Processing of a modified foot-and-mouth disease virus P1 polypeptide by an alternative protease
10308927 ยท 2019-06-04
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2770/32151
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
C12Y304/22044
CHEMISTRY; METALLURGY
C12N2770/32122
CHEMISTRY; METALLURGY
International classification
C12N9/50
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
Polynucleotide constructs that express an engineered foot-and-mouth disease (FMDV) P1 precursor protein and a non-FMDV TEV protease and methods for safe and efficient recombinant production of FMDV antigens and immunogens. Recombinant production of FMDV antigens avoids the need to culture highly-infectious FMDV, while conventional culture methods for producing FMDV antigens rely on the native FMDV 3C protease which exerts toxic effects on host cells. The inventors have developed a new system that efficiently and safely processes FMDV P1 precursor without the FMDV 3C protease, thus avoiding the toxic effects associated with use of the 3C protease. The invention is also directed to the FMDV antigens and virus-like particles produced by this system as well as to FMDV vaccines, diagnostics and other biologics.
Claims
1. A polynucleotide that encodes at least one engineered FMDV P1 precursor polypeptide that comprises at least one Tobacco Etch virus (TEV) protease cleavage site, wherein the at least one TEV protease cleavage site in the engineered FMDV P1 precursor polypeptide comprises E.sub.1-D.sub.2-A.sub.3-Y.sub.4-T.sub.5-Q.sub.6-S.sub.7(SEQ ID NO: 39), E.sub.1-F.sub.2-L.sub.3-Y.sub.4-K.sub.5-Q.sub.6-G.sub.7(SEQ ID NO: 40), E.sub.1-D.sub.2-L.sub.3-Y.sub.4-F.sub.5-Q.sub.6-S.sub.7(SEQ ID NO: 41), E.sub.1-K.sub.2-L.sub.3-Y.sub.4-K.sub.5-Q.sub.6-G.sub.7(SEQ ID NO: 42), E.sub.1-L.sub.2-L.sub.3-Y.sub.4-K.sub.5-Q.sub.6-G.sub.7(SEQ ID NO: 43) or E.sub.1-A.sub.2-L.sub.3-Y.sub.4-K.sub.5-Q.sub.6-S.sub.7(SEQ ID NO: 44) in at least one junction between VP4 and VP2, VP2 and VP3, VP3 and VP1, or VP1 and 2A components of the engineered FMDV P1 precursor polypeptide.
2. The polynucleotide of claim 1, wherein the at least one TEV protease cleavage site in the engineered FMDV P1 precursor polypeptide is positioned at junction(s) that when cleaved by a TEV protease produce VP0, VP3, and VP1.
3. The polynucleotide of claim 1, wherein the at least one TEV protease cleavage site in the engineered FMDV P1 precursor polypeptide is positioned at junction(s) that when cleaved by a TEV protease produce VP2, VP4, VP3 and VP1.
4. The polynucleotide of claim 1, wherein the engineered FMDV P1 precursor polypeptide further comprises at least one protease cleavage site cleaved by a FMDV 3C protease.
5. The polynucleotide of claim 1, further comprising a polynucleotide encoding at least one 2A, delta 1D2A or 2A-like translational interrupter operatively linked to, or embedded within, the polynucleotide sequence encoding the engineered FMDV P1 precursor polypeptide.
6. The polynucleotide of claim 1, further comprising a polynucleotide encoding at least one potyvirus NIa protease.
7. The polynucleotide of claim 1, further comprising a polynucleotide encoding at least one potyvirus NIa protease of Plum pox virus, Tobacco vein mottling virus, Potato virus Y, Pea seed-borne mosaic virus, Turnip mosaic virus, Clover Yellow vein virus, Pepper vein banding virus, Habenaria mosaic virus, Moroccan watermelon mosaic virus, Zucchini shoestring virus, Daphnea virus Y, or Catharanthus mosaic virus.
8. The polynucleotide of claim 1, further comprising a polynucleotide encoding a TEV protease.
9. The polynucleotide of claim 8, wherein the TEV protease is a wild type TEV protease.
10. The polynucleotide of claim 8, wherein the TEV protease is the TEV protease of SEQ ID NO: 26.
11. The polynucleotide of claim 8, wherein the TEV protease is a TEV protease that is at lease 95% identical to the TEV protease sequence of SEQ ID NO: 26.
12. The polynucleotide of claim 1, further comprising a polynucleotide encoding an engineered FMDV 3C protease that is at least 95% identical to a FMDV 3C protease described by SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 20, 86, 88, 90 or 92, and that contains one or more amino acid substitutions within residues 26-35, 46, 80, 84, 125-134, 138-150, 163 or 181; and wherein the engineered FMDV P1 precursor polypeptide comprises at least one protease cleavage site cleaved by a FMDV 3C protease.
13. The polynucleotide of claim 1, wherein the engineered FMDV P1 polypeptide comprises the polypeptide selected from the group consisting of SEQ ID NOS: 22, 24, 124, 126, 128, 130, 132, 134 and 136.
14. The polynucleotide of claim 1, wherein the engineered FMDV P1 polypeptide is at least 90% identical to the polypeptide selected from the group consisting of SEQ ID NOS: 22, 24, 124, 126, 128, 130, 132, 134 and 136.
15. The polynucleotide of claim 12, wherein the encoded engineered FMDV 3C protease contains a L127P substitution.
16. The polynucleotide of claim 12, wherein the encoded engineered FMDV 3C protease contains a C163A substitution.
17. A vector comprising the polynucleotide according to claim 1.
18. The vector of claim 17 that further encodes a potyvirus NIa protease.
19. The vector of claim 17 that further encodes a TEV protease.
20. The vector of claim 19 that further encodes at least one FMDV 3C protease that is at least 95% identical to a FMDV 3C protease described by SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92.
21. The vector of claim 20 that further encodes a modified FMDV 3C protease comprising one or more amino acid substitutions to residues 26-35, 125-134 or 138-150 described by SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92, or to a FMDV 3C protease that is at least 95% identical to the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92.
22. The vector of claim 17, wherein the engineered FMDV P1 polypeptide comprises the polypeptide selected from the group consisting of SEQ ID NOS: 22, 24, 124, 126, 128, 130, 132, 134 and 136.
23. The vector of claim 17, wherein the engineered FMDV P1 polypeptide is at least 90% identical the polypeptide selected from the group consisting of SEQ ID NOS: 22, 24,124,126,128,130,132,134 and 136.
24. The vector of claim 17 that comprises at least one 2A, 2A-like or other translation interrupter sequence.
25. The vector of claim 17 that expresses the encoded engineered FMDV P1 precursor polypeptide in a eukaryotic cell.
26. The vector of claim 17 that expresses the encoded engineered FMDV P1 precursor polypeptide in Arabidopsis thaliana, Chlamydomonas reinhardtii, Glycine max, Nicotiana benthamiana, Nicotiana tabacum, Oryza sativa, Zea mays or another plant cell.
27. The vector of claim 17 that expresses the encoded engineered FMDV P1 precursor polypeptide in Spodopterafrugiperda, Drosophila melanogaster, Sf9, Sf21, or another insect cell.
28. The vector of claim 17 that expresses the encoded engineered FMDV P1 precursor polypeptide in Escherichia, Pseudomonas or in another gram-negative prokaryote.
29. A composition comprising the vector according to claim 17 and at least one other vector encoding a potyvirus NIa protease and optionally a wild type or modified FMDV 3C protease that contains one or more amino acid substitutions to residues 26-35, 125-134 or 138-150 described by SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92, or to a FMDV 3C protease that is at least 95% identical to the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92.
30. A composition comprising the vector according to claim 17 and at least one other vector encoding a TEV protease and optionally a wild type or modified FMDV 3C protease that contains one or more amino acid substitutions to residues 26-35, 125-134 or 138-150 described by SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92, or to a FMDV 3C protease and that is at least 95% identical to the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92.
31. A host cell comprising the vector according to claim 17.
32. A host cell comprising the vector according to claim 19.
33. A host cell comprising the vector according to claim 17 and at least one other vector encoding a TEV protease, and optionally a wild type or modified FMDV 3C protease that contains one or more amino acid substitutions to residues 26-35, 125-134 or 138-150 described by SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92, or to a FMDV 3C protease that is at least 95% identical to the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92.
34. A method for proteolytically processing an engineered FMDV P1 precursor polypeptide comprising culturing the host cell of claim 33 and recovering cleavage products of the at least one engineered FMDV P1 precursor polypeptide produced by cleavage of the at least one TEV protease cleavage site in the engineered polypeptide.
35. The method of claim 34 comprising recovering VP0, VP3 and VP1 in the form of virus-like particles or VLPs.
36. The method of claim 34 comprising recovering VP4, VP2, VP3 and VP1 in the form of virus-like particles or VLPs.
37. The composition produced by the method of claim 34 that comprises VP0, VP1 and VP3 in the form of virus-like particles, or VLPs, optionally as empty capsids not containing RNA.
38. An antigenic composition or diagnostic product comprising a composition produced by the method according to claim 34.
39. A diagnostic chip or platform comprising the composition produced by the method according to claim 34.
40. A polynucleotide that encodes at least one engineered FMDV P1 precursor polypeptide that comprises at least one Tobacco Etch virus (TEV) protease cleavage site in at least one junction between VP4 and VP2, VP2 and VP3, VP3 and VP1, or VP1 and 2A components of the engineered FMDV P1 precursor polypeptide, the polynucleotide further encoding an engineered FMDV 3C protease that is at least 95% identical to a FMDV 3C protease described by SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 20, 86, 88, 90 or 92, wherein the encoded engineered FMDV 3C protease contains a C163A substitution, and further encoding at least one potyvirus TEV protease.
41. The polynucleotide of claim 40, wherein the engineered FMDV P1 precursor polypeptide further comprises at least one protease cleavage site cleaved by the FMDV 3C protease in at least one junction between VP4 and VP2, VP2 and VP3, and VP3 and VP1, or VP1 and 2A components of the engineered FMDV P1 precursor polypeptide.
42. The polynucleotide of claim 40, wherein the encoded engineered FMDV 3C protease comprises one or more amino acid substitutions within residues 26-35, 46, 80, 84, 125-134,138-150, 163 or 181.
43. The polynucleotide of claim 40, wherein the at least one TEV protease cleavage site in the engineered FMDV P1 precursor polypeptide comprises E.sub.1-X.sub.2-X.sub.3-Y.sub.4-X.sub.5-Q.sub.6-(G/S).sub.7 (SEQ ID NO; 29) in at lest one junction between the VP4 and VP2, VP2 and VP3, VP3 and VP1, or VP1 and 2A components of the engineered FMDV P1 precursor polypeptide.
44. The polynucleotide of claim 40, wherein the at least one TEV protease cleavage site in the engineered FMDV P1 precursor polypeptide comprises E.sub.1-N.sub.2-L.sub.3-Y.sub.4-F.sub.5-Q.sub.6-S.sub.7 (SEQ ID NO: 30) in at least one junction between the VP4 and VP2, VP2 and VP3, VP3 and VP1, or VP1and 2A components of the engineered FMDV P1 precursor polypeptide.
45. The polynucleotide of claim 40, further encoding a 2A, delta 1D2A, or 2A-like translational interrupter positioned in the polynucleotide between the at least one engineered FMDV P1 precursor polypeptide and the engineered FMDV 3C protease.
46. A vector comprising the polynucleotide according to claim 40.
47. A host cell comprising the vector according to claim 46.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) An appreciation of the disclosure and many of the attendant advantages thereof may be understood by reference to the accompanying drawings.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
DETAILED DESCRIPTION OF THE INVENTION
(13) In addition to its other benefits, the invention provides a new and advantageous way to produce FMDV capsid proteins from the FMDV P1 precursor polypeptide that is not hindered by toxic effects of the FMDV 3C protease conventionally used to process recombinantly-produced FMDV P1 precursor polypeptide. As mentioned above, conventional recombinant expression and recovery of the FMDV structural proteins that form viral capsids suffers from numerous drawbacks including the requirement for expression of host cell-toxic FMDV 3C protease and recovery of suboptimal amounts of viral proteins. Efficient recombinant production of FMDV viral proteins is highly desirable as it is not necessary to culture live, virulent virus to produce a vaccine.
