (hereinafter, also referred to as 9-DES), in addition to the 012-DES and the 6-DES, as with the 3-DES and the 5-DES.
[0160] In the present specification, the term 9-DES means a protein (enzyme) that catalyzes a reaction of introducing an unsaturated bond into a 9-position of stearic acid (hereinafter, also denoted as C18:0) to form C18:19, as shown in
[0161] Production amount of C18:19 being a starting material of the sequential reaction catalyzed by the 12-DES and the 6-DES is increased by enhancing expression of the 9-DES, and the productivity of PUFA can be further improved.
[0162] It can be confirmed that the protein has the 9-DES activity by a system using a 9-DES gene deletion strain, for example. Alternatively, it can also be confirmed by examining formation of oleic acid by introducing the DNA of which a gene encoding the above-described protein was ligated downstream of a promoter functioning inside a host cell, into the 9-DES gene deletion strain. Alternatively, it can also be confirmed by measuring a decrease of stearic acid amount or an increase of oleic acid amount according to an ordinary method by preparing the 9-DES or cell lysate containing the same to react the resultant material with the reaction solution containing stearic acid, stearoyl-CoA, or the like.
[0163] Preferred examples of the 9-DES in the present invention include the following proteins (Q) to (T): [0164] (Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9; [0165] (R) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (Q), and having 9-desaturase activity; [0166] (S) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 53; and [0167] (T) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (S), and having 9-desaturase activity.
[0168] The protein consisting of the amino acid sequence set forth in SEQ ID NO: 9 is a 9-DES derived from Nannochloropsis oculata strain NIES-2145 (hereinafter, also referred to as No9-DES). Further, the protein consisting of the amino acid sequence set forth in SEQ ID NO: 53 is a 9-DES derived from Nannochloropsis gaditana B-31 strain (hereinafter, also referred to as Ng9-DES).
[0169] Note that, identity of the amino acid sequence of the protein (Q) with the amino acid sequence of the protein (S) is 93%.
[0170] All of the proteins (Q) to (T) have 9-DES activity.
[0171] In the protein (R), the identity with the amino acid sequence of the protein (Q) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 9-DES activity. Further, specific examples of the protein (R) include a protein in which 1 or several (for example 1 or more and 144 or less, preferably 1 or more and 126 or less, more preferably 1 or more and 108 or less, further preferably 1 or more and 90 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 54 or less, furthermore preferably 1 or more and 36 or less, furthermore preferably 1 or more and 29 or less, furthermore preferably 1 or more and 18 or less, furthermore preferably 1 or more and 8 or less, and furthermore preferably 1 or more and 4 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (Q).
[0172] In the protein (T), the identity with the amino acid sequence of the protein (S) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 9-DES activity. Further, specific examples of the protein (T) include a protein in which 1 or several (for example 1 or more and 136 or less, preferably 1 or more and 119 or less, more preferably 1 or more and 102 or less, further preferably 1 or more and 85 or less, furthermore preferably 1 or more and 68 or less, furthermore preferably 1 or more and 51 or less, furthermore preferably 1 or more and 34 or less, furthermore preferably 1 or more and 28 or less, furthermore preferably 1 or more and 17 or less, furthermore preferably 1 or more and 7 or less, and furthermore preferably 1 or more and 4 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (S).
[0173] Specific examples of a method for introducing the mutation into the amino acid sequence include the above-mentioned method with regard to the 12-DES.
[0174] The proteins (Q) to (T) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata or Nannochloropsis gaditana. In addition, the proteins (Q) to (T) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 9 or 53. Alternatively, as recombinant proteins, proteins (Q) to (T) may also be prepared by gene recombination technologies. In the case of preparing a recombinant protein, a gene encoding the 9-DES described below can be used.
[0175] An example of the gene encoding the 9-DES (preferably, any one of the proteins (Q) to (T)) (hereinafter, also referred to as 9-DES gene) includes a gene consisting of any one of the following DNAs (q) to (t). [0176] (q) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 10; [0177] (r) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (q), and encoding a protein having 9-DES activity; [0178] (s) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 54; and [0179] (t) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (s), and encoding a protein having 9-DES activity.
[0180] The nucleotide sequence set forth in SEQ ID NO: 10 is a nucleotide sequence of a gene encoding the protein (No9-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 9 (hereinafter, also referred to as No9-DES gene).
[0181] The nucleotide sequence set forth in SEQ ID NO: 54 is a nucleotide sequence of a gene encoding the protein (Ng9-DES) consisting of the amino acid sequence set forth in SEQ ID NO: 53 (hereinafter, also referred to as Ng9-DES gene).
[0182] In the DNA (r), the identity with the nucleotide sequence of the DNA (q) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 9-DES activity.
[0183] Further, the DNA (r) is also preferably a DNA in which 1 or several (for example 1 or more and 432 or less, preferably 1 or more and 378 or less, more preferably 1 or more and 324 or less, further preferably 1 or more and 270 or less, further preferably 1 or more and 216 or less, further preferably 1 or more and 162 or less, further preferably 1 or more and 108 or less, further preferably 1 or more and 87 or less, further preferably 1 or more and 54 or less, further preferably 1 or more and 22 or less, and furthermore preferably 1 or more and 11 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (q), and encoding a protein having 9-DES activity.
[0184] Furthermore, the DNA (r) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (q) under a stringent condition, and encoding a protein having 9-DES activity.
[0185] In the DNA (t), the identity with the nucleotide sequence of the DNA (s) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99 or more, in view of 9-DES activity.
[0186] Further, the DNA (t) is also preferably a DNA in which 1 or several (for example 1 or more and 410 or less, preferably 1 or more and 359 or less, more preferably 1 or more and 307 or less, further preferably 1 or more and 256 or less, further preferably 1 or more and 205 or less, further preferably 1 or more and 154 or less, further preferably 1 or more and 103 or less, further preferably 1 or more and 82 or less, further preferably 1 or more and 52 or less, further preferably 1 or more and 21 or less, and furthermore preferably 1 or more and 11 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (s), and encoding a protein having 9-DES activity.
[0187] Furthermore, the DNA (t) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (s) under a stringent condition, and encoding a protein having 9-DES activity.
[0188] In the present invention, it is preferred to also enhance expression of a 6-elongase (hereinafter, also referred to as 6-FLO), in addition to the 12-DES and the 6-DES, as with the 3-DES, the 5-DES and the 9-DES.
[0189] A term 6-FLO in the present specification means a protein (enzyme) that catalyzes a reaction of elongating a carbon chain in -linolenic acid (C18:36,9,12) by two carbon atoms to form dihomo--linolenic acid (C20:38,11,14) as shown in
[0190] In the algae belonging to the genus Nannochloropsis, in which the expressions of the 12-DES and the 6-DES are enhanced, production amount of C18:36,9,12 is increased by a sequential reaction catalyzed by the 12-DES and the 6-DES. Accordingly, in the algae belonging to the genus Nannochloropsis, in which the expressions of the 12-DES and the 6-DES are enhanced, introduction (elongation) of the carbon chain into 018:36,9,12 by two carbon atoms is accelerated by also enhancing expression of the 6-ELO, and production amount of C20:38,11,14, C20:45,8,11,14 and 20:55,8,11,14,17 is further increased.
[0191] It can be confirmed that the protein has the 6-ELO activity by a system using a 6-ELO gene deletion strain, for example. Alternatively, it can also be confirmed by examining formation of dihomo--linolenic acid by introducing the DNA of which a gene encoding the above-described protein was ligated downstream of a promoter functioning inside a host cell, into the 6-ELO gene deletion strain. Alternatively, it can also be confirmed by measuring a decrease of -linolenic acid amount or an increase of dihomo--linolenic acid amount according to an ordinary method by preparing the 6-ELO or cell lysate containing the same to react the resultant material with the reaction solution containing -linolenic acid derivatives (the thioester compound with CoA, the ester compound with glycerol, or the like).
[0192] Preferred examples of the 6-ELO in the present invention include the following proteins (U) and (V): [0193] (U) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 74; and [0194] (V) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (U), and having 6-ELO activity.
[0195] The protein consisting of the amino acid sequence set forth in SEQ ID NO: 74 is a 6-ELO derived from Nannochloropsis oculata strain NIES-2145 (hereinafter, also referred to as No6-ELO).
[0196] Both of the proteins (U) and (V) have 6-ELO activity.
[0197] In the protein (V), the identity with the amino acid sequence of the protein (U) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 6-ELO activity. Further, specific examples of the protein (V) include a protein in which 1 or several (for example 1 or more and 111 or less, preferably 1 or more and 97 or less, more preferably 1 or more and 83 or less, further preferably 1 or more and 69 or less, furthermore preferably 1 or more and 56 or less, furthermore preferably 1 or more and 42 or less, furthermore preferably 1 or more and 28 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 14 or less, furthermore preferably 1 or more and 6 or less, and furthermore preferably 1 or more and 3 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (U).
[0198] Specific examples of a method for introducing the mutation into the amino acid sequence include the above-mentioned method with regard to the 12-DES.
[0199] The proteins (U) and (V) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata. In addition, the proteins (U) and (V) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 74. Alternatively, as recombinant proteins, proteins (U) and (V) may also be prepared by gene recombination technologies. In the case of preparing a recombinant protein, a gene encoding the 6-ELO described below can be used.
[0200] An example of the gene encoding the 6-ELO (preferably, any one of the proteins (U) and (V)) (hereinafter, also referred to as 6-ELO gene) includes a gene consisting of any one of the following DNAs (u) and (v). [0201] (u) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 73; and [0202] (v) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (u), and encoding a protein having 6-ELO activity.
[0203] The nucleotide sequence set forth in SEQ ID NO: 73 is a nucleotide sequence of a gene encoding the protein (No6-ELO) consisting of the amino acid sequence set forth in SEQ ID NO: 74 (hereinafter, also referred to as No6-ELO gene).
[0204] In the DNA (v), the identity with the nucleotide sequence of the DNA (u) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of 6-ELO activity.
[0205] Further, the DNA (v) is also preferably a DNA in which 1 or several (for example 1 or more and 333 or less, preferably 1 or more and 291 or less, more preferably 1 or more and 250 or less, further preferably 1 or more and 208 or less, further preferably 1 or more and 167 or less, further preferably 1 or more and 125 or less, further preferably 1 or more and 84 or less, further preferably 1 or more and 67 or less, further preferably 1 or more and 42 or less, further preferably 1 or more and 17 or less, and furthermore preferably 1 or more and 9 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (u), and encoding a protein having 6-ELO activity.
[0206] Furthermore, the DNA (v) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (u) under a stringent condition, and encoding a protein having 6-ELO activity.
[0207] As mentioned above, in the pathway of PUFA synthesis in the algae belonging to the genus Nannochloropsis, the reaction of forming linoleic acid from oleic acid, and forming -linolenic acid from the linoleic acid formed is the rate-limiting step. Accordingly, in the present invention, the expressions of only the 12-DES and the 6-DES that catalyzes the reaction in the rate-limiting step may be enhanced.
[0208] Alternatively, from a viewpoint of more improving the productivity of PUFA, in addition to the 12-DES and the 6-DES, at least any one kind of enzymes selected from the group consisting of the 3-DES, the 5-DES, the 9-DES and the 6-ELO is preferably enhanced, and two or more kinds of enzymes selected from the group consisting of the 3-DES, the 5-DES, the 9-DES and the 6-ELO are more preferably enhanced.
[0209] A method of enhancing the expression of the each enzyme can be appropriately selected from an ordinarily method, and a method of enhancing the expression of the gene encoding the each enzyme is preferred. Specific examples include a method of introducing the each gene into a host to enhance the expression of the gene, a method of modifying expression regulation regions (promoter, terminator, or the like) of the gene in a host having the each gene on a genome, and the like. Among them, the method of introducing the each gene into a host to enhance the expression of the each gene is preferred.
[0210] Hereinafter, in the present specification, a cell in which expression of target protein, such as each enzyme, is enhanced is also referred to as the transformant, and a cell in which the expression of the target protein is not enhanced is also referred to as the host or wild type strain.
[0211] In the transformant used in the present invention, the productivity of PUFA and lipids containing the same as components (production amount of PUFA and lipids containing the same as components, and the proportion of PUFA and lipids containing the same as components in the whole fatty acids or lipids to be produced) is tend to increase, in comparison with that in a host. Moreover, as a result, in the transformant, the fatty acid composition in the lipid is modified. Therefore, the present invention using the transformant can be preferably applied to production of fatty acids or lipids having specific number of carbon atoms, particularly PUFA or lipids containing the same as components, preferably PUFA having 18 or more carbon atoms or lipids containing the same as components, more preferably PUFA having 18 or 20 carbon atoms or lipids containing the same as components, further preferably PUFA having 20 carbon atoms or lipids containing the same as components, further preferably C20:3, C20:4 or C20:5, or lipids containing the same as components, further preferably dihomo--linolenic acid, arachidonic acid, or eicosapentaenoic acid or lipids containing the same as components, further preferably arachidonic acid, eicosapentaenoic acid or lipids containing the same as components, or eicosapentaenoic acid or lipids containing the same as components.
[0212] The productivity of fatty acids and lipids of the host and the transformant can be measured by the method used in Examples described below.
[0213] The method of introducing the each gene into a host to enhance the expression of the gene is described.
[0214] The each gene can be obtained by genetic engineering techniques that are ordinarily carried out. For example, the each gene can be artificially synthesized based on the amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 45, 47, 49, 51, 53 or 74, or the nucleotide sequence set forth in SEQ ID NO: 2, 4, 6, 8, 10, 46, 48, 50, 52, 54 or 73. The synthesis of the each gene can be achieved by utilizing, for example, the services of Invitrogen. Further, the gene can also be obtained by cloning from algae belonging to the genus Nannochloropsis such as Nannochloropsis oculata and Nannochloropsis gaditana. The cloning can be carried out by, for example, the methods described in Molecular Cloning: A LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W. Russell, Cold Spring Harbor Laboratory Press (2001)]. Furthermore, Nannochloropsis oculata NIES-2145 used in Examples can be obtained from National Institute for Environmental Studies (NIES).
[0215] The transformant that can be preferably used in the present invention is obtained by introducing the each gene into a host according to an ordinarily method. Specifically, the transformant can be produced by preparing a recombinant vector or a gene expression cassette which is capable of expressing the each gene in a host cell, introducing this vector or cassette into the host cell, and thereby transforming the host cell.
[0216] The alga used in the present invention is an alga belonging to the genus Nannochloropsis. The algae of the genus Nannochloropsis are small algae (microalgae) having a globular shape or an elliptical shape and a size of about 2 to 5 m.
[0217] Specific examples of the algae belonging to the genus Nannochloropsis used in the present invention include, from a viewpoint of establishment of a gene recombination technique, Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina, Nannochloropsis oceanica, Nannochloropsis atomus, Nannochloropsis maculata, Nannochloropsis granulate, Nannochloropsis sp., and the like. Among these, from a viewpoint of the lipid productivity, Nannochloropsis oculata or Nannochloropsis gaditana is preferable, and Nannochloropsis oculata is more preferable.
[0218] A plasmid for gene expression or a vector (plasmid) containing the gene expression cassette may be any vector capable of introducing the gene encoding the target protein into a host, and expressing the target gene in the host cell. For example, a vector which has expression regulation regions such as a promoter and a terminator in accordance with the type of the host to be introduced, and has a replication initiation point, a selection marker or the like, can be used. Furthermore, the vector may also be a vector such as a plasmid capable of self-proliferation and self-replication outside the chromosome, or may also be a vector which is incorporated into the chromosome.
[0219] Specific examples of the vector that can be used preferably in the present invention include, pUC19 (manufactured by Takara Bio), P66 (Chlamydomonas Center), P-322 (Chlamydomonas Center), pPha-T1 (see Yangmin Gong, et al., Journal of Basic Microbiology, 2011, vol. 51, p. 666-672) and pJET1 (manufactured by COSMO BIO). In particular, pUC19, pPha-T1 or pJET1 is preferably used. Moreover, the host can be transformed, with referring to the method described in Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52), by using the DNA fragment consisting of the target gene, a promoter and a terminator (gene expression cassette). Specific examples of this DNA fragment include a DNA fragment amplified by PCR method, and a restriction enzyme-cut DNA fragment.
