Very high molar mass dextrans

Abstract

The subject matter of the invention is dextrans which have between 95% and 99% of -1,6 glucosidic bonds, a weight-average molar mass M.sub.w at least equal to 0.710.sup.9 g.mol.sup.1, and a dispersity index D of between 1.3 and 3. The invention also relates to a dextran saccharase which makes it possible to produce such dextrans, and to a method for producing said dextrans.

Claims

1. A process for producing dextrans having a weight-average molar mass M.sub.w, at least equal to 0.710.sup.9 g.mol.sup.1, and a dispersity index D.sub.i of between 1.3 and 3, wherein -1,6 glucosidic bonds in the dextrans comprise between 95% and 99% of glucosidic bonds, the process comprising reacting sucrose with a dextransucrase that comprises a protein which is a function-preserving dextransucrase variant of the amino acid sequence set forth in SEQ ID NO:1, said protein having at least 98% amino acid sequence identity with the amino acid sequence set forth in SEQ ID NO: 1, wherein the amino acid sequence of the protein comprises: (a) a glycoside hydrolase family 70 (GH70) DED catalytic triad, (b) a glycoside hydrolase family 70 conserved catalytic core protein motif I corresponding to amino acids 936-942 of SEQ ID NO:1, (c) a glycoside hydrolase family 70 conserved catalytic core protein motif II corresponding to amino acids 458-468 of SEQ ID NO:1, (d) a glycoside hydrolase family 70 conserved catalytic core protein motif III corresponding to amino acids 495-505 of SEQ ID NO:1, and (e) a glycoside hydrolase family 70 conserved catalytic core protein motif IV corresponding to amino acids 568-582 of SEQ ID NO:1.

2. The process of claim 1, wherein the step of reacting is carried out at a temperature of between 20 C. and 40 C.

3. The process of claim 1, wherein the sucrose is present at a concentration that is between approximately 50 and 200 g.l.sup.1.

4. The process of claim 1, wherein pH during the step of reacting is between approximately 5 and 6.5.

5. The process of claim 1 wherein the dextransucrase is a dextransucrase comprising the amino acid sequence set forth in SEQ ID NO: 1.

6. The process of claim 1 wherein wherein -1,6glucosidic bonds in the dextrans comprise between 97% and 98% of glucosidic bonds.

Description

FIGURES

(1) FIG. 1: Diagrammatic representation of the primary structure of DSR-OK (based on the protein alignment with the GFT180 enzyme from Lactobacillus reuteri 180). Five domains are distinct: domain V in red, domain IV in yellow, domain B in green, domain A in blue and domain C in violet. The catalytic triad is indicated by the white letters D, E and D.

(2) FIG. 2: Graphic representation of the relative activity of the DSR-OK dextransucrase at 30 C. as a function of time.

(3) FIG. 3: Determination of the inhibition constant for inhibition by excess substrate (variation of the inverse of the initial rate as a function of the initial concentration of substrate).

(4) FIG. 4: Graphic Michaelis-Menten representation (variation of the initial rate of fructose production as a function of the initial concentration of substrate).

(5) FIG. 5: Graphic Lineweaver-Burk representation (variation of the inverse of the rate as a function of the inverse of the concentration of substrate).

(6) FIG. 6: Spectrum obtained by proton NMR on the dextran synthesized by recombinant DSR-OK. The arrows correspond to the -1,3 and -1,6 bonds.

(7) FIG. 7: Elution profile obtained by AF4-MALLS (Asymmetric Flow-Field-Flow-Fractionation-Multi-Angle Laser Light Scattering) (D1=refractometric response, D1-DL=light scattering) and molar mass distribution of the dextran produced by recombinant DSR-OK preparation (D1 Mw).

(8) FIG. 8: Elution profiles obtained by HPSEC of the dextrans produced from 100 g.l.sup.1 of sucrose by (a) native DSR-S produced by L. mesenteroides NRRL B-512F, (b) the recombinant enzyme DSR-S vardel 4N and by (c) the recombinant enzyme DSR-OK. Peak 1 corresponds to the very high molar mass dextran, peak 2 to oligosaccharides with a degree of polymerization of less than 7, and peak 3 corresponds to the fructose coproduced during the reaction.

(9) FIG. 9: Representation of the radius of gyration (in nm) as a function of the molar mass for various dextrans: gcn1 produced by a DSR-S vardel 4N mutant, the dextran produced by DSR-OK and a commercial dextran T2000 (Pharmacosmos) of 210.sup.6 g.mol.sup.1.

