Genes and uses thereof, methods for synthesizing odd numbered medium chain aliphatic aldehydes and methods for synthesizing even numbered medium chain aliphatic hydrocarbons

Abstract

Provided are genes, coding proteins and uses thereof, gene elements, genes and uses, gene elements, methods for synthesizing odd numbered medium chain aliphatic aldehydes, for synthesizing odd numbered medium chain aliphatic alcohol and for synthesizing even numbered medium chain aliphatic hydrocarbons. Provided is method for producing odd numbered aliphatic alcohols in Escherichia coli. An -dioxygenase from rice is used without additional deoxidization and energy supply from cells. The -dioxygenase can also be used for synthesizing aliphatic alcohols with different proportions of C11 to C15 by co-working with different thioesterases.

Claims

1. A method for synthesizing an odd numbered C8-C15 aliphatic alcohol through an aliphatic aldehyde, comprising using a synthetic polynucleotide encoding -dioxygenase which has an amino acid sequence identical to the amino acid sequence which the nucleotide sequence set forth in SEQ ID NO: 1 encodes, and a synthetic polynucleotide encoding aldehyde reductase which has an amino acid sequence identical to the amino acid sequence which yjgB gene set forth in SEQ ID NO: 76 encodes.

2. The method according to claim 1, wherein the aliphatic aldehyde is an odd numbered C8-C15 aliphatic aldehyde.

3. A vector comprising the synthetic polynucleotide according to claim 1.

4. An isolated host cell comprising the vector according to claim 3.

5. The isolated host cell according to claim 4, wherein the isolated host cell is Escherichia coli.

6. A polynucleotide element for synthesizing the odd numbered C8-C15 aliphatic alcohol, comprising a synthetic polynucleotide encoding -dioxygenase which has an amino acid sequence identical to the amino acid sequence which the nucleotide sequence set forth in SEQ ID NO: 1 encodes, a synthetic polynucleotide encoding aldehyde reductase which has an amino acid sequence identical to the amino acid sequence which yjgB gene set forth in SEQ ID NO: 76 encodes, and a polynucleotide sequence set forth in SEQ ID NO: 77 encoding a thioesterase.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the gas chromatogram of the product after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing pACYC-Trc-tesA (FIG. 1A) or CYX134 plasmid (FIG. 1B) in Example 4; wherein, 1: C.sub.11 aldehyde; 2: C.sub.11 alcohol; 3: C.sub.13 aldehyde; 4: C.sub.13 alcohol; 5: C.sub.15:1 aldehyde; 6: C.sub.15 alcohol; 7: C.sub.16 alcohol (internal standard, IS); (FIG. 1C) C.sub.11 aldehyde mass spectrum; (FIG. 1D) C.sub.11 alcohol mass spectrum; (FIG. 1E) C.sub.13 aldehyde mass spectrum; (FIG. 1F) C.sub.13 alcohol spectrum; (FIG. 1G) C.sub.15:1 aldehyde mass spectrum; (FIG. 1H) C.sub.15 alcohol mass spectrum; the numbers in parentheses are (match factor, reverse match factor); match factors and reverse match factors are capable of quantitatively describing the matching degree between product mass spectrum and database spectrum. If the value is higher than 900, it shows a very excellent match, 800-900 is an excellent match and 700-800 is a good match.

(2) FIG. 2 shows the results of the aliphatic alcohol output after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing CYX143, CYX144, CYX145, CYX146 and CYX147 plasmids in Example 5.

(3) FIG. 3 shows the results of the aliphatic hydrocarbon output after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing CYX148, CYX149, CYX150 and CYX151 plasmids in Example 6; (FIG. 3A) comparison of the yield of aliphatic hydrocarbons of different engineering strains; (FIG. 3B) gas chromatogram of the product after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing CYX148 plasmid; (FIG. 3C) gas chromatogram of the product after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing CYX151 plasmid. 8: C.sub.12 hydrocarbon; 9: C.sub.14 hydrocarbon; (FIG. 3D) C.sub.12 hydrocarbon mass spectrum; (FIG. 3E) C.sub.14 hydrocarbon mass spectrum.

(4) FIG. 4 shows the results of the optimization of the metabolic flow between -dioxygenase and endogenous thioesterase in Example 7.

(5) FIG. 5 shows that it is confirmed that -dioxygenase possesses extensive substrate selectivity and controllability in cell in Example 8. FIG. 5A shows the proportion results of the output of fatty acids of different chain length after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing YX101, YX102 and YX103 plasmids in Example 8; FIG. 5B shows the proportion results of the output of aliphatic aldehydes and aliphatic alcohols of different chain length after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing YX135, YX104 and YX105 plasmids in Example 8; FIG. 5C shows the results of the output of fatty acids after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing YX101, YX102 and YX103 plasmids in Example 8; FIG. 5D shows the results of the output of aliphatic aldehydes and aliphatic alcohols after induced fermentation at 30 C. for 40 h in E. coli BL21 (DE3) containing YX135, YX104 and YX105 plasmids in Example 8.

(6) FIG. 6 shows the results for adjusting the expression intensity of the upstream fatty acid synthesis pathway to increase the synthesis ability of the odd numbered medium chain aliphatic alcohols in Example 9.

(7) FIG. 7 shows the results of fed-batch fermentation in Example 10. FIG. 7A shows the curves of biomass (OD600), residual glycerol, acetic acid content, aliphatic alcohol content over time in fed-batch fermentation in Example 10; FIG. 7B shows the proportion of aliphatic alcohol content of different chain length in the fermentation broth after 9 hours, 17 hours and 27.5 hours of fed-batch fermentation in Example 10.

DETAILED DESCRIPTION OF THE INVENTION

(8) The present invention discloses a gene, a coded protein and use thereof, a gene element, methods for synthesizing an odd numbered medium chain aliphatic aldehyde, for synthesizing an odd numbered medium chain aliphatic alcohol and for synthesizing an even numbered medium chain aliphatic hydrocarbon. Those skilled in the art can use the content herein for reference and suitably modify the process parameters to achieve them. It should be noted that all similar alternatives and modifications will be apparent to those skilled in the art, and they are all deemed to be included in the present invention. The method and use of the present invention have been described by way of preferred embodiments, and related personnel obviously can alter or appropriately change and combine the methods and uses described herein so as to realize and apply the technology of the present invention without departing from the content, spirit and scope of the present invention.

(9) All the materials and reagents used in the gene, the encoded protein and use thereof, the gene element, the methods for the synthesis of an odd numbered medium chain aliphatic aldehyde, for the synthesis of an odd numbered medium chain aliphatic alcohol and for the synthesis of an even numbered medium chain aliphatic hydrocarbon, provided in the present invention are commercially available.

Plasmid No. and Information

(10) TABLE-US-00001 No. Plasmid content YX101 pACYC-(T7-tesA) YX 102 pACYC-(T7-BTE) YX 103 pACYC-(T7-BnFatA) YX 104 pACYC-(T7-Dox-BTE) YX 105 pACYC-(T7-Dox-BnFatA) YX 112 pACYC-(Dox-tesA)-(T7-Dox) YX 114 pACYC-(Dox-tesA)-(T7-tesA) YX 120 pACYC-(T7-Dox) YX 130 pBAD33-tesA-Dox YX 131 pACYC-(T7-tesA-Dox) YX 132 pACYC-(T5-tesA-Dox) YX 133 pACYC-(LacUV5-tesA-Dox) CYX 134 pACYC-(Trc-tesA-Dox) YX 135 pACYC-(T7-Dox-tesA) YX 136 pACYC-(T5-Dox-tesA) YX 137 pACYC-(LacUV5-Dox-tesA) YX 138 pACYC-(Trc-Dox-tesA) YX 140 pBAD33-Dox-tesA CYX 143 pACYC-(Trc-tesA-Dox-AdhP) CYX 144 pACYC-(Trc-tesA-Dox-yjgB) CYX 145 pACYC-(Trc-tesA-Dox-yqhD) CYX 146 pACYC-(Trc-tesA-Dox-AdhE) CYX 147 pACYC-(Trc-tesA-Dox-slr1192) CYX 148 pACYC-(Trc-tesA-Dox-CER1) CYX 149 pACYC-(Trc-tesA-Dox-AD9313) CYX 150 pACYC-(Trc-tesA-Dox-AD7942) CYX 151 pACYC-(Trc-tesA-Dox-AD73102) YX 201 pACYC-(T7-RFP) YX 210 pACYC-(T5-RFP) YX 211 pACYC-(LacUV5-RFP) YX 212 pACYC-(Trc-RFP) YX 213 pACYC-(BAD-RFP) YX 221 pACYC-(T7-Dox.sub.his)-(T7-tesA) YX 222 pACYC-(T5-Dox.sub.his)-(T7-tesA) YX 223 pACYC-(Trc-Dox.sub.his)-(T7-tesA) YX 224 pACYC-(LacUV5-Dox.sub.his)-(T7-tesA) YX 225 pACYC-(BAD-Dox.sub.his)-(T7-tesA) YX 220 pACYC-(T7-Dox)-(T7-tesA) YX 232 pACYC-(T5-Dox)-(T7-tesA) YX 233 pACYC-(Trc-Dox)-(T7-tesA) YX 234 pACYC-(LacUV5-Dox)-(T7-tesA) YX 235 pACYC-(BAD-Dox)-(T7-tesA) FabD pTrcHis2A-fabD FabG pTrcHis2A-fabG FabA pTrcHis2A-fabA FabI pTrcHis2A-fabI FabB pTrcHis2A-fabB FadR pTrcHis2A-fadR