[0220] Moreover, a kind of promoter regulating the expression of the gene encoding a target protein, which is introduced into the expression vector, can also be appropriately selected according to a kind of the host to be used. Specific examples of the promoter that can be preferably used in the present invention include lac promoter, trp promoter, tac promoter, trc promoter, T7 promoter, SpoVG promoter, a promoter that relates to a substance that can be induced by addition of isopropyl -D-1-thiogalactopyranoside (IPTG), Rubisco operon (rbc), PSI reaction center protein (psaAB), D1 protein of PSII (psbA), c-phycocyanin subunit (cpcB), cauliflower mosaic virus 35S RNA promoter, promoters for housekeeping genes (e.g., tubulin promoter, actin promoter and ubiquitin promoter), Brassica napus or Brassica rapa-derived Napin gene promoter, plant-derived Rubisco promoter, a promoter of a violaxanthin/(chlorophyll a)-binding protein gene derived from the genus Nannochloropsis (VCP1 promoter, VCP2 promoter) (Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52)), and a promoter of an oleosin-like protein LDSP (lipid droplet surface protein) gene derived from the genus Nannochloropsis (PLOS Genetics, 2012, vol. 8(11): e1003064. DOI: 10.1371). In the present invention, the promoter of violaxanthin/(chlorophyll a)-binding protein gene, or the promoter of an oleosin-like protein LDSP gene derived from the genus Nannochloropsis can be preferably used.
[0221] Moreover, a kind of selection marker for confirming introduction of the gene encoding a target protein can also be appropriately selected according to a kind of the host to be used. Examples of the selection marker that can be preferably used in the present invention include drug resistance genes such as an ampicillin resistance gene, a chloramphenicol resistance gene, an erythromycin resistance gene, a neomycin resistance gene, a kanamycin resistance gene, a spectinomycin resistance gene, a tetracycline resistance gene, a blasticidin S resistance gene, a bialaphos resistance gene, a zeocin resistance gene, a paromomycin resistance gene, a gentamicin resistance gene, and a hygromycin resistance gene. Further, it is also possible to use a deletion of an auxotrophy-related gene or the like as the selection marker gene.
[0222] Introduction of the gene encoding a target protein to the vector can be conducted by an ordinary technique such as restriction enzyme treatment and ligation.
[0223] Furthermore, the method for transformation can be appropriately selected from ordinary techniques according to a kind of the host to be used. Examples of the method for transformation include a transformation method of using calcium ion, a general competent cell transformation method, a protoplast transformation method, an electroporation method, an LP transformation method, a method of using Agrobacterium, a particle gun method, and the like. In the present invention, transformation can also be performed by using the electroporation method described in Nature Communications, DOI: 10.1038/ncomms1688, 2012, or the like.
[0224] The selection of a transformant having a target gene fragment introduced therein can be carried out by utilizing the selection marker or the like. For example, the selection can be carried out by using an indicator whether a transformant acquires the drug resistance as a result of introducing a drug resistance gene into a host cell together with a target DNA fragment upon the transformation. Further, the introduction of a target DNA fragment can also be confirmed by PCR method using a genome as a template or the like.
[0225] In a host having the each gene on a genome, a method of modifying expression regulation regions of the gene and enhancing the expression of the gene is described.
[0226] The expression regulation region indicates the promoter or the terminator, in which these sequences are generally involved in regulation of the expression amount (transcription amount, translation amount) of the gene adjacent thereto. In a host having the each gene on a genome, productivity of PUFA or lipids containing the same as components can be improved by modifying expression regulation regions of the gene and enhancing the expression of the each gene.
[0227] Specific examples of the method of modifying the expression regulation regions include interchange of promoters. In the host having the above-mentioned each desaturase gene or elongase gene on the genome, the expression of the each gene can be enhanced by interchanging the promoter of the gene (hereinafter, also referred to as desaturase promoter or elongase promoter) with a promoter having higher transcriptional activity.
[0228] For example, in Nannochloropsis oculata strain NIES-2145 being one of the hosts having the each desaturase gene on the genome, the No12-DES gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 55, and a No12-DES gene promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 55.
[0229] Further, the No6-DES gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 56, and a No6-DES gene promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 56.
[0230] Furthermore, the No3-DES gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 57, and a No3-DES gene promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 57.
[0231] Furthermore, the No5-DES gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 58, and a No5-DES gene promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 58.
[0232] Furthermore, the No9-DES gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 59, and a No9-DES gene promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 59.
[0233] Furthermore, the No6-ELO gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 75, and a No6-ELO gene promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 75.
[0234] Therefore, the expression of each of the above-described gene can be enhanced by partially or wholly interchanging the DNA sequences consisting of any one of the nucleotide sequences set forth in SEQ ID NO: 55 to 59 and 75 with the promoter having higher transcriptional activity.
[0235] The promoter used for interchanging the desaturase promoter or elongase promoter is not particularly limited, and can be appropriately selected from the promoters that are higher in the transcriptional activity than the desaturase promoter or elongase promoter and suitable for production of PUFA or lipids containing the same as the components.
[0236] Specific examples of the promoter which can be preferably used in the present invention include a tubulin promoter, a heat shock protein promoter, the above-described promoter of a violaxanthin/(chlorophyll a)-binding protein gene (VCP1 promoter, VCP2 promoter), and a promoter of an oleosin-like protein LDSP gene derived from the genus Nannochloropsis. From a viewpoint of improvement in the productivity of PUFA or lipids containing the same as components, the promoter of a violaxanthin/(chlorophyll a)-binding protein gene or the promoter of LDSP gene is more preferable.
[0237] The above-described modification of a promoter can employ according to an ordinarily method such as homologous recombination. Specifically, a linear DNA fragment containing upstream and downstream regions of a target promoter and containing other promoter instead of the target promoter is constructed, and the resultant DNA fragment is incorporated into a host cell to cause double crossover homologous recombination on the side upstream and downstream of the target promoter of the host genome. As a result, the target promoter on the genome is substituted with other promoter fragment, and the promoter can be modified.
[0238] The method of modifying a target promoter according to such homologous recombination can be conducted with, for example, referring to literature such as Methods in molecular biology, 1995, vol. 47, p. 291-302. In particular, in the case where the host is the algae belonging to the genus Nannochloropsis, specific region in a genome can be modified, with referring to literature such as Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52), by homologous recombination method.
[0239] Furthermore, in the transformant of the present invention, expression of KAS is preferably enhanced, and expression of a gene encoding a KAS (hereinafter, also merely referred to as KAS gene) is more preferably enhanced.
[0240] The KAS is one kind of fatty acid synthesis enzymes which catalyze the condensation reaction of the acyl-ACP with the malonyl-ACP, and is involved in the synthesis of acyl-ACP. In the chloroplast, the elongation reaction of the carbon chain is repeated starting from an acetyl-ACP (or acetyl-CoA), and finally an acyl-ACP having 16 or 18 carbon atoms is synthesized.
[0241] In the first stage of the fatty acid synthesis, an acetoacetyl-ACP is formed by a condensation reaction between the acetyl-ACP (or acetyl-CoA) and a malonyl-ACP. The KAS catalyzes this reaction. Then, the keto group of the acetoacetyl-ACP is reduced by a -ketoacyl-ACP reductase, to produce a hydroxybutyryl-ACP. Subsequently, the hydroxybutyryl-ACP is dehydrated by a -hydroxyacyl-ACP dehydrase, to produce a crotonyl-ACP. Finally, the crotonyl-ACP is reduced by an enoyl-ACP reductase, to produce a butyryl-ACP. The butyryl-ACP in which two carbon atoms are added to the carbon chain of the acyl group of the acetyl-ACP is produced by a series of these reactions. Hereinafter, the similar reactions are repeated to cause elongation of the carbon chain of the acyl-ACP, and an acyl-ACP having 16 or 18 carbon atoms is finally synthesized.
[0242] Therefore, the productivity of the lipids in the algae used for producing the lipids, particularly, the productivity of the fatty acids can be further improved by enhancing expression of the KAS, preferably, enhancing expression of the KAS gene.
[0243] The KAS that can be preferably used in the present invention needs to be the protein having -ketoacyl-ACP synthase activity (hereinafter, also referred to as KAS activity). Herein, the term KAS activity means the activity to catalyze the condensation reaction of the acetyl-ACP or the acyl-ACP with the malonyl-ACP.
[0244] The KAS activity of the protein can be confirmed by, for example, introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell which lacks a fatty acid degradation system, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and analyzing any change caused thereby in the fatty acid composition of the host cell or in the cultured liquid by an ordinary technique. Alternatively, the KAS activity can be confirmed by introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and subjecting a disruption liquid of the cell to a chain length elongation reaction which uses acyl-ACPs, as substrates.
[0245] KAS is categorized into KAS I, KAS II, KAS III or KAS IV according to their substrate specificity. For example, KAS III uses an acetyl-ACP (or acetyl-CoA) having 2 carbon atoms as the substrate to catalyze the elongation reaction that the number of carbon atoms is increased from 2 to 4. KAS I mainly catalyzes the elongation reaction that the number of carbon atoms is increased from 4 to 16, to synthesize the palmitoyl-ACP having 16 carbon atoms. KAS II mainly catalyzes the elongation reaction to the long-chain acyl group having 18 carbon atoms or more, to synthesize a long-chain acyl-ACP. KAS IV mainly catalyzes the elongation reaction that the acyl-ACP having 6 carbon atoms is converted to the acyl-ACP having 14 carbon atoms, to synthesize a medium-chain acyl-ACP.
[0246] Therefore, the productivity of the long-chain fatty acids can be further improved by enhancing expression of the KAS II, preferably, enhancing expression of a gene encoding the KAS II.
[0247] The KAS, which can be preferably used in the present invention, can be appropriately selected from the normal KAS or proteins functionally equivalent to the KAS, according to a kind of host or the like. Specific examples thereof include a KAS II derived from Nannochloropsis oculata (hereinafter, also referred to as NoKASII) (SEQ ID NO: 60). Moreover, as the proteins functionally equivalent to the KAS II, a protein consisting of an amino acid sequence having 50% or more (preferably 70% or more, more preferably 80% or more, and further preferably 90% or more) identity with the amino acid sequence of the NoKASII, and having KAS activity, can be also used. Examples of the gene encoding the NoKASII include a gene consisting of a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 61; and a gene consisting of a DNA consisting of a nucleotide sequence having 50% or more (preferably 70% or more, more preferably 80% or more, and further preferably 90% or more) identity with the nucleotide sequence set forth in SEQ ID NO: 61, and encoding a protein having KAS activity.
[0248] Further, the transformants in which the expression of the KAS is enhanced (for example, the transformants in which the expression of a gene encoding the KAS is enhanced) can be prepared by an ordinary method. For example, the transformants can be prepared by a method similar to the above-described method for enhancing the expression of the each desaturase gene, such as a method for introducing a gene encoding the KAS into a host, a method, in the host having a gene encoding the KAS on a genome, for modifying expression regulation regions of the gene, or the like.
[0249] Furthermore, in the transformant of the present invention, expression of an ACP is preferably enhanced, and expression of a gene encoding an ACP (hereinafter, also merely referred to as ACP gene) is more preferably enhanced.
[0250] The ACP functions as a scaffold (carrier) of a biosynthetic reaction of the fatty acids (elongation reaction of the fatty acids). The acyl group of the fatty acids forms a thioester bond with a phosphopantetheine group bonded to a serine residue of the ACP. The fatty acids are elongated in this state.
[0251] Therefore, the productivity of the lipids in the algae used for producing the lipids, particularly, the productivity of the fatty acids can be further improved by enhancing expression of the ACP, preferably, enhancing expression of the ACP gene.
[0252] The ACP that can be preferably used in the present invention needs to be the protein having acyl-carrier-protein activity (hereinafter, also referred to as ACP activity). A term ACP activity herein means activity that functions as the scaffold of the elongation reaction of the fatty acids by forming the thioester bond with the acyl group of the fatty acids.
[0253] The ACP activity of the protein can be confirmed by, for example, introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into an ACP gene deletion strain to complement the productivity of fatty acids. Alternatively, the ACP activity can be confirmed by introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and analyzing any change caused thereby in the fatty acid composition of the host cell or in the cultured liquid by an ordinary technique. Alternatively, the ACP activity can be confirmed by allowing the above-described protein to react with a coenzyme A (CoA) and suitable ACP synthase (phosphopantetheinyl transferase) to form holo-ACP in which the phosphopantetheine group is bonded therewith with reference to literature such as Biochemistry, 2011, vol. 50(25), p. 5704-5717. Alternatively, the ACP activity can be confirmed by allowing the above-described holo-ACP to react with the fatty acids and suitable acyl-ACP synthetase to form acyl-ACP in which the acyl group is bonded therewith with reference to literature such as The Journal of Biological Chemistry, 1979, vol. 254(15), p. 7123-7128.
[0254] The ACP, which can be preferably used in the present invention, can be appropriately selected from the normal ACP or proteins functionally equivalent to the ACP, according to a kind of host or the like. Specific examples thereof include an ACP derived from Nannochloropsis oculata (hereinafter, also referred to as NoACP) (SEQ ID NO: 62). Moreover, as the proteins functionally equivalent to the ACP, a protein consisting of an amino acid sequence having 50% or more (preferably 70% or more, more preferably 80% or more, and further preferably 90% or more) identity with the amino acid sequence of the NoACP, and having ACP activity, can be also used. Examples of a gene encoding the NoACP include a gene consisting of a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 63; and a gene consisting of a DNA consisting of a nucleotide sequence having 50% or more (preferably 70% or more, more preferably 80% or more, and further preferably 90% or more) identity with the nucleotide sequence set forth in SEQ ID NO: 63, and encoding a protein having ACP activity.
[0255] Further, the transformants in which the expression of the ACP is enhanced (for example, the transformants in which the expression of the ACP gene is enhanced) can be prepared by an ordinary method. For example, the transformants can be prepared by a method similar to the above-described method for enhancing the expression of the desaturase gene, such as a method for introducing a gene encoding the ACP into a host, a method, in the host having a gene encoding the ACP on a genome, for modifying expression regulation regions of the gene, or the like.
[0256] Further, in the algae belonging to the genus Nannochloropsis, the ACP is preferably localized in the chloroplast. For example, it is more preferred to enhance expression of a gene in which a nucleotide sequence encoding a chloroplast transport signal functioning in the cell of the algae belonging to the genus Nannochloropsis is added to a nucleotide sequence of the ACP gene derived from the algae belonging to the genus Nannochloropsis. Alternatively, it is more preferred to introduce a gene encoding the ACP derived from the algae belonging to the genus Nannochloropsis into a chloroplast genome to enhance the expression of the gene introduced.
[0257] Moreover, in the transformant of the present invention, expression of a TE is preferably enhanced, and expression of a gene encoding a TE (hereinafter, also merely referred to as TE gene) is more preferably enhanced.
[0258] As described above, TE is an enzyme that hydrolyzes the thioester bond of the acyl-ACP synthesized by a fatty acid synthase such as the KAS to produce a free fatty acid. The function of the TE terminates the fatty acid synthesis on the ACP, and then the thus-hydrolyzed fatty acid is supplied to the synthesis of PUFA or triacylglycerol or the like. Therefore, lipid productivity of the transformant to be used for the lipid production, particularly productivity of the fatty acids can be further improved by enhancing the expression of the TE, preferably by enhancing the expression of the TE gene.
[0259] The TE that can be used in the present invention needs to be the protein having acyl-ACP thioesterase activity (hereinafter, also referred to as TE activity). Herein, the term TE activity means an activity of hydrolyzing the thioester bond of the acyl-ACP.
[0260] To date, several TEs having different reaction specificities depending on the number of carbon atoms and the number of unsaturated bonds of the acyl group (fatty acid residue) constituting the acyl-ACP substrate are identified. Therefore, TE is considered to be an important factor in determining the fatty acid composition of an organism. In particular, when a host originally having no gene encoding a TE is used in the transformation, introduction of a gene encoding a TE, preferably a gene encoding a TE having substrate specificity to the long-chain acyl-ACP is effective. The productivity of PUFA is further improved by introducing such a gene.