(10) FIG. 10: Rheological behavior of the dextran as a function of the sucrose concentration by measuring the viscosity of the dextran synthesized by DSR-OK in the crude synthesis medium starting from various sucrose concentrations: 50 g.l.sup.1 (.circle-solid.), 75 g.l.sup.1 (.box-tangle-solidup.), 100 g.l.sup.1 (.square-solid.) and 150 g.l.sup.1 ().

(11) FIG. 11: Rheological behavior of the purified dextran by measuring the viscosity of the dextran synthesized by DSR-OK, purified by ethanol precipitation, and concentrated to 50 g.l.sup.1 in distilled water.

(12) FIG. 12: Measurement of the yield point of the dextran produced by DSR-OK in the crude synthesis medium, using 100 g.l.sup.1 of sucrose, by graphic representation of the shear rate of the dextran at 33 g.l.sup.1 produced by DSR-OK as a function of the shear stress applied.

(13) FIG. 13: Rheological behavior of the dextran produced by DSR-OK by measuring the moduli G (.circle-solid.) and G () by frequency scanning under oscillatory conditions (oscillations between 10.sup.2 and 10.sup.2 rad.s.sup.1): behavior of gel type G>G.

(14) FIG. 14: Rheological behavior of various dextrans by measuring the viscosity as a function of the shear stress of dextran produced in the presence of 100 g.l.sup.1 of sucrose, by the recombinant DSR-OK (.square-solid.), by the native DSR-S derived from L. mesenteroides NRRL B-512F (), and by the DSR-S vardel D4N ().

(15) FIG. 15: Evolution of the apparent viscosity of the dextrans in their crude synthesis medium, synthesized starting from 100 g.l.sup.1 of sucrose. A: by recombinant DSR-OK and B: by DSR-S vardel D4N at a constant shear stress of 50 s.sup.1, at 20 C. and ambient atmospheric pressure.

EXAMPLES

Example 1

Identification of the Dsrok Gene in the Oenococcus kitaharae DSM 17330 Genome and Analysis of the Primary Structure of the Corresponding Protein

(16) The dsrok gene was identified in the genome of Oenococcus kitaharae DSM 17330 (available in the NCBI database under reference number NZ_CM001398) by nucleotide blast against a database consisting of glucansucrase nucleotide sequences listed in glycoside hydrolase family 70 according to CAZY (Carbohydrate Active enZYme database, www.cazy.org/GH70_all.html).

(17) The gene was translated into protein sequence using the software available online, Transeq from EMBOSS (www.ebi.ac.uk/Tools/st/emboss_transeq/).

(18) The absence of signal peptide was predicted by the SignalP server 4.1 software (www.cbs.dtu.dk/services/SignalP/).

(19) Multiple protein alignments (with the overall alignment software ClustalW2, available online, www.ebi.ac.uk/Tools/msa/clustalw2/) with other characterized glucansucrases made it possible to identify the conserved motifs of the catalytic core of DSR-OK, and to cut the enzyme up into various protein domains (A, B, C, IV and V).

(20) The various identity and similarity percentages between protein sequences, indicated in the preliminary sheet for the invention, were calculated with the BlastP tool (protein-protein Blast) from the NCBI, available online and using the default parameters proposed by the site.

Example 2

Cloning and Heterologous Expression of the Protein Escherichia coli

(21) The dsrok gene was first of all amplified by PCR, from the genomic DNA of the Oenococcus kitaharae DSM 17330 strain, using the two primers presented in table 1.

(22) TABLE-US-00001 TABLE1 Primer Sequence(5 to3) Forwardprimer CACCATGATGGCGACCGGCTC (SEQIDNO:2) Reverseprimer GAGGATTTGACCGTTTCCAAACTTATCG (SEQIDNO:3)

(23) The addition of the 4 bases, CACC, in the 5 position of the forward primer allowed the correct insertion of the PCR fragment into the entry vector pENTR/D/TOPO (Life Technologies), in order to subsequently perform a cloning using the Gateway technology.

(24) A positive entry clone (entry vector containing the PCR fragment in the desired sense) was selected and recombined with the destination vector pET-53-DEST (Novagen) using the LR clonase enzyme mix II (Life Technologies). The positive recombinant clones were selected and analyzed by restriction. The absence of mutation in the plasmids was confirmed by sequencing (GATC).

