Production Method for L-Amino Acid

20190161780 ยท 2019-05-30

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for producing an L-amino acid such as L-lysine is provided. An L-amino acid is produced by culturing a bacterium having an L-amino acid-producing ability, which has been modified so that the activity of a carotenoid biosynthesis enzyme is increased, in a medium, and collecting the L-amino acid from the medium.

Claims

1. A method for producing an L-amino acid, the method comprising: culturing a bacterium having an L-amino acid-producing ability in a medium to accumulate an L-amino acid in the medium; and collecting the L-amino acid from the medium, wherein the bacterium has been modified so that the activity of a carotenoid biosynthesis enzyme is increased as compared with a non-modified bacterium.

2. The method according to claim 1, wherein the carotenoid biosynthesis enzyme is selected from the group consisting of geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, lycopene beta-cyclase, carotene ketolase, carotene hydroxylase, and combinations thereof.

3. The method according to claim 2, wherein at least the activity or activities of one or more of said carotenoid biosynthesis enzymes is/are increased.

4. The method according to claim 2, wherein at least the activities of geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, and lycopene beta-cyclase are increased.

5. The method according to claim 3, wherein the activity or activities of carotene ketolase and/or carotene hydroxylase is/are further increased.

6. The method according to claim 2, wherein the geranylgeranyl pyrophosphate synthase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence of SEQ ID NO: 12 or 24; (b) a protein comprising the amino acid sequence of SEQ ID NO: 12 or 24, but which includes substitution, deletion, insertion, and/or addition of 1 to 10 amino acid residues, and having geranylgeranyl pyrophosphate synthase activity; and (c) a protein comprising an amino acid sequence having an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 12 or 24, and having geranylgeranyl pyrophosphate synthase activity.

7. The method according to claim 2, wherein the phytoene synthase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence of SEQ ID NO: 14 or 26; (b) a protein comprising the amino acid sequence of SEQ ID NO: 14 or 26, but which includes substitution, deletion, insertion, and/or addition of 1 to 10 amino acid residues, and having phytoene synthase activity; and (c) a protein comprising an amino acid sequence having an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 14 or 26, and having phytoene synthase activity.

8. The method according to claim 2, wherein the phytoene desaturase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence of SEQ ID NO: 16 or 28; (b) a protein comprising the amino acid sequence of SEQ ID NO: 16 or 28, but which includes substitution, deletion, insertion, and/or addition of 1 to 10 amino acid residues, and having phytoene desaturase activity; and (c) a protein comprising an amino acid sequence having an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 16 or 28, and having phytoene desaturase activity.

9. The method according to claim 2, wherein the lycopene beta-cyclase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence of SEQ ID NO: 18; (b) a protein comprising the amino acid sequence of SEQ ID NO: 18, but which includes substitution, deletion, insertion, and/or addition of 1 to 10 amino acid residues, and having lycopene beta-cyclase activity; and (c) a protein comprising an amino acid sequence showing an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 18, and having lycopene beta-cyclase activity.

10. The method according to claim 2, wherein the carotene ketolase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence of SEQ ID NO: 20, 30, or 61; (b) a protein comprising the amino acid sequence of SEQ ID NO: 20, 30, or 61, but which includes substitution, deletion, insertion, and/or addition of 1 to 10 amino acid residues, and having carotene ketolase activity; and (c) a protein comprising an amino acid sequence having an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 20, 30, or 61, and having carotene ketolase activity.

11. The method according to claim 2, wherein the carotene hydroxylase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence of SEQ ID NO: 22, 58, 59, or 60; (b) a protein comprising the amino acid sequence of SEQ ID NO: 22, 58, 59, or 60, but which includes substitution, deletion, insertion, and/or addition of 1 to 10 amino acid residues, and having carotene hydroxylase activity; and (c) a protein comprising an amino acid sequence having an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 22, 58, 59, or 60, and having carotene hydroxylase activity.

12. The method according to claim 1, wherein the activity of the carotenoid biosynthesis enzyme is increased by increasing the expression of a gene encoding the carotenoid biosynthesis enzyme.

13. The method according to claim 12, wherein the expression of the gene is increased by increasing the copy number of the gene and/or modifying an expression control sequence of the gene.

14. The method according to claim 1, wherein the bacterium is a bacterium belonging to the family Enterobacteriaceae or a coryneform bacterium.

15. The method according to claim 1, wherein the bacterium is a bacterium belonging to the genus Pantoea or Escherichia.

16. The method according to claim 15, wherein the bacterium is Pantoea ananatis or Escherichia coli.

17. The method according to claim 1, wherein the bacterium is a bacterium belonging to the genus Corynebacterium.

18. The method according to claim 17, wherein the bacterium is Corynebacterium glutamicum.

19. The method according to claim 1, wherein the L-amino acid is an L-amino acid of aspartate family and/or an L-amino acid of glutamate family.

20. The method according to claim 1, wherein the L-amino acid is selected from the group consisting of L-lysine, L-threonine, L-glutamic acid, and combinations thereof.

21. The method according to claim 1, wherein the bacterium has is able to produce a carotenoid, and said carotenoid accumulates in cells of the bacterium as a result of the culturing.

22. The method according to claim 21, wherein the cells contain the carotenoid in an amount of 10 g/g-DCW or more.

23. The method according to claim 21, wherein the carotenoid is selected from the group consisting of beta-carotene, zeaxanthin, canthaxanthin, astaxanthine, and combinations thereof.

24. The method according to claim 21, which further comprises collecting the cells.

25. A method for producing bacterial cells containing a carotenoid, the method comprising: culturing a bacterium that is able to produce an L-amino acid and a carotenoid in a medium to accumulate a carotenoid in cells of the bacterium; and collecting the cells, wherein the bacterium has been modified so that the activity of a carotenoid biosynthesis enzyme is increased as compared with a non-modified bacterium.

26. The method according to claim 25, wherein the cells contain the carotenoid in an amount of 10 g/g-DCW or more.

27. The method according to claim 25, wherein the carotenoid is selected from the group consisting of beta-carotene, zeaxanthin, canthaxanthin, astaxanthine, and combinations thereof.

28. Cells of a bacterium, wherein the cells contain a carotenoid, wherein the bacterium is able to produce an L-amino acid and a carotenoid, and wherein the bacterium has been modified so that the activity of a carotenoid biosynthesis enzyme is increased as compared with a non-modified bacterium.

29. The cells according to claim 28, wherein the cells contain the carotenoid in an amount of 10 g/g-DCW or more.

30. The cells according to claim 28, wherein the carotenoid is selected from the group consisting of beta-carotene, zeaxanthin, canthaxanthin, astaxanthine, and combinations thereof.

31. A composition for culturing an aquatic organism, the composition containing the cells according to claim 28, wherein the aquatic organism is salmon, shrimp, or seabream.

32. A feed for an aquatic organism, the feed containing the cells according to claim 28, wherein the aquatic organism is salmon, shrimp, or seabream.

33. A method for culturing an aquatic organism, the method comprising: feeding cells produced by the method according to claim 25, wherein the aquatic organism is salmon, shrimp, or seabream.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0041] FIG. 1 shows a graph of the results of L-lysine production culture using an E. coli strain having an enhanced expression of carotenoid biosynthesis enzyme genes (crtEYIB) (n=6).