[0261] The TE that can be used in the present invention can be appropriately selected from ordinary TEs and proteins functionally equivalent to the TEs, according to a kind of host or the like. Specific examples thereof include TE derived from Nannochloropsis gaditana (SEQ ID NO: 64); TE derived from Nannochloropsis oculata (SEQ ID NO: 65 or 67); and TE derived from Nannochloropsis granulate (SEQ ID NO: 66). Moreover, as the proteins functionally equivalent to them, a protein consisting of an amino acid sequence having 50% or more (preferably 70% or more, more preferably 80% or more, and further preferably 90% or more) identity with the amino acid sequence of any one of the TEs described above, and having TE activity, can be also used.
[0262] The transformants in which expression of the TE gene is enhanced can be prepared by an ordinary method. For example, the transformants can be prepared by a method similar to the above-mentioned method for enhancing expression of the each desaturase gene, such as a method of introducing the TE gene into a host, or a method, in a host having a TE gene on a genome, of modifying expression regulation regions of the gene.
[0263] In the transformant of the present invention, productivity of PUFA or lipids containing the same as components is improved in comparison with that in the host in which the expression of neither the 12-desaturase nor 6-desaturase is enhanced. Accordingly, if the transformant of the present invention is cultured under suitable conditions and then the PUFA or the lipids containing the same as components are collected from an obtained cultured product or an obtained growth product, the PUFA or the lipids containing the same as components can be efficiently produced. Herein, the term cultured product means liquid medium and a transformant subjected to cultivation, and the term growth product means a transformant subjected to growth.
[0264] The culture condition of the transformant of the present invention can be appropriately selected in accordance with the type of the host, and any ordinary used culture conditions for the host can be employed. Further, from a viewpoint of the production efficiency of fatty acids, for example, precursor substances involved in the fatty acid biosynthesis system, such as glycerol, acetic acid, or glucose, may be added to the medium.
[0265] A medium based on natural seawater or artificial seawater, or a commercially available culture medium may be used for the medium used in the present invention. Specific examples of the culture medium include f/2 medium, ESM medium, Daigo's IMK medium, L1 medium and MNK medium. Above all, from viewpoints of an improvement in the lipid productivity and a nutritional ingredient concentration, f/2 medium, ESM medium or Daigo's IMK medium is preferred, f/2 medium or Daigo's IMK medium is more preferred, and f/2 medium is further preferred. For growth promotion of the algae and an improvement in productivity of fatty acids, a nitrogen source, a phosphorus source, metal salts, vitamins, trace metals or the like can be appropriately added to the culture medium.
[0266] An amount of the transformant to be seeded to the culture medium is appropriately selected. In view of viability, the amount is preferably 1% (vol/vol) or more, per culture medium. The upper limit thereof is preferably 50% (vol/vol) or less, and more preferably 10% (vol/vol) or less. The range of an amount of the transformant to be seeded is preferably 1 to 50% (vol/vol), and more preferably 1 to 10% (vol/vol), per culture medium. Culture temperature is not particularly limited within the range in which the temperature does not adversely affect growth of the algae, and is ordinarily in the range of 5 to 40 C. From viewpoints of the growth promotion of the algae, the improvement in productivity of fatty acids, and reduction of production cost, the temperature is preferably 10 C. or more, and more preferably 15 C. or more. The upper limit thereof is preferably 35 C. or less, and more preferably 30 C. or less. The range of the culture temperature is preferably 10 to 35 C., and more preferably 15 to 30 C.
[0267] Moreover, the algae are preferably cultured under irradiation with light so that photosynthesis can be made. The light irradiation only needs to be made under conditions in which the photosynthesis can be made, and artificial light or sunlight may be applied. From viewpoints of the growth promotion of the algae and the improvement in the productivity of fatty acids, irradiance during the light irradiation is preferably 100 l or more, more preferably 300 l or more, and further preferably 1,000 l or more. The upper limit thereof is preferably 50,000 l or less, more preferably 10,000 l or less, and further preferably 6,000 l or less. The range of irradiance during the lite irradiation is preferably 100 to 50,000 l, more preferably 300 to 10,000 l, and further preferably 1,000 to 6,000 l. Moreover, an interval of the light irradiation is not particularly limited. From the viewpoints in a manner similar to the viewpoints described above, the irradiation is preferably performed under a light and dark cycle. In 24 hours, a light period is preferably 8 hours or more, and 10 hours or more. The upper limit thereof is preferably 24 hours or less, and 18 hours or less. The range of the light period is preferably from 8 to 24 hours, more preferably from 10 to 18 hours, and further preferably 12 hours.
[0268] Moreover, the algae are preferably cultured in the presence of a carbon dioxide-containing gas or in a culture medium containing carbonate such as sodium hydrogen carbonate so that the photosynthesis can be made. A concentration of carbon dioxide in the gas is not particularly limited. From viewpoints of the growth promotion and the improvement in the productivity of fatty acids, the concentration is preferably 0.03% (which is the same degree as the concentration under atmospheric conditions) or more, more preferably 0.05% or more, further preferably 0.1% or more, and furthermore preferably 0.3% or more. The upper limit thereof is preferably 10% or less, more preferably 5% or less, further preferably 3% or less, and furthermore preferably 1% or less. The range of the concentration of carbon dioxide is preferably from 0.03 to 10%, more preferably from 0.05 to 5%, further preferably from 0.1 to 3%, and furthermore preferably from 0.3 to 1%. A concentration of carbonate is not particularly limited. When sodium hydrogen carbonate is used, for example, from viewpoints of the growth promotion and the improvement in the productivity of fatty acids, the concentration is preferably 0.01% by mass or more, more preferably 0.05% by mass or more, and further preferably 0.1% by mass or more. The upper limit thereof is preferably 5% by mass or less, more preferably 2% by mass or less, and further preferably 1% by mass or less. The range of the concentration of sodium hydrogen carbonate is preferably from 0.01 to 5% by mass, more preferably from 0.05 to 2% by mass, and further preferably from 0.1 to 1% by mass.
[0269] A culture time is not particularly limited, and the culture may be performed for a long time (for example, about 150 days) so that an alga body in which the lipids are accumulated at a high concentration can grow at a high concentration. The culture time is preferably 3 days or more, and more preferably 7 days or more. The upper limit thereof is preferably 90 days or less, and more preferably 30 days or less. The range of the culture time is preferably from 3 to 90 days, more preferably from 3 to 30 days, and further preferably from 7 to 30 days. The culture may be performed in any of aerated and agitated culture, shaking culture or static culture. From a viewpoint of improving air-permeability, aerated and agitated culture is preferred.
[0270] A method of collecting the lipids from the cultured product or growth product is appropriately selected from an ordinary method. For example, lipid components can be isolated and collected from the above-described cultured product or growth product by means of filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, chloroform/methanol extraction, hexane extraction, ethanol extraction, or the like. In the case of carrying out the larger scales culturing, lipids can be obtained by collecting oil components from the cultured product or growth product through pressing or extraction, and then performing general purification processes such as degumming, deacidification, decoloration, dewaxing, and deodorization. After lipid components are isolated as such, the isolated lipids are hydrolyzed, and thereby fatty acids can be obtained. Specific examples of the method of isolating fatty acids from lipid components include a method of treating the lipid components at a high temperature of about 70 C. in an alkaline solution, a method of performing a lipase treatment, and a method of degrading the lipid components using high-pressure hot water.
[0271] The lipids produced in the production method of the present invention preferably contain fatty acids or fatty acid compounds, and more preferably contain fatty acids or fatty acid ester compounds, in view of usability thereof. The fatty acids ester compounds is preferably one kind selected from the group consisting of MAG, DAG and TAG, and more preferably TAG.
[0272] In view of usability for a surfactant or the like, and from a nutritional viewpoint, the fatty acid or the ester compound thereof contained in the lipid is preferably a PUFA having 18 or more carbon atoms or an ester compound thereof, more preferably a PUFA having 18 or 20 carbon atoms or an ester compound thereof, more preferably a PUFA having 20 carbon atoms or an ester compound thereof, more preferably a C20:3, a C20:4 or a C20:5, or an ester compound thereof, more preferably a dihomo--linolenic acid, an arachidonic acid, or an eicosapentaenoic acid or an ester thereof, more preferably an arachidonic acid or an eicosapentaenoic acid or an ester thereof, and further preferably an eicosapentaenoic acid or an ester thereof.
[0273] From a viewpoint of the productivity, the fatty acid ester compound is preferably a simple lipid or a complex lipid, more preferably a simple lipid, and further preferably a triacylglycerol.
[0274] The lipid obtained by the production method of the present invention can be utilized for food, as well as a plasticizer, an emulsifier incorporated into cosmetic products or the like, a cleansing agent such as a soap or a detergent, a fiber treatment agent, a hair conditioning agent, a disinfectant or an antiseptic.
[0275] The present invention also provides a kit for preparing the transformant of the algae belonging to the genus Nannochloropsis, the kit including a recombinant vector containing the 12-DES gene and a recombinant vector containing the 6-DES gene. The kit of the present invention can be used for preparing the transformant which is enhanced in the expression of the enzyme that catalyzes the reaction in the rate-limiting step in the synthetic pathway of PUFA, and is excellent in the productivity of PUFA or lipids containing the same as components. The kit of the present invention may also contain at least any one kind of recombinant vectors selected from the group consisting of the recombinant vectors containing the 3-DES gene, the recombinant vector containing the 5-DES gene, the recombinant vector containing the 9-DES gene, or the recombinant vector containing the 6-ELO gene, preferably two or more kinds of recombinant vectors selected from the group consisting of the recombinant vector containing the 3-DES gene, the recombinant vector containing the 5-DES gene, the recombinant vector containing the 9-DES gene.
[0276] In addition, the kit of the present invention may include, in addition to the above-described recombinant vector, a host, a reagent ordinarily used for transforming the host by the above-described vector, a buffer solution for transformation, and other elements necessary for detection in preparing the transformant, such as a reagent serving as an indicator for selecting the transformant.
[0277] With regard to the embodiments described above, the present invention also discloses methods of producing lipids, methods of modifying composition of fatty acids to be produced, transformants, methods of preparing transformants, and kits for preparing transformants, described below.
<1> A method of producing lipids, containing the steps of: [0278] culturing an alga belonging to the genus Nannochloropsis; and [0279] producing fatty acids or lipids containing the same as components;
wherein expressions of a 12-DES and a 6-DES, or expressions of a 12-DES gene and 6-DES gene are enhanced in the alga.
<2> A method of producing lipids, containing the steps of: [0280] enhancing expressions of a 12-DES and a 6-DES, or expressions of a 12-DES gene and a 6-DES gene in an alga belonging to the genus Nannochloropsis, and [0281] producing PUFA or lipids containing the same as components.
<3> A method of modifying the composition of fatty acids, containing the steps of: [0282] enhancing expressions of a 12-DES and a 6-DES, or expressions of a 12-DES gene and a 6-DES gene in an alga belonging to the genus Nannochloropsis, and [0283] increasing the proportion of PUFA in the whole fatty acids to be produced in a cell of the alga.
<4> A method of modifying the composition of fatty acids, containing the steps of: [0284] enhancing expressions of a 12-DES and a 6-DES, or expressions of a 12-DES gene and a 6-DES gene in an alga belonging to the genus Nannochloropsis, and [0285] increasing the proportion of PUFA residues in the whole fatty acid residues of fatty acid ester compounds, preferably at least any one kind selected from the group consisting of MAG, DAG and TAG, or more preferably TAG, to be produced in a cell of the alga.
<5> The method described in any one of the above items <1> to <4>, wherein the expressions of the 12-DES gene and the 6-DES gene are enhanced in a cell of the alga, to enhance the expressions of the 12-DES and the 6-DES.
<6> The method described in any one of the above items <1> to <5>, wherein the 12-DES gene and the 6-DES gene are introduced into the alga, to enhance the expressions of the 12-DES gene and the 6-DES gene introduced.
<7> The method described in any one of the above items <1> to <6>, wherein the 12-DES is any one of the following proteins (A) to (D), or preferably the following protein (A) or (B): [0286] (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; [0287] (B) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (A), and having 12-DES activity; [0288] (C) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 45; and [0289] (D) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (C), and having 12-DES activity.
<8> The method described in the above item <7>, wherein the protein (B) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 176 or less, more preferably 1 or more and 154 or less, further preferably 1 or more and 132 or less, furthermore preferably 1 or more and 110 or less, furthermore preferably 1 or more and 88 or less, furthermore preferably 1 or more and 66 or less, furthermore preferably 1 or more and 44 or less, furthermore preferably 1 or more and 36 or less, furthermore preferably 1 or more and 22 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 5 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (A).
<9> The method described in the above item <7>, wherein the protein (D) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 181 or less, more preferably 1 or more and 159 or less, further preferably 1 or more and 136 or less, furthermore preferably 1 or more and 113 or less, furthermore preferably 1 or more and 91 or less, furthermore preferably 1 or more and 68 or less, furthermore preferably 1 or more and 46 or less, furthermore preferably 1 or more and 37 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (C).
<10> The method described in any one of the above items <1> to <9>, wherein the gene encoding the 12-DES, or preferably encoding any one of the proteins (A) to (D) is a gene consisting of any one of the following DNAs (a) to (d), or preferably a gene consisting of the following DNA (a) or (b): [0290] (a) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2; [0291] (b) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (a), and encoding the protein having 12-DES activity; [0292] (c) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 46; and [0293] (d) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (c), and encoding the protein having 12-DES activity.
<11> The method described in the above item <10>, wherein the DNA (b) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 527 or less, more preferably 1 or more and 461 or less, further preferably 1 or more and 396 or less, furthermore preferably 1 or more and 330 or less, furthermore preferably 1 or more and 264 or less, furthermore preferably 1 or more and 198 or less, furthermore preferably 1 or more and 132 or less, furthermore preferably 1 or more and 106 or less, furthermore preferably 1 or more and 66 or less, furthermore preferably 1 or more and 27 or less, and furthermore preferably 1 or more and 14 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (a), and encoding the protein having 12-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (a) under a stringent condition, and encoding the protein having 12-DES activity.
<12> The method described in the above item <10>, wherein the DNA (d) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 544 or less, more preferably 1 or more and 476 or less, further preferably 1 or more and 408 or less, furthermore preferably 1 or more and 340 or less, furthermore preferably 1 or more and 272 or less, furthermore preferably 1 or more and 204 or less, furthermore preferably 1 or more and 136 or less, furthermore preferably 1 or more and 109 or less, furthermore preferably 1 or more and 68 or less, furthermore preferably 1 or more and 28 or less, and furthermore preferably 1 or more and 14 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (c), and encoding the protein having 12-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (c) under a stringent condition, and encoding the protein having 12-DES activity.
<13> The method described in any one of the above items <1> to <12>, wherein the 6-DES is any one of the following proteins (E) to (H), or preferably the following protein (E) or (F): [0294] (E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3; [0295] (F) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (E), and having 6-DES activity; [0296] (G) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 47; and [0297] (H) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (G), and having 6-DES activity.
<14> The method described in the above item <13>, wherein the protein (F) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 190 or less, more preferably 1 or more and 166 or less, further preferably 1 or more and 143 or less, furthermore preferably 1 or more and 119 or less, furthermore preferably 1 or more and 95 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 48 or less, furthermore preferably 1 or more and 38 or less, furthermore preferably 1 or more and 24 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (E).
<15> The method described in the above item <13>, wherein the protein (H) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 190 or less, more preferably 1 or more and 166 or less, further preferably 1 or more and 143 or less, furthermore preferably 1 or more and 119 or less, furthermore preferably 1 or more and 95 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 48 or less, furthermore preferably 1 or more and 38 or less, furthermore preferably 1 or more and 24 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (G).
<16> The method described in any one of the above items <1> to <15>, wherein the gene encoding the 6-DES, or preferably encoding any one of the proteins (E) to (H) is a gene consisting of any one of the following DNAs (e) to (h), or preferably a gene consisting of the following DNA (e) or (f): [0298] (e) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 4; [0299] (f) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (e), and encoding the protein having 6-DES activity; [0300] (g) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 48; and [0301] (h) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (g), and encoding the protein having 6-DES activity.