(25) For the production of the recombinant enzyme, Escherichia coli BL21 star DE3 cells were transformed with the pET-53/DSR-OK plasmid constructed as indicated previously. 300 l of the transformation mix were inoculated into 30 ml of LB (Lysogeny Broth) medium, supplemented with 100 g.ml.sup.1 of ampicillin, and incubated overnight at 37 C. in order to prepare a preculture.

(26) Cultures of 1 L in modified ZYM5052 medium (1% glycerol, 0% glucose, 1% lactose, Studier, 2005) were thus inoculated at an initial optical density OD 600 nm of 0.05 using the preculture from the day before, then incubated for 24 hours at 23 C. and 150 rpm. At the end of fermentation, the culture media are centrifuged (15 min, 6500 rpm, 4 C.) and the pellets are concentrated to an OD of 80 in 50 mM of sodium acetate buffer, pH 5.75.

(27) In order to obtain the recombinant enzyme (produced intracellularly by Escherichia coli), the cells are ruptured with ultrasound according to the following protocol: 5 cycles of 20 seconds at 30% of the maximum power of the probe, under cold conditions, with 4 minutes of rest in ice between each cycle. The sonication supernatant (containing the soluble recombinant enzyme) is then recovered after 30 minutes of centrifugation (10 000 rpm, 10 C.) and stored at 4 C.

(28) The recombinant production of dextransucrase in Escherichia coli using the conditions described herein achieves approximately 30 000 units of enzymatic activity per liter of culture, which allows its use at low cost in polymer synthesis processes.

Example 3

Method of Determining the Enzymatic Activity of the DSR-OK Enzyme

(29) One glucansucrase enzymatic unit represents the amount of enzyme which releases one mol of fructose per minute, at 30 C., from 100 g.l.sup.1 of sucrose in 50 mM of sodium acetate buffer, at pH 5.75.

(30) The activity is determined by measuring the initial rate of production of the reducing sugars using the dinitrosalicylic acid (DNS) method. During a time course, 100 l of reaction medium are removed and the reaction is stopped by adding an equivalent volume of DNS. The samples are then heated for 5 min at 95 C., cooled in ice, and diluted 50/50 in water, and the absorbance is read at 540 nm. A standard range of from 0 to 2 g.l.sup.1 of fructose makes it possible to establish the link between the absorbance value and concentration of reducing sugars.

Example 4

Determination of the Optimal Working Conditions for the DSR-OK Enzyme

(31) The optimal temperature value was determined by measuring the activity of the crude enzymatic extract at various temperatures (between 23 and 40 C.) using 100 g.l.sup.1 of sucrose in 50 mM of sodium acetate buffer, to pH 5.75.

(32) The recombinant DSR-OK dextransucrase enzyme has an optimal temperature of 30 C.

(33) The effect of the pH on the enzymatic activity of the crude enzymatic extract is measured at 30 C. using 100 g.l.sup.1 of sucrose, in 50 mM of citrate phosphate buffer, for pH values of between 3.5 and 8 (intervals of 0.5).

(34) The recombinant DSR-OK dextransucrase enzyme has an optimal pH of between 5 and 5.8.

Example 5

Determination of the Production Yields and of the Polymerase Activity of the Recombinant DSR-OK Dextransucrase Enzyme

(35) The production yields are determined by anion exchange chromatography (HPAEC-PAD, High Performance Anion Exchange Chromatography with Pulsed Amperometric Detection), for an enzymatic reaction at 1 U.ml.sup.1 of DSR-OK, using 100 g.l.sup.1 of sucrose in 50 mM of sodium acetate buffer, pH 5.75. The sugars, glucose, fructose, leucrose and sucrose are separated on a Dionex CarboPac PA-100 column by means of a sodium acetate gradient of from 6 to 500 mM over the course of 36 min, containing 150 mM of sodium hydroxide. Standard ranges of 5, 10, 15 and 20 mg.kg.sup.1 of these sugars are prepared and enable their quantification.

(36) The production yields, that is to say the share of glucose derived from the sucrose, that is incorporated into the formation of free glucose, of leucrose and of dextran, are calculated as follows:

(37) $\%G\mathrm{glucose}=\frac{\left(\left[\mathrm{Glucose}\right]\mathrm{tf}-\left[\mathrm{Glucose}\right]t0\right)342}{\left(\left[\mathrm{Sucrose}\right]t0-\left[\mathrm{Sucrose}\right]\mathrm{tf}\right)180}100$$\%G\mathrm{le}\mathrm{ucrose}=\frac{\left(\left[\mathrm{Leucrose}\right]\mathrm{tf}-\left[\mathrm{Leucrose}\right]t0\right)}{\left(\left[\mathrm{Sucrose}\right]t0-\left[\mathrm{Sucrose}\right]\mathrm{tf}\right)}100$