[0042] FIGS. 2A and 2B shows graphs of the results of L-lysine production culture using E. coli strains having an enhanced expression of carotenoid biosynthesis enzyme genes (crtEYIB and crtZ) (n=3):

[0043] Control, WC196LC;

[0044] crtZ(Pa), WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa);

[0045] crtZ(Br), WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Br);

[0046] crtZ(Pc), WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pc);

[0047] crtZ(Al), WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Al).

[0048] FIG. 3 shows a graph of the results of L-lysine production culture using E. coli strains having an enhanced expression of carotenoid biosynthesis enzyme genes (crtEYIB, crtZ, and crtW) (n=3):

[0049] pMIV5JS, WC196LC/pMIV5JS;

[0050] pMIV_Pnlp8_crtW, WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa)/pMIV-Pnlp8-crtW;

[0051] pMW219, WC196LC/pMW219;

[0052] pMW_Ptac_crtW, WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa)/pMW_Ptac_crtW.

[0053] FIG. 4 shows a graph of the results of L-threonine production culture using an E. coli strain having an enhanced expression of carotenoid biosynthesis enzyme genes (crtEYIB):

[0054] pMW119, VKPM B-3996/pMW119 (n=4);

[0055] pMW119-crtEYIB, VKPM B-3996/pMW119-crtEYIB (n=10).

[0056] FIG. 5 shows a graph of the quantification results of carotenoids in a C. glutamicum strain having an enhanced expression of carotenoid biosynthesis enzyme genes (crtY and crtZ) (n=3). The concentrations of substances corresponding to peaks detected by HPLC other than zeaxanthin (Zx) were estimated on the basis of the peak area of a Zx standard solution, and the sum total of them was indicated as Others.

[0057] FIG. 6 shows graph of the results of L-lysine production culture using a C. glutamicum strain having an enhanced expression of carotenoid biosynthesis enzyme genes (crtY and crtZ) (n=4).

[0058] FIG. 7 shows a graph of the quantification results of carotenoids in a P. ananatis strain having an enhanced expression of a carotenoid biosynthesis enzyme gene (crtE) (n=3). Standard solutions of astaxanthin (Ax), canthaxanthin (Cx), zeaxanthin (Zx), and beta-carotene (b-CR) were used for HPLC, and the concentrations of these substances were calculated on the basis of the respective peak areas. The concentrations of substances corresponding to detected peaks other than these substances were estimated on the basis of the peak area of the Ax standard solution, and the sum total of them was indicated as Others.

[0059] FIG. 8 shows a graph of the results of L-glutamic acid production culture using a P. ananatis strain having an enhanced expression of a carotenoid biosynthesis enzyme gene (crtE).

[0060] FIG. 9 shows a graph of the quantification results of carotenoids in a P. ananatis strain having an enhanced expression of carotenoid biosynthesis enzyme genes (crtE and crtW) (n=3). Standard solutions of astaxanthin (Ax), canthaxanthin (Cx), zeaxanthin (Zx), and beta-carotene (b-CR) were used for HPLC, and the concentrations of these substances were calculated on the basis of the respective peak areas. The concentrations of substances corresponding to detected peaks other than these substances were estimated on the basis of the peak area of the Ax standard solution, and the sum total of them was indicated as Others.

[0061] FIG. 10 shows a graph of the results of L-glutamic acid production culture using a P. ananatis strain having an enhanced expression of carotenoid biosynthesis enzyme genes (crtE and crtW).

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0062] <1> Bacterium

[0063] The bacterium as described herein is a bacterium having an ability to produce an L-amino acid, which has been modified so that the activity of a carotenoid biosynthesis enzyme is increased.

[0064] <1-1> Bacterium Having an Ability to Produce an L-Amino Acid

[0065] The phrase bacterium having an ability to produce an L-amino acid can refer to a bacterium having an ability to generate and accumulate an objective L-amino acid in a medium to such a degree that the L-amino acid can be collected, when the bacterium is cultured in the medium. The bacterium having an ability to produce an L-amino acid may be a bacterium that is able to accumulate an objective L-amino acid in a medium in an amount larger than that obtainable with a non-modified strain of the bacterium. The term non-modified strain of the bacterium can refer to a control strain that has not been modified so that the activity of a carotenoid biosynthesis enzyme is increased. That is, examples of the non-modified strain of the bacterium can include a wild-type strain and parental strain. The bacterium having an ability to produce an L-amino acid may be a bacterium that is able to accumulate an objective L-amino acid in a medium in an amount of 0.5 g/L or more, or 1.0 g/L or more.

[0066] Examples of the L-amino acid can include basic amino acids such as L-lysine, L-ornithine, L-arginine, L-histidine, and L-citrulline; aliphatic amino acids such as L-isoleucine, L-alanine, L-valine, L-leucine, and glycine; amino acids which are hydroxy-monoaminocarboxylic acids such as L-threonine and L-serine; cyclic amino acids such as L-proline; aromatic amino acids such as L-phenylalanine, L-tyrosine, and L-tryptophan; sulfur-containing amino acids such as L-cysteine, L-cystine, and L-methionine; acidic amino acids such as L-glutamic acid and L-aspartic acid; and amino acids having an amide group in the side chain such as L-glutamine and L-asparagine. Particular examples of the L-amino acid can include L-amino acids of the glutamate family and L-amino acids of the aspartate family. The term L-amino acids of glutamate family collectively can refer to L-glutamic acid and L-amino acids that are biosynthesized via L-glutamic acid as an intermediate. Examples of the L-amino acids that are biosynthesized via L-glutamic acid as an intermediate can include L-glutamine, L-proline, L-arginine, L-citrulline, and L-ornithine. The term L-amino acids of aspartate family collectively can refer to L-aspartic acid and L-amino acids that are biosynthesized via L-aspartic acid as an intermediate. Examples of the L-amino acids that are biosynthesized via L-aspartic acid as an intermediate include L-lysine, L-threonine, L-isoleucine, and L-methionine. More particular examples of the L-amino acid include L-lysine, L-threonine, and L-glutamic acid. The bacterium may have an ability to produce a single kind of L-amino acid, or two or more kinds of L-amino acids.

[0067] The term amino acid can refer to an L-amino acid, unless otherwise stated. The term L-amino acid can refer to an L-amino acid in a free form, a salt thereof, or a mixture thereof, unless otherwise stated. Examples of salt will be described later.

[0068] Examples of the bacterium can include bacteria belonging to the family Enterobacteriaceae and coryneform bacteria.

[0069] Examples of bacteria belonging to the family Enterobacteriaceae can include bacteria belonging to the genus Escherichia, Enterobacter, Pantoea, Klebsiella, Serratia, Erwnia, Photorhabdus, Providencia, Salmonella, Morganella, or the like. Specifically, bacteria classified into the family Enterobacteriaceae according to the taxonomy used in the NCBI (National Center for Biotechnology Information database ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=91347) can be used.

[0070] The Escherichia bacteria are not particularly limited, and examples thereof can include those classified into the genus Escherichia according to the taxonomy known to those skilled in the field of microbiology. Examples of the Escherichia bacteria can include, for example, those described in the work of Neidhardt et al. (Backmann B. J., 1996, Derivations and Genotypes of some mutant derivatives of Escherichia coli K-12, pp. 2460-2488, Table 1, In F. D. Neidhardt (ed.), Escherichia coli and Salmonella Cellular and Molecular Biology/Second Edition, American Society for Microbiology Press, Washington, D.C.). Examples of the Escherichia bacteria can include, for example, Escherichia coli. Specific examples of Escherichia coli can include, for example, Escherichia coli K-12 strains such as W3110 strain (ATCC 27325) and MG1655 strain (ATCC 47076); Escherichia coli K5 strain (ATCC 23506); Escherichia coli B strains such as BL21 (DE3) strain; and derivative strains thereof.