<17> The method described in the above item <16>, wherein the DNA (f) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 570 or less, more preferably 1 or more and 499 or less, further preferably 1 or more and 428 or less, furthermore preferably 1 or more and 357 or less, furthermore preferably 1 or more and 285 or less, furthermore preferably 1 or more and 214 or less, furthermore preferably 1 or more and 143 or less, furthermore preferably 1 or more and 114 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 29 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (e), and encoding the protein having 6-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (e) under a stringent condition, and encoding the protein having 6-DES activity.
<18> The method described in the above item <16>, wherein the DNA (h) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 572 or less, more preferably 1 or more and 500 or less, further preferably 1 or more and 429 or less, furthermore preferably 1 or more and 357 or less, furthermore preferably 1 or more and 286 or less, furthermore preferably 1 or more and 215 or less, furthermore preferably 1 or more and 143 or less, furthermore preferably 1 or more and 115 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 29 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (g), and encoding the protein having 6-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (g) under a stringent condition, and encoding the protein having 6-DES activity.
<19> The method described in any one of the above items <1> to <18>, wherein expression of an 3-DES or expression of an 3-DES gene is enhanced in the alga.
<20> The method described in the above item <19>, wherein the expression of the 3-DES gene is enhanced in a cell of the alga, to enhance the expression of the 3-DES.
<21> The method described in the above item <19> or <20>, wherein the 3-DES gene is introduced into the alga, to enhance the expression of the 3-DES gene introduced.
<22> The method described in any one of the above items <19> to <21>, wherein the 3-DES is any one of the following proteins (I) to (L), or preferably the following protein (I) or (J): [0302] (I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5; [0303] (J) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (I), and having 3-DES activity; [0304] (K) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 49; and [0305] (L) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (K), and having 3-DES activity.
<23> The method described in the above item <22>, wherein the protein (J) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 164 or less, more preferably 1 or more and 144 or less, further preferably 1 or more and 123 or less, furthermore preferably 1 or more and 103 or less, furthermore preferably 1 or more and 82 or less, furthermore preferably 1 or more and 62 or less, furthermore preferably 1 or more and 41 or less, furthermore preferably 1 or more and 33 or less, furthermore preferably 1 or more and 21 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 5 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (I).
<24> The method described in the above item <22>, wherein the protein (L) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 163 or less, more preferably 1 or more and 143 or less, further preferably 1 or more and 123 or less, furthermore preferably 1 or more and 102 or less, furthermore preferably 1 or more and 82 or less, furthermore preferably 1 or more and 62 or less, furthermore preferably 1 or more and 41 or less, furthermore preferably 1 or more and 33 or less, furthermore preferably 1 or more and 21 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 5 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (K).
<25> The method described in any one of the above items <19> to <24>, wherein the gene encoding the 3-DES, or preferably encoding any one of the proteins (I) to (L) is a gene consisting of any one of the following DNAs (i) to (l), or preferably a gene consisting of the following DNA (i) or (j): [0306] (i) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 6; [0307] (j) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (i), and encoding the protein having 3-DES activity; [0308] (k) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 50; and [0309] (l) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (k), and encoding the protein having 3-DES activity.
<26> The method described in the above item <25>, wherein the DNA (j) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 494 or less, more preferably 1 or more and 432 or less, further preferably 1 or more and 370 or less, furthermore preferably 1 or more and 309 or less, furthermore preferably 1 or more and 247 or less, furthermore preferably 1 or more and 185 or less, furthermore preferably 1 or more and 124 or less, furthermore preferably 1 or more and 99 or less, furthermore preferably 1 or more and 62 or less, furthermore preferably 1 or more and 25 or less, and furthermore preferably 1 or more and 13 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (i), and encoding the protein having 3-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (i) under a stringent condition, and encoding the protein having 3-DES activity.
<27> The method described in the above item <25>, wherein the DNA (l) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 490 or less, more preferably 1 or more and 429 or less, further preferably 1 or more and 368 or less, furthermore preferably 1 or more and 306 or less, furthermore preferably 1 or more and 245 or less, furthermore preferably 1 or more and 184 or less, furthermore preferably 1 or more and 123 or less, furthermore preferably 1 or more and 98 or less, furthermore preferably 1 or more and 62 or less, furthermore preferably 1 or more and 25 or less, and furthermore preferably 1 or more and 13 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (k), and encoding the protein having 3-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (k) under a stringent condition, and encoding the protein having 3-DES activity.
<28> The method described in any one of the above items <1> to <27>, wherein expression of a 5-DES or expression of a 5-DES gene is enhanced in the alga.
<29> The method described in the above item <28>, wherein the expression of the 5-DES gene is enhanced in a cell of the alga, to enhance the expression of the 5-DES.
<30> The method described in the above item <28> or <29>, wherein the 5-DES gene is introduced into the alga, to enhance the expression of the 5-DES gene introduced.
<31> The method described in any one of the above items <28> to <30>, wherein the 5-DES is any one of the following proteins (M) to (P), or preferably the following protein (M) or (N): [0310] (M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7; [0311] (N) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (M), and having 5-DES activity; [0312] (O) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 51; and [0313] (P) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (O), and having 5-DES activity.
<32> The method described in the above item <31>, wherein the protein (N) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 211 or less, more preferably 1 or more and 185 or less, further preferably 1 or more and 158 or less, furthermore preferably 1 or more and 132 or less, furthermore preferably 1 or more and 106 or less, furthermore preferably 1 or more and 79 or less, furthermore preferably 1 or more and 53 or less, furthermore preferably 1 or more and 43 or less, furthermore preferably 1 or more and 27 or less, furthermore preferably 1 or more and 11 or less, and furthermore preferably 1 or more and 6 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (M).
<33> The method described in the above item <31>, wherein the protein (P) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 206 or less, more preferably 1 or more and 181 or less, further preferably 1 or more and 155 or less, furthermore preferably 1 or more and 129 or less, furthermore preferably 1 or more and 103 or less, furthermore preferably 1 or more and 78 or less, furthermore preferably 1 or more and 52 or less, furthermore preferably 1 or more and 42 or less, furthermore preferably 1 or more and 26 or less, furthermore preferably 1 or more and 11 or less, and furthermore preferably 1 or more and 6 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (O).
<34> The method described in any one of the above items <28> to <33>, wherein the gene encoding the 5-DES, or preferably encoding any one of the proteins (M) to (P) is a gene consisting of any one of the following DNAs (m) to (p), or preferably a gene consisting of the following DNA (m) or (n): [0314] (m) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 8; [0315] (n) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (m), and encoding the protein having 5-DES activity; [0316] (o) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 52; and [0317] (p) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (o), and encoding the protein having 5-DES activity.
<35> The method described in the above item <34>, wherein the DNA (n) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 633 or less, more preferably 1 or more and 554 or less, further preferably 1 or more and 475 or less, furthermore preferably 1 or more and 396 or less, furthermore preferably 1 or more and 317 or less, furthermore preferably 1 or more and 238 or less, furthermore preferably 1 or more and 159 or less, furthermore preferably 1 or more and 127 or less, furthermore preferably 1 or more and 80 or less, furthermore preferably 1 or more and 32 or less, and furthermore preferably 1 or more and 16 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (m), and encoding the protein having 5-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (m) under a stringent condition, and encoding the protein having 5-DES activity.
<36> The method described in the above item <34>, wherein the DNA (p) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 620 or less, more preferably 1 or more and 542 or less, further preferably 1 or more and 465 or less, furthermore preferably 1 or more and 387 or less, furthermore preferably 1 or more and 310 or less, furthermore preferably 1 or more and 233 or less, furthermore preferably 1 or more and 155 or less, furthermore preferably 1 or more and 124 or less, furthermore preferably 1 or more and 78 or less, furthermore preferably 1 or more and 31 or less, and furthermore preferably 1 or more and 16 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (o), and encoding the protein having 5-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (o) under a stringent condition, and encoding the protein having 5-DES activity.
<37> The method described in any one of the above items <1> to <36>, wherein expression of a 9-DES or expression of a 9-DES gene is enhanced in the alga.
<38> The method described in the above item <37>, wherein the expression of the 9-DES gene is enhanced in a cell of the alga, to enhance the expression of the 9-DES.
<39> The method described in the above item <37> or <38>, wherein the 9-DES gene is introduced into the alga, to enhance the expression of the 9-DES gene introduced.
<40> The method described in any one of the above items <37> to <39>, wherein the 9-DES is any one of the following proteins (Q) to (T), or preferably the following protein (Q) or (R): [0318] (Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9; [0319] (R) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (Q), and having 9-DES activity; [0320] (S) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 53; and [0321] (T) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (S), and having 9-DES activity.
<41> The method described in the above item <40>, wherein the protein (R) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 144 or less, more preferably 1 or more and 126 or less, further preferably 1 or more and 108 or less, furthermore preferably 1 or more and 90 or less, furthermore preferably 1 or more and 72 or less, furthermore preferably 1 or more and 54 or less, furthermore preferably 1 or more and 36 or less, furthermore preferably 1 or more and 29 or less, furthermore preferably 1 or more and 18 or less, furthermore preferably 1 or more and 8 or less, and furthermore preferably 1 or more and 4 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (Q).
<42> The method described in the above item <40>, wherein the protein (T) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 136 or less, more preferably 1 or more and 119 or less, further preferably 1 or more and 102 or less, furthermore preferably 1 or more and 85 or less, furthermore preferably 1 or more and 68 or less, furthermore preferably 1 or more and 51 or less, furthermore preferably 1 or more and 34 or less, furthermore preferably 1 or more and 28 or less, furthermore preferably 1 or more and 17 or less, furthermore preferably 1 or more and 7 or less, and furthermore preferably 1 or more and 4 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (S).
<43> The method described in any one of the above items <37> to <42>, wherein the gene encoding the 9-DES, or preferably encoding any one of the proteins (Q) to (T) is a gene consisting of any one of the following DNAs (q) to (t), or preferably a gene consisting of the following DNA (q) or (r): [0322] (q) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 10; [0323] (r) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (q), and encoding the protein having 9-DES activity; [0324] (s) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 54; and [0325] (t) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (s), and encoding the protein having 9-DES activity.
<44> The method described in the above item <43>, wherein the DNA (r) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 432 or less, more preferably 1 or more and 378 or less, further preferably 1 or more and 324 or less, furthermore preferably 1 or more and 270 or less, furthermore preferably 1 or more and 216 or less, furthermore preferably 1 or more and 162 or less, furthermore preferably 1 or more and 108 or less, furthermore preferably 1 or more and 87 or less, furthermore preferably 1 or more and 54 or less, furthermore preferably 1 or more and 22 or less, and furthermore preferably 1 or more and 11 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (q), and encoding the protein having 9-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (q) under a stringent condition, and encoding the protein having 9-DES activity.
<45> The method described in the above item <43>, wherein the DNA (t) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 410 or less, more preferably 1 or more and 359 or less, further preferably 1 or more and 307 or less, furthermore preferably 1 or more and 256 or less, furthermore preferably 1 or more and 205 or less, furthermore preferably 1 or more and 154 or less, furthermore preferably 1 or more and 103 or less, furthermore preferably 1 or more and 82 or less, furthermore preferably 1 or more and 52 or less, furthermore preferably 1 or more and 21 or less, and furthermore preferably 1 or more and 11 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (s), and encoding the protein having 9-DES activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (s) under a stringent condition, and encoding the protein having 9-DES activity.
<46> The method described in any one of the above items <1> to <45>, wherein expression of a 6-ELO or expression of a 6-ELO gene is enhanced in the alga.
<47> The method described in the above item <46>, wherein the expression of the 6-ELO gene is enhanced in a cell of the alga, to enhance the expression of the 6-ELO.
<48> The method described in the above item <46> or <47>, wherein the 6-ELO gene is introduced into the alga, to enhance the expression of the 6-ELO gene introduced.
<49> The method described in any one of the above items <46> to <48>, wherein the 6-ELO is the following protein (U) or (V): [0326] (U) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 74; and [0327] (V) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (U), and having 6-ELO activity.
<50> The method described in the above item <49>, wherein the protein (V) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 111 or less, more preferably 1 or more and 97 or less, further preferably 1 or more and 83 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 56 or less, furthermore preferably 1 or more and 42 or less, furthermore preferably 1 or more and 28 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 14 or less, furthermore preferably 1 or more and 6 or less, and furthermore preferably 1 or more and 3 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (U).
<51> The method described in any one of the above items <46> to <50>, wherein the gene encoding the 6-ELO, or preferably any one of the proteins (U) and (V) is a gene consisting of any one of the following DNAs (u) and (v): [0328] (u) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 73; [0329] (v) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (u), and encoding the protein having 6-ELO activity.
<52> The method described in the above item <51>, wherein the DNA (v) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 333 or less, more preferably 1 or more and 291 or less, further preferably 1 or more and 250 or less, furthermore preferably 1 or more and 208 or less, furthermore preferably 1 or more and 167 or less, furthermore preferably 1 or more and 125 or less, furthermore preferably 1 or more and 84 or less, furthermore preferably 1 or more and 67 or less, furthermore preferably 1 or more and 42 or less, furthermore preferably 1 or more and 17 or less, and furthermore preferably 1 or more and 9 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (u), and encoding the protein having 6-ELO activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (u) under a stringent condition, and encoding the protein having 6-ELO activity.
<53> The method described in any one of the above items <1> to <52>, wherein, in the alga, expression of at least any one kind of enzymes selected from the group consisting of an 3-DES, a 5-DES, a 9-DES and a 6-ELO, preferably any two or more kinds of enzymes selected from the group consisting of an 3-DES, a 5-DES, a 9-DES and a 6-ELO, or genes encoding the same is enhanced.
<54> The method described in any one of the above items <1> to <53>, wherein, in the alga, at least any one of the proteins selected from the group consisting of a KAS II, an ACP and a TE, preferably a gene encoding at least any one of the proteins selected from the group consisting of a KAS II, an ACP and a TE is enhanced.
<55> The method described in the above item <54>, wherein the gene encoding at least any one of the proteins selected from the group consisting of the KAS II, the ACP and the TE is introduced into the alga, to enhance the expression of the gene introduced.
<56> The method described in the above item <54> or <55>, wherein the KAS II is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 60, or a protein consisting of an amino acid sequence having 50% or more, preferably 70% or more, more preferably 80% or more, or more preferably 90% or more identity with the amino acid sequence set forth in SEQ ID NO: 60, and having KAS activity.
<57> The method described in any one of the above items <54> to <56>, wherein the gene encoding the KAS II is a gene consisting of a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 61, or a gene consisting of a nucleotide sequence having 50% or more, preferably 70% or more, more preferably 80% or more, or more preferably 90% or more identity with the nucleotide sequence set forth in SEQ ID NO: 61, and encoding a protein having KAS activity.
<58> The method described in the above item <54> or <55>, wherein the ACP is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 62, or a protein consisting of an amino acid sequence having 50% or more, preferably 70% or more, more preferably 80% or more, or more preferably 90% or more identity with the amino acid sequence set forth in SEQ ID NO: 62, and having ACP activity.
<59> The method described in any one of the above items <54>, <55> and <58>, wherein the gene encoding the ACP is a gene consisting of a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 63, or a gene consisting of a nucleotide sequence having 50% or more, preferably 70% or more, more preferably 80% or more, or more preferably 90% or more identity with the nucleotide sequence set forth in SEQ ID NO: 63, and encoding a protein having ACP activity.
<60> The method described in any one of the above items <54>, <55>, <58> and <59>, wherein the gene encoding the ACP is a gene to which a nucleotide sequence encoding a chloroplast transit signal sequence functioning in the cell of the algae is added.
<61> The method described in any one of the above items <54>, <55>, <58> and <59>, wherein the gene encoding the ACP is introduced into a chloroplast genome to enhance the expression of the gene introduced.
<62> The method described in the above item <54> or <55>, wherein the TE is a protein consisting of any one of the amino acid sequences set forth in SEQ ID NO: 64 to 67, of a protein functionally equivalent thereto.
<63> The method described in any one of the above items <54>, <55> and <62>, wherein the TE is a protein consisting of any one of the amino acid sequences set forth in SEQ ID NO: 64 to 67, or a protein consisting of an amino acid sequence having 50% or more, preferably 70% or more, more preferably 80% or more, or more preferably 90% or more identity with any one of the amino acid sequences set forth in SEQ ID NO: 64 to 67, and having TE activity.