(38) The analysis of the reaction products by size exclusion chromatography (HPSEC) shows that there is synthesis of only glucose, leucrose and very high molecular weight dextran. As a consequence of recurring problems of clogging of the columns during the analysis with this polymer, direct quantification of the very high molecular weight dextran cannot be carried out. The percentage of glycosyl units incorporated in the dextran synthesis was deduced from the HPAEC-PAD analyses as follows:
%G dextran=100%(%G glucose+%G leucrose)

(39) It was demonstrated here that the enzyme is an excellent polymerase. Indeed, the chromatographic analyses (HPAEC-PAD and HPSEC-RI) carried out following a synthesis of dextran from 100 g.l.sup.1 of sucrose show that approximately 89% (more specifically, 86% 5%) of the glycosyl units derived from the substrate are used for the production of the polymer under the standard production conditions (100 g.l.sup.1 of sucrose, at 30 C. and at pH 5.75).

(40) Only 2% and 9% of these units are lost by incorporation into the synthesis of free glucose and of leucrose, respectively.

Example 6

Study of the Stability of the DSR-OK Recombinant Enzyme

(41) In order to study the stability of DSR-OK at 30 C., the enzyme (purified or nonpurified) is placed at 30 C., initially at 40 U.ml.sup.1, in 50 mM of sodium acetate buffer, pH 5.75. The residual activity is measured, at regular intervals, starting from 100 g.l.sup.1 of sucrose, in 50 mM of sodium acetate buffer, pH 5.75, until complete denaturation of the protein. The half-life time corresponds to the time at which the enzyme has lost half its initial enzymatic activity.

(42) As can be seen in FIG. 2, the half-life time of the DSR-OK enzyme at 30 C. is 111 h10 h during a characterization in crude (nonpurified) medium. The DSR-OK enzyme is thus very stable, which is a particularly advantageous property for a glucansucrase of glycoside hydrolase family 70.

(43) In comparison, DSR-S vardel 4N, another recombinant glucansucrase, has a half-life time of only 24 h under the same conditions.

Example 7

Purification of the DSR-OK Recombinant Enzyme by Affinity Chromatography

(44) The DSR-OK recombinant enzyme produced in Escherichia coli is fused to two purification tags, 6His and Strep Tag II, at the N- and C-terminal ends respectively, in order to allow affinity purification. A double purification on a StrepTactin column (affinity for the Strep Tag II tag) proved to be the method that was the most efficient and of excellent quality.

(45) The enzymatic purifications are carried out on the KTAxpress system from GE Healthcare, in a chamber at 8 C. 10 ml of enzymatic extract containing the tagged DSR-OK protein are injected into a 5 ml Strep Tactin Sepharose High Performance column (GE Healthcare), preequilibrated with 1 PBS buffer, 280 mM NaCl, pH 7.4. After one hour of binding in a closed circuit, the elution is carried out, at 4 ml.min.sup.1, by means of a D-desthiobiotin gradient of from 0.05 to 2.5 mM in binding buffer (1 PBS, 280 mM NaCl, pH 7.4) on 20 column volumes. The purified fraction is desalted on a 10 DG column (Biorad) preequilibrated with 50 mM of sodium acetate buffer, pH 5.75, 0.05 g.l.sup.1 CaCl.sub.2, 0.1% Tween80. In order to improve the purification factor and the quality of the pure enzymatic preparation, the extract previously obtained is again purified according to these same conditions.

(46) The protein concentrations measured at 280 nm in a Nanodrop 1000 3.7.1 spectrophotometer from Thermo Scientific, by setting the molar extinction coefficient of the DSR-OK enzyme at 224160 M.sup.1.cm.sup.1 and its molecular weight at 165124 Da (predicted by the Expasy ProtParam program available online).

Example 8

Determination of the Kinetic Parameters of the Recombinant DSR-OK Dextransucrase Enzyme

(47) The kinetic parameters (Vm, Km and Kcat) were determined at 30 C., in 50 mM of sodium acetate buffer, pH 5.75, supplemented with 250 mg.l.sup.1 of BSA. The initial rates are measured for sucrose concentrations ranging from 2 to 600 mM, using the purified enzyme at a final concentration of 1 U.ml.sup.1. Samples are taken at regular intervals, and the enzymatic reaction is stopped by heating at 95 C. for 5 min.