[0071] The Enterobacter bacteria are not particularly limited, and examples can include those classified into the genus Enterobacter according to the taxonomy known to those skilled in the field of microbiology. Examples of the Enterobacter bacterium can include, for example, Enterobacter agglomerans and Enterobacter aerogenes. Specific examples of Enterobacter agglomerans can include, for example, the Enterobacter agglomerans ATCC 12287 strain. Specific examples of Enterobacter aerogenes can include, for example, the Enterobacter aerogenes ATCC 13048 strain, NBRC 12010 strain (Biotechnol. Bioeng., 2007, Mar. 27; 98(2):340-348), and AJ110637 strain (FERM BP-10955). Examples of the Enterobacter bacteria also can include, for example, the strains described in European Patent Application Laid-open (EP-A) No. 0952221. In addition, Enterobacter agglomerans also can include some strains classified as Pantoea agglomerans.

[0072] The Pantoea bacteria are not particularly limited, and examples can include those classified into the genus Pantoea according to the taxonomy known to those skilled in the field of microbiology. Examples of the Pantoea bacteria can include, for example, Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, and Pantoea citrea. Specific examples of Pantoea ananatis can include, for example, the Pantoea ananatis LMG20103 strain, AJ13355 strain (FERM BP-6614), AJ13356 strain (FERM BP-6615), AJ13601 strain (FERM BP-7207), SC17 strain (FERM BP-11091), SC17(0) strain (VKPM B-9246), and SC17sucA strain (FERM BP-8646). Some of Enterobacter bacteria and Erwinia bacteria were reclassified into the genus Pantoea (Int. J. Syst. Bacteriol., 39, 337-345 (1989); Int. J. Syst. Bacteriol., 43, 162-173 (1993)). For example, some strains of Enterobacter agglomerans were recently reclassified into Pantoea agglomerans, Pantoea ananatis, Pantoea stewartii, or the like on the basis of nucleotide sequence analysis of 16S rRNA etc. (Int. J. Syst. Bacteriol., 39, 337-345 (1989)). The Pantoea bacteria can include those reclassified into the genus Pantoea as described above.

[0073] Examples of the Erwinia bacteria can include Erwinia amylovora and Erwinia carotovora. Examples of the Klebsiella bacteria can include Klebsiella planticola.

[0074] Examples of the coryneform bacteria can include bacteria belonging to the genus Corynebacterium, Brevibacterium, Microbacterium, or the like.

[0075] Specific examples of the coryneform bacteria can include the following species.

[0076] Corynebacterium acetoacidophilum

[0077] Corynebacterium acetoglutamicum

[0078] Corynebacterium alkanolyticum

[0079] Corynebacterium callunae

[0080] Corynebacterium crenatum

[0081] Corynebacterium glutamicum

[0082] Corynebacterium lilium

[0083] Corynebacterium melassecola

[0084] Corynebacterium thermoaminogenes (Corynebacterium efficiens)

[0085] Corynebacterium herculis

[0086] Brevibacterium divaricatum (Corynebacterium glutamicum)

[0087] Brevibacterium flavum (Corynebacterium glutamicum)

[0088] Brevibacterium immariophilum

[0089] Brevibacterium lactofermentum (Corynebacterium glutamicum)

[0090] Brevibacterium roseum

[0091] Brevibacterium saccharolyticum

[0092] Brevibacterium thiogenitalis

[0093] Corynebacterium ammoniagenes (Corynebacterium stationis)

[0094] Brevibacterium album

[0095] Brevibacterium cerinum

[0096] Microbacterium ammoniaphilum

[0097] Specific examples of the coryneform bacteria can include the following strains.

[0098] Corynebacterium acetoacidophilum ATCC 13870

[0099] Corynebacterium acetoglutamicum ATCC 15806

[0100] Corynebacterium alkanolyticum ATCC 21511

[0101] Corynebacterium callunae ATCC 15991

[0102] Corynebacterium crenatum AS1.542

[0103] Corynebacterium glutamicum ATCC 13020, ATCC 13032, ATCC 13060, ATCC 13869, FERM BP-734

[0104] Corynebacterium lilium ATCC 15990

[0105] Corynebacterium melassecola ATCC 17965

[0106] Corynebacterium efficiens (Corynebacterium thermoaminogenes) AJ12340 (FERM BP-1539)

[0107] Corynebacterium herculis ATCC 13868

[0108] Brevibacterium divaricatum (Corynebacterium glutamicum) ATCC 14020

[0109] Brevibacterium flavum (Corynebacterium glutamicum) ATCC 13826, ATCC 14067, AJ12418 (FERM BP-2205)

[0110] Brevibacterium immariophilum ATCC 14068

[0111] Brevibacterium lactofermentum (Corynebacterium glutamicum) ATCC 13869

[0112] Brevibacterium roseum ATCC 13825

[0113] Brevibacterium saccharolyticum ATCC 14066

[0114] Brevibacterium thiogenitalis ATCC 19240

[0115] Corynebacterium ammoniagenes (Corynebacterium stationis) ATCC 6871, ATCC 6872

[0116] Brevibacterium album ATCC 15111

[0117] Brevibacterium cerinum ATCC 15112

[0118] Microbacterium ammoniaphilum ATCC 15354

[0119] The Corynebacterium bacteria can include bacteria that had previously been classified into the genus Brevibacterium, but are presently united into the genus Corynebacterium (Int. J. Syst. Bacteriol., 41, 255 (1991)). Moreover, Corynebacterium stationis can include bacteria that had previously been classified as Corynebacterium ammoniagenes, but are presently re-classified into Corynebacterium stationis on the basis of nucleotide sequence analysis of 16S rRNA etc. (Int. J. Syst. Evol. Microbiol., 60, 874-879 (2010)).

[0120] These strains are available from, for example, the American Type Culture Collection (Address: P.O. Box 1549, Manassas, Va. 20108, United States of America). That is, registration numbers are given to the respective strains, and the strains can be ordered by using these registration numbers (refer to atcc.org). The registration numbers of the strains are listed in the catalogue of the American Type Culture Collection. These strains can also be obtained from, for example, the depositories at which the strains were deposited.

[0121] The bacterium can inherently have the ability to produce an L-amino acid, or may be a bacterium that is modified to have such an ability. The bacterium having the ability to produce an L-amino acid can be obtained by imparting an ability to such a bacterium as mentioned above, or by enhancing an ability of such a bacterium as mentioned above.

[0122] To impart or enhance the ability to produce an L-amino acid, methods conventionally employed in the breeding of amino acid-producing strains of coryneform bacteria, Escherichia bacteria, and so forth (refer to Amino Acid Fermentation, Gakkai Shuppan Center (Ltd.), 1st Edition, published May 30, 1986, pp. 77-100) can be used. Examples of such methods can include, for example, acquiring an auxotrophic mutant strain, acquiring an L-amino acid analogue-resistant strain, acquiring a metabolic regulation mutant strain, and constructing a recombinant strain in which the activity of an L-amino acid biosynthetic enzyme is enhanced. In the breeding of L-amino acid-producing bacteria, one of the above-described properties such as auxotrophy, analogue resistance, and metabolic regulation mutation may be imparted alone, or two or three or more of such properties may be imparted in combination. Also, in the breeding of L-amino acid-producing bacteria, the activity of one of L-amino acid biosynthetic enzymes may be enhanced alone, or the activities of two or three or more of such enzymes may be enhanced in combination. Furthermore, imparting property(s) such as auxotrophy, analogue resistance, and metabolic regulation mutation can be combined with enhancing the activity(s) of biosynthetic enzyme(s).