Detailed Information of Plasmids

(11) TABLE-US-00002 Plasmid name Replicon Promoter and over-expressed gene Resistance YX101 p15A P.sub.T7: tesA (derived from E. coli MG1655) Chloramphenicol YX102 p15A P.sub.T7: bte (derived from U. californica, optimized with Chloramphenicol E. coli codons) YX103 p15A P.sub.T7: BnfatA (derived from B. napus, optimized with E. coli Chloramphenicol codons) YX104 p15A P.sub.T7: dox and bte (dox is derived from O. sativa, Chloramphenicol optimized with E. coli codons) YX105 p15A P.sub.T7: dox and BnfatA Chloramphenicol YX112 p15A P.sub.T7: dox and tesA, P.sub.T7: dox Chloramphenicol YX114 p15A P.sub.T7: dox and tesA, P.sub.T7: tesA Chloramphenicol YX120 p15A P.sub.Trc: tesA Chloramphenicol YX130 p15A P.sub.BAD: tesA and dox Chloramphenicol YX131 p15A P.sub.T7: tesA and dox Chloramphenicol YX132 p15A P.sub.T5: tesA and dox Chloramphenicol YX133 p15A P.sub.lacUV5: tesA and dox Chloramphenicol CYX134 p15A P.sub.Trc: tesA and dox Chloramphenicol YX135 p15A P.sub.T7: dox and tesA Chloramphenicol YX136 p15A P.sub.T5: dox and tesA Chloramphenicol YX137 p15A P.sub.lacUV5: dox and tesA Chloramphenicol YX138 p15A P.sub.Trc: dox and tesA Chloramphenicol YX140 p15A P.sub.BAD: dox and tesA Chloramphenicol CYX143 p15A P.sub.Trc: tesA, dox and adhP (adhP is derived from E. coli Chloramphenicol BL21(DE3).sup.) CYX144 p15A P.sub.Trc: tesA, dox and yjgB (yjgB is derived from E. coli Chloramphenicol BL21(DE3).sup.) CYX145 p15A P.sub.Trc: tesA, dox and yqhD (yqhD is derived from E. coli Chloramphenicol BL21(DE3), with NdeI restriction site removed) CYX146 p15A P.sub.Trc: tesA, dox and adhE (yqhD is derived from E. coli Chloramphenicol BL21(DE3), with NcoI restriction site removed) CYX147 p15A P.sub.Trc: tesA, dox and slr1192 (slr1192 is derived from Chloramphenicol Synechocystis sp. PCC 6803, optimized with E. coli codons) CYX148 p15A P.sub.Trc: tesA, dox and cer1 (cer1 is derived from A. thaliana, Chloramphenicol optimized with E. coli codons) CYX149 p15A P.sub.Trc: tesA, dox and ad9313 (ad9313 is derived from P. marinus Chloramphenicol MIT9313, optimized with E. coli codons) CYX150 p15A P.sub.Trc: tesA, dox and ad7942 (ad7942 is derived from S. elongates Chloramphenicol PCC7942, optimized with E. coli codons) CYX151 p15A P.sub.Trc: tesA, dox and ad73102 (ad73102 is derived from Chloramphenicol N. punctiforme PCC73102, optimized with E. coli codons) YX201 p15A P.sub.T7: rfp (derived from standard biology brick, Massachusetts Institute of Technology, BBa_E1010 element) YX210 p15A P.sub.T5: rfp YX211 p15A P.sub.lacUV5: rfp YX212 p15A P.sub.Trc: rfp YX213 p15A P.sub.BAD: rfp YX221 p15A P.sub.T7: dox with 6*His tag, P.sub.T7: tesA Chloramphenicol YX222 p15A P.sub.T5: dox with 6*His tag, P.sub.T7: tesA Chloramphenicol YX223 p15A P.sub.lacUV5: dox with 6*His tag, P.sub.T7: tesA Chloramphenicol YX224 p15A P.sub.Trc: dox with 6*His tag, P.sub.T7: tesA Chloramphenicol YX225 p15A P.sub.BAD: dox with 6*His tag, P.sub.T7: tesA Chloramphenicol YX220 p15A P.sub.T7: dox, P.sub.T7: tesA Chloramphenicol YX232 p15A P.sub.T5: dox, P.sub.T7: tesA Chloramphenicol YX233 p15A P.sub.lacUV5: dox, P.sub.T7: tesA Chloramphenicol YX234 p15A P.sub.Trc: dox, P.sub.T7: tesA Chloramphenicol YX235 p15A P.sub.BAD: dox, P.sub.T7: tesA Chloramphenicol FabD pBR322 P.sub.Trc: fabD (derived from E. coli MG1655, with XhoI Ampicillin restriction site removed) FabG pBR322 P.sub.Trc: fabG (derived from E. coli MG1655, with NcoI Ampicillin restriction site removed) FabA pBR322 P.sub.Trc: fabA (derived from E. coli MG1655) Ampicillin FabI pBR322 P.sub.Trc: fabI (derived from E. coli MG1655) Ampicillin FabB pBR322 P.sub.Trc: fabB (derived from E. coli MG1655) Ampicillin FadR pBR322 P.sub.Trc: fabR (derived from E. coli MG1655) Ampicillin

(12) The invention is further illustrated in conjunction with the following examples:

EXAMPLE 1

Construction of the Gene Element for Synthesizing an Odd Numbered Medium Chain Aliphatic Aldehyde

(13) Experiment Materials:

(14) Thioesterase (TesA): The thioesterase gene I (tesA) endogenous to E. coli was purchased from addgene (Plasmid 24636). The gene is placed into a plasmid having p15A as the replicon and placUV5 as the promoter, designated as pKS1, and the 75 bp nucleotide behind the start codon ATG is removed. The removed nucleotide encodes an amino acid sequence that is a signal peptide that is used to localize the enzyme in the intracellular substance. With this signal peptide sequence removed, the thioesterase can be enriched within the cells, and plenty of free fatty acids were produced in E. coli.

(15) -Dioxygenase (Dox): the protein sequence of -dioxygenase (NCBI Reference Sequence: NP_001066718.1) reported in Oryza sativa is optimized according to the E. coli codons. The DNA molecule encoding the -dioxygenase after optimization has the nucleotide sequence set forth in SEQ ID NO: 1, wherein the gene is synthesized in Genewiz.

(16) Plasmid pTrcHis2A was purchased from Invitrogen.

(17) Plasmid pACYCDuet-1 was purchased from Novagen.

(18) Plasmid pET21a was purchased from Novagen.

(19) Experiment Methods:

(20) 1. Construction of pHisTrc-tesA plasmid 1) The vector was pTrcHis2A, restriction-digested with NcoI and BamHI; with a length of 4400; purified; 2) The template was pKS1, amplified with the primers NcoI-tesA-fwd and BamHI-SpeI-tesA-rev; with a length of 575; gel-extracted, restriction-digested with NcoI and BamHI, purified and ligated to vector; 3) Colony PCR with primer pTrcHis2A-F and primer pTrcHis2A-R, with the correct length of 894.