(14) Like the genome of other members of the Picornaviridae family, the FMDV genome encodes a single open reading frame (ORF) that is expressed and processed into precursor polypeptides, such as P1, P2 mid P3, and then into individual viral peptides (VPs),
(15) The FMDV P1 precursor polypeptide encodes four structural proteins, VP4, VP2, VP3, and VP1 that comprise the FMDV capsid. Representative polynucleotide mid amino acid sequences for FMDV P1 precursor proteins appear in SEQ ID NOS: 21-24 and 123-136. Upon translation, a native FMDV P1 precursor polypeptide is processed by the FMDV 3C protease into structural proteins VP0, VP3, and VP1, VP0 is a fusion of VP4 and VP2,
(16) In FMDV, processing and cleavage of VP0 occurs independently of viral RNA.
(17) Conventional FMDV vaccine constructs utilize the 3C protease to process the P1 polypeptide into the individual VPs for assembly into virus like particles (VLPs). However, in host cells used to express FMDV proteins, the expression of the 3C protease has significant negative implications including Golgi fragmentation, loss of gamma-tubulin from microtubule organizing center, and processing of a number of host proteins including Histone H3, SAM68, NEMO, eIF4aI, and eIF4G.
(18) The toxicity of the FMDV 3C protease to the host cell is detrimental to recombinant production of both individual FMDV VPs and VLPs (virus-like particles) that contain epitopes absent from individual or unassembled viral proteins.
(19) The inventors have sought and found ways to avoid these problems. In U.S. Patent Application entitled Modified Foot and Mouth Disease Virus Proteases, Compositions and Methods Thereof, U.S. application Ser. No. 15/259,409, filed Sep. 9, 2016, which is hereby incorporated by reference in its entirety, the inventors disclose re-engineering of the FMDV 3C protease to be less toxic to host cells, for example, by providing a mutant FMDV 3C protease containing the V28K, L127P, V141T, C142T, or C163A substitutions to the 3C protease amino acid sequence. While the present invention is independently directed to use of the TEV protease instead of the 3C protease to process the FMDV P1 precursor polypeptide, in some embodiments both TEV and 3C proteases may be used in conjunction. For purposes of these embodiments of the invention, variants of the FMDV 3C protease amino acid sequence that retain proteolytic activity and are encoded by a polynucleotide having at least 70, 80, 90, 95, 99% sequence identity to SEQ ID NO: 85 (O1 Manissa FMDV 3C Protease), SEQ ID NO: 87 (Asia Lebanon 89 FMDV 3C Protease), SEQ ID NO: 89 (SAT 1 FMDV 3C Protease), or SEQ ID NO: 91 (SAT 2 Egypt FMDV 3C Protease) or which have at least 70, 80, 90, 95, 99% sequence similarity or identity to the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92 or which contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more amino acid deletions, substitutions, or insertions to the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90, or 92, may be employed. FMDV 3C proteases from other serotypes of FMDV as well as specific mutants of, and constructs containing, the FMDV 3C protease are incorporated by reference to U.S. patent application Publication US 2018/0066235 A1.
(20) In the present application the inventors disclose an alternative approach that uses a potyvirus protease, such as TEV protease, that is not derived from FMDV. The toxic FMDV 3C protease is not needed to process a FMDV P1 precursor polypeptide, or other precursor polypeptide, using this new approach. FMDV capsid proteins VP0, VP1, VP2, VP3 and VP4 are efficiently expressed in the absence of FMDV 3C protease and expression of these proteins is not affected by the cytotoxic effects the FMDV 3C protease exerts on host cells.
(21) The inventors have found that an FMDV P1 precursor protein expression system or platform using a. TEV protease, instead of an FMDV 3C protease, effectively processes a recombinant FMDV P1 precursor protein that was engineered to contain TEV recognition sites. Surprisingly, this system produces satisfactory quantities of FMDV P1 precursor polypeptide and processes the P1 precursor polypeptide into antigenic viral proteins completely independently of the FMDV 3C protease and its toxic effects. This new expression platform or system completely avoids the host cell cytotoxicity associated with other systems that use the FMDV 3C protease.
(22) The invention provides a valuable platform and foundation for the development and production of FMDV vaccines and other anti-FMDV biologics. Efficient recombinant production of FMDV viral antigens, immunogens, and virus-like particles contributes to meeting national defense objectives against bioterrorism, protecting critical farming and livestock infrastructure, and help respond to emergency situations involving FMDV.
(23) Definitions
(24) Potyvirus NIa protease (Nuclear Inclusion a protease)
(25) The potyvirus NIa protein contains the following two domains; the VPg domain at the N-terminus and the NIa-pro domain at the C-terminus [PMID: 18024078, PMID: 9356344]. The 250-amino acid NIa-pro domain adopts a characteristic two-domain antiparallel beta-barrel fold that is the hallmark of trypsin-like serine proteases, with the catalytic triad residues His, Asp, and Cys located at the interface between domains [PMID: 12377789]. There is only one proteolytic catalytic domain.
(26) Potyvirus NIa proteases include those of Plum Pox Virus: (SEQ ID NO: 50), Tobacco vein mottling virus: (SEQ ID NO: 51), Potato Virus Y (SEQ ID NO: 52); Pea seed-borne mosaic virus (SEQ ID NO: 53); Turnip Mosaic Virus: (SEQ ID NO: 54); Clover Yellow Vein Virus (SEQ ID NO: 55); and Pepper Vein Banding Virus (SEQ ID NO: 56). Other NIa proteases are described by SEQ ID NOS: 57-67. NIa protease sequences are also incorporated by reference to the GI accession numbers described by
(27) Potyvirus NIa Protease Cleavage Recognition Sites
(28) Recognition sites for potyviruses NIa proteases include: Plum Pox Virus: NVVVHQA (SEQ ID NO: 70), Tobacco vein mottling virus: ETVRFQS (SEQ ID NO: 71), Potato Virus Y: YEVHHQA (SEQ ID NO: 72), Pea seed-borne mosaic virus: IKVRLQA (SEQ ID NO: 74); Turnip Mosaic Virus: XVRHQS (SEQ ID NO: 75); where X=E/A/L/I; Clover Yellow Vein Virus: MLFVFQS (SEQ ID NO: 76); and Pepper Vein Banding Virus: GGQVAHQA (SEQ ID NO: 77). Other recognition sites are described by SEQ ID NOS: 78-83.
(29) TEV Protease.
(30) Tobacco Etch Virus (TEV) is a potyvirus. TEV encodes and expresses a NIa protein containing a 27 kDa catalytic proteolytic domain, hereinafter known as the TEV protease. TEV protease has at least 41-52% sequence identity with other NIa proteases as can be shown by aligning the sequences described by
(31) TEV protease recognizes and cleaves particular sites and the inventors have found that it can be effectively used to cleave engineered FMDV P1 precursor proteins engineered to contain TEV cleavage sites. Also, the inventors have found that TEV protease does not exhibit the cytotoxic effects that FMDV 3C protease does on host cells even though both TEV protease and FMDV 3C proteases are exogenous to most if not all host cells.
(32) A modified TEV protease that comprises the amino acid sequence of SEQ ID NO: 26 is advantageously used as part of a platform according to the invention. This modified TEV protease contains the S219V mutation which has been previously shown to make it impervious to auto-inactivation thus providing a more efficient protease than the native TEV protease. However, the native TEV protease lacking the S219V mutation may be used or other engineered TEV protease variants may be employed in some embodiments of the invention. Such engineered TEV variants retain proteolytic activity and have at least 70, 80, 90, 95, 99% sequence identity to SEQ ID NO: 26, or may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more amino acid deletions, substitutions, or insertions to SEQ ID NO: 26.
(33) TEV Cleavage Recognition Sites
(34) TEV protease recognizes and processes amino acid sequences comprising E.sub.1-X.sub.2-X.sub.3-Y.sub.4-X.sub.5-Q.sub.6-(G/S).sub.7 (SEQ ID NO: 29) with cleavage occurring between amino acids six and seven of the recognition sequence. While the recognition domain of TEV protease does allow variability at the P.sub.2, P.sub.3, and/or P.sub.5 amino acids, a preferred recognition sequence is E.sub.1-N.sub.2-L.sub.3-Y.sub.3-Y.sub.4-F.sub.5-Q.sub.6-S.sub.7 (SEQ ID NO: 30).
(35) Foot and Mouth Disease Virus
(36) A foot-and-mouth-disease virus or the acronym FMDV refers to, but is not limited to, any of the seven major FMDV antigenically distinct virus serotypes, for example serotypes A, O, C, Asia 1 and South African Territories (SAT) 1, 2 and 3 as well as the multiple subtypes or topotypes which exist within each serotype. The foot-and-mouth disease virus (FMDV) is a non-enveloped picornavirus, belonging to the genus Aphthovirus of the family Picornaviridae, with a single-stranded genomic RNA of between 7,500 to 8,000 nucleotides or approximately between 7,500 to 8,000 nucleotides, approximately 7,500 nucleotides, or approximately 8,000 nucleotides. Referring to
(37) FMDV Hosts and Animals Susceptible to FMDV Infection.
(38) The term host refers to a mammalian subject, especially but not limited to cloven-hooved livestock and wildlife (e.g. cattle, pigs, sheep, goats, water buffalos, yaks, reindeer, deer, elk, llamas, alpacas, bison, moose, camels, chamois, giraffes, hogs, warthogs, kudus, antelopes, gazelles, wildebeests) that are in need of treatment for foot-and-mouth disease (FMD). Hosts are in need of treatment for FMD when they are infected with one or more strains of the FMDV, have been diagnosed with FMD, or are otherwise at risk of contracting FMDV infection. Hosts that are predisposed to to FMD can be defined as hosts that do not exhibit overt symptoms of FMD but that are genetically, physiologically, or otherwise at risk of developing FMD. Cells of mammals may also host FMDV.
(39) Mutants
(40) The terms wild-type or its acronym wt, and native refer to a biological molecule that has not been genetically engineered or otherwise modified, for example, a nucleotide sequence that encodes an FMDV P1 precursor polypeptide that exists in nature and has not been genetically engineered or modified, an FMDV P1 precursor polypeptide translated from a coding nucleotide sequence that exists in nature and has not been genetically engineered or modified, a transgene expression cassette containing a nucleotide sequence encoding for an FMDV P1 precursor polypeptide that exists in nature and has not been genetically modified, and a vector carrying a mutant nucleotide sequence encoding for an FMDV P1 precursor polypeptide that exists in nature and has not been genetically engineered or modified or a transgene expression cassette containing a mutant nucleotide sequence encoding for an FMDV P1 precursor polypeptide that exists in nature and has not been genetically engineered or otherwise modified.
(41) The term mutation as used herein indicates any genetic modification of a nucleic acid and/or polypeptide which results in an altered nucleic acid or polypeptide. Mutations include, but are not limited to point mutations, deletions, or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genetic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, a nonsense mutation, an insertion, or a deletion of part or all of a gene. In addition, in some embodiments of the engineered or modified microorganism, a portion of the microorganism genome has been replaced with a heterologous polynucleotide. In some embodiments, the mutations or modifications are naturally-occurring. In other embodiments, the mutations are identified and/or enriched through artificial selection pressure. It must be noted that all the mutations, modifications or alterations described and exemplified in the present disclosure are the result of genetic engineering, and not naturally occurring mutations. However, some engineered constructs may comprise or make use of naturally-occurring mutations or modifications beyond those engineered by human intervention or selection.