[0123] An auxotrophic mutant strain, analogue-resistant strain, or metabolic regulation mutant strain having an L-amino acid-producing ability can be obtained by subjecting a parental strain or wild-type strain to a usual mutagenesis treatment, and then selecting a strain exhibiting autotrophy, analogue resistance, or a metabolic regulation mutation, and having an L-amino acid-producing ability from the obtained mutant strains. Examples of the usual mutagenesis treatment can include irradiation of X-ray or ultraviolet and a treatment with a mutation agent such as N-methyl-N-nitro-N-nitrosoguanidine (MNNG), ethyl methanesulfonate (EMS), and methyl methanesulfonate (MMS).

[0124] An ability to produce an L-amino acid can also be imparted or enhanced by enhancing the activity of an enzyme involved in biosynthesis of an objective L-amino acid. An enzyme activity can be enhanced by, for example, modifying a bacterium so that the expression of a gene encoding the enzyme is enhanced. Methods for enhancing gene expression are described in WO00/18935, EP1010755A, and so forth. The detailed procedures for enhancing enzyme activity will be described herein.

[0125] Furthermore, an ability to produce an L-amino acid can also be imparted or enhanced by reducing the activity of an enzyme that catalyzes a reaction branching away from the biosynthetic pathway of an objective L-amino acid to generate a compound other than the objective L-amino acid. The enzyme that catalyzes a reaction branching away from the biosynthetic pathway of an objective L-amino acid to generate a compound other than the objective L-amino acid can include an enzyme involved in decomposition of the objective amino acid. The method for reducing an enzyme activity will be described herein.

[0126] Hereinafter, L-amino acid-producing bacteria and methods for imparting or enhancing an L-amino acid-producing ability will be specifically exemplified. All of the properties of the L-amino acid-producing bacteria and modifications for imparting or enhancing an L-amino acid-producing ability may be used independently or in any appropriate combination.

[0127] <L-Glutamic Acid-Producing Bacteria>

[0128] Examples of methods for imparting or enhancing L-glutamic acid-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-glutamic acid biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, glutamate dehydrogenase (gdhA), glutamine synthetase (glnA), glutamate synthase (gltBD), isocitrate dehydrogenase (icdA), aconitate hydratase (acnA, acnB), citrate synthase (OA), methylcitrate synthase (prpC), pyruvate carboxylase (pyc), pyruvate dehydrogenase (aceEF, lpdA), pyruvate kinase (pykA, pykF), phosphoenolpyruvate synthase (ppsA), enolase (eno), phosphoglyceromutase (pgmA, pgmI), phosphoglycerate kinase (pgk), glyceraldehyde-3-phophate dehydrogenase (gapA), triose phosphate isomerase (tpiA), fructose bisphosphate aldolase (fbp), glucose phosphate isomerase (pgi), 6-phosphogluconate dehydratase (edd), 2-keto-3-deoxy-6-phosphogluconate aldolase (eda), and transhydrogenase. Shown in the parentheses after the names of the enzymes are the name of the genes encoding the enzymes (the same shall apply similarly hereinafter). The activity or activities of one or more of, for example, glutamate dehydrogenase, citrate synthase, phosphoenol pyruvate carboxylase, and methylcitrate synthase, can be enhanced.

[0129] Examples of strains belonging to the family Enterobacteriaceae and modified so that the expression of the citrate synthase gene, phosphoenolpyruvate carboxylase gene, and/or glutamate dehydrogenase gene are increased can include those disclosed in EP1078989A, EP955368A, and EP952221A. Furthermore, examples of strains belonging to the family Enterobacteriaceae and modified so that the expression of a gene of the Entner-Doudoroff pathway (edd, eda) is increased can include those disclosed in EP1352966B. Examples of coryneform bacteria modified so that the expression of the glutamate synthetase gene (gltBD) is increased can include those disclosed in WO99/07853.

[0130] Examples of methods for imparting or enhancing L-glutamic acid-producing ability also can include, for example, a method of modifying a bacterium so that the bacterium has a reduced activity or activities of one or more of the enzymes that catalyze a reaction branching away from the biosynthesis pathway of L-glutamic acid to generate a compound other than L-glutamic acid. Examples of such enzymes can include, but are not particularly limited to, isocitrate lyase (aceA), -ketoglutarate dehydrogenase (sucA, odhA), acetolactate synthase (ilvI), formate acetyltransferase (pfl), lactate dehydrogenase (ldh), alcohol dehydrogenase (adh), glutamate decarboxylase (gadAB), and succinate dehydrogenase (sdhABCD). The activity of, for example, -ketoglutarate dehydrogenase, can be reduced or deleted.

[0131] Escherichia bacteria having a reduced -ketoglutarate dehydrogenase activity or deficient in the -ketoglutarate dehydrogenase activity, and methods for obtaining such bacteria are described in U.S. Pat. Nos. 5,378,616 and 5,573,945. Furthermore, methods for reducing or deleting the -ketoglutarate dehydrogenase activity of Enterobacteriaceae bacteria such as Pantoea bacteria, Enterobacter bacteria, Klebsiella bacteria, and Erwinia bacteria are disclosed in U.S. Pat. Nos. 6,197,559, 6,682,912, 6,331,419, and 8,129,151, and WO2008/075483. Specific examples of Escherichia bacteria having a reduced -ketoglutarate dehydrogenase activity or deficient in the -ketoglutarate dehydrogenase activity can include the following strains:

[0132] E. coli W3110sucA::Km.sup.r

[0133] E. coli AJ12624 (FERM BP-3853)

[0134] E. coli AJ12628 (FERM BP-3854)

[0135] E. coli AJ12949 (FERM BP-4881)

[0136] E. coli W3110sucA::Km.sup.r is a strain obtained by disrupting the sucA gene encoding -ketoglutarate dehydrogenase of E. coli W3110. This strain is completely deficient in the -ketoglutarate dehydrogenase activity.