(21) 2. Construction of pACYC-Trc-tesA plasmid 1) The pACYCDuet-1 was amplified with the primers AflII-pACYC-fwd and PstI-pACYC-rev, and with a length of 3810; gel-extracted, restriction-digested with PstI and AflII, and purified. 2) The fragment template was pHisTrc-tesA; PCR was carried out with PstI-Gibson-pHisTrc-fwd and AflII-Gibson-rrnBT1-rev, with a length of 1190, gel-extracted, and Gibson ligated to vector. 3) Colony PCR with Duet-seq-F and pACYCDuet-R, with a length of 1443.

(22) 3. Construction of pET21a-Dox plasmid 1) The vector was pET21a, restriction-digested with NdeI and BamHI, with a length of 5350. 2) The fragment template was the synthetic dox gene, amplified with the primers NdeI-Dox-fwd and BamHI-SpeI-Dox-rev, with a length of 1885, gel-extracted, restriction-digested with NdeI and BamHI, purified and ligated to vector. 3) Colony PCR with the primer pET-fwd and primer pET-rev, with the correct length of 2401.

(23) 4. Construction of pET28a-Dox plasmid 1) The vector was pET28a, restriction-digested with NdeI and BamHI. 2) The fragment template was the synthetic dox gene, amplified with the primers NdeI-Dox-fwd and BamHI-SpeI-Dox-rev, with a length of 1885, gel-extracted, restriction-digested with NdeI and BamHI, purified and ligated to vector. 3) Colony PCR with the primer pET-fwd and the primer pET-rev.

(24) 5. Construction of pET21a-tesA plasmid 1) The vector was pET21a, restriction-digested with NdeI and BamHI. 2) The fragment template was pKS1, amplified with the primers NdeI-teaA-fwd and BamHI-SpeI-tesA-rev, gel-extracted, restriction-digested with NdeI and BamHI, purified and ligated to vector. 3) Colony PCR with the primer pET-fwd and the primer pET-rev.

(25) TABLE-US-00003 TABLE1 Thelistofprimersneededintheconstructionofthegeneelements forsynthesizingoddnumberedmediumchainaliphaticaldehydes Sequence Primername No. Sequence NcoI-tesA-fwd SEQID CCTCCATGGCGGACACGTTATTGATTCTG No.6 BamHI-SpeI-tesA-rev SEQID CCGGGATCCGAATACTAGTTATGAGTCATGATT No.7 TACTA pTrcHis2A-F SEQID ACAGCGCCGCTGAGAAAAAGCGAA No.8 pTrcHis2A-R SEQID AGTTCGGCATGGGGTCAGGT No.9 AflII-pACYC-fwd SEQID GGCCCTTAAGTCGAACAGAAAGTA No.10 PstI-pACYC-rev SEQID TATCTGCAGCATAAGGGAGAGCGTCGAGA No.11 PstI-Gibson-pHisTrc- SEQID TCTCGACGCTCTCCCTTATGCTGCAGACATCAT fwd No.12 AACGGTTCTGGCA AflII-Gibson-rrnBT1- SEQID TACGATTACTTTCTGTTCGACTTAAGGGCGGAT rev No.13 TTGTCCTACTCAG Duet-seq-F SEQID GTCCATGTGCTGGCGTTCAA No.14 pACYCDuet-R SEQID GATTATGCGGCCGTGTACAA No15 NdeI-Dox-fwd SEQID ACAGGCATATGGGCAGCGGTTTATTCAA No.16 BamHI-SpeI-Dox-rev SEQID GGGGGATCCGAATACTAGTTATTAATAGTCTGC No.17 ATCCC pET-fwd SEQID TCTTCCCCATCGGTGATGTC No.18 pET-rev SEQID TCACGCTGCGCGTAACCACCACA No.19

EXAMPLE 2

Construction of the Gene Elements for Synthesizing Odd Numbered Medium Chain Aliphatic Alcohols

(26) Experiment Materials

(27) AdhE: Acetaldehyde coenzyme A reductase/ferric ion-dependent ethanol dehydrogenase, derived from the genome of E. coli BL21 (DE3) (NCBI-GeneID: 8180074), wherein the NcoI restriction site in the sequence was substituted by single point mutation.

(28) AdhP: Ethanol active dehydrogenase/acetaldehyde active reductase, derived from the genome of E. coli BL21 (DE3) (NCBI-GeneID: 8181169).

(29) YqdD: NADPH-dependent acetaldehyde reductase, derived from the genome of E. coli BL21 (DE3) (NCBI-GeneID: 8180496), wherein the NdeI restriction site in the sequence was substituted by single point mutation.

(30) YjgB: Ethanol dehydrogenase (atypical zinc ethanol dehydrogenase-like protein, zinc and NADPH-dependent), derived from the genome of E. coli BL21 (DE3) (NCBI-GeneID: 8182107).

(31) Slr1192: Ethanol dehydrogenase containing zinc, derived from Synechocystis sp. PCC 6803, with the protein sequence of NCBI Reference Sequence: NP_443028.1, optimized according to E. coli codons; after optimization, the DNA molecule encoding Slr1192 has the nucleotide sequence set forth in SEQ ID NO: 2, and the gene was synthesized in our laboratory.

(32) Plasmid pET28a was purchased from Novagen.

(33) Experiment Methods

(34) 1. Construction of pHisTrc-tesA plasmid 1) The vector was pTrcHis2A, restriction-digested with NcoI and BamHI; with a length of 4400; purified. 2) The template was pKS1, amplified with the primers NcoI-tesA-fwd and BamHI-SpeI-tesA-rev; with a length of 575; gel-extracted, restriction-digested with NcoI and BamHI, purified and ligated to vector. 3) Colony PCR with primer pTrcHis2A-F and primer pTrcHis2A-R, with the correct length of 894.

(35) 2. Construction of pACYC-Trc-tesA plasmid 1) The pACYCDuet-1 was amplified with the primers AflII-pACYC-fwd and PstI-pACYC-rev, and with a length of 3810; gel-extracted, restriction-digested with PstI and AflII, and purified. 2) The fragment template was pHisTrc-tesA; PCR was carried out with PstI-Gibson-pHisTrc-fwd and AflII-Gibson-rrnBT1-rev, with a length of 1190, gel-extracted, and Gibson ligated to vector. 3) Colony PCR with Duet-seq-F and pACYCDuet-R, with a length of 1443.

(36) 3. Construction of pET21a-Dox plasmid 1) The vector was pET21a, restriction-digested with NdeI and BamHI, with a length of 5350. 2) The fragment template was the synthetic dox gene, amplified with the primers NdeI-Dox-fwd and BamHI-SpeI-Dox-rev, with a length of 1885, gel-extracted, restriction-digested with NdeI and BamHI, purified and ligated to vector. 3) Colony PCR with the primer pET-fwd and primer pET-rev, with the correct length of 2401.

(37) 4. Construction of pET28a-AdhP plasmid 1) The vector was pET28a, restriction-digested with NdeI and BamHI, with a length of 5400. 2) The fragment template was E. coli BL21 (DE3) genome, amplified with primers NdeI-AdhP-fwd and BamHI-SpeI-AdhP-rev, with a length of 1036. 3) Colony PCR with primer pET-fwd and primer pET-rev, with the correct length of 1552.

(38) 5. Construction of plasmids pET28a-YjgB, pET28a-YqhD, pET28a-AdhE and pET28a-Slr1192 1) The vector was pET28a-AdhP, restriction-digested with NdeI and SpeI, gel-extracted for the fragments with a length of 5350. 2) The fragment template was E. coli BL21 (DE3) genome, amplified with primers NdeI- *** -fwd and SpeI- *** -rev for different gene fragments (*** represents a gene name), see primer sequence in Table 3, and the fragment name and length after PCR are shown in Table 2, wherein substitution of NdeI restriction site was required in YqhD and substitution of NcoI restriction site was required in AdhE, therefore it was needed to perform PCR amplification of two parts on the left and right sides with the mutation site as the center, with the fragments gel-extracted followed by overlapping, and finally the fragments with the NdeI and SpeI restriction sites were gel-extracted; restriction-digested with NdeI and SpeI, purified and ligated to vector. 3) Colony PCR with primer pET-fwd and primer pET-rev, with the correct length shown in Table 2.