<64> The method described in any one of the above items <1> to <63>, wherein the alga is Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina, Nannochloropsis oceanica, Nannochloropsis atomus, Nannochloropsis maculata, Nannochloropsis granulata, or Nannochloropsis sp., preferably Nannochloropsis oculata or Nannochloropsis gaditana, or more preferably Nannochloropsis oculata.
<65> The method described in any one of the above items <1> to <64>, wherein the fatty acids or lipids contain a PUFA having 18 or more carbon atoms or an ester compound thereof, preferably a PUFA having 18 or 20 carbon atoms or an ester compound thereof, more preferably a PUFA having 20 carbon atoms or an ester compound thereof, more preferably a C20:3, a C20:4 or a C20:5, or an ester compound thereof, more preferably a dihomo--linolenic acid, an arachidonic acid, or an eicosapentaenoic acid or an ester thereof, more preferably an arachidonic acid or an eicosapentaenoic acid or an ester thereof, or further preferably an eicosapentaenoic acid or an ester thereof.
<66> The method described in any one of the above items <1> to <65>, wherein the alga is cultured by using f/2 media.
<67> A transformant of an alga belonging to the genus Nannochloropsis, wherein expressions of a 12-DES and a 6-DES, or expressions of a 12-DES gene and a 6-DES gene are enhanced in a host cell.
<68> The transformant described in the above item <67>, wherein the expressions of the 12-DES gene and the 6-DES gene are enhanced in a cell of the alga, and the expressions of the 12-DES and the 6-DES are enhanced.
<69> The transformant described in the above item <68>, containing the 12-DES gene and the 6-DES gene, or a recombinant vector containing the 12-DES gene and a recombinant vector containing the 6-DES gene.
<70> A method of preparing a transformant, containing the step of introducing a 12-DES gene and a 6-DES gene, or a recombinant vector containing a 12-DES gene and a recombinant vector containing a 6-DES gene into an alga belonging to the genus Nannochloropsis.
<71> A kit for preparing a transformant of alga belonging to the genus Nannochloropsis, containing a recombinant vector containing a 12-DES gene and a recombinant vector containing a 6-DES gene.
<72> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <67> to <71>, wherein the 12-DES is any one of the proteins (A) to (D), or preferably the protein (A) or (B).
<73> The transformant, the method of preparing the same, or the kit for preparing the transformant described in the above item <72>, wherein the protein (B) or (D) is a protein specified in any one of the above items <7> to <9>.
<74> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <67> to <73>, wherein a gene encoding the 12-DES, or preferably encoding any one of the proteins (A) to (D) is a gene specified in any one of the above items <10> to <12>.
<75> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <67> to <74>, wherein the 6-DES is any one of the proteins (E) to (H), or preferably the protein (E) or (F).
<76> The transformant, the method of preparing the same, or the kit for preparing the transformant described in the above item <75>, wherein the protein (F) or (H) is a protein specified in any one of the above items <13> to <15>.
<77> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <67> to <76>, wherein a gene encoding the 6-DES, or preferably encoding any one of the proteins (E) to (H) is a gene specified in any one of the above items <16> to <18>.
<78> The transformant described in any one of the above items <67> to <69> and <72> to <77>, wherein expression of an 3-DES or expression of an 3-DES gene is enhanced in the transformant.
<79> The transformant described in the above item <78>, wherein the expression of the 3-DES gene is enhanced in a cell of the alga, and the expression of the 3-DES is enhanced.
<80> The transformant described in the above item <79>, containing the 3-DES gene, or a recombinant vector containing the 3-DES gene.
<81> The method of preparing a transformant described in any one of the above items <70> and <72> to <77>, wherein an 3-DES gene, or a recombinant vector containing an 3-DES gene is introduced into the alga.
<82> The kit for preparing a transformant described in any one of the above items <71> to <77>, containing a recombinant vector containing an 3-DES gene.
<83> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <78> to <82>, wherein the 3-DES is any one of the proteins (I) to (L), or preferably the protein (I) or (J).
<84> The transformant, the method of preparing the same, or the kit for preparing the transformant described in the above item <83>, wherein the protein (J) or (L) is a protein specified in any one of the above items <22> to <24>.
<85> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <78> to <84>, wherein a gene encoding the 3-DES, or preferably encoding any one of the proteins (I) to (L) is a gene specified in any one of the above items <25> to <27>.
<86> The transformant described in any one of the above items <67> to <69>, <72> to <80> and <83> to <85>, wherein expression of a 5-DES or expression of a 5-DES gene is enhanced in the transformant.
<87> The transformant described in the above item <86>, wherein the expression of the 5-DES gene is enhanced in a cell of the alga, and the expression of the 5-DES is enhanced.
<88> The transformant described in the above item <87>, containing the 5-DES gene, or a recombinant vector containing the 5-DES gene.
<89> The method of preparing a transformant described in any one of the above items <70>, <72> to <77>, <81> and <83> to <85>, wherein a 5-DES gene, or a recombinant vector containing a 5-DES gene is introduced into the alga.
<90> The kit for preparing a transformant described in any one of the above items <71> to <77> and <82> to <85>, containing a recombinant vector containing a 5-DES gene.
<91> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <86> to <90>, wherein the 5-DES is any one of the proteins (M) to (P), or preferably the protein (M) or (N).
<92> The transformant, the method of preparing the same, or the kit for preparing the transformant described in the above item <91>, wherein the protein (N) or (P) is a protein specified in any one of the above items <31> to <33>.
<93> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <86> to <92>, wherein a gene encoding the 5-DES, or preferably encoding any one of the proteins (M) to (P) is a gene specified in any one of the above items <34> to <36>.
<94> The transformant described in any one of the above items <67> to <69>, <72> to <80>, <83> to <88> and <91> to <93>, wherein expression of a 9-DES or expression of a 9-DES gene is enhanced in the transformant.
<95> The transformant described in the above item <94>, wherein the expression of the 9-DES gene is enhanced in a cell of the alga, and the expression of the 9-DES is enhanced.
<96> The transformant described in the above item <95>, containing the 9-DES gene, or a recombinant vector containing the 9-DES gene.
<97> The method of preparing a transformant described in any one of the above items <70>, <72> to <77>, <81>, <83> to <85>, <89> and <91> to <93>, wherein a 9-DES gene, or a recombinant vector containing a 9-DES gene is introduced into the alga.
<98> The kit for preparing a transformant described in any one of the above items <71> to <77>, <82> to <85> and <90> to <93>, containing a recombinant vector containing a 9-DES gene.
<99> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <94> to <98>, wherein the 9-DES is any one of the proteins (Q) to (T), or preferably the protein (Q) or (R).
<100> The transformant, the method of preparing the same, or the kit for preparing the transformant described in the above item <99>, wherein the protein (R) or (T) is a protein specified in any one of the above items <40> to <42>.
<101> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <94> to <100>, wherein a gene encoding the 9-DES, or preferably encoding any one of the proteins (Q) to (T) is a gene specified in any one of the above items <43> to <45>.
<102> The transformant described in any one of the above items <67> to <69>, <72> to <80>, <83> to <88>, <91> to <96> and <99> to <101>, wherein expression of a 6-ELO or expression of a 6-ELO gene is enhanced in the transformant.
<103> The transformant described in the above item <102>, wherein the expression of the 6-ELO gene is enhanced in a cell of the alga, and the expression of the 6-ELO is enhanced.
<104> The transformant described in the above item <103>, containing the 6-ELO gene, or a recombinant vector containing the 6-ELO gene.
<105> The method of preparing a transformant described in any one of the above items <70>, <72> to <77>, <81>, <83> to <85>, <89>, <91> to <93>, <97> and <99> to <101>, wherein a 6-ELO gene, or a recombinant vector containing a 6-ELO gene is introduced into the alga.
<106> The kit for preparing a transformant described in any one of the above items <71> to <77>, <82> to <85>, <90> to <93> and <98> to <101>, containing a recombinant vector containing a 6-ELO gene.
<107> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <102> to <106>, wherein the 6-ELO is any one of the proteins (U) and (V).
<108> The transformant, the method of preparing the same, or the kit for preparing the transformant described in the above item <107>, wherein the protein (V) is a protein specified in the above item <49> or <50>.
<109> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <102> to <108>, wherein a gene encoding the 6-ELO, or preferably encoding any one of the proteins (U) and (V) is a gene specified in the above item <51> or <52>.
<110> The transformant described in any one of the above items <67> to <69>, <72> to <80>, <83> to <88>, <91> to <96>, <99> to <104> and <107> to <109>, wherein expression of at least any one kind of enzymes selected from the group consisting of an 3-DES, a 5-DES, a 9-DES and a 6-ELO, or preferably any two or more kinds of enzymes selected from the group consisting of an 3-DES, a 5-DES, a 9-DES and a 6-ELO, or genes encoding the same is enhanced.
<111> The method of preparing a transformant described in any one of the above items <70>, <72> to <77>, <81>, <83> to <85>, <89>, <91> to <93>, <97>, <99> to <101>, <105> and <107> to <109>, wherein at least any one kind of the genes selected from the group consisting of an 3-DES gene, a 5-DES gene, a 9-DES gene and a 6-ELO gene, or preferably any two or more kinds of genes selected from the group consisting of an 3-DES gene, a 5-DES gene, a 9-DES gene and a 6-ELO gene or a recombinant vector containing the gene is introduced.
<112> The kit for preparing a transformant described in any one of the above items <71> to <77>, <82> to <85>, <90> to <93>, <98> to <101> and <106> to <109>, containing at least any one kind of recombinant vectors selected from the group consisting of a recombinant vector containing an 3-DES gene, a recombinant vector containing a 5-DES gene, a recombinant vector containing a 9-DES gene and a recombinant vector containing a 6-ELO gene, or preferably any two or more kinds of recombinant vectors selected from the group consisting of a recombinant vector containing an 3-DES gene, a recombinant vector containing a 5-DES gene, a recombinant vector containing a 9-DES gene and a recombinant vector containing a 6-ELO gene.
<113> The transformant or the method of preparing the same described in any one of the above items <67> to <70>, <72> to <81>, <83> to <89>, <91> to <97>, <99> to <105> and <107> to <112>, wherein expression of at least any one of the proteins selected from the group consisting of a KAS II, an ACP and a TE, or preferably expression of a gene encoding at least any one selected from the group consisting of a KAS II, an ACP and a TE is enhanced in the transformant.
<114> The transformant or the method of preparing the same described in the above item <113>, wherein the gene is introduced into the alga, and the expression of the gene introduced is enhanced in a cell of the alga.
<115> The kit for preparing a transformant described in any one of the above items <71> to <77>, <82> to <85>, <90> to <93>, <98> to <101>, <106> to <109> and <112>, containing at least any one of the recombinant vectors selected from the group consisting of a recombinant vector containing a gene encoding a KAS II, a recombinant vector containing a gene encoding an ACP and a recombinant vector containing a gene encoding a TE.
<116> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <115>, wherein the KAS II is a protein specified in the above item <56>.
<117> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <116>, wherein a gene encoding the KAS II is a gene specified in the above item <57>.
<118> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <117>, wherein the ACP is a protein specified in the above item <58>.
<119> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <118>, wherein a gene encoding the ACP is a gene specified in the above item <59>.
<120> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <119>, wherein a gene encoding the ACP is a gene to which a nucleotide sequence encoding a chloroplast transit signal functioning in the cell of the algae is added.
<121> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <119>, wherein a gene encoding the ACP is introduced into a chloroplast genome to enhance the expression of the introduced gene.
<122> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <113> to <121>, wherein the TE is a protein specified in the above item <62> or <63>.
<123> The transformant, the method of preparing the same, or the kit for preparing the transformant described in any one of the above items <67> to <122>, wherein the alga is Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina, Nannochloropsis oceanica, Nannochloropsis atomus, Nannochloropsis maculata, Nannochloropsis granulata, or Nannochloropsis sp., preferably Nannochloropsis oculata or Nannochloropsis gaditana, or more preferably Nannochloropsis oculata.
<124> Use of the transformant, the transformant prepared by the method of producing the same, or the kit for preparing the transformant described in any one of the above items <67> to <123>, for producing lipids.
<125> The use described in the above item <124>, wherein the lipids contain a PUFA having 18 or more carbon atoms or an ester compound thereof, preferably a PUFA 18 or 20 carbon atoms or an ester compound thereof, more preferably a PUFA having 20 carbon atoms or an ester compound thereof, further preferably a C20:3, a C20:4 or a C20:5 or an ester compound thereof, furthermore preferably a dihomo--linolenic acid, an arachidonic acid, or an eicosapentaenoic acid or an ester compound thereof, furthermore preferably an arachidonic acid, an eicosapentaenoic acid or an ester compound thereof, or an eicosapentaenoic acid or an ester compound thereof.
<126> The method described in the above item <65> or the use described in the above item <125>, wherein the fatty acid ester compound is at least any one kind selected from the group consisting of MAG, DAG and TAG, or preferably TAG.
EXAMPLES
[0330] Hereinafter, the present invention will be described more in detail with reference to Examples, but the present invention is not limited thereto. Herein, the nucleotide sequences of the primers used in Examples are shown in Tables 1 and 2.
TABLE-US-00001 TABLE1 PrimerNo Sequence(5 .fwdarw. 3) SEQIDNO 13 CTTTTTTGTGAAGCAATGGCCAAGTTGACCAGTGCCG SEQIDNO:13 14 TTTCCCCCATCCCGATTAGTCCTGCTCCTCGGCCAC SEQIDNO:14 15 CGAGCTCGGTACCCGACTGCGCATGGATTGACCGA SEQIDNO:15 16 TGCTTCACAAAAAAGACAGCTTCTTGAT SEQIDNO:16 17 TCGGGATGGGGGAAAAAAACCTCTG SEQIDNO:17 18 ACTCTAGAGGATCCCCTTTCGTAAATAAATCAGCTC SEQIDNO:18 20 GGGATCCTCTAGAGTCGACC SEQIDNO:20 21 CGGGTACCGAGCTCGAATTC SEQIDNO:21 22 CAGCCCGCATCAACAATGGTCTTCCAGCTCGCCCG SEQIDNO:22 23 CTCTTCCACAGAAGCTTAGTTGTACTTGGGGTGATTGC SEQIDNO:23 24 CAGCCCGCATCAACAATGGGACGCGGCGGTGAGAA SEQIDNO:24 25 CTCTTCCACAGAAGCCTATGCCCGCTGCTTGTAGA SEQIDNO:25 26 CAGCCCGCATCAACAATGGGACGCGGTGGCGAGCG SEQIDNO:26 27 CTCTTCCACAGAAGCTTACATGGCGGGGAAATCGG SEQIDNO:27 28 CAGCCCGCATCAACAATGCCTCCCCAGAACGACGC SEQIDNO:28 29 CTCTTCCACAGAAGCCTAACCCATGTGCACCTCCG SEQIDNO:29 30 CAGCCCGCATCAACAATGGTTGAGCAAACGTTACC SEQIDNO:30 31 CTCTTCCACAGAAGCTTACGGAGGGGAGGATGAAC SEQIDNO:31 32 CGAGCTCGGTACCCGTTCTTCCGCTTGTTGCTGCC SEQIDNO:32 33 TGTTGATGCGGGCTGAGATTGGTGG SEQIDNO:33 34 GCTTCTGTGGAAGAGCCAGTG SEQIDNO:34 35 GGCAAGAAAAGCTGGGGGAAAAGACAGG SEQIDNO:35 38 CCAGCTTTTCTTGCCACTGCGCATGGATTGACCGA SEQIDNO:38
TABLE-US-00002 TABLE2 PrimerNo Sequence(5 .fwdarw. 3) SEQIDNO 40 CTTTTTTGTGAAGCAATGGTCGAGATTCGAAGCAT SEQIDNO:40 41 TTTCCCCCATCCCGATCAGAAGAACTCGTCCAACA SEQIDNO:41 43 CTTTTTTGTGAAGCAATGACACAAGAATCCCTGTTAC SEQIDNO:43 44 TTTCCCCCATCCCGATCAGGCGCCGGGGGCGGTGTC SEQIDNO:44 69 CTTTTTTGTGAAGCAATGAGCCCAGAACGACGCCC SEQIDNO:69 70 TTTCCCCCATCCCGATCAGATCTCGGTGACGGGCAGG SEQIDNO:70 71 CAGCCCGCATCAACAATGGCCGCCGCCCTTCTTGCAG SEQIDNO:71 72 CTCTTCCACAGAAGCTTAAGCCTTCTTGGAAACCGG SEQIDNO:72
Example 1 Preparation of a Plasmid for Expression of Desaturase Gene Derived from Nannochloropsis oculata, Transformation of Nannochloropsis oculata, and Production of Lipids by the Transformant
(1) Construction of Plasmid for Zeocin Resistance Gene Expression
[0331] A zeocin resistance gene (SEQ ID NO: 11), and a tubulin promoter sequence (SEQ ID NO: 12) derived from Nannochloropsis gaditana strain CCMP 526 described in a literature (Nature Communications, DOI:10.1038/ncomms1688, 2012) were artificially synthesized. Using the thus-synthesized DNA fragments as a template, and a pair of the primer Nos. 13 and 14 shown in Table 1, and a pair of the primer Nos. 15 and 16 shown in Table 1, PCR were carried out, to amplify the zeocin resistance gene and the tubulin promoter sequence, respectively.