[0137] Coryneform bacteria in which the -ketoglutarate dehydrogenase activity is reduced or eliminated, and methods for obtaining those are disclosed in WO2008/075483. Specific examples of coryneform bacteria in which the -ketoglutarate dehydrogenase activity is reduced or eliminated can include, for example, the following strains:

[0138] Corynebacterium glutamicum (Brevibacterium lactofermentum) L30-2 strain (Japanese Patent Laid-open (Kokai) No. 2006-340603)

[0139] Corynebacterium glutamicum (Brevibacterium lactofermentum) AS strain (WO95/34672)

[0140] Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ12821 (FERM BP-4172, French Patent No. 9401748)

[0141] Corynebacterium glutamicum (Brevibacterium flavum) AJ12822 (FERM BP-4173, French Patent No. 9401748)

[0142] Corynebacterium glutamicum AJ12823 (FERM BP-4174, French Patent No. 9401748)

[0143] Examples of L-glutamic acid-producing bacteria and parental strains that can be used to derive such bacteria also can include Pantoea bacteria, such as the Pantoea ananatis AJ13355 strain (FERM BP-6614), Pantoea ananatis SC17 strain (FERM BP-11091), and Pantoea ananatis SC17(0) strain (VKPM B-9246). AJ13355 is a strain isolated from soil in Iwata-shi, Shizuoka-ken, Japan as a strain that can proliferate in a low pH medium containing L-glutamic acid and a carbon source. The SC17 strain was selected as a low phlegm-producing mutant strain from the AJ13355 strain (U.S. Pat. No. 6,596,517). The SC17 strain was deposited at the independent administrative agency, National Institute of Advanced Industrial Science and Technology, International Patent Organism Depository (currently independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Feb. 4, 2009, and assigned an accession number of FERM BP-11091. The AJ13355 strain was deposited at the National Institute of Bioscience and Human Technology, Agency of Industrial Science and Technology (currently, independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Feb. 19, 1998 and assigned an accession number of FERM P-16644. Then, the deposit was converted to an international deposit under the provisions of Budapest Treaty on Jan. 11, 1999, and assigned an accession number of FERM BP-6614.

[0144] Furthermore, examples of L-glutamic acid-producing bacteria and parental strains that can be used to derive such bacteria also can include Pantoea bacteria having a reduced -ketoglutarate dehydrogenase activity or deficient in the -ketoglutarate dehydrogenase activity. Examples of such strains can include the AJ13356 strain (U.S. Pat. No. 6,331,419), which is an -ketoglutarate dehydrogenase E1 subunit (sucA) gene-deficient strain of the AJ13355 strain, and the SC17sucA strain (U.S. Pat. No. 6,596,517), which is a sucA gene-deficient strain of the SC17 strain. The AJ13356 strain was deposited at the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology (currently, independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Feb. 19, 1998, and assigned an accession number of FERM P-16645. Then, the deposit was converted into an international deposit under the provisions of the Budapest Treaty on Jan. 11, 1999, and assigned an accession number of FERM BP-6616. The SC17sucA strain was assigned a private number of AJ417, and deposited at the independent administrative agency, National Institute of Advanced Industrial Science and Technology, International Patent Organism Depositary (currently, independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Feb. 26, 2004, under an accession number of FERM BP-8646.

[0145] The AJ13355 strain was identified as Enterobacter agglomerans when it was isolated, but it was recently reclassified as Pantoea ananatis on the basis of nucleotide sequencing of 16S rRNA and so forth. Therefore, although the AJ13355 and AJ13356 strains are deposited at the aforementioned depository as Enterobacter agglomerans, they are referred to as Pantoea ananatis in this specification.

[0146] Furthermore, examples of L-glutamic acid-producing bacteria and parental strains that can be used to derive such bacteria also can include Pantoea bacteria such as the Pantoea ananatis SC17sucA/RSFCPG+pSTVCB strain, Pantoea ananatis AJ13601 strain, Pantoea ananatis NP106 strain, and Pantoea ananatis NA1 strain. The SC17sucA/RSFCPG+pSTVCB strain was obtained by introducing the plasmid RSFCPG containing the citrate synthase gene (gltA), phosphoenolpyruvate carboxylase gene (ppc), and glutamate dehydrogenase gene (gdhA) derived from Escherichia coli, and the plasmid pSTVCB containing the citrate synthase gene (gltA) derived from Brevibacterium lactofermentum, into the SC17sucA strain. The AJ13601 strain was selected from the SC17sucA/RSFCPG+pSTVCB strain as a strain resistant to a high concentration of L-glutamic acid at a low pH. The NP106 strain was obtained from the AJ13601 strain by curing the RSFCPG and pSTVCB plasmids. The NA1 strain was obtained from the NP106 strain by introducing the plasmid RSFPPG thereinto (WO2010/027045). The plasmid RSFPPG has a structure corresponding to the plasmid RSFCPG except that gltA gene thereof has been replaced with a methylcitrate synthase gene (prpC), and hence, contains prpC gene, ppc gene, and gdhA gene (WO2008/020654). The AJ13601 strain was deposited at the National Institute of Bioscience and Human Technology, Agency of Industrial Science and Technology (currently, independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Aug. 18, 1999, and assigned an accession number FERM P-17516. Then, the deposit was converted to an international deposit under the provisions of the Budapest Treaty on Jul. 6, 2000, and assigned an accession number FERM BP-7207.

[0147] Examples of L-glutamic acid-producing bacteria and parental strains that can be used to derive such bacteria also can include strains in which both the -ketoglutarate dehydrogenase (sucA) activity and the succinate dehydrogenase (sdh) activity are reduced or deleted (Japanese Patent Laid-open (Kokai) No. 2010-041920). Specific examples of such strains can include, for example, a sucAsdhA double-deficient strain of the Pantoea ananatis NA1 strain and an odhAsdhA double-deficient strain of the Corynebacterium glutamicum ATCC 14067 strain, i.e. the Corynebacterium glutamicum 8L3GASDH strain (Japanese Patent Laid-open (Kokai) No. 2010-041920).

[0148] Examples of L-glutamic acid-producing bacteria and parental strains that can be used to derive such bacteria also can include auxotrophic mutant strains. Specific examples of auxotrophic mutant strains can include, for example, E. coli VL334thrC.sup.+ (VKPM B-8961, EP1172433). E. coli VL334 (VKPM B-1641) is an L-isoleucine and L-threonine auxotrophic strain having mutations in the thrC and ilvA genes (U.S. Pat. No. 4,278,765). E. coli VL334thrC.sup.+ is an L-isoleucine-auxotrophic L-glutamic acid-producing bacterium obtained by introducing a wild-type allele of the thrC gene into the VL334 strain. The wild-type allele of the thrC gene was introduced by the method of general transduction using a bacteriophage P1 grown on the wild-type E. coli K-12 strain (VKPM B-7) cells.

[0149] Examples of L-glutamic acid-producing bacteria and parental strains that can be used to derive such bacteria also can include strains having resistance to an aspartic acid analogue. Such strains can also be deficient in the -ketoglutarate dehydrogenase activity. Specific examples of strains having resistance to an aspartic acid analogue and deficient in the -ketoglutarate dehydrogenase activity can include, for example, E. coli AJ13199 (FERM BP-5807, U.S. Pat. No. 5,908,768), E. coli FFRM P-12379, which additionally has a lowered L-glutamic acid-decomposing ability (U.S. Pat. No. 5,393,671), and E. coli AJ13138 (FERM BP-5565, U.S. Pat. No. 6,110,714).

[0150] Examples of methods for imparting or enhancing L-glutamic acid-producing ability also can include, for example, a method of enhancing the expression of an L-glutamic acid secretion gene, such as yhfK gene (WO2005/085419) or ybjL gene (WO2008/133161).

[0151] Furthermore, examples of methods for imparting or enhancing L-glutamic acid-producing ability to or in coryneform bacteria also can include methods of imparting resistance to an organic acid analogue, respiratory inhibitor, or the like, and methods of imparting sensitivity to a cell wall synthesis inhibitor. Specific examples of such methods can include, for example, the method of imparting monofluoroacetic acid resistance (Japanese Patent Laid-open (Kokai) No. 50-113209), the method of imparting adenine resistance or thymine resistance (Japanese Patent Laid-open (Kokai) No. 57-065198), the method of attenuating urease (Japanese Patent Laid-open (Kokai) No. 52-038088), the method of imparting malonic acid resistance (Japanese Patent Laid-open (Kokai) No. 52-038088), the method of imparting resistance to benzopyrones or naphthoquinones (Japanese Patent Laid-open (Kokai) No. 56-1889), the method of imparting HOQNO resistance (Japanese Patent Laid-open (Kokai) No. 56-140895), the method of imparting -ketomalonic acid resistance (Japanese Patent Laid-open (Kokai) No. 57-2689), the method of imparting guanidine resistance (Japanese Patent Laid-open (Kokai) No. 56-35981), the method of imparting sensitivity to penicillin (Japanese Patent Laid-open (Kokai) No. 4-88994), and so forth.