(39) TABLE-US-00004 TABLE 2 Detailed information of the fragments Fragment Colony PCR name Fragment length length YjgB 1038 1564 YqhD-left 808 1705 YqhD-right 392 YqhD 1179 AdhE-left 1981 3217 AdhE-right 731 AdhE 2691 slr1192 1026 1552

(40) TABLE-US-00005 TABLE3 Thelistofprimersneededintheconstructionofthegeneelements forsynthesizingoddnumberedmediumchainaliphaticalcohols Sequence Primername No. Sequence NdeI-AdhP-fwd SEQID GGGGACATATGAAGGCTGCAGTTGTTAC No.20 BamHI-SpeI-AdhP-rev SEQID GAGGGATCCGAATACTAGTTAGTGACGGAAAT No.21 CAATCA NdeI-yjgB-fwd SEQID GGGGCATATGTCGATGATAAAAAGCTATG No.22 SpeI-yjgB-rev SEQID GGGACTAGTTATCAATAATCGGCTTTCAAC No.23 NdeI-yqhD-fwd SEQID GGGGCATATGAACAACTTTAATCTGCA No.24 yqhD-NdeI-left-rev SEQID TGCGTTGCCCAGTCCTGCG No.25 yqhD-NdeI-right-fwd SEQID CGCAGGACTGGGCAACGCACATGCTGGGCCAC No.26 GAACTGA SpeI-yqhD-rev SEQID GGGACTAGTTAGCGGGCGGCTTCGTATA No.27 NdeI-adhE-fwd SEQID GGTTCATATGGCTGTTACTAATGTCGC No.28 adhE-NcoI-left-rev SEQID GCGTGAGTTACTGCGTCCAG No.29 adhE-NcoI-right-fwd SEQID CTGGACGCAGTAACTCACGCGATGGAAGCTTA No.30 TGTTTCTGT SpeI-adhE-rev SEQID GGGACTAGTTAAGCGGATTTTTTCGCTTTTTTC No.31 NdeI-slr1192-fwd SEQID GGTACATATGATCAAGGCTTACGCTGC No.32 SpeI-slr1192-rev SEQID GGGACTAGTTAGTTTTTAGAGTGAGACA No.33

EXAMPLE 3

Construction of the Gene Elements for Synthesizing Even Numbered Medium Chain Aliphatic Hydrocarbons

(41) Experiment Materials

(42) CER1: Aliphatic aldehyde decarbonylase, derived from Arabidopsis thaliana; the protein sequence was UniProtKB/Swiss-Prot: F4HVY0.1, optimized according to E. coli codons; after optimization, the DNA molecule encoding CER1 has the nucleotide sequence set forth in SEQ ID NO: 3, and the gene was synthesized in genscript.

(43) AD9313: Aliphatic aldehyde decarbonylase, derived from Prochlorococcus marinus MIT9313; the protein sequence was NCBI Reference Sequence: NP_895059.1, optimized according to E. coli codons; after optimization, the DNA molecule encoding AD9313 has the nucleotide sequence set forth in SEQ ID NO: 4, and the gene was synthesized in our laboratory.

(44) AD7942: Aliphatic aldehyde decarbonylase, derived from Synechococcus elongatus PCC7942; the protein sequence was accession number: YP_400610, optimized according to E. coli codons; after optimization, the DNA molecule encoding AD7942 has the nucleotide sequence set forth in SEQ ID NO: 5, and the gene was synthesized in GENEART.

(45) AD73102: Aliphatic aldehyde decarbonylase, derived from Nostoc punctiforme PCC73102; the protein sequence was accession number: YP_001865325, optimized according to E. coli codons; the DNA molecule encoding AD73102 after optimization was a gift from Squire J. Booker's group of the Pennsylvania State University, USA.

(46) Experiment Methods

(47) Construction of plasmids pET28a-CER1, pET28a-AD9313, pET28a-AD7942 and pET28a-AD73102 1) The vector was pET28a-AdhP, restriction-digested with NdeI and SpeI, gel-extracted for the fragments with a length of 5350. 2) Amplified with primers NdeI- *** -fwd and SpeI- *** -rev for different gene fragments (*** represents a gene name), see primer sequence in Table 5, and the fragment name and length after PCR are shown in Table 4; gel-extracted, restriction-digested with NdeI and SpeI, purified and ligated to vector. 3) Colony PCR with primer pET-fwd and primer pET-rev, with the correct length shown in Table 4.

(48) TABLE-US-00006 TABLE 4 Detailed information of the fragments Fragment Fragment Colony name length PCR length CER1 1893 2419 ADC9313 747 1273 ADC7942 715 1240 ADC73102 714 1240

(49) TABLE-US-00007 TABLE5 Thelistofprimersneededintheconstructionofthegeneelements forsynthesizingevennumberedmediumchainaliphatichydrocarbons Primername SequenceNo. Sequenc NdeI-CER1-fwd SEQlDNo.34 GTTTCATATGGCTACCAAACCGGGTGT SpeI-CER1-rev SEQIDNo.35 AATACTAGTTAGTGGTGCGGCAGGAGCA NdeI-ADC9313-fwd SEQlDNo.36 TTTTCATATGCCGACCCTGGAAATGCC SpeI-ADC9313-rev SEQlDNo.37 GGTACTAGTTAGCTAACCAGTGCTGCTG CT NdeI-AD7942-fwd SEQIDNo.38 ATATACATATGCCGCAGCTGGAAGCGAG SpeI-AD7942-rev SEQIDNo.39 AATACTAGTTATTACACCGCCGCCAGGC NdeI-AD73102-fwd SEQIDNo.40 AACCACATATGCAGCAGCTGACCGATCA SpeI-AD73102-rev SEQIDNo.41 GGGACTAGTTATGCACCAATCAGACCAT

EXAMPLE 4

Verification of the Feasibility of -Dioxygenase for Synthesizing Odd Numbered Medium Chain Aliphatic Alcohols and Even Numbered Medium Chain Aliphatic Hydrocarbons

(50) Experiment Methods:

(51) 1. Construction of pACYC-Trc-tesA-Dox (CYX134) plasmid 1) The vector was pACYC-Trc-tesA, restriction-digested with SpeI and BamHI, and purified. 2) The fragment template was 21A-Dox, restriction-digested with XbaI and BamHI, with a length of 1911, gel-extracted and ligated to vector.

(52) 2. Plasmid CYX134 was transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. The cells were all cultured in an incubator at 30 C., and the content of each antibiotic in the solid and liquid media was 34 g/mL chloramphenicol.

(53) 3. The E. coli BL21 (DE3) strain transformed with the plasmid pACYC-Dox-tesA was subjected to fermentation. The recombinant single colonies were inoculated in LB medium and cultured at 30 C. overnight, and inoculated in 5 mL of M9 medium at a ratio of 1:100 and subjected to fermentation on a shaker at 220 rpm at 30 C. When the biomass was between OD600=1.0-1.2, 1 mM IPTG was added, and after 40 h of induced expression, the aliphatic alcohol samples were extracted for detection.

(54) 4. Extraction of aliphatic alcohols, specifically: 1) 0.5 mL of medium fermented at 30 C. for 40 h after induction was sampled and 25 mg/L of cetyl alcohol was added as internal standard. 2) 0.5 mL of ethyl acetate was added, vortex-shaked for 5 min, and centrifuged at 15000 rpm for 2 min. 3) The top-layer organic phase was aspirated and filtered through a 0.22 m nylon membrane. Samples were stored in a 80 C. refrigerator prior to injecting.

(55) 5. Detection of aliphatic alcohol extraction samples. The Gas Chromatography-Mass Spectrometer (GC/MS) system involved in this experiment was the Waters GCT Premier MICROMASS system, which included: 1) Agilent 7683 autosampler 2) Agilent 6890 Gas Chromatography (GC, Agilent Technologies, USA) 3) Time-of-Flight Mass Spectrometer (TOF-MS, Waters Corp., USA) 4) J & W DB-5 capillary quartz column (30 m length, I.D. 0.25 mm, Film 0.25 m, Agilent Technologies, USA)

(56) GC conditions were as follows: DB-5 gas chromatography column was employed, with a injecting volume of 1 L; post-column shunt technology was employed, with the split ratio of 2:1. The inlet temperature was 260 C. and the GC interface temperature was 280 C. Taking high-purity helium as the carrier gas, with 91 Kpa constant pressure. The program of temperature rising of the chromatographic separation was as follows: the initial temperature was maintained at 70 C. for 2 min, then the temperature raised to 290 C. at a rate of 8 C..Math.min.sup.1, and kept at 290 C. for 6 min. TOF/MS.

(57) Mass spectrometric conditions were as follows: the mass spectrometry ionization mode was positive ion mode electron Impact ionization (EI+), of which the ionization voltage was 70 eV, and the source temperature maintained at 250 C. The scanning range of mass spectrometry was 50-800 m/z and the scanning speed was 2 scan.Math.s.sup.1.