[0332] Further, using a genome of Nannochloropsis oculata strain NIES-2145 as a template, and a pair of the primer Nos. 17 and 18 shown in Table 1, PCR was carried out to amplify the heat shock protein terminator sequence (SEQ ID NO: 19).
[0333] Furthermore, using a plasmid vector pUC19 (manufactured by Takara Bio) as a template, and a pair of the primer Nos. 20 and 21 shown in Table 1, PCR was carried out to amplify the plasmid vector pUC19.
[0334] These four amplified fragments were treated by restriction enzyme DpnI (manufactured by TOYOBO) respectively, and were purified using a High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Then, obtained four fragments were fused using an In-Fusion HD Cloning Kit (manufactured by Clontech) to construct a plasmid for zeocin resistance gene expression.
[0335] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the tubulin promoter sequence, the zeocin resistance gene and the heat shock protein terminator sequence were linked in this order.
(2) Obtaining Desaturase Gene, and Construction of Plasmid for Desaturase Gene Expression
[0336] Total RNA of Nannochloropsis oculata strain NIES-2145 was extracted. The cDNA was obtained by reverse transcription using the total RNA, and SuperScript (trademark) III First-Strand Synthesis SuperMix for qRT-PCR (manufactured by invitrogen).
[0337] Using the above cDNA as a template, and a pair of the primer Nos. 22 and 23 shown in Table 1, PCR was carried out to obtain a gene (No9-DES gene) fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 10.
[0338] In a similar manner, using the above cDNA as a template, and a pair of the primer Nos. 24 and 25 shown in Table 1, PCR was carried out to obtain a gene (No12-DES gene) fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 2.
[0339] In a similar manner, using the above cDNA as a template, and a pair of the primer Nos. 26 and 27 shown in Table 1, PCR was carried out to obtain a gene (No6-DES gene) fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 4.
[0340] In a similar manner, using the above cDNA as a template, and a pair of the primer Nos. 28 and 29 shown in Table 1, PCR was carried out to obtain a gene (No5-DES gene) fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 8.
[0341] Further, using the above cDNA as a template, and a pair of the primer Nos. 30 and 31 shown in Table 1, PCR was carried out to obtain a gene (No3-DES gene) fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 6.
[0342] Further, using a genome of Nannochloropsis oculata strain NIES-2145 as a template, and a pair of the primer Nos. 32 and 33, and a pair of the primer Nos. 34 and 35 shown in Table 1, PCR were carried out to obtain the LDSP promoter fragment (SEQ ID NO: 36), and the VCP1 terminator fragment (SEQ ID NO: 37).
[0343] Furthermore, using the plasmid for zeocin resistance gene expression as a template, and a pair of the primer Nos. 38 and 21 shown in Table 1, PCR was carried out to amplify a fragment containing the cassette for zeocin resistance gene expression (the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence) and the pUC19 sequence.
[0344] The fragments containing each desaturase gene fragment, LDSP promoter fragment, VCP1 terminator fragment, and zeocin resistance gene expression cassette, and pUC19 sequence were fused by a method in a manner similar to described above, to construct a plasmid for No9-DES gene expression, a plasmid for No12-DES gene expression, a plasmid for No6-DES gene expression, a plasmid for No5-DES gene expression, and a plasmid for No3-DES gene expression, respectively.
[0345] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, the each desaturase gene, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene and the heat shock protein terminator sequence were linked in this order.
(3) Introduction of a Cassette for Desaturase Gene Expression into Nannochloropsis oculata, and Culturing the Transformant
[0346] Using the above-described plasmid for the each desaturase gene expression prepared as a template respectively, and a pair of the primer Nos. 32 and 18 shown in Table 1, PCR were carried out to amplify the cassette for each desaturase gene expression (a DNA fragment containing the LDSP promoter sequence, the each desaturase gene, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence) respectively.
[0347] The amplified each DNA fragment was purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.
[0348] About 110.sup.9 cells of Nannochloropsis oculata strain NIES-2145 were washed with 384 mM sorbitol solution to completely remove a salt, and the resultant was used as a host cell for transformation. The cassette for each desaturase gene expression as amplified above was mixed by about 500 ng with the host cell respectively, and electroporation was carried out under the conditions of 50 F, 500 and 2,200 v/2 mm.
[0349] After twenty four hours recovery cultivation in f/2 liquid medium (75 mg of NaNO.sub.3, 6 mg of NaH.sub.2PO.sub.4.2H.sub.2O, 0.5 g of vitamin B12, 0.5 g of biotin, 100 g of thiamine, 10 mg of Na.sub.2SiO.sub.3.9H.sub.2O, 4.4 mg of Na.sub.2EDTA.2H.sub.2O, 3.16 mg of FeCl.sub.3.6H.sub.2O, 12 g of FeCl.sub.3.6H.sub.2O, 21 g of ZnSO.sub.4.7H.sub.2O, 180 g of MnCl.sub.2.4H.sub.2O, 7 g of CuSO.sub.4.5H.sub.2O, 7 g of Na.sub.2MoO.sub.4.2H.sub.2O/artificial sea water 1 L), the resultant was inoculated in f/2 agar medium containing 2 g/mL of zeocin, and cultured for two to three weeks under 12 h/12 h light-dark conditions at 25 C. under an atmosphere of 0.3% CO.sub.2. Each Nannochloropsis oculata strain containing the cassette for each desaturase gene expression (No9-DES transgenic strain ((delta9 DES) strain), No12-DES transgenic strain ((delta12 DES) strain), No6-DES transgenic strain ((delta6 DES) strain), No5-DES transgenic strain ((delta5 DES) strain), and No3-DES transgenic strain ((omega3 DES) strain)) was selected from the resultant colonies by a PCR method (obtaining three independent lines, respectively). The selected strain was inoculated to 20 mL of medium in which a nitrogen concentration in the f/2 medium was reinforced 15 times, and a phosphorus concentration therein was reinforced 5 times (hereinafter, referred to as N15P5 medium), and subjected to shaking culture for two weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 2 mL of the preculture fluid was inoculated to 18 mL of medium in which a nitrogen concentration in the f/2 medium was reinforced 5 times, and a phosphorus concentration therein was reinforced 5 times (hereinafter, referred to as N5P5 medium), and subjected to shaking culture for two weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2. In addition, as a negative control, an experiment was also conducted on the wild type strain, Nannochloropsis oculata strain NIES-2145 (WT strain).
(4) Extraction of Lipid from Culture Fluid and Analysis of Fatty Acids Contained Therein
[0350] To 1 mL of the culture fluid, 50 L of 1 mg/mL glyceryl triheptadecanoate (manufacture by Sigma-Aldrich) solution in chloroform as an internal standard was added, and then 0.5 mL of chloroform and 1 mL of methanol were further added. The mixture was vigorously stirred and then was left for 10 minutes. Further, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl were added thereto. The mixture was stirred and centrifuged for 5 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with Pasteur pipette.
[0351] A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid, 0.7 mL of 0.5 N potassium hydroxide solution in methanol was added thereto, and the resultant material was kept warm at 80 C. 30 minutes. Then, 1 mL of 14% boron trifluoride solution (manufactured by Sigma-Aldrich) was added thereto, and the mixture was kept warm at 80 C. for 10 minutes. Thereafter, 0.5 mL of hexane and 1 mL of saturated saline were added thereto, and the mixture was vigorously stirred and then was left for 10 minutes at room temperature. Then, the hexane layer being upper layer was collected to obtain fatty acid methyl esters.
[0352] Under the measuring conditions as follows, the obtained fatty acid methyl esters were provided for gas chromatographic analysis.
<Gas Chromatography Conditions>
[0353] Analysis apparatus: 7890A (manufactured by Agilent Technologies) [0354] Capillary column: DB-WAX (10 m100 m0.10 m, manufactured by J&W Scientific) [0355] Mobile phase: high purity helium [0356] Oven temperature: maintained for 0.5 minutes at 100 C..fwdarw.100 to 250 C. (temperature increase at 20 C./minute).fwdarw.maintained for 3 minutes at 250 C. (post run: 1 minute) [0357] Injection port temperature: 300 C. [0358] Injection method: split injection (split ratio: 50:1) [0359] Amount of injection: 5 L [0360] Cleaning vial: methanol [0361] Detection method: FID [0362] Detector temperature: 350 C.
[0363] The fatty acid methyl esters were identified by providing the identical sample for gas chromatography-mass spectrometry analysis under identical conditions described above.
[0364] Amounts of the fatty acid methyl esters of each of the fatty acids were quantitatively determined based on the peak areas of waveform data obtained by the above gas chromatographic analysis. The peak area corresponding to each of the fatty acid methyl esters was compared with that of fatty acid methyl esters having 17 carbon atoms derived from the internal standard, and carried out corrections between the samples, and then the amount of each of the fatty acids per liter of the culture fluid was calculated. Further, the amount of total fatty acids was calculated by summing the amounts of each of the fatty acids thus obtained, and weight proportion of each of the fatty acids in the amount of total fatty acids were calculated. Table 3 shows the results.
[0365] Herein, in Table below, TFA presents total fatty acid, and Fatty Acid Composition (% TFA) presents the proportion of a weight of each fatty acid relative to a weight of the total fatty acid. Further, n designates an integer of 3 to 5. C20:n (% TFA) presents a total of the proportion of weight of each of C20:3 fatty acids, C20:4 fatty acids and C20:5 fatty acids relative to the weight of the total fatty acids.
TABLE-US-00003 TABLE 3 Fatty acid composition (% TFA) TFA C16:1 C18:1 C18:2 C18:2 C18:3 (mg/L) C12:0 C14:0 C16:0 (9) C18:0 (9) (6, 9) (9, 12) (6, 9, 12) WT strain 1499.5 0.3 5.5 37.5 25.4 1.0 11.3 0.2 1.4 0.4 (comparative example) 1396.8 0.3 5.4 37.1 25.4 1.0 11.4 0.2 1.4 0.4 1293.7 0.3 5.4 36.8 25.4 1.0 11.3 0.2 1.3 0.4 (delta9 DES) strain 1345.9 0.3 5.2 31.1 29.2 0.6 21.4 0.2 1.0 0.2 (comparative example) 1665.9 0.3 5.4 30.9 28.7 0.6 20.4 0.2 1.0 0.2 1507.8 0.3 5.3 29.4 29.3 0.6 21.2 0.2 1.0 0.2 (delta12 DES) strain 1215.4 0.2 5.4 39.9 26.9 1.1 4.7 0.0 5.6 0.6 (comparative example) 1296.5 0.3 5.1 39.0 27.0 1.0 4.7 0.0 5.7 0.7 1358.3 0.2 5.1 39.8 27.2 1.1 4.7 0.0 5.3 0.6 (delta6 DES) strain 1427.7 0.2 5.2 38.4 26.8 1.2 10.9 1.8 0.2 0.4 (comparative example) 1430.0 0.2 4.9 38.0 26.7 1.1 10.8 1.9 0.2 0.5 1369.6 0.3 4.9 38.8 27.5 1.1 11.0 2.0 0.2 0.4 (delta5 DES) strain 1381.0 0.6 5.2 37.9 27.6 1.2 11.1 0.1 1.2 0.3 (comparative example) 1382.1 0.3 5.3 37.2 28.0 1.0 11.4 0.2 1.2 0.3 1402.3 0.3 5.3 36.9 28.4 1.0 11.5 0.2 1.1 0.3 (omega3 DES) strain 1488.8 0.3 5.3 37.1 27.0 1.0 11.9 0.1 1.2 0.3 (comparative example) 1358.4 0.3 5.7 37.0 26.3 1.0 11.7 0.1 1.3 0.4 1386.3 0.3 5.7 36.5 26.3 1.0 11.6 0.1 1.3 0.4 Fatty acid composition (% TFA) TFA C18:4 C20:3 C20:4 C20:5 C20:n (mg/L) (6, 9, 12, 15) (8, 11, 14) (5, 8, 11, 14) (5, 8, 11, 14, 17) (% TFA) WT strain 1499.5 0.0 0.0 3.2 13.9 17.1 (comparative example) 1396.8 0.0 0.0 2.9 14.7 17.6 1293.7 0.0 0.0 3.1 15.0 18.1 (delta9 DES) strain 1345.9 0.0 0.0 2.2 8.6 10.8 (comparative example) 1665.9 0.0 0.0 2.7 9.6 12.3 1507.8 0.0 0.0 2.4 10.1 12.5 (delta12 DES) strain 1215.4 0.0 0.6 4.1 10.9 15.6 (comparative example) 1296.5 0.0 0.6 4.4 11.5 16.5 1358.3 0.0 0.7 4.3 10.9 15.9 (delta6 DES) strain 1427.7 0.0 0.3 3.3 11.3 14.8 (comparative example) 1430.0 0.0 0.2 3.4 12.0 15.7 1369.6 0.0 0.2 2.8 10.9 13.9 (delta5 DES) strain 1381.0 0.0 0.0 3.3 11.5 14.8 (comparative example) 1382.1 0.0 0.0 2.8 12.2 15.0 1402.3 0.0 0.0 2.6 12.4 15.0 (omega3 DES) strain 1488.8 0.2 0.0 0.5 15.2 15.6 (comparative example) 1358.4 0.2 0.0 0.5 15.5 16.0 1386.3 0.2 0.0 0.5 16.1 16.6
[0366] As is apparent from the Table 3, in the transformant into which the No9-DES gene was introduced ((delta9 DES) strain), the proportion of the amount of C18:19 was significantly increased in comparison with that in the wild type strain (WT strain). However, the proportion of the amount of C20:55,8,11,14,17 was reduced. These results suggest that a reaction catalyzed by 9-DES is hard to be a rate-limiting step in synthesis of PUFA.
[0367] Further, in the transformant into which the No12-DES gene was introduced ((delta12 DES) strain), the proportion of the amount of C18:19 was reduced, and the proportion of the amount of C18:29,12 was significantly increased.
[0368] In the transformant into which the No6-DES gene was introduced ((delta6 DES) strain), the proportion of the amount of C18:29,12 was slightly reduced, and the proportion of the amount of C18:26,9 was slightly increased in comparison with that in the wild type strain.
[0369] Further, in the transformant into which the No5-DES gene was introduced ((delta5 DES) strain), no significant change of the fatty acid composition was observed.
[0370] Furthermore, in the transformant into which the No3-DES gene was introduced ((omega3 DES) strain), the proportion of the amount of C20:45,8,11,14 was reduced, and the proportion of the amount of C20:55,8,11,14,17 was slightly increased, in comparison with that in the wild type strain. From these results, it was suggested that, in the synthesis of PUFA of the genus Nannochloropsis, the pathway is not through C20:48,11,14,17, but through C20:45,8,11,14.
[0371] Thus, it became apparent that the fatty acid composition is changed by enhancing expression of the each desaturase gene. Then, a main synthetic pathway of EPA in the algae belonging to the genus Nannochloropsis was identified as a pathway through C20:45,8,11,14 as shown in
[0372] However, amount of PUFA such as C20:3, C20:4 and C20:5 was unable to be highly increased only by enhancing expression of only one kind of desaturase gene.