[0152] Specific examples of such resistant or sensitive bacteria can include the following strains:

[0153] Corynebacterium glutamicum (Brevibacterium flavum) AJ3949 (FERM BP-2632, Japanese Patent Laid-open (Kokai) No. 50-113209)

[0154] Corynebacterium glutamicum AJ11628 (FERM P-5736, Japanese Patent Laid-open (Kokai) No. 57-065198)

[0155] Corynebacterium glutamicum (Brevibacterium flavum) AJ11355 (FERM P-5007, Japanese Patent Laid-open (Kokai) No. 56-1889)

[0156] Corynebacterium glutamicum AJ11368 (FERM P-5020, Japanese Patent Laid-open (Kokai) No. 56-1889)

[0157] Corynebacterium glutamicum (Brevibacterium flavum) AJ11217 (FERM P-4318, Japanese Patent Laid-open (Kokai) No. 57-2689)

[0158] Corynebacterium glutamicum AJ11218 (FERM P-4319, Japanese Patent Laid-open (Kokai) No. 57-2689)

[0159] Corynebacterium glutamicum (Brevibacterium flavum) AJ11564 (FERM BP-5472, Japanese Patent Laid-open (Kokai) No. 56-140895)

[0160] Corynebacterium glutamicum (Brevibacterium flavum) AJ11439 (FERM BP-5136, Japanese Patent Laid-open (Kokai) No. 56-35981)

[0161] Corynebacterium glutamicum H7684 (FERM BP-3004, Japanese Patent Laid-open (Kokai) No. 04-88994)

[0162] Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ11426 (FERM P-5123, Japanese Patent Laid-open (Kokai) No. 56-048890)

[0163] Corynebacterium glutamicum AJ11440 (FERM P-5137, Japanese Patent Laid-open (Kokai) No. 56-048890)

[0164] Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ11796 (FERM P-6402, Japanese Patent Laid-open (Kokai) No. 58-158192)

[0165] Furthermore, examples of methods for imparting or enhancing L-glutamic acid-producing ability to or in coryneform bacteria also can include a method of enhancing the expression of yggB gene and a method of introducing a mutant yggB gene having a mutation in the coding region (WO2006/070944). That is, the bacterium may have been modified so that the expression of yggB gene is increased, or may have been modified so as to harbor (have) a mutant yggB gene.

[0166] The yggB gene is a gene encoding a mechanosensitive channel. Examples of the yggB gene can include yggB genes of coryneform bacteria. Specific examples of the yggB genes of coryneform bacteria can include, for example, yggB genes of Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum ATCC14967, and Corynebacterium melassecola ATCC17965 (WO2006/070944). The yggB gene of Corynebacterium glutamicum ATCC 13032 corresponds to the sequence complementary to the sequence of the nucleotide numbers 1,336,091 to 1,337,692 in the genome sequence registered as Genbank Accession No. NC_003450 in the NCBI database, and is also called NCgl1221. The YggB protein encoded by the yggB gene of Corynebacterium glutamicum ATCC 13032 is registered as GenBank accession No. NP 600492. In addition, the nucleotide sequence of the yggB gene of Corynebacterium glutamicum 2256 (ATCC 13869) and the amino acid sequence of the YggB protein encoded by the gene are shown in SEQ ID NOS: 7 and 8, respectively.

[0167] A yggB gene having the specific mutation described herein can also be referred to as mutant yggB gene, and a protein encoded thereby can also be referred to as mutant YggB protein. Furthermore, a yggB gene not having the specific mutation described herein can also be referred to as wild-type yggB gene, and a protein encoded thereby can also be referred to as wild-type YggB protein. Incidentally, as for the YggB protein, a change of the amino acid sequence caused by the specific mutation in the yggB gene can also be referred to as specific mutation. The term wild-type is used for convenience to distinguish the wild-type yggB gene or YggB protein from the mutant yggB gene or YggB protein, and the wild-type yggB gene or YggB protein is not limited to those obtained as natural substances, so long as it does not have the specific mutation. Examples of the wild-type YggB protein can include the YggB proteins exemplified above, such as YggB protein having the amino acid sequence of SEQ ID NO: 8. Examples of the wild-type YggB protein also can include conservative variants (variants in which the original function thereof is maintained) of the YggB proteins exemplified above, provided that the conservative variants do not have the specific mutation. The original function regarding the YggB protein may be, for example, a function as a mechanosensitive channel or a property that an increased expression thereof in a coryneform bacterium provides an improved L-glutamic acid-producing ability of the coryneform bacterium.

[0168] The specific mutation is not particularly limited, so long as it changes the amino acid sequence of the YggB protein such as those described above to thereby improve an L-glutamic acid-producing ability of a coryneform bacterium. Examples of the specific mutation can include mutation on the C-terminus side and mutation in a transmembrane region (WO2006/070944). The specific mutation may also be a combination of these.

[0169] (1) Mutation on C-Terminus Side

[0170] The mutation on the C-terminus side is a mutation introduced into the region of the wild-type yggB gene coding for the amino acid residues of the positions 419 to 533 of the wild-type YggB protein. The mutation on the C-terminus side may be introduced at one or more sites in the region. The type of change of the amino acid sequence induced by the mutation on the C-terminus side is not particularly limited. The mutation on the C-terminus side may be a mutation causing amino acid substitution (missense mutation), insertion of amino acid residue, deletion of amino acid residue, introduction of stop codon (nonsense mutation), frame shift mutation, or a combination of these. The mutation on the C-terminus side can be, for example, a mutation for inserting a nucleotide sequence such as an insertion sequence (henceforth also referred to as IS) or transposon.

[0171] (1-1) Insertion of Nucleotide Sequence

[0172] Examples of the mutation on the C-terminus side can include, for example, a mutation that inserts a nucleotide sequence at the site coding for the valine residue at the position 419 of the wild-type YggB protein (2A-1 type mutation). The 2A-1 type mutation may be, for example, a mutation that causes deletion or substitution for a part or all of the amino acid residues of the positions 419 to 533 of the wild-type YggB protein. Specific examples of the mutant yggB gene having the 2A-1 type mutation can include, for example, the yggB gene including IS inserted into the next of G at the position 1255 in SEQ ID NO: 7, and thereby coding for a mutant YggB protein having a full length of 423 amino residues, which is shorter than that of the original wild-type YggB protein (SEQ ID NO: 8). The nucleotide sequence of this mutant yggB gene (V419::IS) and the amino acid sequence of the mutant YggB protein encoded by the gene are shown in SEQ ID NOS: 9 and 10, respectively. In the SEQ ID NO: 9, the positions 1 to 1269 correspond to CDS for this mutant YggB protein (V419::IS). Specific examples of the L-glutamic acid-producing bacterium having the mutant yggB gene (V419::IS) can include, for example, the C. glutamicum 2256sucAldhA yggB* strain (WO2014/185430).