(42) The terms mutated, mutant. modified, altered, variant, and engineered are used as adjectives describing a nucleotide sequence, a nucleic acid, a protein or a protease that differs from a native polynucleotide or amino acid sequence found in nature or from any prior sequence of interest. A prior sequence of interest includes a native polynucleotide or amino acid sequence, such as one isolated from a natural source, but also includes previously engineered polynucleotide or amino acid sequences that can be further engineered, mutated or otherwise modified. A native or unmodified FMDV P1 precursor polypeptide that is engineered to contain amino acid residues defining a potyvirus Na protease site such as a TEV protease site is one example of a mutated, mutant, altered, variant or engineered polypeptide of interest. These terms may be similarly applied to a polynucleotide encoding mutated, mutant, altered, variant or engineered polypeptide of interest. The same terms apply to mutations to other polypeptide or nucleotide sequences, such as those constituting or encoding a previously engineered polypeptide of interest, a modified FMDV 3C protease, modified 2A or 2A-like polypeptide, luciferase or reporter protein, protein tag, or a modified NIa protease such as a modified TEV protease, as disclosed herein. A mutant may contain a single amino acid residue, nucleotide, or codon deletion, substitution, or insertion or multiple deletions, substitutions, or insertions compared to an unmodified, native or not mutated sequence, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more of such deletions, substitutions, or insertions to residues, nucleotides or codons. Alternatively, a mutant or variant may be characterized by a degree of sequence identity or similarity to an unmodified, native or not mutated sequence or to an active portion of such a sequence (e.g., a catalytic site or domain or a nucleotide sequence encoding such), such as by a 60, 70, 80, 90, 95, 98, 99, 99.5, or <100% (or any intermediate value within this range) sequence identity or similarity to a sequence described herein or to an otherwise known sequence.
(43) Polynucleotides, Vectors, Constructs, Recombinant or Genetic Expression
(44) A nucleotide refers to an organic molecule that serves as a monomer, or a subunit of nucleic acids or polynucleotides like DNA and RNA. Nucleotides are building blocks of nucleic acids and are composed of a nitrogenous base, e.g., A (adenine), G (guanine), C (cytosine), T or U (thymine or uracil), a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Thus, a nucleoside plus a phosphate group yields a nucleotide. Nucleotides in a nucleotide sequence are commonly indicated based on their nitrogenous bases.
(45) A nucleotide sequence or a nucleic acid sequence is a succession of letters that indicate the order of nucleotides or nucleic acids within a DNA (using G, A, C, T) or RNA molecule (using G, A, C, U). A DNA or NA molecule e or polynucleotide may be single or double stranded and may be genomic, recombinant, synthetic, a transcript, a PCR- or amplification product, an mRNA or cDNA. It may optionally comprise modified bases or a modified backbone. It may comprise a sequence in either a sense or antisense orientation and it inherently describes its complement.
(46) A recombinant polynucleotide is a polynucleotide that is not in its native state, e.g., the polynucleotide comprises a nucleotide sequence not found in nature, or the polynucleotide is in a context other than that in which it is naturally found, e.g., separated from nucleotide sequences with which it typically is in proximity in nature, or adjacent (or contiguous with) nucleotide sequences with which it typically is not in proximity. For example, the sequence at issue can be cloned into a vector, or otherwise recombined with one or more additional nucleic acids.
(47) An isolated polynucleotide is a polynucleotide whether naturally occurring or recombinant, that is present outside the cell in which it is typically found in nature, whether purified or not. Optionally, an isolated polynucleotide is subject to one or more enrichment or purification procedures, e.g., cell lysis, extraction, centrifugation, precipitation or the like.
(48) A coding region or simply, a region of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene. A coding region of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a tRNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).
(49) Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g. rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
(50) A transgene expression cassette, a transgene expression construct, an expression cassette, an expression construct, a construct, a chimera, a chimeric DNA, a DNA chimera or a chimeric gene is a nucleic acid sequence that has been artificially constructed to comprise one or more functional units, e.g. a promoter, control element, consensus sequence, translational frame-shift sequence, or protein encoding gene not found together in nature, and is capable of directing the expression of any RNA transcript in an organism that the cassette has been transferred to, including gene en coding sequence(s) of interest as well as non-translated RNAs, such as shRNAs, microRNAs, siRNAs, or anti-sense RNAs. A transgene expression cassette may be single- or double-stranded and circular or linear. A transgene expression cassette can be constructed, inserted or cloned into a vector, which serves as a vehicle for transferring, replicating and/or expressing nucleic acid sequences in target cells.
(51) A promoter is a region of DNA that initiates transcription of a particular gene or an expression cassette and is located near the transcription start sites of genes or expression cassettes, on the same strand and upstream on the DNA (towards the 5 region of the sense strand). A promoter can be about 100 to 1,000 base pairs long.
(52) A vector is any means by which a nucleic acid can be propagated and/or transferred between organisms, cells, or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, cosmids, viral vectors, expression vectors, gene transfer vectors, minicircle vectors, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), and the like, that are episomes, that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector typically contains at least an origin of replication, a cloning site and a selectable marker (e.g., antibiotic resistance). Natural versions of the foregoing non-limiting examples may be isolated, purified, and/or modified so the resultant natural version is differentiable from the material in its natural state. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a polylysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as an Agrobacterium or a bacterium.
(53) The term recombinant vector as used herein is defined as vector produced by joining pieces of nucleic acids from different sources or a copy thereof.
(54) A minicircle DNA vector may be referred to as minicircle vector or minicircle is a small (usually in the range of 3-4 kb, approximately 3-4 kb or usually no larger than 10 kb) circular, episomal plasmid derivative wherein all prokaryotic vector parts (e.g., bacterial origin of replication, genes associated with bacterial propagation of plasmids) have been removed. Since minicircle vector contain no prokaryotic DNA sequences, they are less likely to be perceived as foreign and destroyed when they are employed as vehicles for transferring transgenes into mammalian or other suitable target cells.
(55) Transformation
(56) Transformation refers to the process by which a vector or polynucleotide construct is introduced into a host cell. Transformation (or transduction, or transfection), can be achieved by any one of a member of means including chemical transformation (e.g., lithium acetate transformation), electroporation, microinjection, biolistics (or particle bombardment-mediated delivery), or Agrobacterium mediated transformation.
(57) Transfection refers to the process by which a nucleic acid such as a gene cloned inside a vector (DNA or PNA) is delivered into a eukaryotic host cell.
(58) Host Cells
(59) The term host cell refers to a prokaryotic (e.g. bacterial) or a eukaryotic cell (e.g. mammalian, insect, yeast etc.) that is naturally infected or artificially transfected or transformed with a virus or a vector, for example, by vaccination. The virus introduced to the host cell may be live, inactivated, attenuated or modified, while the vector introduced carries a transgene expression cassette that, when expressed in the host cell, may produce viral structural proteins that self-assemble to form virus-like particles (VLPs). In some cases, a host cell may be inside of a host or subject and said host or subject may be treated by the administration of nucleic-acid-based vaccine encoding a modified FMDV P1 precursor polypeptide (or other modified polypeptide of interest) and at least one protease or polynucleotide sequence that cleaves or otherwise processes (e.g., via 2A transcription termination) an engineered FMDV P1 precursor polypeptide or other engineered polypeptide of interest. A host cell may contain a polynucleotide encoding a modified 3C protease in its genomic or episomal DNA. For example, a modified polynucleotide encoding a modified FMDV P1 precursor polypeptide may be incorporated into a host cell genome via recombination, by use of a transposon, or by other recombinant DNA methods well known in the art. Engineered proteins of interest and their cleavage or processed products as well as proteases that process them may also be expressed from the same or different plasmids, episomes, or other DNA or RNA constructs inside of a host cell.
(60) A host cell for expression of an engineered polypeptide of interest or protease, such as FMDV P1 precursor protein or NIa protease, or other FMDV proteins or antigenic sequences and as other proteins of interest, may be a prokaryotic or eukaryotic cell. The term host cell includes yeast or fungal host cells, such as those of Saccharomyces cerevisiae, or Pichia pastoris; plant host cells, such as those of Arabidopsis thaliana, Chlamydomonas reinhardtii, Glycine max, Nicotiana benthamiana, Nicotiana tabacum, Oryza sativa, or Zea mays; insect cells or insect cell lines such as those of Spodoptera frugiperda, Drosophila melanogaster Sf9, or Sf21; the cells of vertebrates or mammals or mammalian cell lines, such as HEK-293T (human kidney embryo) cell, LF-BK (porcine cell), LF-BK V/6, or cells of animals susceptible to FMDV infection; prokaryotic host cells such as those of gram-positive bacteria including cells of Bacillus, Lactococcus, Streptomyces, Rhodococcus, Corynebacterium, Mycobacterium or gram-negative bacteria such as Escherichia or Pseudomonas.
(61) Amino Acids, Proteins, Polypeptide Structures
(62) A residue or an amino acid residue refers to a specific amino acid within the polymeric chain of a peptide, a polypeptide or a protein. A residue may be one of the twenty-two conventional proteinogenic amino acid residues (which include selenocysteine and pyrolysine), a modified proteinogenic amino acid residue, or a non-proteinogenic amino acid residue.
(63) An amino acid sequence, a peptide sequence or a protein sequence refers to the order in which amino acid residues, connected by peptide bonds, link in the chain in peptides and proteins. The sequence is generally reported from the N-terminal end containing a free amino group to the C-terminal end containing a free carboxyl group. Peptide sequence is often called protein sequence if it represents the primary structure of a protein. Throughout the present disclosure, an amino acid residue may be represented by a three-letter code or a single-letter code, including but not limited to Ala (A) for alanine, Arg (R) for arginine, Asn (N) for asparagine, Asp (D) for aspartic acid, Cys (C) for cysteine. Gin (Q) for glutamine, Glu (E) for glutamic acid. Gly (G) for glycine, His (H) for histidine, Ile (I) for isoleucine, Leu (L) for leucine, Lys (K) for lysine, Met (M) for methionine, Phe (F) for phenylalanine, Pro (P) for proline, Ser (S) for serine, Thr (T) for threonine, Trp (W) for tryptophan, Tyr (Y) for tyrosine, Val (V) for valine, Pyl (O) for pyrolysine, Sec (U) for selenocysteine.
(64) As used herein, a non-coded amino acid, a non-proteinogenic amino acid, a synthetic amino acid or an unnatural amino acid refers to an amino acid that is not naturally encoded or found in the genetic code (DNA or mRNA) of any organism, and may be synthesized in vitro or otherwise genetically engineered into a cell
(65) A genetically coded amino acid, a coded amino acid or a natural amino acid refers to an amino acid that is naturally encoded by or found in the genetic code (DNA or mRNA) of an organism, such as alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, pyrrolysine and selenocysteine.
(66) The term protein, peptide, or polypeptide as used herein indicates an organic polymer composed of two or more amino acidic monomers and/or analogs thereof. As used herein, the term amino acid or amino acidic monomer refers to any natural and/or synthetic amino acids including glycine and both D- or L-optical isomers. The term amino acid analog refers to an amino acid in which one or more individual atoms have been replaced either with a different atom, or with a different fictional group. Accordingly, the term polypeptide includes amino acidic polymer of any length including full length proteins, and peptides as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called a protein oligomer or oligopeptide.