Example 2 Transformation of Nannochloropsis oculata Using Two Kinds of Desaturase Genes Derived from Nannochloropsis oculata, and Production of Lipids by the Transformant
(1) Construction of Plasmid for Desaturase Gene Expression (Paromomycin Resistance)
[0373] Using the each plasmid for No6-DES gene expression, plasmid for No5-DES gene expression, and plasmid for No3-DES gene expression constructed in Example 1 as a template respectively, and a pair of the primer Nos. 16 and 17 shown in Table 1, PCR were carried out to prepare each desaturase gene fragment (containing the vector sequence and the like).
[0374] Further, paromomycin resistance gene was amplified by carrying out PCR by using the paromomycin resistance gene (SEQ ID NO: 39) artificially synthesized as a template, and a pair of the primer Nos. 40 and 41 shown in Table 2.
[0375] The each desaturase gene fragment (containing the vector sequence and the like) and the paromomycin resistance gene fragment were fused by a method in a manner similar to that in Example 1, and a plasmid for No6-DES gene expression (paromomycin resistance), a plasmid for No5-DES gene expression (paromomycin resistance), and a plasmid for No3-DES gene expression (paromomycin resistance) were constructed respectively.
[0376] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, each desaturase gene, the VCP1 terminator sequence, the tubulin promoter sequence, the paromomycin resistance gene and the heat shock protein terminator sequence were linked in this order.
[0377] Using the prepared plasmid for the each desaturase gene expression (paromomycin resistance) as a template, and a pair of the primer Nos. 32 and 18 shown in Table 1, PCR was carried out to amplify the cassette for each desaturase gene expression (a DNA fragment containing the LDSP promoter sequence, the each desaturase gene, the VCP1 terminator sequence, the tubulin promoter sequence, the paromomycin resistance gene, and the heat shock protein terminator sequence).
[0378] The amplified DNA fragments obtained were purified according to the same method as in Example 1, and the purified fragments were introduced into the No12-DES transgenic strain prepared in Example 1 by electroporation. Recovery cultivation was carried out according to the same method as in Example 1, and then the resultant was applied onto an f/2 agar medium containing 2 g/mL of zeocin and 100 g/mL of paromomycin, and cultured for two to three weeks under 12 h/12 h light-dark conditions at 25 C. under an atmosphere of 0.3% CO.sub.2. Nannochloropsis oculata strains containing each cassette for desaturase gene expression (No12-DES and No6-DES transgenic strain ((delta12 DES+delta6 DES) strain), No12-DES and No5-DES transgenic strain ((delta12 DES+delta5 DES) strain), or No12-DES and No3-DES transgenic strain ((delta12 DES+omega3 DES) strain)) were selected by PCR from obtained colonies.
(2) Culture of Transformant, Extraction of Lipids and Analysis of Fatty Acids Contained Therein
[0379] The selected strains (obtaining three independent lines, respectively) were inoculated to 20 mL of the N15P5 media, and subjected to shaking culture for three to four weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 2 mL of the preculture fluids were inoculated to 18 mL of the N5P5 media, and subjected to shaking culture for two weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2. In addition, as negative controls, the wild type strain and the No12-DES transgenic strain were also subjected to the same experiment.
[0380] Extraction of lipids from obtained culture liquids and analysis of fatty acids contained therein were carried out, according to the same method as in Example 1. Table 4 shows the results.
TABLE-US-00004 TABLE 4 Fatty acid composition (% TFA) TFA C16:1 C18:1 C18:2 C18:2 C18:3 (mg/L) C12:0 C14:0 C16:0 (9) C18:0 (9) (6, 9) (9, 12) (6, 9, 12) WT strain 1450.9 0.3 6.2 40.0 28.3 1.3 11.9 0.0 1.1 0.4 (comparative example) 1664.5 0.3 6.2 39.7 28.1 1.3 12.1 0.0 1.2 0.4 1764.4 0.3 6.3 40.0 28.3 1.2 11.2 0.0 1.1 0.4 (delta12 DES) strain 1536.9 0.3 6.2 42.0 27.0 1.2 4.6 0.0 4.7 0.6 (comparative example) 1733.9 0.3 6.3 41.8 27.2 1.2 4.7 0.0 4.5 0.6 1887.5 0.3 6.2 42.1 27.8 1.2 4.9 0.0 4.5 0.6 (delta12 DES + 1563.5 0.2 5.6 42.2 26.3 1.0 3.2 0.0 0.6 1.3 delta6 DES) strain 1678.4 0.2 6.1 43.5 25.4 1.2 3.3 0.0 0.5 1.3 (present invention) 1744.8 0.2 6.2 43.9 25.5 1.2 3.3 0.0 0.4 1.3 (delta12 DES + 1717.6 0.3 6.1 42.4 26.6 1.1 4.7 0.0 4.4 0.7 delta5 DES) strain 1814.2 0.2 6.3 43.0 26.9 1.1 4.9 0.0 4.3 0.7 (comparative example) 1907.4 0.3 6.2 43.0 27.4 1.1 5.0 0.0 4.2 0.7 (delta12 DES + 1567.4 0.3 7.1 42.2 22.6 1.2 7.3 0.0 5.0 0.5 omega3 DES) strain 1730.5 0.4 7.5 41.3 22.3 1.1 7.2 0.0 5.1 0.5 (comparative example) 1641.1 0.4 7.4 40.9 22.0 1.1 7.2 0.0 5.3 0.5 Fatty acid composition (% TFA) TFA C18:4 C20:3 C20:4 C20:5 C20:n (mg/L) (6, 9, 12, 15) (8, 11, 14) (5, 8, 11, 14) (5, 8, 11, 14, 17) (% TFA) WT strain 1450.9 0.0 0.0 2.4 8.0 10.5 (comparative example) 1664.5 0.0 0.0 2.5 8.2 10.7 1764.4 0.0 0.0 2.4 8.7 11.1 (delta12 DES) strain 1536.9 0.0 0.6 4.1 8.7 13.4 (comparative example) 1733.9 0.0 0.7 4.2 8.6 13.4 1887.5 0.0 0.7 3.8 7.9 12.4 (delta12 DES + 1563.5 0.0 2.5 7.9 9.0 19.4 delta6 DES) strain 1678.4 0.0 2.6 7.3 8.4 18.4 (present invention) 1744.8 0.0 2.6 7.3 8.0 17.9 (delta12 DES + 1717.6 0.0 0.5 4.6 8.5 13.6 delta5 DES) strain 1814.2 0.0 0.5 4.2 7.8 12.6 (comparative example) 1907.4 0.0 0.5 4.0 7.7 12.2 (delta12 DES + 1567.4 0.4 0.0 0.6 12.7 13.3 omega3 DES) strain 1730.5 0.4 0.0 0.6 13.5 14.1 (comparative example) 1641.1 0.5 0.0 0.5 14.1 14.6
[0381] As shown in Example 1, even if a transcription amount of each of the No6-DES gene or the No12-DES gene was enhanced alone, an increase in the amount of PUFA was unable to be confirmed.
[0382] On the other hand, as is apparent from the Table 4, in the transformant into which the No12-DES gene and the No8,6-DES gene were introduced ((delta12 DES+delta6 DES) strain), the proportion of the amount of 018:19 was greatly reduced, and a proportion of the amount of C20:n was largely increased, in comparison with that in the wild type strain or (delta12 DES) strain. In particular, the proportion of the amount of C20:45,8,11,14 (arachidonic acid) was largely increased.
[0383] Moreover, as shown in Table 4, in the (delta12 DES+delta6 DES) strain, accumulation of C18:36,9,12 was hardly able to be detected. This result indicates that, in the synthetic pathway of PUFA, particularly, C20:45,8,11,14 and C20:55,8,11,14,17 in the algae belonging to the genus Nannochloropsis, a series of consecutive steps in which a reaction is catalyzed by the 12-DES and the 6-DES (the reaction in which C18:2,8,9,12 is formed from C18:19 and C18:36,9,12 is formed from C18:29,12 formed) are in the rate-limiting step.
[0384] Further, in the transformant into which the No12-DES gene and No3-DES gene were introduced ((delta12 DES+omega3 DES) strain), the proportion of the amount of C20:45,8,11,14 was reduced, and the proportion of the amount of C20:55,8,11,14,17 was increased, in comparison with that in (delta12 DES) strain. However, the proportion of the amount of C20:n was nearly unchanged Further, in the transformant into which the No12-DES gene and the No5-DES gene were introduced ((delta12 DES+delta5 DES) strain), the proportions of the amount of C20:45,8,11,14, the amount of C20:55,8,11,14,17, and the amount of C20:n were nearly unchanged in comparison with that in (delta12 DES) strain.
[0385] From these results also, it is found that it is important to enhance expressions of the 12-DES and the 6-DES to reinforce a sequential reaction catalyzed by the 12-DES and the 6-DES in order to improve the productivity of PUFA in the genus Nannochloropsis.
Example 3 Transformation of Nannochloropsis oculata Using Three Kinds of Desaturase Genes Derived from Nannochloropsis oculata, and Production of Lipids by the Transformant
(1) Construction of Plasmid for Desaturase Gene Expression (Hygromycin Resistance)
[0386] Using the plasmid for No3-DES gene expression constructed in Example 1 as a template, and a pair of the primer Nos. 16 and 17 shown in Table 1, PCR was carried out to prepare the No3-DES gene fragment (containing the vector sequence and the like).
[0387] Further, hygromycin resistance gene was amplified by carrying out PCR by using the hygromycin resistance gene (SEQ ID NO: 42) artificially synthesized as a template, and a pair of the primer Nos. 43 and 44 shown in Table 2.
[0388] These two fragments were fused by a method in a manner similar to that in Example 1, and a plasmid for No3-DES gene expression (hygromycin resistance) was constructed.
[0389] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, the No3-DES gene, the VCP1 terminator sequence, the tubulin promoter sequence, the hygromycin resistance gene and the heat shock protein terminator sequence were linked in this order.
[0390] Using the prepared plasmid for the No3-DES gene expression (hygromycin resistance) as a template, and a pair of the primer Nos. 32 and 18 shown in Table 1, PCR was carried out to amplify the cassette for No3-DES gene expression (a DNA fragment containing the LDSP promoter sequence, the No3-DES gene, the VCP1 terminator sequence, the tubulin promoter sequence, the hygromycin resistance gene, and the heat shock protein terminator sequence).
[0391] The amplified fragment was purified according to the same method as in Example 1, and the purified fragment was introduced into the No12-DES and No6-DES transgenic strain prepared in Example 2, by electroporation. Recovery cultivation was carried out according to the same method as in Example 1, and then the resultant was applied onto an f/2 agar medium containing 500 g/mL of hygromycin, and cultured for two to three weeks under 12 h/12 h light-dark conditions at 25 C. under an atmosphere of 0.3% CO.sub.2. Nannochloropsis oculata strain containing the cassette for No3-DES gene expression (No12-DES, No6-DES and No3-DES transgenic strain ((delta12 DES+delta6 DES+omega3 DES) strain)) was selected by PCR from obtained colonies.
(2) Culture of Transformant, Extraction of Lipids and Analysis of Fatty Acids Contained Therein
[0392] The selected strain was inoculated to 20 mL of the N15P5 medium, and subjected to shaking culture for three to four weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 2 mL of the preculture fluid was inoculated to 18 mL of the N5P5 medium, and subjected to shaking culture for three weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2. In addition, as negative controls, the wild type strain, the No12-DES transgenic strain, the 12-DES and No6-DES transgenic strain, and the No12-DES and No3-DES transgenic strain were also subjected to the same experiment.
[0393] Extraction of lipids from obtained culture liquids and analysis of fatty acids contained therein were carried out, according to the same method as in Example 1. The results of production amount of total fatty acids and the fatty acid composition in the third week are shown in Table 5. The amount of total fatty acids, production amount of C20:5 fatty acid and production amount of C20:n fatty acids in the first week, the second week and the third week of culture are shown in Table 6. Then, the proportion of the amount of C20:5 fatty acid and the proportion of the amount of C20:n fatty acids in the first week, the second week and the third week of culture are shown in Table 7.
TABLE-US-00005 TABLE 5 Fatty acid composition (% TFA) TFA C16:1 C18:1 C18:2 C18:2 C18:3 (mg/L) C12:0 C14:0 C16:0 (9) C18:0 (9) (6, 9) (9, 12) (6, 9, 12) WT strain 1309.2 0.0 4.8 38.0 31.4 1.4 14.6 0.2 0.9 0.2 (comparative example) (delta12 DES) strain 1566.5 0.0 5.5 42.7 29.1 1.7 6.7 0.0 4.6 0.5 (comparative example) (delta12 DES + 1586.4 0.0 6.0 43.0 23.1 1.6 11.0 0.0 5.3 0.6 omega3 DES) strain (comparative example) (delta12 DES + 1764.0 0.0 5.4 45.5 27.8 1.7 4.3 0.0 0.4 1.1 delta6 DES) strain (present invention) (delta12 DES + 1526.5 0.0 5.1 40.1 28.2 1.4 7.7 0.0 0.6 1.6 delta6 DES + omega3 DES) strain (present invention) Fatty acid composition (% TFA) TFA C18:4 C20:3 C20:4 C20:5 C20:n (mg/L) (6, 9, 12, 15) (8, 11, 14) (5, 8, 11, 14) (5, 8, 11, 14, 17) (% TFA) WT strain 1309.2 0.0 0.0 1.6 6.9 8.5 (comparative example) (delta12 DES) strain 1566.5 0.0 0.7 3.3 5.2 9.2 (comparative example) (delta12 DES + 1586.4 0.4 0.0 0.3 8.6 9.0 omega3 DES) strain (comparative example) (delta12 DES + 1764.0 0.0 2.9 6.3 4.6 13.8 delta6 DES) strain (present invention) (delta12 DES + 1526.5 0.0 1.5 0.8 12.9 15.3 delta6 DES + omega3 DES) strain (present invention)
TABLE-US-00006 TABLE 6 Type of Yield (mg/L) fatty acid 1 w 2 w 3 w WT strain TFA 272.2 855.2 1309.2 (comparative example) C20:5 46.9 70.6 90.0 C20:n 55.3 85.0 110.7 (delta12 DES) strain TFA 323.9 941.3 1566.5 (comparative example) C20:5 45.2 63.7 81.7 C20:n 60.7 103.8 144.6 (delta12 DES + omega3 DES) TFA 311.5 909.2 1586.4 strain (comparative example) C20:5 62.0 100.0 136.7 C20:n 62.0 104.2 142.2 (delta12 DES + delta6 DES) TFA 486.3 1069.7 1764.0 strain (present invention) C20:5 55.8 64.3 80.8 C20:n 104.3 162.7 242.7 (delta12 DES + delta6 DES + TFA 314.1 907.4 1504.2 omega3 DES) strain (present C20:5 83.4 135.4 193.7 invention) C20:n 91.8 166.1 246.8
TABLE-US-00007 TABLE 7 Type of Proportion (% TFA) fatty acid 1 w 2 w 3 w WT strain C20:5 17.2 8.3 6.9 (comparative example) C20:n 20.3 9.9 8.5 (delta12 DES) strain C20:5 14.0 6.8 5.2 (comparative example) C20:n 18.8 11.0 9.2 (delta12 DES + omega3 DES) C20:5 19.9 11.0 8.6 strain (comparative example) C20:n 19.9 11.5 9.0 (delta12 DES + delta6 DES) C20:5 11.5 6.0 4.6 strain (present invention) C20:n 21.5 15.2 13.8 (delta12 DES + delta6 DES + C20:5 26.6 14.9 12.9 omega3 DES) strain (present invention) C20:n 29.2 18.3 16.4
[0394] As is apparent from the Table 5, in the transformant into which the No12-DES gene, the No6-DES gene and the No3-DES gene were introduced ((delta12 DES+delta6 DES+omega3 DES) strain), the proportion of the amount of C20:45,8,11,14 was greatly reduced, and the proportion of the amount of C20:55,8,11,14,17 was largely increased, in comparison with that in the (delta12 DES+delta6 DES) strain. Further, the proportion of the amount of C20:n was also increased. From these results, it was found that the productivity of PUFA, particularly, C20:55,8,11,14,17 is further improved by enhancing expression of the 3-DES in addition to the 12-DES and the 6-DES.