[0173] (1-2) Substitution for Proline Residues

[0174] Examples of the mutation on the C-terminus side also can include, for example, a mutation that replaces a proline residue present at the positions 419 to 533 of the wild-type YggB protein with another amino acid residue. Examples of such a proline residue can include the proline residues at the positions 424, 437, 453, 457, 462, 469, 484, 489, 497, 515, 529, and 533 of the wild-type YggB protein. It is a particular example to replace the proline residue(s) of the position(s) 424 and/or 437 with other amino acid residue(s). The other amino acid is not particularly limited so long as it is a naturally occurring amino acid other than proline. Examples of the other amino acid can include Lys, Glu, Thr, Val, Leu, Ile, Ser, Asp, Asn, Gln, Arg, Cys, Met, Phe, Trp, Tyr, Gly, Ala, and His. For example, the proline residue at the position 424 may be replaced with a residue of hydrophobic amino acid (Ala, Gly, Val, Leu, or Ile), or a residue of branched chain amino acid (Leu, Val, or Ile). Furthermore, for example, the proline residue at the position 437 may be replaced with a residue of an amino acid having hydroxyl group in the side chain (Thr, Ser, or Tyr), or with a Ser residue.

[0175] (2) Mutation in Transmembrane Region

[0176] The YggB protein is estimated to have five transmembrane regions. The transmembrane regions correspond to the amino acid residues of the positions 1 to 23 (first transmembrane region), the positions 25 to 47 (second transmembrane region), the positions 62 to 84 (third transmembrane region), the positions 86 to 108 (fourth transmembrane region), and the positions 110 to 132 (fifth transmembrane region) of the wild-type YggB protein. The mutation in a transmembrane region is a mutation in the regions coding for these transmembrane regions of the wild-type yggB gene. The mutation in transmembrane region may be introduced into one or more sites in the regions. The mutation in transmembrane region can be a mutation that induces substitution, deletion, addition, insertion, or inversion of one or several amino acid residues, but does not include any frame shift mutation or nonsense mutation. The number meant by the term one or several can be 1 to 20, 1 to 10, 1 to 5, or 1 to 3. Examples of the mutation in a transmembrane region can include a mutation that inserts one or several amino acid residues, such as Cys-Ser-Leu, between the leucine residue at the position 14 and the tryptophan residue at the position 15; a mutation that replaces the alanine residue at the position 100 with another amino acid residue, such as a residue of an amino acid having hydroxyl group in the side chain, for example, Thr, Ser, or Tyr; a mutation that replaces the alanine residue at the position 111 with another amino acid residue such as a residue of an amino acid having hydroxyl group in the side chain, for example Thr, Ser, or Tyr; in the wild-type YggB protein

[0177] An amino acid residue at the position X of the wild-type YggB protein can mean the amino acid residue corresponding to that of the position X in SEQ ID NO: 8, unless otherwise stated. The position X in an amino acid sequence is the X-th position counted from the N-terminus of the amino acid sequence, and the amino acid residue of the N-terminus is the amino acid residue of the position 1. That is, the aforementioned positions of amino acid residues indicate relative positions, and the absolute positions thereof may shift due to deletion, insertion, addition, or the like of an amino acid residue or residues. For example, the amino acid residue at the position 419 of the wild-type YggB protein can mean the amino acid residue corresponding to that of the position 419 in SEQ ID NO: 8, and when one amino acid residue is deleted at a position on the N-terminus side of the position 419, the 418th amino acid residue from the N-terminus is the amino acid residue at the position 419 of the wild-type YggB protein. Furthermore, when one amino acid residue is inserted a position on the N-terminus side of the position 419, the 420th amino acid residue from the N-terminus is the amino acid residue at the position 419 of the wild-type YggB protein. Specifically, for example, amino acid residues of the positions 419 to 529 of the YggB protein of Corynebacterium glutamicum ATCC14967 correspond to amino acid residues of the positions 419 to 533 of the wild-type YggB protein.

[0178] Which amino acid residue is the amino acid residue corresponding to that of the position X in SEQ ID NO: 8 in the amino acid sequence of an arbitrary YggB protein can be determined by alignment between the amino acid sequence of the arbitrary YggB protein and the amino acid sequence of SEQ ID NO: 8. The alignment can be performed by, for example, using known gene analysis software. Specific examples of such software can include DNASIS produced by Hitachi Solutions, GENETYX produced by Genetyx, and so forth (Elizabeth C. Tyler et al., Computers and Biomedical Research, 24 (1) 72-96, 1991; Barton G J et al., Journal of Molecular Biology, 198 (2), 327-37, 1987).

[0179] A mutant yggB gene can be obtained by modifying a wild-type yggB gene so as to have the aforementioned specific mutation. The modification of DNA can be performed by a known method. For example, an objective mutation can be introduced into an objective site of DNA by the site-specific mutation method. Specific examples of the site-specific mutation method can include, for example, a method of using PCR (Higuchi, R., 61, in PCR Technology, Erlich, H. A. Eds., Stockton Press, 1989; Carter P., Meth. In Enzymol., 154, 382, 1987), and a method of using a phage (Kramer, W. and Frits, H. J., Meth. in Enzymol., 154, 350, 1987; Kunkel, T. A. et al., Meth. in Enzymol., 154, 367, 1987). Furthermore, a mutant yggB gene can also be obtained by chemical synthesis.

[0180] Such modification of a bacterium that the bacterium has a mutant yggB gene can be attained by introducing the mutant yggB gene into the bacterium. Such modification of a bacterium that the bacterium has a mutant yggB gene can also be attained by introducing a mutation into the yggB gene of the bacterium through natural mutation or a treatment with a mutagen.

[0181] The methods for imparting or enhancing L-glutamic acid-producing ability can also be effective for imparting or enhancing an ability to produce L-amino acids that are biosynthesized via L-glutamic acid as an intermediate, such as L-glutamine, L-proline, L-arginine, L-citrulline, and L-ornithine. Hence, a bacterium having an ability to produce any of these L-amino acids that are biosynthesized via L-glutamic acid may have, as required, such a property possessed by an L-glutamic acid-producing bacterium as mentioned above. For example, a bacterium having an ability to produce any of these L-amino acids that are biosynthesized via L-glutamic acid may have been modified so that the activity of -ketoglutarate dehydrogenase and/or succinate dehydrogenase is reduced.

[0182] <L-Glutamine-Producing Bacteria>

[0183] Examples of the method for imparting or enhancing L-glutamine-producing ability can include, for example, a method of modifying a bacterium so that the activity or activities of one or more of the L-glutamine biosynthesis enzymes are enhanced. Examples of such enzymes can include, but are not particularly limited to, glutamate dehydrogenase (gdhA) and glutamine synthetase (glnA). The glutamine synthetase activity can also be enhanced by disruption of the glutamine adenylyltransferase gene (glnE) or disruption of the PII control protein gene (glnB) (EP1229121).

[0184] Examples of the method for imparting or enhancing L-glutamine-producing ability also can include, for example, a method of modifying a bacterium so that the activity or activities of one or more enzymes that catalyze a reaction branching away from the biosynthesis pathway of L-glutamine to generate a compound other than L-glutamine are reduced. Examples of such enzymes can include, but not particularly limited to, glutaminase.