(48) The samples are then analyzed by high performance liquid chromatography (HPLC) on an Aminex Biorad HPX-87K column (3007.8 mm, Biorad). The column oven temperature is maintained at 65 C. and ultrapure water is used as eluent at a flow rate of 0.6 ml.min.sup.1. Standard ranges of 5, 10, 15 and 20 g.kg.sup.1 of sucrose, leucrose, glucose and fructose are prepared in order to allow quantification of various sugars. The detection is carried out by refractometry.

(49) Since DSR-OK is a Michaelian enzyme, the kinetic parameters Vm and Km are determined from the graphic Lineweaver and Burk representation, according to the equation

(50) $\frac{1}{\mathrm{vi}}=\left(\frac{\mathrm{Km}}{V\max }\frac{1}{\left[S\right]}\right)+\frac{1}{V\max }$
where [S] represents the initial concentration of sucrose and vi represents the initial rate.

(51) The kinetic parameters of the enzyme were determined in 50 mM of sodium acetate buffer, pH 5.75, in the presence of BSA (250 mg.l.sup.1) and at 30 C.

(52) It was thus demonstrated that DSR-OK, which follows a Michaelian mechanism with inhibition by excess substrate, is a very effective catalyst with an affinity constant Km of 9 mM1 mM and a catalytic constant Kcat of 550 s.sup.1 (FIGS. 3 and 4).

(53) These values are close to those of the DSR-S vardel 4N dextransucrase which is one of the most effective enzymes among the characterized glucansucrases of glycoside hydrolase family 70 (Km of 7.5 mM and Kcat of 584 s.sup.1).

(54) However, DSR-OK differs from the DSR-S vardel 4N dextransucrase in that it is much less inhibited by excess substrate. Indeed, as can be seen in FIG. 5, its inhibition constant only comes to 1M compared with 0.326M for DSR-S vardel 4N.

Example 9

Synthesis of Dextran by the Recombinant DSR-OK Dextransucrase

(55) The dextran syntheses are carried out starting from variable concentrations of sucrose (generally 100 g.l.sup.1 ), at 30 C. in 50 mM of sodium acetate buffer, pH 5.75, and using 1 U.ml.sup.1 of enzyme over a period of time of 15 h. For most of the analyses, the polymer was purified by two precipitations with 50% ethanol, followed by two washes and by resuspension in ultrapure water before being lyophilized.

Example 10

Analysis of the Nature of the Bonds of the Dextran Produced by the Recombinant DSR-OK Dextransucrase

(56) After lyophilization, 20 mg of purified dextran are diluted in 0.5 ml of deuterated water and analyzed by proton NMR with the Bruker Avance spectrometer (500 MHz). The spectra are then processed and interpreted with the TOPSPIN 3.0 software.

(57) It was thus demonstrated by the NMR analyses that the product synthesized from 100 g.l.sup.1 of sucrose, at 30 C., pH 5.75, is a polymer of glycosyl units which are 97.6% (0.2%) -1,6 linked and 2.4% -1,3 linked, as shown in FIG. 6.

(58) It is thus a virtually linear dextran, and this further demonstrates that the DSR-OK dextransucrase is a dextransucrase that is very specific for polymerization via glycosidic bonds of -1,6 type.

Example 11

Determination of the Macromolecular Characteristics of the Dextran Produced by the Recombinant DSR-OK Dextransucrase

(59) The number-average and weight-average molar mass and the structure of the dextran synthesized by DSR-OK were then analyzed by AFFFF-MALLS (Asymmetric Flow-Field-Flow-Fractionation-Multi-Angle Laser Light Scattering), using the crude synthesis media under the production conditions described in example 9.

(60) The samples were diluted 500 times, in water containing 0.02% of sodium azide, and filtered on a 0.45 m Durapore membrane, before injection (filtration yield>90%). The operating mode is the same as that used to characterize the high molar mass dextrans synthesized by DSR 4N variants (9). Thus, the samples are injected at 0.2 ml.min.sup.1 over a period of time of 300 s with a cross flow of 1 ml.min.sup.1. Once the injection is complete, a relaxation time of 60 seconds is imposed on the samples. The elution is carried out under an entrainment flow of 0.84 ml.min.sup.1, at a constant cross flow of 0.1 ml.min.sup.1 for 3125 seconds, at ambient temperature. The molar mass values (M.sub.i) and the radius of gyration values (R.sub.Gi,) are determined with the ASTRA software, version 5.3.2.13 (Wyatt Technology).