(58) Qualitative and quantitative analysis of the products: GC-TOF/MS data were qualitatively and quantitatively analyzed using Masslynx software (Version 4.1, Waters Corp., USA). The chromatography peaks were identified by NIST database (National Institute of Standard and Technology library, NIST, 2005, Gaithersburg, Md.) and the peak areas of metabolites were automatically integrated by QuanLynx software. The ratio of the peak area of the total ion chromatogram of each substance to the peak area of the internal standard on the same spectrum was used to obtain the normalized FAME and relative concentrations of hydrocarbons.

(59) Experiment Results

(60) The pACYC-Trc-tesA and CYX134 plasmids were transformed into E. coli BL21 (DE3), the induced fermentation was conducted at 30 C. for 40 h and GC-MS detection was performed on the fermentation products. The results are shown in FIG. 2. In the strains transformed with the pACYC-Trc-tesA module only detected the production of fatty acids, which were generated from the hydrolysis of aliphatic acyl-ACP by thioesterase (TesA). Meanwhile, after addition of the dox gene to the pACYC-Trc-tesA plasmid (CYX134), three aliphatic aldehydes,1-undecanal, tridecanal and pentadecenal were detected at retention times (RT) of 11.20 min, 14.73 min and 17.59 min, respectively. The three aliphatic aldehydes were generated by oxidation of -Dox from free fatty acids of C.sub.12, C.sub.14 and C.sub.16:1 in E. coli cells. The results confirmed the feasibility of a synthesis of odd numbered medium chain aliphatic alcohols and even numbered medium chain hydrocarbons in the present patent application, i.e., -dioxygenase can synthesize odd numbered medium chain aliphatic aldehydes in E. coli and can provide precursors for synthesizing odd numbered medium chain aliphatic alcohols and even numbered medium chain aliphatic hydrocarbons.

(61) In addition, in the strains transformed with CYX134 module, 1-undecanol, 1-tridecanol and 1-pentadecanol were also detected at the retention times (RT) of 12.37 min, 15.75 min and 18.80 min, respectively (as shown in FIG. 2B). These three aliphatic alcohols were the products of spontaneous reduction of aliphatic aldehydes with the corresponding carbon chain in the cells. The mass spectra profiles of the products are shown in FIG. 1C-H. The match factor and the reverse match factor of the respective substances were both 850 or more, and the accuracy of the odd numbered medium chain aliphatic aldehyde/alcohol molecules of the present invention was confirmed.

EXAMPLE 5

Selection of Aldehyde Reductase

(62) Experiment Methods

(63) 1. Construction of plasmids: Different aldehyde reductases (AdhP, YjgB, YqhD, AdhE, Slr1192) were ligated into CYX134 plasmid. Specifically, CYX134 was taken as vector, restriction-digested with SpeI and BamHI, and purified. 28a-AdhP, 28a-YjgB, pET28a-YqhD, pET28a-AdhE, pET28a-Slr1192 were taken as templates, respectively, restriction-digested with XbaI and BamHI, gel-extracted and ligated to vector. See the specific fragment length in Table 6.

(64) TABLE-US-00008 TABLE 6 Construction of the plasmids Name of the Restriction Length Origin Restriction Length plasmid site of of the of the site of the of the constructed Vector the vector vector fragment fragment fragment CYX143 CYX134 SpeI 6950 28A-AdhP XbaI 1036 CYX144 BamHI 28A-yjgB BamHI 1038 CYX145 28A-yqhD 1275 CYX146 28A-AdhE 2687 CYX147 28A-slr119 1122

(65) 2. Each plasmid was transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. The cells were all cultured in an incubator at 30 C., and the content of each antibiotic in the solid and liquid media was 34 /mL chloramphenicol.

(66) 3. The E. coli BL21 (DE3) strain transformed with each plasmid was subjected to fermentation, with the same method process as in Example 1.

(67) 4. Extraction of aliphatic alcohols, the method process was the same as in Example 1.

(68) 5. Detection of aliphatic alcohol extraction samples, the method process was the same as in Example 1.

(69) Experiment Results

(70) E. coli BL21 (DE3) was transformed with each plasmid and induced fermentation was conducted for 40 h at 30 C. The results of GC-MS analysis on the fermentation products are shown in FIG. 2. It can be seen that AdhE and AdhP do not have promotion effect on the production of odd numbered medium chain aliphatic alcohols, while YqdD, Slr1192 and YjgB further promote the E. coli synthesis of an odd numbered medium chain aliphatic alcohol proposed in this patent. Wherein YjgB has the most significant promotion effect on the production, with the production of total aliphatic alcohols increased from 35.2 mg/L to 68.3 mg/L.

Example 6

Selection of Aldehyde Decarbonylase

(71) Experiment Methods

(72) 1. Construction of the plasmids: different aldehyde decarbonylases (CER1, AD9313, AD7942 and AD7310) were ligated into the CYX134 plasmid. Specifically, CYX134 was taken as vector, and pET28a-CER1, pET28a-AD9313, pET28a-AD7942 and pET28a-AD73102 were respectively taken as templates, restriction-digested, gel-extracted and ligated to vector. Vector restriction site, vector length, fragment restriction site, fragment length and other specific information are shown in Table 7.

(73) TABLE-US-00009 TABLE 7 Information of plasmid construction Vector Origin Fragment Vector restriction Vector of the restriction Fragement Name name site length fragment site length CYX148 CYX134 SpeI 6950 28A-CER1 XbaI 1879 CYX149 BamHI 28A-AD9313 BamHI 747 CYX150 28A-AD7942 750 CYX151 SpeI-SacI 6950 28A-AD73102 XbaI-SacI 806

(74) 2. Each plasmid was transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. The cells were all cultured in an incubator at 30 C., and the content of each antibiotic in the solid and liquid media was 34 g/mL chloramphenicol.

(75) 3. The E. coli BL21 (DE3) strain transformed with each plasmid was subjected to fermentation, with the same method process as in Example 1.

(76) 4. Extraction of aliphatic alcohols, the method process was the same as in Example 1.

(77) 5. Detection of aliphatic alcohol extraction samples, the method process was the same as in Example 1.

(78) Experiment Results

(79) E. coli BL21 (DE3) was transformed with each plasmid and induced fermentation was conducted for 40 h at 30 C. The results of GC-MS analysis on the fermentation products are shown in FIG. 3. It can be seen that decarbonylase CER1 derived from Arabidopsis thaliana did not allow engineered E. coli to synthesize even numbered chain aliphatic hydrocarbons, while after expression of the three decarbonylases derived from cyanobacteria, all of the engineering E. coli synthesized the aliphatic hydrocarbons with chain length of C12 and C14, confirming the method for synthesizing medium chain aliphatic hydrocarbons using E. coli by the present patent. Wherein, it has the highest production, 5.2 mg/L, of the medium chain hydrocarbons when the decarbonylase AD7942 derived from Nostoc flagelliform was expressed. FIG. 3B shows the position of the aliphatic hydrocarbons in the gas chromatogram after transformed with the CYX151 plasmid. Wherein 8 was dodecane and 9 was tetradecane. The mass spectra of the respect products are shown in FIGS. 3D and E. The match factor and reverse match factor for each substance were both 850 or more, confirming the qualitative accuracy of the even numbered chain aliphatic hydrocarbon products of the present invention.

(80) In summary, the invention provides a microbial synthesis pathway and a construction method of odd numbered medium chain aliphatic alcohols and even numbered medium chain hydrocarbons by synthetic biological means; the present invention also provides an engineered E. coli that prepares odd numbered medium chain aliphatic alcohols and even numbered medium chain hydrocarbons using the above-described pathway.

Example 7

Optimization of the Metabolic Flow Between -Dioxygenase and Thioesterase

(81) Experiment Materials

(82) Plasmid pBAD33 was purchased from ATCC.

(83) Experiment Methods

(84) 1. Construction of expression plasmids (YX210, YX211, YX212 and YX213) containing different promoters 1) The vector was pACYCDute-1 and amplified with the primer AflII-pACYC-fwd and the primer PstI-pACYC-rev in Table 8. 2) The fragment templates were pQE-80L, pKS1, pTrcHis2A and pBAD33, and amplified with the remaining primers in Table 8, ligated to vector to construct the plasmids YX210, YX211, YX212 and YX213. These plasmids have two promoters simultaneously, one promoter was T7 and the other promoter was T5, pLacUV5, Trc and BAD. The specific information of these plasmids is shown in Table 9.