[0395] Further, as is apparent from Table 6 and Table 7, in the wild type strain (WT strain), accordingly as a culture period becomes longer, the proportion of the amount of C20:n or C20:5 is reduced.
[0396] In contrast, in the (delta12 DES+delta6 DES) strain, the production amount of C20:n and the proportion of the amount of C20:n in the amount of whole fatty acids were increased in any culture period in comparison with that in the wild type strain (WT strain) and the (delta12 DES) strain.
[0397] Further, in the (delta12 DES+delta6 DES+omega3 DES) strain, the production amount of C20:n (particularly, C20:55,8,11,14,17), and the proportion of the amount of C20:n (particularly, C20:55,8,11,14,17) in the amount of whole fatty acids were further increased in comparison with that in the (delta12 DES+delta6 DES) strain.
[0398] Further, in the (delta12 DES+delta6 DES) strain or the (delta12 DES+delta6 DES+omega3 DES) strain, a reduction rate of the proportion of the amount of C20:n in association with prolongation of the culture period is suppressed in comparison with that in the wild stain (WT strain) or the like.
Example 4 Transformation of (Delta12 DES+Delta6 DES+Omega3 DES) Strain Using 9-DES Gene, 5-DES Gene and 6-ELO Gene, and Production of Lipids by the Transformant
(1) Construction of Plasmid for Desaturase Gene or Elongase Gene Expression (Bialaphos Resistance)
[0399] Using the plasmid for No9-DES gene expression or the plasmid for No5-DES gene expression constructed in Example 1 as a template, and a pair of the primer Nos. 16 and 17 shown in Table 1, PCR were carried out to amplify the No9-DES gene fragment and the No5-DES gene fragment (containing the pUC19 vector sequence itself and the like), respectively.
[0400] Further, bialaphos resistance gene (SEQ ID NO: 68) was artificially synthesized. Using the synthesized DNA fragment as a template, and a pair of the primer Nos. 69 and 70 shown in Table 2, PCR was carried out to amplify the bialaphos resistance gene.
[0401] Each of No9-DES gene fragment and No5-DES gene fragment, and bialaphos resistance gene fragment were fused by a method in a manner similar to that in Example 1, and a plasmid for No9-DES gene expression (bialaphos resistance) and a plasmid for No5-DES gene expression (bialaphos resistance) were constructed, respectively.
[0402] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, No9-DES gene or No5-DES gene, the VCP1 terminator sequence, the tubulin promoter sequence, the bialaphos resistance gene and the heat shock protein terminator sequence were linked in this order.
[0403] Using the cDNA of Nannochloropsis oculata strain NIES-2145 prepared in Example 1 as a template, and a pair of the primer Nos. 71 and 72 shown in Table 2, PCR was carried out to prepare the gene (No6-ELO gene) fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 73.
[0404] The amplified fragment and the fragment containing LDSP promoter fragment, VCP1 terminator fragment, the cassette for zeocin resistance gene expression, and pUC19 sequence, were fused by a method in a manner similar to that in Example 1, and a plasmid for No6-ELO gene expression was constructed.
[0405] Using the plasmid for No6-ELO gene expression as a template, and a pair of the primer Nos. 16 and 17 shown in Table 1, PCR was carried out to amplify the No6-ELO gene fragment (containing pUC19 vector sequence itself and the like). A plasmid for No6-ELO gene expression (bialaphos resistance) was constructed by fusing the amplified fragment with the bialaphos resistance gene fragment, according to the same method as in Example 1
[0406] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, the No6-ELO gene, the VCP1 terminator sequence, the tubulin promoter sequence, the bialaphos resistance gene and the heat shock protein terminator sequence were linked in this order.
[0407] Using the plasmid for No9-DES gene expression (bialaphos resistance), the plasmid for No5-DES gene expression (bialaphos resistance), or the plasmid for No6-ELO gene expression (bialaphos resistance) prepared as a template, and a pair of the primer Nos. 32 and 18 shown in Table 1, PCR was carried out, to amplify cassette for No9-DES gene expression, cassette for No5-DES gene expression, or cassette for No6-ELO gene expression (DNA fragment consisting of the LDSP promoter sequence, the desaturase gene or the elongase gene (No9-DES gene, No5-DES gene or No6-ELO gene), the VCP1 terminator sequence, the tubulin promoter sequence, the bialaphos resistance gene, and the heat shock protein terminator sequence).
[0408] The amplified fragments obtained were purified according to the same method as in Example 1, and the purified fragments were introduced respectively into the No12-DES transgenic, the No6-DES transgenic, and the No3-DES transgenic strain prepared in Example 3, by electroporation. Recovery cultivation was carried out according to the same method as in Example 1, and then the resultant was applied onto an f/2 agar medium containing 750 g/mL of bialaphos, and cultured for two to three weeks under 12 h/12 h light-dark conditions at 25 C. under an atmosphere of 0.3% CO.sub.2. Nannochloropsis oculata strain containing the cassette for No9-DES gene expression ((delta12 DES+delta6 DES+omega3 DES+delta9 DES) strain), Nannochloropsis oculata strain containing the cassette for No5-DES gene expression ((delta12 DES+delta6 DES+omega3 DES+delta5 DES) strain), and Nannochloropsis oculata strain containing the cassette for No6-ELO gene expression ((delta12 DES+delta6 DES+omega3 DES+delta6 ELO) straom) were selected by PCR from obtained colonies, respectively.
(2) Culture of Transformant, Extraction of Lipids and Analysis of Fatty Acids Contained Therein
[0409] The selected strains were inoculated to 4 mL of the N15P5 media (Microplate for Tissue Culture, manufactured by IWAKI), and subjected to shaking culture for three to four weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 0.4 mL of the preculture fluids were inoculated to 4 mL of the N5P5 media (Microplate for Tissue Culture, manufactured by IWAKI), and subjected to shaking culture for three weeks under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2. In addition, as negative controls, the wild type strain, and the No12-DES transgenic, the No6-DES transgenic and the No3-DES transgenic strain were also subjected to the same experiment.
[0410] Extraction of lipids from obtained culture liquids and analysis of fatty acids contained therein were carried out, according to the same method as in Example 1. The results of a production amount of total fatty acids and the fatty acid composition in the third week are shown in Table 8.
TABLE-US-00008 TABLE 8 Fatty acid composition (% TFA) TFA C16:1 C18:1 C18:1 C18:2 C18:2 (mg/L) C12:0 C14:0 C16:0 (9) C18:0 (9) (11) (6, 9) (9, 12) WT strain 1755.0 0.0 5.2 38.0 30.9 1.2 14.4 0.0 0.2 0.9 (comparative example) (delta12 DES + 1652.4 0.0 4.7 34.7 29.1 0.9 7.9 0.0 0.0 1.1 delta6 DES + omega3 DES) strain (present invention) (delta12 DES + 2026.1 0.0 3.9 27.8 28.9 0.5 12.8 0.0 0.1 1.7 delta6 DES + omega3 DES + delta9 DES) strain (present invention) (delta12 DES + 1610.2 0.0 4.8 32.7 28.3 0.9 7.0 0.0 0.0 1.1 delta6 DES + omega3 DES + delta5 DES) strain (present invention) (delta12 DES + 1816.0 0.0 5.0 36.5 29.4 0.9 5.1 0.0 0.2 0.8 delta6 DES + omega3 DES + delta6 ELO) strain (present invention) Fatty acid composition (% TFA) C18:3 C18:4 C20:3 C20:4 C20:5 TFA (6, (6, 9, (8, (5, 8, (5, 8, 11, C20:n (mg/L) 9, 12) 12, 15) 11, 14) 11, 14) 14, 17) (% TFA) WT strain 1755.0 0.3 0.0 0.1 1.5 7.3 8.9 (comparative example) (delta12 DES + 1652.4 2.0 0.0 1.3 1.4 16.9 19.6 delta6 DES + omega3 DES) strain (present invention) (delta12 DES + 2026.1 1.9 0.0 1.8 1.6 18.9 22.3 delta6 DES + omega3 DES + delta9 DES) strain (present invention) (delta12 DES + 1610.2 2.1 0.0 0.7 2.0 20.4 23.1 delta6 DES + omega3 DES + delta5 DES) strain (present invention) (delta12 DES + 1816.0 0.2 0.0 2.3 1.2 18.3 21.8 delta6 DES + omega3 DES + delta6 ELO) strain (present invention)
[0411] As is apparent from the Table 8, in the strain into which the No12-DES gene, the No6-DES gene, the No3-DES gene and the Nan-DES gene were introduced ((delta12 DES+delta6 DES+omega3 DES+delta9 DES) strain), the proportion of C16:0 was reduced, and the proportions of C18:19 and C20:n were increased, in comparison with that in the (delta12 DES+delta6 DES+omega3 DES) strain.
[0412] In addition, in the strain into which the No12-DES gene, the No6-DES, the No3-DES gene, and the No5-DES gene were introduced ((delta12 DES+delta6 DES+omega3 DES+delta5 DES) strain), the proportion of C20:38,11,14 was reduced, and the proportions of C20:45,8,11,14 and C20:55,8,11,14,17 were increased, in comparison with that in the (delta12 DES+delta6 DES+omega3 DES) strain.
[0413] Further, in the strain into which the No12-DES gene, the No6-DES gene, the No3-DES gene, and the No6-ELO gene were introduced ((delta12 DES+delta6 DES+omega3 DES+delta6 ELO) strain), the proportion of C18:36,9,12 was reduced, and the proportions of C20:38,11,14 and C20:n were improved, in comparison with that in the (delta12 DES+delta6 DES+omega3 DES) strain.
[0414] From these results, it was found that the productivity of PUFA, particularly, C20:55,8,11,14,17 is further improved by enhancing the expression of any one of the 9-DES, the 5-DES and the 6-ELO, in addition to the 12-DES, the 6-DES and the 3-DES.
Example 5 Analysis of Fatty Acid Composition Contained in TAG in (Delta12 DES+Delta6 DES+Omega3 DES) Strain and (Delta12 DES+Delta6 DES+Omega3 DES+Delta6 ELO) Strain
(1) Culture of Wild Type Strain and Transformant
[0415] The (delta12 DES+delta6 DES+omega3 DES) strain, (delta12 DES+delta6 DES+omega3 DES+delta6 ELO) strain, and wild type strain as a negative control obtained in Example 3 and 4 were inoculated to 20 mL of the N5P5 media, and subjected to shaking culture for five days under the 12 h/12 h light-dark conditions at 25 C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid 1. Then, 2 mL of the preculture fluids were inoculated to 18 mL of the N5P5 media, and subjected to shaking culture for five days, to prepare preculture fluid 2. Then, 2 mL of the preculture fluids 2 were inoculated to 18 mL of the N5P5 media, and subjected to shaking culture for three weeks under the same condition.
(2) Extraction of Lipid, Fractionation of TAG, and Analysis of Fatty Acids Contained in TAG
[0416] To 0.25 mL of the culture fluid, 0.5 mL of chloroform and 1 mL of methanol were added. The mixture was vigorously stirred and then was left for 10 minutes or more. Further, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl were added thereto. The mixture was stirred and centrifuged for 5 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with Pasteur pipette. A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid, and the resultant material was dissolved into 20 L of chloroform.
[0417] A total amount of the thus obtained lipids extract, and 3 L of standard solutions {10 mg/mL of trimyristin (manufactured by Wako Pure Chemical Industries, Ltd.) in chloroform solution} each were spotted onto TLC silica gel 60F.sub.254 (manufactured by Merck). The resultant material was developed for about 15 minutes by using TLC developing tank DT-150 (manufactured by Mitsubishi Chemical Medience Corporation) with a developing solvent (hexane:diethyl ether:formic acid=42:28:0.3 (volume ratio)). After development, the plate was dried, 0.1% primulin (manufactured by Wako Pure Chemical Industries, Ltd.) dissolved in methanol was sprayed thereon and dried, and then a TAG fraction was detected by handy type UV lamp UVL-21 (manufactured by SOGO LABORATORY GLASS WORKS CO., LTD.).
[0418] The TAG fraction was scratched and collected by using a toothpick and 0.1 mL of chloroform, and 0.5 mL of 14% boron trifluoride-methanol solution (manufactured by Sigma-Aldrich) were added thereto, and the temperature of the resultant material was kept constant at 80 C. for 30 minutes. Then, 0.5 mL of hexane and 1 mL of saturated saline were added thereto, and the resultant mixture was vigorously stirred and left to stand for 10 minutes at room temperature, and then, the hexane layer being an upper layer was collected to obtain fatty acid methyl esters.
[0419] The obtained fatty acid methyl esters were provided for gas chromatographic analysis according to the same method as in Example 1, and analysis of fatty acids contained therein was carried out thereon. Table 9 shows the results. In addition, in Table 9, TAG-FA presents total weight of fatty acid residues constituting TAG, and fatty acid composition (% TAG-FA) presents a proportion of weight of each fatty acid residue to the total weight of the fatty acid residues constituting TAG (composition ratio of the fatty acid residues constituting TAG).
TABLE-US-00009 TABLE 9 Fatty acid composition (% TAG-FA) C16:1 C18:1 C18:1 C18:2 C18:2 C18:3 C12:0 C14:0 C16:0 (9) C18:0 (9) (11) (6, 9) (9, 12) (6, 9, 12) WT strain 0.0 4.4 43.1 28.5 2.6 15.6 0.0 0.2 1.0 0.4 (comparative example) (delta12 DES + 0.0 5.3 42.6 28.8 1.6 7.5 0.4 0.0 0.6 1.6 delta6 DES + omega3 DES) strain (present invention) (delta12 DES + 0.0 5.4 45.1 29.8 1.3 5.2 0.4 0.0 0.4 0.0 delta6 DES + omega3 DES + delta6 ELO) strain (present invention) Fatty acid composition (% TAG-FA) C20:n C18:4 C20:3 C20:4 C20:5 (% TAG- (6, 9, 12, 15) (8, 11, 14) (5, 8, 11, 14) (5, 8, 11, 14, 17) FA) WT strain 0.0 0.0 1.0 3.2 4.3 (comparative example) (delta12 DES + 0.0 1.4 0.7 9.4 11.5 delta6 DES + omega3 DES) strain (present invention) (delta12 DES + 0.0 2.7 0.5 9.2 12.4 delta6 DES + omega3 DES + delta6 ELO) strain (present invention)
[0420] As is apparent from the Table 9, in the strain into which the No12-DES gene, the No6-DES gene and the No3-DES gene were introduced ((delta12 DES+delta6 DES+omega3 DES) strain), the proportion of C20:n (especially, C20:55,8,11,14,17) in the TAG was improved, in comparison with that in the wild type strain.
[0421] Further, in the strain into which the No12-DES gene, the No6-DES gene, the No3-DES gene, and the No6-ELO gene were introduced ((delta12 DES+delta6 DES+omega3 DES+delta6 ELO) strain), the proportion of C20:n (especially, C20:38,11,14) was further increased, in comparison with that in the strain into which the No12-DES gene, the No6-DES gene, and the No3-DES gene were introduced ((delta12 DES+delta6 DES+omega3 DES) strain).
[0422] From these results, it was found that the productivity of PUFA is further improved by enhancing expression of the 6-ELO in addition to the 12-DES, the 6-DES and the 3-DES.
[0423] As described above, in the synthetic pathway of PUFA in the algae belonging to the genus Nannochloropsis, the 12-DES and the 6-DES each are the enzyme that catalyzes the reaction in the rate-limiting step. Then, the production amount of PUFA can be significantly increased by enhancing the expression of the 12-DES and the 6-DES. Further, productivity of the PUFA can be improved by culturing the transformant of an alga belonging to the genus Nannochloropsis, in which the expressions of the 12-DES and the 6-DES are enhanced.
[0424] Having described our invention as related to the present embodiments, it is our intention that the invention not be limited by any of the details of the description, unless otherwise specified, but rather be construed broadly within its spirit and scope as set out in the accompanying claims.
[0425] This application claims priority on Patent Application No. 2016-174752 filed in Japan on Sep. 7, 2016, which is entirely herein incorporated by reference.