(61) At each time interval (i), the refractometric response makes it possible to determine the concentration C.sub.i. The molar mass and the radius of gyration are determined by extrapolation from the relationship of the light scattering at zero angle, by means of a Berry diagram according to:

(62) $\sqrt{\left(\frac{K_C}{R_{}}\right)}=\sqrt{\frac{1}{M_i}\left(1+\frac{16{}^2{n}^2}{3{}^2}{R}_{\mathrm{Gi}}^2{\sin }^2\left(/2\right)\right)}$

(63) where K is the optical constant, R.sub.is the Rayleigh ratio, is the wavelength of the incident laser beam, n is the refractive index of the light and is the angle of observation.

(64) The ASTRA software directly calculates the weight-average molar masses (M.sub.w) and number-average molar masses (M.sub.n), and also the z-average radius of gyration (R.sub.Gz) according to the following relationships:

(65) $M_n=\frac{{}_i{c}_i}{{}_i\frac{c_i}{M_i}}$$M_w=\frac{{}_i{c}_i{M}_i}{{}_i{c}_i}$$R_{\mathrm{Gz}}^2=\frac{{}_i{c}_i{M}_i{R}_{\mathrm{Gi}}^2}{{}_i{c}_i{M}_i}$

(66) The M.sub.w/M.sub.n ratio represents the dispersity index D.sub.i.

(67) The density (d.sub.Gapp) is calculated from the following equation:

(68) $d_{\mathrm{Gapp}}=\frac{M_w}{\left(\frac{4}{3}\right)R_{\mathrm{Gw}}^3}$

(69) where R.sub.Gw represents the weight-average radius of gyration.

(70) The hydrodynamic coefficient, .sub.G, is determined from the graphic representation of the radius of gyration (R.sub.Gi) as a function of the molar mass (M.sub.i) and according to the equation:
R.sub.Gi=K.sub.G.Math.M.sub.i.sup.G

(71) where K.sub.G is a constant.

(72) The value of the branching parameter g.sub.M is calculated according to the following relationship:

(73) $g_M=\frac{{\stackrel{\_}{R}}_{\mathrm{Gw}\left(\mathrm{br}\right)}^2}{{\stackrel{\_}{R}}_{\mathrm{Gw}\left(\mathrm{lin}\right)}^2}$

(74) where R.sub.Gw(br) and R.sub.Gw(lin) represent the weight-average radii of gyration of the branched polymer of its linear equivalent of the same chemical nature and of the same molar mass.

(75) It was thus demonstrated by the analysis of the macromolecular characteristics that the dextran has a very high weight-average molar mass M.sub.w of approximately 1.0110.sup.9 g.mol.sup.1 (0.310.sup.9 g.mol.sup.1), as can be seen in FIG. 7.

(76) The number-average molar mass is also high, namely M.sub.n=5.510.sup.8 g.mol.sup.1(1.610.sup.8 g.mol.sup.1).

(77) The dispersity index D.sub.i of the dextran produced by DSR-OK is thus approximately 1.8, which represents a very low index compared with the dextrans produced until now.

(78) For example, in comparison with the dextran produced by the historic strain L. mesenteroides NRRL B-512F, and with the dextran produced by the DSR-S vardel 4N recombinant enzyme, the dextran produced by the DSR-OK dextransucrase is larger in size, and is much less polydisperse than the native dextran produced by the L. mesenteroides NRRL B-512F strain.

(79) The radius of gyration of the polymer is also extremely high, about 370 nm (FIG. 9). The hydrodynamic coefficient, that is to say the slope of the graph representing the radius of gyration as a function of the molar mass (FIG. 9), is 0.48. This value shows that it is a virtually linear polymer, with very little branching.

(80) Table 2 reiterates the main macromolecular characteristics of the dextran produced by recombinant DSR-OK.

(81) TABLE-US-00002 TABLE 2 Characteristic Value M.sub.w (weight-average 1 10.sup.9 g .Math. mol.sup.1 0.3 10.sup.9 g .Math. mol.sup.1 molar mass) M.sub.n (number-average 5.5 10.sup.8 g .Math. mol.sup.1 1.6 10.sup.8 g .Math. mol.sup.1 molar mass) D.sub.i = M.sub.w/M.sub.n (dispersity index) 1.8 0.3 R.sub.Gz (z-average radius of 370 nm 18.5 nm gyration) d.sub.Gapp (apparent density) 8.2 g .Math. mol.sup.1.nm.sup.3 2.2 g .Math. mol.sup.1.nm.sup.3 .sub.G (hydrodynamic coefficient) 0.48 0.02 g.sub.M (average branching parameter) 0.0158 0.004