(85) 2. Construction of the plasmids of thioesterase gene endogenous to E. coli controlled by the T7 promoter 1) The vectors were pACYCDute-1, YX210, YX211, YX212 and YX213, restriction-digested with NdeI and KpnI, and purified. 2) The fragment template was pKS1 plasmid, amplified with the primers NdeI-tesA-fwd and KpnI-tesA-rev (see Table 8 for primer sequences). After PCR, the products were restriction-digested and purified, and ligated to vector. The correct transformants were picked.

(86) 3. Construction of the plasmids of -dioxygenase and endogenous thioesterase controlled by dual promoters without 6*His tag (YX220, YX232, YX233, YX234 and YX235) 1) The vectors were the five plasmids generated in step 2, with the polyclonal sites in the first promoter cleaved with NcoI and BamHI, and purified. 2) The fragment template was the synthetic dox gene, amplified with the primers NcoI-Dox-fwd and BamHI-SpeI-Dox-rev (see Table 8 for primer sequences), and the length after PCR was 1874; restriction-digested and purified, and ligated to vector, and the correct transformants were picked. The first promoter (T7, T5, pLacUV5, Trc and BAD) in YX220, YX232, YX233, YX234 and YX235 controls the dox gene without the 6*His tag and the second promoter (T7) controls the tesA gene.

(87) 4. Construction of the plasmids of -dioxygenase and endogenous thioesterase controlled by dual promoters containing 6*His tag (YX221, YX222, YX223, YX224 and YX225)

(88) 1) The vectors were the five plasmids generated in step 2, with the polyclonal sites in the first promoter cleaved with NcoI and BamHI, and purified.

(89) 2) The fragment template was the 21a-dox plasmid, restriction-digested with NcoI and BamHI, gel-extracted, ligated to vector, and the correct transformants were picked. The first promoter (T7, T5, pLacUV5, Trc and BAD) in YX221, YX222, YX223, YX224 and YX225 controls the dox gene containing the 6*His tag and the second promoter (T7) controls the tesA gene.

(90) 5. Construction of plasmids containing -dioxygenase controlled by T7, T5, pLacUV5, Trc and BAD promoters 1) The vectors were pACYCDute-1, YX210, YX211, YX212 and YX213, restriction-digested with NcoI and BamHI, and purified. 2) The fragment template was the synthetic dox gene, amplified with the primers NcoI-Dox-fwd and BamHI-SpeI-Dox-rev (see Table 8 for primer sequences); restriction-digested after PCR and purified, ligated to vector, and the correct transformants were picked.

(91) 6. Construction of plasmids containing dox-tesA controlled by T7, T5, pLacUV5, Trc and BAD promoters (YX135, YX136, YX137, YX138 and YX140) 1) The vectors were the five plasmids generated in Step 5, restriction-digested with SpeI and BamHI, and purified. 2) The fragment template 21a-tesA was restriction-digested with XbaI and BamHI, gel-extracted, ligated to vector, and the correct transformants were picked. The first promoters (T7, T5, pLacUV5, Trc and BAD) in YX135, YX136, YX137, YX138 and YX140 control both the two genes dox and tesA.

(92) 7. Construction of a plasmid containing the thioesterase gene endogenous to E. coli controlled by the T7, T5, pLacUV5, Trc and BAD promoters 1) The vectors were YX210, YX211, YX212 and YX213, restriction-digested with NcoI and BamHI, and purified. 2) The fragment template was pKS1, amplified with the primers NcoI-tesA-fwd and BamHI-SpeI-tesA-rev (see Table 8 for primer sequences); restriction-digested after PCR and purified, ligated to vector, and the correct transformants were picked.

(93) 8. Construction of plasmids containing tesA-dox controlled by T7, T5, pLacUV5, Trc and BAD promoters (YX131, YX132, YX133, YX134 and YX130) 1) The vectors were the five plasmids generated in Step 7, restriction-digested with SpeI and BamHI, and purified. 2) The fragment template 21a-Dox was restriction-digested with XbaI and BamHI, gel-extracted, ligated to vector, and the correct transformants were picked. The first promoters (T7, T5, pLacUV5, Trc and BAD) in YX131, YX132, YX133, YX134 and YX130 control both the two genes tesA and dox.

(94) TABLE-US-00010 TABLE8 Theprimersneededinoptimizationofthemetabolicflowbetween -dioxygenaseandthioesterase Primer number Sequence* AflII-pACYC-fwd SEQID GGCCCTTAAGTCGAACAGAAAGTA No.42 PstI-pACYC-rev SEQID TATCTGCAGCATAAGGGAGAGCGTCGAGA No.43 PstI-pT5-fwd SEQID AAACTGCAGCCTTTCGTCTTCACCTCGAG No.44 SacI-MCS-rev SEQID TTGAGCTCGCATGCGGATCCTT No.45 PstI-pLacUV5-fwd SEQID AATCTGCAGCCGATGGCGCGCCGA No.46 AflII-rrnB-rev SEQID TCGACTTAAGCGTTCACCGACAAACAACAG No.47 PstI-Gibson-pHisTrc- SEQID TCTCGACGCTCTCCCTTATGCTGCAGACATCATAACGGT fwd No.48 TCTGGCA AflII-Gibson-rrnBT1- SEQID TACGATTACTTTCTGTTCGACTTAAGGGCGGATTTGTCC rev No.49 TACTCAG PstI-Gibson-araC-fwd SEQID TCTCGACGCTCTCCCTTATGCTGCAGCCTGTCAAATGGA No.50 CGAAG NdeI-tesA-fwd SEQID CGGAT GCGGACACGTTATTGAT No.51 KpnI-tesA-rev SEQID CCCCGGTACC TGAGTCATGATTTACTA No.52 NcoI-Dox-fwd SEQID GCG GCAGCGGTTTATTCAA No.53 *Linear underlined sequences are the restriction sites, and bold, italic sequences are the start codon or stop codon.

(95) TABLE-US-00011 TABLE 9 Information of expression plasmids containing different promoters Vectors Replication origin Promoters Resistance YX210 p15A P.sub.T5 and P.sub.T7 Cam YX211 p15A P.sub.lacUV5 and P.sub.T7 Cam YX212 p15A P.sub.Trc and P.sub.T7 Cam YX213 p15A P.sub.BAD with areC operon, and P.sub.T7 Cam

(96) 9. Each plasmid was transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. The cells were all cultured in an incubator at 30 C., and the content of each antibiotic in the solid and liquid media was 34 g/mL chloramphenicol.

(97) 10. The E. coli BL21 (DE3) strains transformed with each of the plasmids were subjected to fermentation, with the same method process as in Example 1.

(98) 11. Extraction of aliphatic alcohols, the method process was the same as in Example 1.

(99) 12. Detection of the aliphatic alcohol extraction sample, the method process was the same as in Example 1.

(100) Experiment Results:

(101) The E. coli BL21 (DE3) were transformed with each plasmid and induced fermentation was conducted for 40 h at 30 C. The results of GC-MS analysis on the fermentation products are shown in FIG. 4. The metabolic flow between TesA and -Dox was divided into two parts for optimization.

(102) Firstly, TesA and -Dox were expressed in two open reading frames (ORFs). TesA was controlled by the T7 promoter and -Dox was expressed with five different promoters. When -Dox was under the control of T7 promoter with the strongest expression of or BAD promoter with the weakest expression, the amount of aliphatic alcohol production was relatively low. When the expression intensity of -Dox was moderate (controlled by T5, LacUV5 and Trc promoters), the output of aliphatic alcohols was relatively high. This indicated that the expression intensities between TesA and -Dox were too much different from each other, and when the expression of -Dox was slightly less than TesA, the metabolic flow was relatively balanced. In addition, addition of the 6*His tag at the N-terminus of the -Dox protein did not increase the output of aliphatic alcohols at the same intensity of expression, suggesting that -Dox was stable in the (post) transcriptional and/or (post) translational stages.

(103) Secondly, TesA and -Dox were expressed in one open reading frame to optimize the expression intensities of the two genes. In the construction of plasmids, dox-tesA and tesA-dox constructs were constructed respectively. When the two genes were simultaneously expressed in one open reading frame, the gene closer to the promoter will have stronger expression intensity. It can be seen from FIG. 4 that the aliphatic alcohol output was higher when the tesA was closer to the promoter. This was consistent with the conclusion of the first optimization that TesA expression intensity needs to be slightly higher than -Dox. In addition, the expression intensity of tesA-dox should not be too high or too low, and when under the control of Trc promoter, the highest output of aliphatic alcohol was reached (35.2 mg/L).