(67) FMDV 3C protease. The FMDV 3C protease is a 213-amino acid, 23.1-kDa cysteine protease whose amino acid sequence is greater than 95% homologous across known serotypes and strains of the virus. The cysteine-histidine-aspartic acid catalytic triad at the active site of the FMDV 3C protease, which is conserved in cysteine proteases, is formed by the residues H46, D64 and C163. Proteolytic activity can be knocked out by substituting a residue in this active site, such as by the C163A substitution. The 3C protease cleaves the FMDV P1 precursor protein at the last three positions shown in
(68) FMDV P1 precursor polypeptide (or P1 precursor protein) is a polypeptide comprised of the FMDV structural proteins and/or precursors, VP0, VP1, VP2, VP3, and VP4, as well as the 2A translational interrupter, see
(69) The FMDV VP0 protein is a precursor peptide comprised of the FMDV VP2 and VP4 structural proteins. The FMDV VP0 protein is also identified as the FMDV 1AB protein and is around 33 kDa in molecular weight. It is produced by the processing of the FMDV P1 precursor protein by the FMDV 3C protease. The FMDV VP0 protein is important in the formation of promoters along with FMDV proteins VP3 and VP1. Five of these promoters assemble into a pentamer and twelve pentamers can assemble into a FMDV capsid or VLP. Cleavage of VP0 into VP2 and VP4 occurs through an unknown mechanism. FMDV VP0 protein produced by cleavage of a NIa protease or TEV protease recognition site inserted into an engineered precursor polypeptide will generally be at least 90, 95 or 99% identical or similar to a native VP0 protein. Its terminal amino acid residues may be identical to a corresponding native VP protein and it may contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 variant amino acid residues, such as those forming a NIa or TEV cleavage site, proximal to its termini.
(70) The FMDV VP1 protein is a structural protein which comprises the FMDV capsid and/or FMDV VLP. The FMDV VP1 protein is also identified as the FMDV 1D protein and is around 24 kDa in molecular weight. The FMDV VP1 protein contains a mobile loop structure, identified as the G-H loop, which emerges from the surface of the FMDV capsid and/or VLP. The FMDV VP1 protein can form a protomer along with VP0 and VP3. Five of these promoters assemble into a pentamer and twelve pentamers can assemble into a FMDV capsid or VLP. FMDV VP1 protein produced by cleavage of a NIa protease or TEV protease recognition site inserted into an engineered precursor polypeptide will generally be at least 90, 95 or 99% identical or similar to a native VP1 protein. Its terminal amino acid residues may be identical to a corresponding native VP1 protein and it may contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 variant amino acid residues, such as those forming a NIa or TEV cleavage site, proximal to its termini.
(71) The FMDV VP2 protein is a structural protein which comprises the FMDV capsid and/or FMDV VLP. The FMDV VP2 protein is also identified as the FMDV 1B protein and is around 24 kDa in molecular weight. The FMDV VP2 protein, along with the FMDV VP4 protein, is part of the FMDV VP0 protein until the formation of FMDV capsids and/or VLPs at which point the VP0 protein is processed into VP2 and VP4. FMDV VP2 protein produced by cleavage of a NIa protease or TEV protease recognition site inserted into an engineered precursor polypeptide will generally be at least 90, 95 or 99% identical or similar to a native VP2 protein. Its terminal amino acid residues may be identical to a corresponding native VP2 protein and it may contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 variant amino acid residues, such as those forming a NIa or TEV cleavage site, proximal to its termini.
(72) The FMDV VP3 protein is a structural protein which comprises the FMDV capsid and/or FMDV VLP. The FMDV VP3 protein is also identified as the FMDV 1C protein and is around 24 kDa in molecular weight. The FMDV VP3 protein can form a protomer along with VP0 and VP1. Five of these promoters assemble into a pentamer and twelve pentamers can assemble into a FMDV capsid or VLP. FMDV VP3 protein produced by cleavage of a NIa protease or TEV protease recognition site inserted into an engineered precursor polypeptide will generally be at least 90, 95 or 99% identical or similar to a native VP3 protein. Its terminal amino acid residues may be identical to a corresponding native VP3 protein and it may contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 variant amino acid residues, such as those forming a NIa or TEV cleavage site, proximal to its termini.
(73) The FMDV VP4 protein is the smallest of the FMDV structural proteins and is part of the FMDV capsid and/or FMDV VLP. The FMDV VP4 protein is also identified as the FMDV 1A protein and is around 9 kDa in molecular weight. The FMDV VP4 protein, along with the FMDV VP2 protein, is part of the FMDV VP0 protein until the formation of FMDV capsids and/or VLPs at which point the VP0 protein is processed into VP2 and VP4. Unlike other FMDV proteins which comprise the capsid and/or VLP the VP4 protein is entirely located inside the capsid and/or VLP structure. FMDV VP4 protein produced by cleavage of a NIa protease or TEV protease recognition site inserted into an engineered precursor polypeptide will generally be at least 90, 95 or 99% identical or similar to a native VP4 protein. Its terminal amino acid residues may be identical to a corresponding native VP4 protein and it may contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 variant amino acid residues, such as those forming a NIa or TEV cleavage site, proximal to its termini.
(74) Virus-like particles or VLPs resemble viruses, but are non-infectious because they do not contain any viral genetic material. The expression of viral structural proteins, such as envelope or capsid, can result in the self-assembly of VLPs that can stimulate an immune response in a mammalian organism. In other words, VLPs are often empty viral envelopes or empty viral capsids that are capable of stimulating an immune response like a fill virus. Methods and problems associated with the production of VLPs in alternative systems include those described by Lee, et al., J. Biomed. Sci. 16:69 (Aug. 11, 2009), Srinivas, et al., Biologicals 44:64-68 (2016), Mayr, et al., Vaccine 19: 2152-2162 (2001) and Niborski, et al., Vaccine 24: 7204-7213 (2006) which are each incorporated by reference.
(75) 2A is an FMDV translation interrupter sequence, see Luke, et al, Biotech. Genetic Eng. Revs. 26:223-260 (2009) which is incorporated by reference. A 2A polynucleotide sequence is described by nucleotides 34-90 of SEQ ID NO: 111 and by the amino acid residues encoded thereby (SEQ ID NO: 112). Other 2A sequences may confirming to the 2A motif DXEXNPGP (SEQ ID NO: 113) described herein such as may be employed as well as translation interrupters from other Aphthoviruses such as but not limited to Bovine rhinitis A virus, Bovine rhinitis B virus, and Equine rhinitis A virus and Senecaviruses such as Senecavirus A.
(76) 1D2A. A translation termination sequence that comprises FMDV 1D residues and the FMDV 2A amino acid residues. The polynucleotide sequence of SEQ ID NO: 109 encodes the 1D2A polypeptide of SEQ ID NO: 110. Other degenerate sequences encoding the polypeptide of SEQ ID NO: 110 may also be used. Polynucleotides 1-33 encode FMDV 1D residues, 34-87 encode the 2A amino acid residues, and 88-90 encode a C-terminal proline residue described by both SEQ ID NOS: 109 and 110. Other translation termination sequences similar to 1D2A may have fewer or more residues of the 1D protein than 1D2A or may contain 1, 2, 3 or more point mutations to the 2A sequence that do not affect its ability to act as a translation termination sequence. 1D2A will comprise the amino acid sequence PGP and may optionally comprise part or all of one of the following motifs:
(77) TABLE-US-00001 (SEQIDNO:114) (H/R/Y/D)(K/R)(Q/T/F/V)(E/K/P/A/D)(I/P/L/A)(I/T/V) (A/K/G/S)(P/V)(E/A/V)(K/R)Q(V/L/M/T)(L/C)(N/S) FDLLKLAGDVESNPGP. (SEQIDNO:115) (A/V/I/L/M/T)(T/S/L/C)(N/S)(F/K)(D/S/E)LL(K/Q/L) (Q/R/L)AGD(V/I)E(T/C/S)NGNP (SEQIDNO:116) AGD(V/I)E(T/C/S)NPGP (SEQIDNO:117) LLXXAGDXEXNPGP (SEQIDNO:113) DXEXNPGP
(78) GLuc. Gaussia luciferase gene (GLuc) or a protein expressed therefrom, including variants that are luciferous, such as proteins having at least 90, 95, or 99% sequence identity with a native GLuc protein. GLuc is a small, naturally secreted luciferase of 185 amino acids (SEQ ID NOS: 118/119) useful for examination of low levels of protein expression.
(79) Quaternary FMDV Protein structures. The FMDV VP1, VP0, and VP3 proteins can form a protomer structure consisting of a single copy of each protein. Five of these protomers, consisting of VP1, VP0, and VP3, can assemble into a pentamer structure.
(80) Prophylaxis/Treatment
(81) As used herein, the terms prevent and preventing include the prevention of the recurrence, spread or onset. It is not intended that the present disclosure be limited to complete prevention. In some embodiments, prevention delays disease onset, reduces severity, reduces contagion, or otherwise alters disease symptoms and presentation.
(82) As used herein, the terms treat and treating are not limited to the case where the subject (e.g. cattle) is cured and the disease is eradicated. Rather, embodiments of the present disclosure also contemplate treatment that delays disease progression, decreases particular symptoms, reduces contagion, or otherwise reduces the severity of disease, disease presentation or its symptoms or progression. Prevention or treatment with proteins, such as FMDV viral proteins or VLPs according to the invention may induce cellular or humoral immune responses, for example, by priming or expanding T cells or B cells. The term in vivo refers to a reaction or interaction occurring inside the body, such as inside of the body of subject at risk or having a disease such as FMD.
(83) The term in vitro referring to a reaction or interaction occurring outside of a host body or cell, including but not limited to tissue culture or other cultivation of host cells to produce FMDV viral proteins, NIa or TEV protease, or FMDV 3C proteases. Such processes may take place in a solution, a liquid culture medium, a liquid/solid or viscous medium, such as on agarose in a petri dish, test tube, flask, fermenter, or in an apparatus configured for production of large quantities of FMDV viral proteins or other proteins of interest.
(84) Sequence Homology/Identity/Similarity
(85) The term homolog used with respect to an original enzyme or gene of a first family or species, refers to distinct enzymes or genes of a second family or species which are determined by functional, structural or genomic analyses to be an enzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Most often, homologs will have functional, structural or genomic similarities. Techniques are known by which homologs of an enzyme or gene can readily be cloned using genetic probes and PCR. Identity of cloned sequences as homolog can be confirmed using functional assays and/or by genomic mapping of the genes. Homologs include, but are not limited to, those of NIa proteases (e.g., TEV protease), FMDV P1 protein, FMDV viral proteins, and FMDV 3C proteases.
(86) A protein has homology or is homologous to a second protein if the amino acid sequence encoded by a gene has a similar amino acid sequence to that of the second gene. Alternatively, a protein has homology to a second protein if the two proteins have similar amino acid sequences. Thus, the term homologous proteins is defined to mean that the two proteins have similar amino acid sequences.
(87) A mutant, variant or modified polypeptide may have 75, 80, 85, 90, 95, 97.5, 98, 99, or 100% sequence identity or sequence similarity with a Known FMDV polynucleotide or polypeptide sequence, such as those described herein and in the sequence listing.
(88) BLASTN may be used to identify a polynucleotide sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to a reference polynucleotide. A representative BLASTN setting optimized to find highly similar sequences uses an Expect Threshold of 10 and a Wordsize of 28, max matches in query range of 0, match/mismatch scores of 1/2, and linear gap cost. Low complexity regions may be filtered or masked. Default settings of a Standard Nucleotide BLAST are described by and incorporated by reference to blast.ncbi.nlm.nih.gov/_Blast.cgi?PROGPRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LNK_LOC=blasthome (last accessed Feb. 4, 2016).
(89) BLASTP can be used to identify an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity, or similarity to a reference amino acid using a similarity matrix such as BLOSUM45, BLOSUM62 or BLOSUM80 where BLOSUM45 can be used for closely related sequences, BLOSUM62 for midrange sequences, and BLOSUM80 for more distantly related sequences. Unless otherwise indicated a similarity score will be based on use of BLOSUM62. When BLASTP is used, the percent similarity is based on the BLASTP positives score and the percent sequence identity is based on the BLASTP identities score. BLASTP Identities shows the number and fraction of total residues in the high scoring sequence pairs which are identical; and BLASTP Positives shows the number and fraction of residues for which the alignment scores have positive values and which are similar to each other. Amino acid sequences having these degrees of identity or similarity or any intermediate degree of identity or similarity to the amino acid sequences disclosed herein are contemplated and encompassed by this disclosure. A representative BLASTP setting that ruses an Expect Threshold of 10, a Word Size of 3, BLOSUM 62 as a matrix, and Gap Penalty of 11 (Existence) and 1 (Extension) and a conditional compositional score matrix adjustment. Other default settings for BLASTP are described by and incorporated by reference to the disclosure available at: blast.ncbi.nlm.nih.gov/_Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome(last accessed Jun. 29, 2016).