Example 12

Analysis of the Rheological Behavior of the Dextran Produced by the Recombinant DSR-OK Dextransucrase

(82) Flow Curve and Determination of the Yield Point of the Dextran in its Crude Synthesis Medium Starting from Various Sucrose Concentrations

(83) The syntheses are carried out in a total volume of 20 ml, starting from various initial concentrations of sucrose (50, 75, 100 and 150 g.l.sup.1), in 50 mM of sodium acetate buffer, pH 5.75, at 1 U.ml.sup.1 of enzyme. The temperature and the stirring are set at 30 C. and at 60 rpm. The enzymatic reaction is carried out over a period of time of 15 hours.

(84) The rheological analyses of the dextran (in its crude synthesis medium) are carried out on the Haake Mars III rheometer from Thermo Scientific, controlled by the Haake RheoWin 4 software. All the measurements are determined using a plate-plate geometry (diameter of 35 mm), with a gap of 0.5 mm, at 20 C. (peltier MTMC MarsIII) and at atmospheric pressure.

(85) The flow curves are obtained by varying the rate gradient from 10.sup.1 to 10.sup.3s.sup.1. The yield point values are determined from the graphic representation plotting the values of the stress as a function of the rate gradient. The yield point is determined by the stress obtained at the lowest shear rate (tending toward a plateau).

(86) Viscosity Curve and Viscoelastic Measurements of the Purified Dextran

(87) The polymer, purified by means of two ethanol precipitations and lyophilized, is resuspended at 50 g.l.sup.1 in distilled water and dissolved overnight at 25 C., with gentle stirring. The rheological properties are measured with an imposed-strain rheometer (Ares, TA.) using a cone-plate geometry (diameter of 5 cm, cone angle of 0.05 rad) at 20 C. and at atmospheric pressure. The flow curve is determined by varying the rate gradient from 10.sup.2 to 10.sup.2s.sup.1. The mechanical spectra (moduli G and G as a function of frequency) are determined in dynamic regime, by varying the frequency from 10.sup.2 to 10.sup.2 rad.s.sup.1, at an imposed strain amplitude located in the linear viscoelasticity range.

(88) It is observed that the dextran polymer is very viscous to the naked eye and that it is necessary to apply a force in order for it to flow.

(89) The flow curves determined on the basis of the crude synthesis medium for various initial concentrations of sucrose (50, 75, 100, and 150 g.l.sup.1) are presented in FIG. 10 and the flow curves determined on the basis of polymer purified by alcohol precipitation and prepared at a concentration of 5% (weight/volume) in distilled water are presented in FIG. 11.

(90) In both cases, the dynamic viscosity of the solution is very high for low shear rates (of about 100 Pa.s at 0.1 s.sup.1. FIGS. 10 and 11). The polymer adopts a behavior of shear-thinning or pseudoplastic type, i.e. its dynamic viscosity decreases when the rate gradient (or shear rate) increases.

(91) As can be seen in FIG. 14, the dextran produced by the DSR-OK dextransucrase has a viscosity approximately 500 times higher than the native dextran produced by L. mesenteroides NRRL B-512F for low applied shear stresses. In addition, the native dextran exhibits Newtonian behavior, unlike the dextrans produced by DSR-OK or DSR-S vardel 4N, which are shear-thinning.

(92) Furthermore, the dextran in solution has a yield point. Thus, yield points of 26 Pa and 38 Pa were measured for the dextran in the crude synthesis medium using 100 g.l.sup.1 and 200 g.l.sup.1 of sucrose respectively (FIG. 12).

(93) In comparison, the dextran of the synthesis medium produced by the DSR-S vardel 4N recombinant enzyme using 100 g.l.sup.1 has a yield point of 12 Pa.

(94) Low dextran concentrations could be used for products requiring a yield point, for example as a replacement for xanthan gum solution or guar solution, used as thickeners and having yield points at 10 g.l.sup.1 of 7 and 4 Pa, respectively. The dextran in accordance with the present invention can thus be used in products of toothpaste, sauce, etc. type.

(95) The frequency scanning tests, under oscillation conditions, indicate moreover that the polymer is a weak gel. This is because, as can be seen in FIG. 13, the elastic modulus G is greater than the viscous modulus G in the range of frequencies tested, from 10.sup.2 to 10.sup.2 rad.s.sup.1.