(104) The CYX134 plasmid in Example 4 was the plasmid most optimized in the metabolic flow between tesA and -Dox in this example (CYX is equivalent to YX).

Example 8

Confirmation of the Extensive Substrate Selectivity and Controllability of -Dioxygenase in Cells

(105) Experiment Methods

(106) 1. Construction of fatty acid pathway over-expressing plasmids containing different thioesterases (YX101, YX102 and YX103) 1) The vector was pACYCDute-1, restriction-digested with EcoRI and SacI, or restriction-digested with SalI and HindIII, and purified. 2) The fragment templates were three different thioesterase genes: tesA gene in pKS1 (derived from Escherichia coli), or synthetic bte (derived from Umbellularia californica) and BnFatA gene (derived from Brassica napus), and different gene fragments were amplified by corresponding primers (the primer sequences are shown in Table 10, and the names of the fragments and the length after PCR are shown in Table 11), restriction-digested, purified, and ligated to vector. 3) Colony PCR with the primer Duet-seq-F and the primer pACYCDuet-R, with the correct length shown in Table 11.

(107) Construction of aliphatic alcohol synthesis pathway over-expressing plasmids containing different thioesterases (YX135, YX104 and YX105) 1) The vectors were YX101, YX102 or YX103, restriction-digested with NcoI and BamHI, and purified. 2) The fragment template was the synthetic dox gene, amplified with the primers NcoI-Dox-fwd and BamHI-SpeI-Dox-rev, with the length after PCR of 1874, restriction-digested, purified, ligated to vector, and the correct transformants were picked.

(108) TABLE-US-00012 TABLE 10 The list of primers needed to confirm the extensive substrate selectivity and controllability of -dioxygenase possesses in cells Primer number Sequence* EcoRI-RBS-tesA-fwd SEQ ID No. 54 SacI-tesA-rev SEQ ID No. 55 SalI-RBS-BTE-fwd SEQ ID No. 56 HindIII-BET-rev SEQ ID No. 57 SalI-BnFatA-RBS-fwd SEQ ID No. 58 HindIII-BnFatA-rev SEQ ID No. 59

(109) TABLE-US-00013 TABLE 11 Detailed information of the fragments Name of the constructed Name of the Fragment plasmid fragment length Colony PCR length YX101 pKS1 585 835 YX102 BTE 941 1187 YX103 BnFatA 1137 1383

(110) 3. YX101, YX102 and YX103 plasmids were respectively transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. All the cells were cultured in an incubator at 30 C., and the content of each antibiotic in the solid and liquid media was 34 g/mL of chloramphenicol.

(111) 4. The E. coli BL21 (DE3) strain transformed with each plasmid was subjected to fermentation as in Example 1.

(112) 5. Extraction of fatty acid: 0.5 mL of medium fermented at 30 C. for 40 h after induction was sampled, and 50 L of hydrochloric acid and 25 g of heptadecanoic acid were added as internal standards; 0.5 mL ethyl acetate was added, vortexed for 5 min, and centrifugated at 15000 rpm for 2 min (the same hereinafter); the top-layer organic phase was aspirated, 0.5 mL ethyl acetate was added to the bottom-layer solution again, vortexed for 5 min, and centrifuged to obtain the top-layer organic phase; the two parts of extracts were combined, and the extracted free fatty acids were methylated by addition of 20 l of diazomethane, 1 L of hydrochloric acid and 9 L of methanol, and the mixture was blow-dried with nitrogen gas after two hours of reaction; the evaporated product (fatty acid methyl ester, FAME) was dissolved in 0.5 mL of n-hexane, and filtered with 0.22 m nylon membrane. Samples were stored in a 80 C. refrigerator prior to injecting.

(113) 6. Detection of fatty acid extraction samples, the method process was the same as that of Example 1 for the detection of aliphatic alcohols.

(114) 7. YX135, YX104 and YX105 plasmids were respectively transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. The cells were all cultured in an incubator at 30 C., and the content of each antibiotic in the solid and liquid media was 34 g/mL of chloramphenicol.

(115) 8. The E. coli BL21 (DE3) strain transformed with each plasmid were subjected to fermentation, with the same method process as in Example 1.

(116) 9. Extraction of aliphatic alcohols, the method process was the same as in Example 1.

(117) 10. Detection of aliphatic alcohol extraction samples, the method process was the same as in Example 1.

(118) Experiment Results

(119) The E. coli containing YX101, YX102 or YX103 plasmids was subjected to fermentation, and the results are shown in FIG. 5. The engineered strains over-expressing TesA, BTE or BnFatA synthesized fatty acids of C.sub.14/C.sub.16 (39%/36%), C.sub.12 (75%) and C.sub.16/C.sub.18 (75%/24%) as the major products, respectively. When DOX was co-over-expressed with thioesterase, the different engineered strains synthesized C.sub.13/C.sub.15 (57%/30%), C.sub.11 (95%), as well as C.sub.15 (93%) of aliphatic aldehydes+aliphatic alcohols as the major products. This indicates that the ratio of the product of the aliphatic aldehydes+the aliphatic alcohols after over-expression of DOX matches the ratio of the product of the precursor fatty acids. The only exception was when BnFatA was over-expressed, there was 24% of the C18 fatty acids, however, no corresponding C17 aliphatic aldehyde/alcohol was produced after over-expression of DOX. These results indicate that DOX was capable of oxidizing C12-C16 fatty acids in the cell. In this range, it was possible to convert fatty acid substrate with different chain lengths into the corresponding aliphatic aldehyde, indicating that the controllability was possessed by DOX and the present system.

Example 9

Regulation of the Expression Intensity of the Upstream Fatty Acid Synthesis Pathway to Increase the Synthesis Ability of Odd Numbered Medium Chain Aliphatic Alcohols

(120) Experiment Methods

(121) 1. Construction of an upstream fatty acid pathway over-expression plasmids 1) The vector was pTrcHis2A, restriction-digested with NcoI and BamHI, and purified. 2) The fragment template was E. coli MG1655 genome, amplified with primers NcoI-GCG- *** -fwd and BamHI-SpeI- *** -rev for different gene fragments (*** represents a gene name) (see primer sequence in Table 12, and the fragment name and length after PCR shown in Table 13, wherein substitution of XhoI restriction site was required in FabD and substitution of NcoI restriction site was required in FabG), gel-extracted, restriction-digested with NcoI and BamHI, purified, and ligated to vector. 3) Colony PCR with primer pTrcHis2A-F and primer pTrcHis2A-R, with the correct length shown in Table 13.

(122) TABLE-US-00014 TABLE12 Thelistofprimersneededinover-expressionoffattyacidpathwaygenes Primer number Sequence* NcoI-GCG-fabD-fwd SEQID CGTT CGACGCAATTTGCATTTGTGTT No.60 BamHI-SpeI-fabD- SEQID AAGGATCCGAAT AAGCTCCAGCGCCGCTGC rev No.61 CATCGCTGA NcoI-GCG-fabG-fwd SEQID GGGT CGAATTTTGAAGGAAAAATCGC No.62 BamHI-SpeI-fabG- SEQID AAGGATCCGAAT GACCATGTACATCCCGCCG rev No.63 NcoI-fabA-fwd SEQID GGT TAGATAAACGCGAATC No.64 BamHI-SpeI-fabA- SEQID AAGGATCCGAAT GAAGGCAGACGTATCC rev No.65 G NcoI-GCG-fabI-fwd SEQID GGTT GTTTTCTTTCCGGTAA No.66 BamHI-SpeI-fabI-rev SEQID AAGGATCCGAAT TTTCAGTTCGAGTTCGT NO.67 NcoI-GCG-fabB-fwd SEQID AATT CGAAACGTGCAGTGATTACTGG No.68 BamHI-SpeI-fabB- SEQID AAGGATCCGAAT ATCTTTCAGCTTGCGCATT rev No.69 NcoI-fadR-fwd SEQID GGTT TCATTAAGGCGCAAAG No.70 BamHI-fadR-rev SEQID GAGGATCCGAAT TCGCCCCTGAATGGCTA No.71 *Linear underlined sequences are the restriction sites, and bold, italic sequences are the start codon or stop codon.