(90) Codon Usage: Further modifications may be made to a polynucleotide sequence encoding a modified FMDV antigen, such as P1, VP0, VP1, VP2, VP3, VP4 or other proteins, such as the TEV or FMDV 3C proteases. For example, prior to the transformation of a host cell, codon frequency of a polynucleotide sequence encoding FMDV P1 precursor polypeptide, or other FMDV antigens may be modified to optimize expression or stability of a nucleic acid encoding FMDV P1 or other FMDV antigens. Software suitable for optimizing codon usage is known and may be used to optimize codon usage in nucleic acid encoding FMDV P1, or other FMDV antigens, see Optimizer available at genomes._urv.cat/OPTIMIZER/(last accessed Feb. 5, 2016). Codon usage frequencies for various organisms are known and are also incorporated by reference to the Codon Usage Database at www._kazusa.or.jp/codon/(last accessed Feb. 5, 2016).
(91) Not all amino acid codons are degenerate, for example, in the genetic code of most organisms. Met and Trp are encoded by single codons. However, for degenerate codons, frequency or average frequency of codon usage may be selected to range from 0% (no common degenerate codons) to 100% (same frequency of codon usage as host cell genome). This range includes all intermediate values include 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% and 100%. Similarly, G+C content of a nucleic acid encoding FMDV P1, other FMDV or picornavirus proteins, or NIa protease may be matched, moved closer or moved away from that of the host cell by selection of a degenerate codon with more or fewer G or C nucleotides. G+C content of exogenous nucleic acids encoding FMDV P1 precursor polypeptide or other FMDV antigens may range within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50% more or less than the average G+C content of the host cell. Alternatively, codon usage may be modified to modulate or control the expression of NIa protease such as TEV protease, FMDV P1 or other FMDV or picornavirus polypeptides or to attenuate the expression of host cell proteins required for host cell viability, growth, or robustness; see for example, Kew, et al., U.S. Pat. No. 8,846,051 hereby incorporated by reference. In some embodiments, expression of TEV protease, 3C protease, 2A, GLuc, SGLuc, FMDV P1, other FMDV antigens or other proteins by a host cell may be limited or reduced by 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or more compared to a maximum expression rate (e.g., where codon frequency is matched to the host cell) in order to permit aggregation of an antigen (e.g., into a quaternary structure) or a particular folding of an expressed protein (e.g., having a particular secondary or tertiary structure).
(92) Polymerase Chain Reaction
(93) A polymerase chain reaction, or a PCR, is a laboratory technique used to make multiple copies of a segment of DNA. PCR can be used to amplify, or copy, a specific DNA target from a mixture of DNA/mRNA/cDNA molecules. First, two short DNA/RNA sequences called primers are designed to bind to the start, and end of the DNA target. Then, to perform PCR, the DNA/mRNA/cDNA template that contains the target is added to a tube that contains a formulated buffer, primers, free nucleotides, and an enzyme called DNA polymerase, and the mixture is placed in a PCR machine. The PCR machine increases and decreases the temperature of the sample in automatic, programmed steps. Initially, the mixture is heated to denature, or separate, the double-stranded DNA/mRNA/cDNA template into single strands. The mixture is then cooled so that the primers anneal, or bind, to the DNA template. At this point, some DNA polymerase are capable of synthesizing new strands of DNA starting from the primers at the same temperature as the annealing step. Other DNA polymerases require the temperature to be raised to a slightly higher temperature, but still below denaturation temperature. In either case this step is referred to as extension. Following extension and at the end of the first cycle, each double-stranded DNA molecule consists of one new and one old DNA strand. PCR then continues with additional cycles that repeat the aforementioned steps. The newly synthesized DNA segments serve as templates in later cycles, which allow the DNA target to be exponentially amplified millions of times. Thus. PCR can be used to detect, amplify, or mutate the polynucleotide constructs of the invention or their component parts. PCR can also be used to introduce one or more mutations and types of mutations to amplified copies of a DNA segment, such as but not limited to a site directed mutagenesis PCR. PCR may be used to modify proteins or proteases of interest, including FMDV P1 precursor protein, NIa/TEV proteases, and FMDV 3C proteases or to amplify polynucleotides expressing such proteins.
EMBODIMENTS
(94) The invention includes the following, non-limited embodiments.
(95) In one embodiment the invention involves a polynucleotide encoding an engineered substrate polypeptide recognized and cleaved by a NIa or by a NIa protease and FMDV 3C protease. A polypeptide of interest may be any polypeptide for which it is desired to introduce protease cleavage sites, such as a precursor polypeptide that to be processed into separate proteins. Such precursor polypeptides include but are not limited to FMDV P1 precursor polypeptide, as well as those of other viruses, including precursor polypeptides of other picornaviruses, especially those encompassing structural VPs that form capsids. The engineered, modified or mutated polypeptide of interest encoded by the polynucleotide sequence according to the invention will comprise at least one, two, three, four, five, six or more protease cleavage site(s) absent from a corresponding not engineered polypeptide of interest. The at least one protease cleavage site is recognized and cleaved by the catalytic domain of a potyvirus nuclear inclusion protein a, hereinafter called potyvirus NIa protease. A polypeptide of interest may also contain or be engineered to contain other protease sites. such as sites recognized and cleaved by the FMDV 3C protease or a modified or engineered variant thereof.
(96) The polynucleotide of the invention as described above may further comprise at least one promoter or other transcription regulatory element, at least one prokaryotic or eukaryotic translation initiation sequence or other translation regulatory element, at least one translational interrupter sequence, or at least one reporter gene operatively linked to, or embedded within, the polynucleotide sequence encoding the engineered polypeptide of interest. Such sequences are known in the art and include, but are not limited to CMV, (cytomegalovirus promoter), SV40 (simian virus 40 promoter), EF-1 (elongation factor 1 promoter), PGK1 (phosphoglycerate kinase 1 promoter). Ube (ubiquitin C promoter), Beta Actin, CAG (combination of CMV enhancer, beta actin promoter, and rabbit beta-globin splice acceptor), TRE (Tetracycline response element promoter), UAS (Drosophila promoter), Ac5 (Drosophila Actin 5c gene promoter), Polyhedrin (baculovirus promoter), CaMKIIa (Ca2+/calmodulin-dependent protein kinase II promoter). GAL1 (Galactokinase promoter), GAL10 (Galactokinase promoter), TEF1 (Yeast transcription elongation factor promoter), GDS (Yeast Glyceraldehyde 3-phosphage dehydrogenase promoter). ADH1 (Yeast alcohol dehydrogenase I promoter), ADH2 (Yeast alcohol dehydrogenase 2 promoter) CaMV35S (Cauliflower Mosaic Virus promoter). Ubi (Maize ubiquitin gene promoter), HI (human polymerase III RNA promoter), U6 (human U6 small nuclear promoter), T7 (T7 bacteriophage promoter). T71ac (T7 bacteriophage promoter with lac operators), Sp6 (Sp6 bacteriophage promoter), araBAD (arabinose metabolic operon promoter), tip (E. coli tryptophan operon promoter), lac (lac operon promoter), Ptac (hybrid promoter of lac and tip), pL (bacteriophage lambda promoter), CYC1/GRE, MLFalpha1 (Mating Factor a 1 promoter), and PHO5 (Acid Phosphatase promoter).
(97) The polynucleotide of the invention may further comprise a polynucleotide encoding a tag or reporter protein. Representative sequences include SEQ ID NO: 105 which encodes a FLAG or epitope tag (SEQ ID NO: 106), SEQ ID NO: 107 which encodes a His tag (SEQ ID NO: 108), SEQ ID NO: 118 encoding GLuc (SEQ ID NO: 119) and SEQ ID NO: 120 encoding SGLuc (SEQ ID NO: 121). Such tags may be used to monitor cleavage of a precursor polypeptide, to monitor intracellular trafficking or secretion of cleaved proteins linked to a tag or reporter, or for recovering or purifying a protein containing the tag.
(98) A polynucleotide according to the invention may further comprise a polynucleotide sequence that represents a translation interrupter sequence, such as 2A, delta, 1D2A, or at least one other 2A-like translational interrupter, operatively linked to, or embedded within, the polynucleotide sequence encoding the engineered polypeptide of interest. Translation interrupters other than the 2A interrupter from FMDV may be employed.
(99) The polynucleotide of the invention may encode an engineered polypeptide of interest containing protease cleavage sites recognized or cleaved by a potyvirus NIa protease including, but not limited to those of Tobacco Etch Virus, Plum pox virus. Tobacco vein mottling virus, Potato virus Y, Pea seed-borne mosaic virus, Turnip mosaic virus, Clover Yellow vein virus, Pepper vein banding virus, Habenaria mosaic virus, Moroccan watermelon mosaic virus, Zucchini shoestring virus, Daphnea virus Y, or Catharanthus mosaic virus.
(100) The protease recognition or cleavage sites engineered into and encoded by the polynucleotide of the invention may include one or more sites described by an amino acid sequence selected from the group consisting of NVVVHQA (SEQ ID NO: 70), ETVRFQS (SEQ ID NO: 71), YEVHHQA (SEQ ID NO: 72), IVRHQS (SEQ ID NO: 73), IKVRLQA (SEQ ID NO: 74), XVRHQS, where X is Y/E/A/L or I (SEQ ID NO: 75), MLFVFQS (SEQ ID NO: 76), GGQVAHQA (SEQ ID NO: 77), GQVAHQA (SEQ ID NO: 78), EVRHQS (SEQ ID NO: 79), AVRHQS (SEQ ID NO: 80), LVRHQS (SEQ ID NO: 81), ENLYFQS (SEQ ID NO: 82), and ENLYFQG (SEQ ID NO: 83).
(101) In some preferred embodiments the polynucleotide of the invention will encode protease recognition or cleavage sites cleaved by the catalytic domain of Tobacco Etch virus NIa protease (SEQ ID NO: 26), hereinafter called TEV protease. Such a TEV protease recognition or cleavage site may comprise the amino acid motif E.sub.1-X.sub.2-X.sub.3-Y.sub.4-X.sub.5-Q.sub.6-(G/S).sub.7 (SEQ ID NO: 29) or E.sub.1-N.sub.2-L.sub.3-Y.sub.4-F.sub.5-Q.sub.6-S.sub.7 (SEQ ID NO: 30) or may comprise a specific amino acid sequence such as EDAYTQS (SEQ ID NO: 39), EFLYKQG (SEQ ID NO: 40), EDLYFQS (SEQ ID NO: 41), EKLYKQG (SEQ ID NO: 42), ELLYKQG (SEQ ID NO: 43) or EALYKQS (SEQ ID NO: 44).
(102) Embodiments of the polynucleotide according to the invention also include those encoding the TEV protease site(s) described above and also comprising polynucleotides representing 2A, delta 1D2A, or other 2A-like translational interrupters, operatively linked to, or embedded within, the polynucleotide sequence encoding the engineered polypeptide of interest having TEV protease site(s).
(103) In one preferred embodiment, the polynucleotide of the invention will encode a FMDV P1 precursor polypeptide, which is engineered to contain NIa protease cleavage sites, that is at least 70, 75, 80, 85, 90, 95, 99% identical or similar to a FMDV P1 polypeptide described by SEQ ID NOS: 22, 24, 124, 126, 128, 130, 132, 134, and 136. Such NIa protease cleavage sites may be TEV protease cleavage sites. In such embodiments where an engineered FMDV P1 precursor polypeptide is encoded, the NIa or TEV protease recognition and cleavage sites or translation terminator sites are preferably position between at least one junction between VP4 and VP2, P2 and VP3, VP3 and VP1, or VP1 so as to permit a P1 precursor polypeptide to be cleaved into separate viral proteins. Such cleavage or translation terminator sites may also be positioned at junctions producing other FMDV P1 cleavage products such as VP0, VP3 and VP or VP2, VP4, VP3 and VP1. Cleavage sites or translation terminators may also be engineered at junctions between other viral proteins derived from a precursor polypeptide besides those in the FMDV P1 precursor polypeptide or in non-FMDV precursor polypeptides, or at sites where cleavage or translation termination is desired in any protein of interest.