(96) Finally, it is noted that the viscosity of the polymer produced by DSR-OK remains stable when constant shear stresses of long duration are applied, while the viscosity of the polymer produced by DSR-S vadel 4N decreases under the same conditions (FIG. 15). The dextran in accordance with the present invention can thus be used in industrial processes for which constant stirring is required.

Example 13

Determination of the Glass Transition Temperature and of the Water Content of the Dextran Produced by the Recombinant DSR-OK Dextransucrase

(97) The polymer purified by means of two ethanol precipitations and lyophilized is equilibrated at 57% and at 43% relative humidity by placing it under vacuum in the presence of saturated solutions of NaBr and of K.sub.2CO.sub.3 at ambient temperature for one week. The glass transition temperatures (T.sub.g) are determined by means of a differential scanning calorimetry system, DSC Q100 (TA Instruments, France). The device is calibrated with indium. Measurements are carried out on 2 to 30 mg of sample using sealed aluminum capsules (TA Instruments, Guyancourt, France), heated from 0 to 120 C. at 3 C.min.sup.1. Two heating scans were carried out, separated by a phase of cooling down to 0 C. at 10 C. min.sup.1, making it possible to prevent against any signature due to aging of the sample. An empty capsule is used as reference. The glass transition temperature (T.sub.g) is taken at the inflection point of the change in heat capacity.

(98) The water content is determined after each calorimetric measurement by thermogravimetric analysis (TGA) using a TGA2050 system (T.A. Instruments, New Castle, Del., U.S.A.). The water content corresponds to the weight loss when the sample is heated up to 130 C. at 10 C. min.sup.1 and then maintained at this temperature for 40 min.

(99) The DSC (Differential Scanning calorimetry) analyses thus made it possible to determine glass transition temperatures of 95 C. (1 C.) for a water content of 6.6%, and of 25 C. (1 C.) for a water content of 12.9%.

(100) For a water content of approximately 13%, the polymer will thus exhibit a rubbery state at temperatures above 25 C. and will be considered to be brittle below 25 C.

REFERENCES

(101) (1) Characterization of Leuconostoc mesenteroides NRRL B-512F dextransucrase (DSRS) and identification of amino-acid residues playing a key role in enzyme activity, Monchois et al., Applied Microbiology and Biotechnology, October 1997, vol. 48, Issue 4, 465-472

(102) (2) High-level production and purification of a fully active recombinant dextransucrase from Leuconostoc mesenteroides NRRL B-512F, Moulis and al, FEMS Microbiology Letters, August 2006, vol. 261, Issue 2, 203-210

(103) (3) Functional Divergence in the Genus Oenococcus as Predicted by Genome Sequencing of the Newly-Described Species, Oenococcus kitaharae, Borneman and al, PloS ONE, January 2012, vol. 7, Issue 1

(104) (4) Oenococcus kitaharae sp. nov., a non-acidophilic and non-malolacfic-fermenting oenococcus isolated from a composting distilled shochu residue, Akihito Endo and Sanae Okada, International Journal of Systematic and Evolutionary Microbiology (2006), 56, 2345-2348

(105) (5) Glucansucrases: Three-dimensional structures, reactions, mechanism, alpha-glucan analysis and their implications in biotechnology and food applications Lemhuis et al., Journal of Biotechnology, January 2013, vol. 163, Issue 2, 250-272

(106) (6) Dextran: effect of process parameters on production, purification and molecular weight and recent applications, Vettori et al., Dilogos & Cincia, ISSN 1678-0493, no 31, September 2012

(107) (7) Functional Polymers Based on Dextran, Thomas Heinze, Tim Liebert, Brigitte Heublein, Stephanie Hornig, Adv Polym Sci (2006) 205: 199-291, DOI 10.1007/12_100.

(108) (8) Structure and macromolecular properties of Weissella confusa and Leuconostoc citreum dextrans with a potential application in sourdough, Ndegwa Henry Maina, 1 Jun. 2012, University of Helsinki, Department of Food and Environmental Sciences, Chemistry and Biochemistry Division.

(109) (9) Structure and Property Engineering of alpha-D-Glucans Synthesized by Dextransucrase Mutants, Irague and al, BioMacromolecules, 2012, vol. 13, Issue 1, 187-195.

(110) (10) A method for determination of invertase activity, Sumner & Howell, Journal of biological chemistry, 1935, vol. 108, Issue 51

(111) (11) Online Determination of Structural Properties and Observation of Deviations from Power Law Behavior, Rolland-Sabat et al, Biomacromolecules, 2008, vol. 9, 1719-1730.