(123) TABLE-US-00015 TABLE 13 Detailed information of the fragments Name of the constructed Name of the Colony PCR plasmid fragment Fragment length length FabA fabA 534 863 FabI fabI 814 1133 FabG fabG 761 1082 FabD fabD 955 1277 FabB fabB 1246 1568 FadR fadR 735 1055

(124) 2. Knockout of the fadD and fadE genes in the -oxidation pathway 1) Primer sequences for homologous recombination are shown in Table 14. The chloramphenicol was amplified from pKD3 plasmids with these two primers, the products were identified by agarose gel electrophoresis, and PCR gel-extraction products were recovered by agarose gel DNA recovery kit. 2) The plasmid pKD46 was transformed into E. coli BL21 (DE3) and the bacteria were cultured overnight in LB liquid medium at 30 C. The activated bacteria were inoculated into a liquid medium containing 10 mmol/L of L-arabinose in a ratio of 1:100; when the bacterial OD.sub.600 reaches 0.5-0.6, pre-cooled on ice for 10 min, and centrifuged at 4 C., 4000 rpm for 5 min (the same hereinafter), followed by 3 times of centrifugation and washing with 10% chilling glycerol, concentrated 100-fold to electro-transfer competent cells, with 100 L for each tube, and stored in 80 C. refrigerator for use. 3) Electroporator 2170 (Eppendorf, Germany) (0.1-cm chambers) was employed to transform the PCR-gel-extracted products in step 1) (10-100 ng) into competent BL-46 cells which were subjected to 1800 V electric shock for 5-6 ms, followed by addition of 1 mL antibiotic-free-LB medium, recovered at 37 C., 150 rpm for 3-4 h, and thereafter half of the cells were plated on LB plate medium containing 25 g/mL chloramphenicol, with the remaining cells standing overnight at room temperature. If there was still no strain growing in the chloramphenicol plate after 24 h, these remaining cells were re-plated. 4) Single colonies in the plate of step 3) were picked, and colony PCR was conducted to verify whether the fadE gene in the genome had been substituted with chloramphenicol. 5) The correct transformants verified in step 4) were inoculated into 2 mL chloramphenicol LB medium and cultured at 43 C. for 12 h to delete the pKD46 plasmid. After streaking, the same single colony was picked and plated on ampicillin and chloramphenicol plates simultaneously, and cultured at 30 C. for 24 h, and if the same single colony grows in the chloramphenicol plate while not in the ampicillin plate, pKD46 was completely deleted. 6) The transformants with pKD46 deleted were inoculated and prepared into electroporation competent cells, and transformed with pCP20 plasmid; after recovered in 1 mL of antibiotic-free medium at 30 C. for 3-4 h, 100 L was aspirated and inoculated into 2 mL of duel-antibiotic medium of ampicillin and chloramphenicol and cultured overnight at 30 C., followed by inoculation into antibiotic-free medium with a ratio of 1:200, cultured at 43 C. till stable phase and streaked on an antibiotic-free LB plate; single colonies were picked and streaked respectively on ampicillin plates and chloramphenicol plates to verify the ejection of chloramphenicol in chromatin and loss of pCP20 plasmid. PCR and sequencing verification were also performed.

(125) TABLE-US-00016 TABLE 14 The list of primers needed for knockout of fadD and fadE genes in E. coli BL21 (DE3) genome Primer number Sequence* fadE-pKD3-fwd SEQ ID No. 72 fadE-pKD3-rev SEQ ID No. 73 fadD-pKD3-fwd SEQ ID No. 74 0 fadD-pKD3-rev SEQ ID No. 75

(126) 3. CYX144 plasmid and one of the plasmids constructed in method 1 were transformed into E. coli BL21 (DE3) strain by heat shock and screened on LB solid plate. All the cells were cultured in an incubator at 30 C. The content of each antibiotic in the solid and liquid media was 34 g/mL chloramphenicol and 100 g/mL ampicillin.

(127) 4. The E. coli BL21 (DE3) strain transformed with each plasmid were subjected to fermentation, with the same method process as in Example 1. When the CYX144 and fab genes were co-transformed into E. coli BL21 (DE3) strain for fermentation, the IPTG concentration was divided into three concentrations, 1 mM, 0.1 mM and 0.01 mM, for induction.

(128) 5. Extraction of aliphatic alcohols, the method process was the same as in Example 1.

(129) 6. Detection of aliphatic alcohol extraction samples, the method process was the same as in Example 1.

(130) Experiment Results

(131) Each plasmid was transformed into E. coli BL21 (DE3) and the bacteria were induced to ferment for 40 h at 30 C. The results of GC-MS analysis on fermentation products are shown in FIG. 6. When the IPTG concentration was 1 mM, none of the genes in the over-expressed fatty acid synthesis pathway could enhance the synthesis ability of aliphatic alcohol; blocking of the fatty acid -oxidation pathway by knockout of the fadD or fadE gene also did not promote the synthesis of aliphatic alcohol. However, when the concentration of the inducer IPTG was reduced to 0.1 mM, over-expression of acetyl-CoA carboxylase (ACC), FabD, FabI and FadR was capable of significantly increasing the output of aliphatic alcohols. For example, when FabD or FadR was co-over-expressed with CYX144, the output of odd numbered chain aliphatic alcohols was capable of being increased from 65.1 mg/L to 100.8 mg/L or 101.5 mg/L. When the concentration of IPTG was 0.01 mM, similarly, the overexpression of ACC, FabD, Fab I and FadR was capable of promoting the output of aliphatic alcohols. When FadR was co-over-expressed with CYX144, the output of aliphatic alcohols was 77.1% higher than that when CYX144 was over-expressed alone.

Example 10

Fed-Batch Fermentation

(132) Experiment Methods:

(133) 1. CYX144 and FadR plasmids were transformed into E. coli BL21 (DE3) strain by heat shock and the bacteria were cultured overnight on LB solid plate at 30 C.; the recombinant single colonies were inoculated into 2 mL of LB medium and cultured at 30 C. until OD reached 2.5-4, and transferred to 20 mL of M9 medium at a ratio of 1:100, cultured at 30 C. until OD reached 2.5-4 and then transferred to 800 mL of M9 medium at a ratio of 1:100. When OD reached 2.5-4, the culture medium was centrifuged and concentrated to 50 mL and inoculated to 2.5 L fermentor for fed-batch fermentation. When the OD reached 15, induction was performed with 10 M IPTG. Sampled for every 4 h, with 15 mL each time for analysis on cell density, glycerol, acetic acid, aliphatic alcohol concentrations. The content of each antibiotic in the solid and liquid media was 34 g/mL of chloramphenicol and 100 g/mL of ampicillin.

(134) 2. Cell densities were measured with a TU-1810 UV-Vis spectrophotometer (Beijing Purkinje General Instrument Co., Ltd.) at a wavelength of 600.

(135) 3. Measurement of glycerol and acetic acid concentrations: 1 mL of fermentation broth was centrifuged at 12,000 rpm for 10 min, and the supernatant was filterd with 0.22 m filtration membrane and diluted as appropriate, or directly injected into HPLC for separation and detection. HPLC was Waters e2695, the detector was a 2414 RI differential detector, and the chromatographic column was Aminex HPX-87H column (BioRad, CA); the column temperature was maintained at 65 C. and the mobile phase was 5 mM dilute sulphuric acid aqueous solution with a flow rate of 0.6 mL/min.

(136) 4. Extraction of aliphatic alcohols, the method process was the same as in Example 1.

(137) 5. Detection of aliphatic alcohol extraction samples, the method process was the same as in Example 1.

(138) Experiment Results

(139) As shown in FIG. 7, after 18.5 h of induction, the yield of fatty alcohol reached 1.95 g/L, the OD value was 124.5 and the productivity was 0.105 g/L/h. The rates of glycerol consumption and addition were almost the same during fermentation, without generation of acetic acid. During the process of fermentation, the proportion of aliphatic alcohols with different chain length was almost constant over time, and at the end of fermentation, the proportions of C11, C13 and C15 fatty alcohols were 18.6%, 66.2% and 15.2%, respectively.

(140) The gene, the encoded protein and use thereof, the gene element, the method for synthesizing an odd numbered medium chain aliphatic aldehyde, and the method for synthesizing an even numbered medium chain aliphatic hydrocarbon according to the present invention are described above in detail. The principles and embodiments of the present invention have been described using specific examples, and the description of the above examples is only for helping understanding the method of the present invention and the core idea thereof. It should be noted that a number of improvements and modifications of the present invention can be made by those skilled in the art without departing from the principles of the present invention, these improvements and modifications also fall within the protection scope of the present invention as defined by the claims of the present invention.