(104) In addition to NIa protease and 2A-like translation interrupters, the polynucleotide of the invention may encode a polypeptide of interest containing sites recognized and cleaved by the FMDV 3C protease or an engineered variant of the FMDV 3C protease. Such sites may pre-exist in the engineered polypeptide or be engineered into it. Thus, in some embodiments the polynucleotide of the invention will encode an engineered polypeptide comprising at least one site recognized by the FMDV 3C protease or a variant thereof.
(105) The polynucleotide of the invention may encode a 3C protease that is active or inactive and inactive proteases may function as scaffolds or accessories to cleavage of the engineered polypeptide of interest.
(106) In another embodiment, the polynucleotide of the invention will encode at least one of a NIa, TEV or 3C protease in addition to an engineered polypeptide of interest containing NIa or TEV protease recognition and cleavage sites or 2A-like translation termination sites absent from the unmodified polypeptide of interest. It may encode at least one potyvirus NIa protease of Plum pox virus, Tobacco vein mottling virus, Potato virus Y, Pea seed-borne mosaic virus, Turnip mosaic virus, Clover Yellow vein virus, Pepper vein banding virus, Habenaria mosaic virus, Moroccan watermelon mosaic virus, Zucchini shoestring virus, Daphnea virus Y, or Catharanthus mosaic virus; or a protease that is at least 80%, 85%, 90%, 95%, or 99% identical or similar thereto and recognizes the same cleavage site as a reference NIa protease. For example, the polynucleotide of the invention may encode a TEV protease comprising the amino acid sequence of SEQ ID NO: 26 or a TEV protease that is at least 80, 85, 90, 95, or 99% identical or similar thereto and recognizes the same TEV protease cleavage sites as that described by SEQ ID NO: 26.
(107) Such an embodiment may encode an FMDV 3C protease or a variant thereof that is at least 80%, 85%, 90%, 95%, or 99% identical or similar to a reference FMDV 3C protease, such as those encoded by or described by SEQ ID NOS: 1-20 or 85-92 or other FMDV strains. Modified FMDV 3C proteases include those that contain one or more amino acid substitutions within residues 26-35, 46, 80, 84, 125-134, 138-150, 163 or 181 of the FMDV 3C protease and that recognize and cleave at least one protease cleavage site recognized by the reference FMDV 3C protease. Such a modified FMDV 3C protease may contain one or more amino acid substitutions within residues 125-134, or preferably for purposes of reducing toxicity on host cells, the L127P substitution. A 3C protease cleavage site may be present in a precursor polypeptide such as a FMDV P1 precursor polypeptide naturally, or may be engineered into a P1 or other precursor polypeptide of interest.
(108) A modified FMDV 3C protease encoded by a polynucleotide according to the invention may also contain one or more amino acid substitutions at residues 46, 80, 84, 163, or 181 of a reference FMDV 3C protease described herein. Specific substitutions to the encoded FMDV 3C protease include one or more of C163A, C163G, C163I, C163L, C163S, C163V, H46Y, H181Y, D80E, D84E, or D84N.
(109) In one embodiment the polynucleotide of the invention will encode an engineered FMDV P1 polypeptide containing NIa or TEV protease cleavage sites and further comprise a polynucleotide encoding 2A, delta 1D2A or at least one other 2A-like translational interrupter operatively linked to, or embedded within, the polynucleotide sequence encoding the engineered FMDV P1 polypeptide; and encode a TEV protease that is at least 90, 95, or 99% identical or similar to the TEV protease of SEQ ID NO: 26; and optionally encode a FMDV 3C protease that is at least 90, 95 or 99% identical or similar to a FMDV 3C protease described by SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90 or 92.
(110) Another embodiment of the invention constitutes a vector, or one or more vectors, comprising the engineered polynucleotide(s) according to the invention. Suitable vectors for transformation into and expression in host cells that express the polynucleotides of the invention are known and include, but are not limited to plasmids such as pET, pLac-Z, pTac, pGEX, YIP (Yeast Integrative plasmids), TOPO, pJC, pBR322, pTarget, pCEP4, pBacPAK8, pCambia, pPZP, pGreen, pRI, pEarleyGate, pHELLSGATE, as well as vectors derived from pPZP such as the pPZP100, pPZP101, pPZP102, pPZP111, pPZP112, pPZP121, pPZP122, pPZP200, pPZP201, pPZP202, pPZP211, pPZP212, pPZP221, and pPZP222 vectors or vectors derived from the pET or pUC vector.
(111) Polynucleotides according to the invention may also be incorporated into viral vectors such as Baculovirus, Adenovirus. Vaccinia Virus, Tobacco Mosaic Virus, Cowpea Mosaic Virus, Plum Pox Virus, Potato Virus X, and Tomato bushy stunt virus.
(112) The polynucleotides according to the invention expressing an engineered polypeptide of interest and other components, such as NIa, TEV, or 3C proteases, or 3C polypeptides lacking protease activity, or 2A or 2A-like translation interrupters may be expressed on the same vector or different vectors. For example, a polynucleotide encoding an engineered FMDV P1 polypeptide comprising NIa or TEV protease cleavage sites as well as a NIa or TEV protease may be expressed on the same vector, or each may be expressed on a different vector. Preferably, they are both expressed on the same vector because this simplifies transformation of a host cell and expression of the encoded polypeptides. In some embodiments, the engineered polypeptide of interest and/or the NIa, TEV or 3C protease or polypeptide, may be incorporated into a host cell chromosome.
(113) Examples of the vector according to the invention include these carrying a polynucleotide encoding an engineered polypeptide of interest, such as an engineered FMDV P1 precursor polypeptide, that comprise one or more potyvirus NIa or TEV sites, FMDV 3C protease sites, or 2-like translation interrupter sequences, and that optionally encodes a NIa, TEV, or 3C protease that recognizes the protease sites in the engineered polypeptide of interest. A vector or vectors according to the invention may comprise any of the polynucleotides according to the invention disclosed herein or may comprise subparts of a polynucleotide of the invention, such as two vectors where one vector encodes an engineered polypeptide and the other a protease that cleaves the engineered polypeptide of interest.
(114) A vector according to the invention may be selected to permit or facilitate expression in a particular kind of host cell, such as a vector suitable for transformation and expression in a eukaryotic cell or a prokaryotic cell. Such vectors include those transformable and expressible in yeasts or fungi, such as Saccharomyces cerevisiae or Pichia pastoris; in Arabidopsis thaliana, Chlamydomonas reinhardtii, Glycine max, Nicotiana benthamiana, Nicotiana tabacum, Oryzas encoded engineered FMDV P1 precursor polypeptide in Spodoptera frugiperda, Drosophila melanogaster, Sf9, Sf21, or another insect cell; in a vertebrate cell; in HEK-293T (human kidney embryo) cell, LF-BK (porcine cell), LF-BK V/6 cell, CHO (Chinese hamster ovary) cell, another mammalian cell.
(115) A vector according to the invention may transform and express in a host cell obtained or derived from a mammal or other animal susceptible to a viral infection, such as FMDV or other picornavirus.
(116) Vectors transformable and expressible in prokaryotic cells include those for Gram-positive bacteria like Bacillus, Lactococcus, Streptomyces, Rhodococcus, Corynebacterium, Mycobacterium; or those transformable and expressible in Gram-negative bacteria such as Escherichia, Salmonella, or Pseudomonas.
(117) Other vectors according to the invention may be minicircle vector, a replication deficient adenovirus vector, a vaccinia virus vector, or other viral vectors that express the encoded engineered FMDV P1 precursor polypeptide or other engineered polypeptide of interest in a host cell.
(118) A vector according to the invention in addition to encoding one or more polypeptides of interest, which contain cleavage sites for TEV protease or one or more other NIa proteases, may further comprise a polynucleotide encoding 2A, delta 1D2A or at least one other 2A-like translational interrupter operatively linked to, or embedded within, a polynucleotide sequence encoding the engineered polypeptide of interest.
(119) Other embodiments of the invention relate to vector composition(s) composition(s) comprising (i) a vector encoding a potyvirus NIa protease and (ii) at least one other vector encoding an engineered polypeptide of interest that comprises at least one site cleaved by said potyvirus NIa protease. Such vector compositions may contain two or more vectors encoding the polypeptide(s) of interest, and separately, two or more vectors encoding at least one TEV or other NIa protease. Compositions containing multiple vectors may contain multiple vectors in a single composition or may constitute a kit comprising two or more compositions that can be combined, each of which contain a vector encoding a polypeptide of interest or a TEV or NIa protease. In specific embodiments, such a composition may comprise a vector that encodes TEV protease and (ii) the at least one other vector that encodes an engineered polypeptide of interest that comprises at least one site cleaved by TEV protease. Such a vector composition may contain a vector encoding at least one potyvirus NIa protease and a separate vector encoding at least one engineered polypeptide of interest that is a FMDV P1 precursor polypeptide that is at least 90% identical to a FMDV P1 precursor polypeptide having a sequence of SEQ ID NO: 22, 24, 124, 126, 128, 130, 132, 134, or 136 and that comprises at least one site cleaved by NIa protease. In another embodiment the vector composition may contain a vector encoding at least one TEV or other NIa protease and at least one other vector that encodes an engineered polypeptide of interest that is a FMDV P precursor pol peptide that is at least 90% identical to a FMDV P1 precursor polypeptide having a sequence of SEQ ID NO: 22, 24, 124, 126, 128, 130, 132, 134, or 136.
(120) Another aspect of the invention is a host cell that comprises the engineered polynucleotide or vector according to the invention. Such a host cell may contain any of the vectors described herein, including those containing polynucleotides encoding engineered FMDV P1 polypeptides containing NIa or TEV protease cleavage sites, FMDV 3C proteases or modified proteases, a 2A or 2A-like translation interrupters. For example, the host cell may contain a vector that expresses an engineered FMDV P1 precursor polypeptide having a sequence that is at least 90% identical to the sequence described by SEQ ID NO: 22, 24, 124, 126, 128, 130, 132, 134, or 136 that contains one or more protease cleavage sites at junctions between viral proteins. The host cell may also contain, on the same vector or on a different vector, a 2A or 2A-like translation interrupter sequence and/or a sequence encoding a NIa, TEV, 3C or modified 3C protease that recognizes the protease cleavage sites on the engineered FMDV P1 polypeptide. When the host cell encodes a modified FMDV 3C protease the protease may contain one or more amino acid substitutions to residues 26-35, 125-134 or 138-150 of the native FMDV 3C protease sequence described by SEQ 13 NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90 or 92 or to a 3C protease that is least 85% identical to the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 86, 88, 90 or 92.
(121) A host cell according to the invention will generally express the engineered polypeptide or proteases encoded by the polynucleotides and vectors of the invention described herein. It may be a eukaryotic host cell or a prokaryotic host cell. Examples of such eukaryotic cells include those of fungi and yeasts including Saccharomyces cerevisiae, Pichia pastoris, or another yeast or fungus cell; Arabidopsis thaliana, Chlamydomonas reinhardtii, Glycine max, Nicotiana benthamiana, Nicotiana tabacum, Oryza sativa, Zea mays or another plant cell; Spodoptera frugiperda, Drosophila melanogaster, Sf9, Sf21, or another insect cell; a vertebrate cell: a mammalian cell, such as those from mammals or other animals susceptible to, or carriers of, FMDV infection, HEK-293T (human kidney embryo) cell, LF-BK (porcine cell), LF-BK V/6 cell, CHO (Chinese hamster ovary) cell, or another mammalian cell.
(122) Alternatively, a host cell may be a prokaryotic cell. For example, a host cell may be selected from Bacillus, Lactococcus, Streptomyces, Rhodococcus, Corynebacterium, Escherichia, Pseudomonas or another gram-negative prokaryote.
(123) A host cell may carry, or be capable of carrying, a vector that is minicircle vector, a replication deficient adenovirus vector, a vaccinia virus vector, or another viral vector that encodes and expresses the engineered polypeptide of interest and, optionally, an engineered FMDV 3C protease.
(124) A host cell may also carry a vector or other nucleic acids that encode at least one engineered polypeptide of interest that comprises a 2A, delta 1D2A or at least one other 2A-like translational interrupter operatively linked to, or embedded within the at least one engineered polypeptide of interest.
(125) Non-limited examples of host cells according to the invention include those carrying a polynucleotide or vector encoding FMDV P1 precursor polypeptide or another polypeptide of interest containing at least one protease cleavage site is cleaved by the catalytic domain of a TEV protease and wherein the at least one engineered polypeptide of interest comprises a TEV protease, and a 2A, delta 1D2A or at least one other 2A-like translational interrupter operatively linked to, or embedded within the at least one engineered polypeptide of interest; or a polynucleotide or vector encoding a TEV protease, an engineered FMDV P1 precursor polypeptide that is at least 90% identical to a P1 precursor polypeptide having a sequence of SEQ ID NO: 22, 24, 124, 126, 128, 130, 132, 134, or 136, and a 2A, delta 1D2A or at least one other 2A-like translational interrupter operatively linked to, or embedded within the at least one engineered polypeptide of interest, wherein the engineered FMDV P1 precursor polypeptide further comprises at least one protease cleavage site that is cleaved by the catalytic domain of a TEV protease.
(126) Another aspect of the invention involves a method for proteolytically processing an engineered polypeptide of interest comprising culturing a host cell according to the invention and recovering cleavage products of the at least one engineered polypeptide of interest produced by cleavage of the at least one protease cleavage site in the engineered polypeptide or by producing shorter polypeptides from a longer precursor polypeptide by translation interruption via a 2A or 2A-like sequence.
(127) Such a method may cultivate a host cell transformed or transfected with polynucleotide(s) encoding engineered FMDV P1 polypeptides containing NIa or TEV protease cleavage sites, FDMC 3C proteases or modified proteases, a 2A or 2A-like translation interrupters. For example, a host cell may be cultivated that contains a vector that expresses an engineered FMDV P1 precursor polypeptide having a sequence that is at least 90% identical to the sequence described by SEQ ID NO: 22, 24, 124, 126, 128, 130, 132, 134, or 136 that contains one or more protease cleavage sites at junctions between viral proteins. One may also cultivate a host cell containing, on the same vector or on a different vector, a 2A or 2A-like translation interrupter sequence and/or a sequence encoding a NIa, TEV, 3C or modified 3C protease that recognizes the protease cleavage sites on the engineered FMDV P1 polypeptide. When a host cell expressing a FMDV P1 precursor polypeptide that contains NIa, TEV, 3C or modified 3C proteases cleavage sites or 2A or 2A-like translation terminator sites at junctions between VP and VP3; VP3 and VP1; or VP1 and 2A and said culturing produces VP0, VP3 and VP1, then one may recover FMDV viral proteins VP0, VP1, VP2, VP3 and/or VP4 from the host cell culture as individual proteins or a higher order structures such as a quaternary structure of one or more viral proteins or as VLPs.
(128) Those skilled in the art may further recover, concentrate or purify proteins produced by the methods according to the invention from the host cells per se (e.g., after cell lysis) or from culture medium. Proteins, such as individual FMDV viral proteins produced by cleavage of the P1 precursor polypeptide, may be further isolated on the basis of differences in protein size, physico-chemical properties, binding affinity or biologically activity, for example, by chromatographic separation or by affinity purification. In some embodiments viral proteins will be tagged, for example, with an epitope tag, a FLAG or His tag or a luminescent tag or reporter protein to facilitate recovery. Antibodies that recognize different FMDV proteins are known and may be used to selectively purify the proteins to which they bind using affinity purification.
(129) Upon recovery, proteins such as FMDV viral proteins, may be allowed to assemble into higher order structures or assembled using methods known in the art into higher order structures such as VLPs. Higher order structures often contain structural epitopes absent from the individual proteins funning them. Examples of FMDV proteins that may be recovered include VP0, VP3 and VP1 as individual proteins or in the form of virus-like particles or VLPs; or VP4, VP2, VP3 and VP1 as individual proteins or in the form of virus-like particles or VLPs. Accordingly, some embodiments of this method according to the invention, include recovering VP0, VP3 and VP1 and assembling them into VLPs or recovering VP4, VP2, VP3 and VP1 and assembling them into VLPs. Such a method may advantageously be practiced by cultivating a host cell expressing an engineered FMDV P1 precursor polypeptide containing a cleavage site cleaved by the catalytic domain of a TEV protease at junctions between VP4 and VP2; VP2, and VP3; VP3 and VP1: or VP1 and 2A and said culturing produces VP4, VP2, VP3 and VP1; and then recovering and optionally assembling individual viral proteins into VLPs.
(130) In some embodiments of this method the host cells are cultured at a temperature at which the TEV protease is inactive, and then cultured or held at a temperature at which the TEV protease is active, and thereafter, optionally lysed and held at a temperature at which the TEV protease is active so that cleavage of the engineered precursor polypeptide may occur. Alternatively, a host cell may express a Na or TEV protease (or 3C or modified 3C protease) under the control of an inducible promoter. In this embodiment, the host cells are cultured in the absence of an inducer for the inducible promoter and then cultured in the presence of said inducer and thereafter, optionally lysed and held at a temperature or under other conditions at which NIa, TEV, 3C and/or modified 3C protease is active.
(131) Another embodiment of the invention constitutes a composition containing a modified polypeptide of interest, such as an engineered FMDV P1 precursor polypeptide containing NIa, TEV, 3C, or modified 3C cleavage sites, or polypeptide products produced by cleavage of such a polypeptide of interest by NIa, TEV, 3C and/or modified 3C proteases. For example, such a composition may contain an uncleaved engineered FMDV P1 polypeptide that can be admixed with a NIa, TEV, 3C or modified 3C protease, or may contain cleavage products of such a precursor polypeptide such as VP0, VP2 or VP3, or VP4, VP2, VP3 and VP1. Examples of composition containing cleavage products of an engineered FMDV P1 precursor polypeptide include those containing VP0, VP1 and VP3; VP0, VP1 and VP3 in the form of virus-like particles, or VLPs, optionally as empty capsids not containing RNA; VP4, VP2, VP1 and VP3; or VP4, VP2, VP1 and VP3 in the form of virus-like particles, or VLPs, optionally as empty capsids not containing RNA.
(132) A composition according to the invention may comprise a suitable buffer for further processing the protein, for stabilizing the protein(s) for storage or for use in diagnostic procedures, or for administering the protein(s), such a pharmaceutically acceptable adjuvant, buffer, carrier, solute or excipient. For therapeutic uses, the composition may further comprise at least one other active immunogen, drug or antiviral agent, such as immunogens for antiviral agents for FMDV or other picornavirus diseases.
(133) In some embodiments a therapeutic composition will be formulated for parenteral administration, for intramuscular, intranasal, or intravenous administration, or for administration orally or otherwise into the alimentary canal.
(134) Another aspect of the invention involves treatment of a subject at risk of or having a disease, such as FMD or another picornavirus disease, by administering polypeptides or cleavage products of polypeptides according to the invention. In one embodiment the invention is directed to a method for preventing or treating FMDV infection comprising administering a composition that contains FMDV viral proteins or VLPs to a subject in need thereof or at risk of FMDV infection. This method may comprise administering a FMDV viral protein composition according to the invention to an uninfected subject or to an infected subject. Suitable subjects include cloven-footed animals such as a bovine, caprine, ovine or swine. The composition may be administered to the subject parenterally, orally or otherwise into the alimentary canal, intranasally, intratracheally, intrapulmonarily or on to a mucous membrane.
(135) In another embodiment, the invention is directed to a method for preventing or treating FMDV infection comprising administering at least one polynucleotide or vector encoding an engineered FMD P1 precursor protein containing one or more potyvirus NIa, TEV, 3C, or modified 3C, protease cleavage sites and/or encoding a potyvirus NIa, TEV, 3C, or modified 3C protease. The engineered FMDV P1 polypeptide and protease may be encoded one polynucleotide or vector or on separate polynucleotides and vectors.
(136) Another embodiment of the invention is directed to a method for preventing or treating FMDV infection comprising administering a host cell that expresses an engineered FMDV P1 precursor polypeptide containing one or more potyvirus NIa or TEV protease, and/or a 3C or modified 3C protease cleavage sites and a potyvirus NIa or TEV protease. Such a host cell may be autologous, syngeneic, or xenogeneic to the subject.
(137) Other embodiments of the invention are directed to diagnostic products, assays and kits and include, but are not limited to, an antigenic composition or diagnostic product comprising the composition obtained by proteolysis of the at least one engineered polypeptide of interest according to the invention an antigenic composition or diagnostic product comprising a composition that comprises cleavage products of a FMDV P1 precursor polypeptide; a diagnostic chip or platform comprising the composition obtained by proteolysis of the at least one engineered polypeptide of interest, such as but not limited to proteolysis of an engineered FMDV P1 precursor polypeptide; a diagnostic kit or assay comprising a composition according to the invention obtained by proteolysis of the engineered polypeptide of interest and, optionally, at least one other reagent, test strip, plate, reaction container, package, bag, or instructions for use in written or computer readable form; a diagnostic kit or assay comprising the composition according to the invention obtained by proteolysis of the engineered polypeptide of interest and, optionally, at least one other reagent, test strip, plate, reaction container, package, bag, or instructions for use in written or computer readable form.
EXAMPLES
(138) To explore and evaluate whether it was practical and feasible to use a. Na protease (TEV protease) to process a FMDV P1 polypeptide modified to contain NIa protease cleavage sites, plasmids were constructed. These plasmids expressed a P1 polyprotein derived from FMDV O1 Manisa that was modified to have TEV protease recognition sequences at the junctions between segments of the P1 protein corresponding to individual FMDV VPs.
(139) Plasmids encoding P1 polyprotein with either the minimum or optimum TEV recognition sequences were constructed and evaluated. This work showed that while TEV protease had some difficulty processing junctions modified to match the minimum recognition sequence, E.sub.1-X.sub.2-X.sub.3-Y.sub.4-X.sub.5-Q.sub.6-(G/S).sub.7 (SEQ ID NO: 29), it had no difficulty processing junctions modified to match the optimum recognition sequence, E.sub.1-N.sub.2-L.sub.3-Y.sub.1-F.sub.5-Q.sub.6-S.sub.7 (SEQ ID NO: 30). These results showed that the TEV-based system produced fully processed VPs from the P1 polyprotein and subsequent work with immunoprecipitates of the processed VPs showed co-precipitation of different VPs suggesting that the VPs produced by this TEV-based system were able to interact.
Example 1
(140) Engineering and Analysis of Constructs Expressing Engineered FMDV P1 Precursor Polypeptides Having Modified VP Junction Sites.
(141) The amino acid sequences at the VP junction sites of the P1 precursor proteins of six FMDV serotypes were examined. Nucleic acid and amino sequences of the P1 precursor proteins were obtained from GenBank accessions as follows SAT 1 isolate KNP/196/91 (DQ009716.1)(SEQ ID NOS: 21 and 22), SAT 3 isolate ZIM/05/91/3 (DQ009740.1)(SEQ ID NOS: 23 and 24), O1 Manisa Iso87 (AY593823)(SEQ ID NOS: 123 and 124), O1 pan Asia (JX170747)(SEQ ID NOS: 125 and 126), A24 Cruzeiro iso71 (AY593768)(SEQ ID NOS: 127 and 128), A Turkey/2006 (JF749841)(SEQ ID NOS: 129 and 130), SAT2 Egypt 2010 (KC440884)(SEQ ID NO: 131 and 132), C3 indaial (AY593806)(SEQ ID NO: 133 and 134), Asial Shamir (JF739177)(SEQ ID NO: 135 and 136).
(142) Constructs pMM and pOM were synthesized by Genscript and inserted into the mpTarget vector using cut sites BamHI and EcoRI. Vectors were propagated by transfecting NEB 5-alpha competent E. coli High Efficiency (New England Biolabs) as per manufacturer's instructions. Construct pV0J was created using construct pOM as a template.
(143) A non-modified O1 Manisa template was used for PCR with primers mpTarget-F (GACATCCACTTTGCCTTTCTCTC)(SEQ ID NO: 100) and O1VP0-2j-R (TCCTCTAGAAGAGTGGT)(SEQ ID NO: 101) amid OneTaq 2X Master Mix with Standard Buffer (New England Biolabs) as per manufacturer's instructions.
(144) PCR product and pOM vector were digested with BamHI and XbaI (New England Biolabs) restriction enzymes as suggested by manufacturer.
(145) Digested PCR product was ligated into digested pOM vector using a 3:1 insert to vector ratio with T4 DNA ligase (Roche) as per manufacturer's instructions.
(146) Ligation reactions were transfected into NEB 5-alpha Competent E. coli High Efficiency (New England Biolabs) as per manufacturer's instructions and plated onto LB Agar plates with 100 g/mL Carbenicillin, X-gal, and IPTG (Teknova) and incubated at 37 C. overnight.
(147) Colonies were picked and grown in Terrific Broth with 100 ug/ml Carbenicillin overnight and plasmids isolated by using Qiagen plasmid mini-preps (Qiagen).
(148) Construct expression sequences are described as follows: pMM (SEQ ID NO: 93), pOM (SEQ ID NO: 95) and pVOJ (SEQ ID NO: 97).
(149) HEK293-T cells were transfected with constructs or controls using Lipofectamine 2000 (Life Technologies) as per manufacturer's instructions. Cells were placed at 30 C. for 48 hours to allow for expression and processing of transgene. Cells were removed from flasks by flushing media with a pipette. Media was then centrifuged at 500 rpm for 3 minutes to pellet cells. Supernatant was removed and the cell pellet dissolved in 500 l of M-PER Mammalian Protein Extraction Reagent (Life Technologies).
(150) For each lane on a protein gel 15 l of cell lysate was mixed with 7.5 l of 4 NuPage Loading Buffer and heated at 959C for 10 minutes prior to loading. NuPAGE protein gels (Invitrogen) were run for 35 minutes at 200V in running buffer. Samples were then transferred to membranes using the i-BLOT (Invitrogen) system as per manufacturer's instructions.
(151) For western blotting, membranes were incubated in 5% milk blocking buffer at room temperature for 1 hour then washed three times with 1PBS-T buffer for five minutes each time. Four different primary antibodies were diluted in 1PBS-T and used for westerns F14 mouse monoclonal at 1:50 dilution, Anti-VP3 Rabbit polyclonal at 1:250 dilution, 12FE9 mouse monoclonal at 1:50 dilution, and m anti-DYKDDDDK (SEQ ID NO: 106) mouse monoclonal antibody (Clontech) at 1:1000 dilution. Primary antibodies were incubated on membranes for 1 hour at room temperature. After incubation, membranes were washed three times for five minutes each. Depending on the source of the primary antibody either a Goat anti-mouse-HRP conjugated antibody or Goat anti-rabbit-HRP conjugated antibody was used at 1:500 dilution. Membranes were incubated in secondary antibody for 1 hour at room temperature then washed three times for five minutes each. DAB stain packets (Sigma) were used as per manufacturer's instructions to visualize bands. After band visualization membranes were rinsed three times in ddH.sub.2O.
(152) Co-Immunoprecipitation was performed using Pierce Classic Magnetic IP/Co-IP Kit (Life Technologies) as per manufacturer's instructions using antibodies B473M anti-FMDV mouse monoclonal (ABCAM), 2D2 anti-FMDV mouse monoclonal (ABCAM), and G16 anti-Interferon alpha mouse monoclonal (ABCAM). Western blotting of elutions was performed as described previously with the same antibodies as described previously.
Example 2
Evaluation of VP Junction Sites in FMDV P1 Polypeptide Precursor
(153) There are four points of cleavage in the FMDV P1 precursor polypeptide utilized to create the four fully processed VPs,
(154) To test the ability of TEV protease to process the P1 polypeptide the inventors examined its ability to process a modified P1 with the minimal number of mutations needed to generate the four separate VPs (pMM). It was decided not to induce cleavage between VP1 and 2A as a previous publication showed virus viability with VP1-2A fusions. This resulted in a total of 9 amino acids being altered at three VP junction sites,
(155) The pMM construct was able to provide expression of TEV protease unattached to the P1 polypeptide through usage of the 2A translational interrupter sequence,
(156) The TEV protease was able to process two of the three junctions in the engineered P1 polypeptide expressed by the pMM construct between VP4/VP2 and VP3/VP1. No fully processed VP2 or VP3 was observed suggesting that the TEV protease had difficulty processing the modified VP2/VP3 site of E.sub.1-F.sub.2-P.sub.3-Y.sub.4-K.sub.5-Q.sub.6-G.sub.7 (SEQ ID NO: 32),
(157) Since the TEV protease was active but unable to fully process the engineered P1 polypeptide of the pMM construct which have E.sub.1-F.sub.2-P.sub.3-Y.sub.4-K.sub.5-Q.sub.6-G.sub.7 (SEQ ID NO: 32) at the modified VP2/VP3 junction, the inventors examined the ability of the TEV protease to cleave a junction based on a preferred TEV consensus sequence. The pOM and pVOJ constructs were designed to have this preferred TEV protease target site present at all VP junction sites, see
(158) In the pOM construct, all four points of cleavage needed to make fully processed VPs were modified to comprise the amino acid sequence E.sub.1-N.sub.2-L.sub.3-Y.sub.4-F.sub.5-Q.sub.6-S.sub.7 (SEQ ID NO: 30),
(159) In the pVOJ construct, there is no TEV protease target/recognition site at the VP4/VP2 junction, a junction that is not processed by the native FMDV 3C protease. VP4 and VP2 when uncleaved together form VP0. The process by which VP0 is separated into VP2 and VP4 is described in the literature as being independent from processing by the native FMDV 3C protease and as taking place upon encapsulation and not processed by the 3C protease. The inventors examined the pVOJ construct which had no TEV recognition sequence present within VP while retaining the preferred TEV consensus sequences at the other three VP junctions (pV0J),
(160) Using the pOM construct, the inventors demonstrated that it is possible to obtain full processing of the engineered P1 precursor polypeptide into VPs using the TEV protease with only small amounts partially processed intermediates being present as shown by
(161) The pV0J, which contains the preferred TEV protease target/recognition site at three of the found P1 junctions, closely mirrored the P1 processing products of the 3C protease and was able to produce fully processed VP0, VP3, and VP1; see
Example 3
Effects of Co-Expression of FMDV 3C Protease with Engineered FMDV P1 and TEV Protease
(162) The invention eliminates the requirement for native FMDV 3C protease to process FMDV P1 precursor polypeptide and thus avoids host cell toxicity associated with the 3C protease. However, it is unknown whether the FMDV 3C protease serves some other non-proteolytic function such as participation in post-translation modification of viral proteins or in their assembly into higher order structures such as viral capsids. For example, the 3C polypeptide could serve as a scaffolding protein to facilitate interactions amongst processed and/or unprocessed VPs.
(163) To account for this possibility the inventors created two additional constructs based on the pOM and pV0J constructs that express an inactive FMDV 3C protease containing the C163A mutation which inactivates the FMDV 3C proteolytic catalytic site. These constructs are pOM+3C(C163A) and pV0J+3C(C163A) respectively, and are described by
(164) The pOM+3C(C163A) and pV0J+3C(C163A) constructs demonstrate that a fusion of the FMDV 3C(C163A) with the TEV protease retains the ability to process junctions on the FMDV P1 polypeptide modified to TEV protease recognition sequences; see
Example 4
Evaluation of Higher Order VP Structures Using Immunoprecipitation
(165) For vaccine production, the assembly of tertiary or quaternary structures from individual FMDV VPs is desirable because these higher order structures contain unique or protective epitopes similar to those in the native virus. Since the pOM construct was able to produce fully processed VPs from the engineered FMDV P1 precursor polypeptide, the inventors further investigated protein interactions amongst these VPs. Co-immunoprecipitations were performed to look for protein interactions associated with the formation of the FMDV capsid or other higher order structures,
(166) Co-IPs using anti-FMDV antibodies 12FE9 (anti-VP1) and B473M were successful in pulling down fully processed VP2 and VP3,
(167) Co-IPs using 12FE9 and B473M antibodies with the pV0J sample, which does not contain a TEV protease site between VP4/VP2, showed successful capture of VP0, VP3 and VP1 peptides,
(168) Co-IPs using 12FE9 (anti-VP1) and B473M antibodies with the pOM+3C (C163A) and pV0J+3C(C163A) samples showed successful capture of VP2, VP3 and VP1 peptides for only the pOM+3C(C163A) construct in the presence of modified 3C protease,
(169) The addition of the FMDV 3C(C163A) sequence on the N-terminus of the TEV protease enhanced the amount of VP2, VP3, and VP1 pulled down in both 12FE9 and B473M co-IPs when compared to the pOM construct alone suggesting the advantages of coexpressing a 3C or modified 3C protein. However, the lack of capture of any significant amounts of VP2 in the pV0J+3C(C163A) construct suggests that while interactions amongst the processed VPs is taking place it is not inducing the reaction required to process VP0 into VP2 and VP4.
(170) The Examples above demonstrate the feasibility of FMDV P1 processing using an alternative protease, specifically, the TEV protease, to reduce the negative effects on host cells caused by the FMDV 3C protease as well as the potential advantages of co-expressing a modified FMDV 3C protease.
Example 5
Prokaryotic Expression
(171) Bacterial Expression of DNA constructs encoding an engineered FMDV P1 protein and TEV Protease. A construct, pSNAP OM (SEQ ID NO: 122), which comprises DNA encoding the P1 precursor protein from FMDV serotype O and TEV protease. The pSNAP vector comprising this construct was transformed into prokaryotic (bacterial cells, E. coli). The western blot data in
(172) These results in conjunction with data showing expression of FMDV and TEV in eukaryotic host cells suggest that other expression systems including other bacteria, yeasts, insect cells and plant cells will express functional TEV protease and permit processing of a protein expressed from a single open reading flame, such as an engineered FMDV P1 precursor polypeptide. Such expression systems are useful for production of vaccines, in biotherapies or in biomanufacturing where multiple proteins in stoichiometric amounts are desired. Moreover, expression of a single protein facilitates recombinant expression as only a single vector need be used.
(173) The data herein show that FMDV P1 polypeptide can be altered in such a way to allow for processing by the TEV protease, a far more specific protease than the FMDV 3C protease. As shown, the TEV protease can be used to process a long single peptide into individual peptides which retain structural interactions similar to what occurs in nature using a single open reading frame in a plasmid system. The invention thus provides a safe and convenient way to produce larger amounts of FMDV proteins suitable for use in vaccines, diagnostic products, and other anti-FMDV biologics without the drawbacks of existing expression systems employing the FMDV 3C protease. The invention also provides a way that the TEV protease can be expressed within a single ORF along with a polypeptide for processing through utilization of the FMDV 2A translational interrupter sequence.
(174) The foregoing disclosure provides examples of specific embodiments. As will be understood by those skilled in the art, the approaches, methods, techniques, materials, devices, and so forth disclosed herein may be embodied in additional embodiments as understood by those of skill in the art, it is the intention of this application to encompass and include such variations. Accordingly, this disclosure is illustrative and should not be taken as limiting the scope of the following claims.