[0185] Specific examples of L-glutamine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, coryneform bacteria in which the activity or activities of glutamate dehydrogenase (gdhA) and/or glutamine synthetase (glnA) (EP1229121, EP1424398) are enhanced, and coryneform bacteria in which the glutaminase activity (Japanese Patent Laid-open (Kokai) No. 2004-187684) is reduced. Examples of L-glutamine-producing bacteria and parental strains that can be used to derive such bacteria can include a strain belonging to the genus Escherichia and having a mutant glutamine synthetase in which the tyrosine residue of the position 397 of glutamine synthetase has been replaced with another amino acid residue (US2003-0148474A).

[0186] Examples of the methods for imparting or enhancing L-glutamine-producing ability to or in coryneform bacteria also can include the method of imparting 6-diazo-5-oxo-norleucine resistance (Japanese Patent Laid-open (Kokai) No. 3-232497), the method of imparting purine analogue resistance and methionine sulfoxide resistance (Japanese Patent Laid-open (Kokai) No. 61-202694), and the method of imparting -ketomalonic acid resistance (Japanese Patent Laid-open (Kokai) No. 56-151495). Specific examples of coryneform bacteria having L-glutamine-producing ability can include, for example, the following strains:

[0187] Corynebacterium glutamicum (Brevibacterium flavum) AJ11573 (FERM P-5492, Japanese Patent Laid-open (Kokai) No. 56-151495)

[0188] Corynebacterium glutamicum (Brevibacterium flavum) AJ11576 (FERM BP-10381, Japanese Patent Laid-open (Kokai) No. 56-151495)

[0189] Corynebacterium glutamicum (Brevibacterium flavum) AJ12212 (FERM P-8123, Japanese Patent Laid-open (Kokai) No. 61-202694)

[0190] <L-Proline-Producing Bacteria>

[0191] Examples of methods for imparting or enhancing L-proline-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-proline biosynthesis enzymes. Examples of such enzymes can include glutamate-5-kinase (proB), -glutamylphosphate reductase, and pyroline-5-carboxylate reductase (putA). For enhancing the activity of such an enzyme, for example, the proB gene encoding a glutamate-5-kinase desensitized to feedback inhibition by L-proline (German Patent No. 3127361) can be used.

[0192] Examples of methods for imparting or enhancing L-proline-producing ability also can include, for example, a method of modifying a bacterium so that the bacterium has a reduced activity of an enzyme involved in decomposition of L-proline. Examples of such an enzyme can include proline dehydrogenase and ornithine aminotransferase.

[0193] Specific examples of L-proline-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli NRRL B-12403 and NRRL B-12404 (British Patent No. 2075056), E. coli VKPM B-8012 (Russian Patent Application No. 2000124295), E. coli plasmid mutant strains described in German Patent No. 3127361, E. coli plasmid mutant strains described by Bloom F. R. et al. (The 15th Miami winter symposium, 1983, p. 34), E. coli 702 strain (VKPM B-8011), which is a 3,4-dehydroxyproline and azetidine-2-carboxylate resistant strain, and E. coli 702ilvA strain (VKPM B-8012), which is an ilvA gene-deficient strain of the 702 strain (EP1172433).

[0194] <L-Threonine-Producing Bacteria>

[0195] Examples of methods for imparting or enhancing L-threonine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-threonine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, aspartokinase III (lysC), aspartate semialdehyde dehydrogenase (asci), aspartokinase I (thrA), homoserine kinase (thrB), threonine synthase (thrC), and aspartate aminotransferase (aspartate transaminase) (aspC). Among these enzymes, the activity or activities of one or more of aspartokinase III, aspartate semialdehyde dehydrogenase, aspartokinase I, homoserine kinase, aspartate aminotransferase, and threonine synthase can be enhanced. Any of the genes encoding the L-threonine biosynthesis enzymes can be introduced into a bacterium having a reduced ability to decompose threonine. Examples of such a strain in which threonine decomposition is suppressed can include, for example, the E. coli TDH6 strain, which is deficient in the threonine dehydrogenase activity (Japanese Patent Laid-open (Kokai) No. 2001-346578).

[0196] The activities of the L-threonine biosynthesis enzymes are inhibited by the endproduct, L-threonine. Therefore, for constructing L-threonine-producing strains, the genes of the L-threonine biosynthesis enzymes can be modified so that the enzymes are desensitized to feedback inhibition by L-threonine. The aforementioned thrA, thrB, and thrC genes constitute the threonine operon, which forms an attenuator structure. The expression of the threonine operon is inhibited by isoleucine and threonine in the culture broth and also suppressed by attenuation. Therefore, expression of the threonine operon can be enhanced by removing the leader sequence or the attenuator in the attenuation region (Lynn, S. P., Burton, W. S., Donohue, T. J., Gould, R. M., Gumport, R. L, and Gardner, J. F., J. Mol. Biol. 194:59-69 (1987); WO02/26993; WO2005/049808; and WO2003/097839).

[0197] The native promoter of the threonine operon is present upstream of the threonine operon, and can be replaced with a non-native promoter (WO98/04715). Also, the threonine operon may be constructed so that the threonine biosynthesis genes are expressed under control of the repressor and promoter of -phage (EP0593792B). Furthermore, a bacterium modified so that it is desensitized to feedback inhibition by L-threonine can also be obtained by selecting a strain resistant to -amino--hydroxyisovaleric acid (AHV), which is an L-threonine analogue.

[0198] The expression amount of the threonine operon that is modified so as to be desensitized to feedback inhibition by L-threonine as described above can be increased in a host by increasing the copy number thereof or by ligating it to a potent promoter. The copy number can be increased by introducing a plasmid containing the threonine operon into a host. The copy number can also be increased by transferring the threonine operon to the genome of a host using a transposon, Mu-phage, or the like.

[0199] Examples of methods for imparting or enhancing L-threonine-producing ability also can include, for example, a method of imparting L-threonine resistance to a host, and a method of imparting L-homoserine resistance to a host. Such resistance can be imparted by, for example, enhancing the expression of a gene that imparts L-threonine resistance or a gene that imparts L-homoserine resistance. Examples of the genes that impart the above-mentioned resistance can include the rhtA gene (Res. Microbiol. 154:123-135 (2003)), rhtB gene (EP0994190A), rhtC gene (EP1013765A), yfiK gene, and yeaS gene (EP1016710A). Methods for imparting L-threonine resistance to a host are described in EP0994190A and WO90/04636.

[0200] Specific examples of L-threonine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli TDH-6/pVIC40 (VKPM B-3996, U.S. Pat. Nos. 5,175,107 and 5,705,371), E. coli 472T23/pYN7 (ATCC 98081, U.S. Pat. No. 5,631,157), E. coli NRRL-21593 (U.S. Pat. No. 5,939,307), E. coli FERM BP-3756 (U.S. Pat. No. 5,474,918), E. coli FERM BP-3519 and FERM BP-3520 (U.S. Pat. No. 5,376,538), E. coli MG442 (Gusyatiner et al., Genetika (in Russian), 14, 947-956 (1978)), E. coli VL643 and VL2055 (EP1149911A), and E. coli VKPM B-5318 (EP0593792B).

[0201] VKPM B-3996 is a strain obtained by introducing the plasmid pVIC40 into the TDH-6 strain. The TDH-6 strain has sucrose-assimilating ability and is deficient in the thrC gene, and the ilvA gene thereof has a leaky mutation. The TDH-6 strain also has a mutation in the rhtA gene, which imparts resistance to high concentration of threonine or homoserine. The plasmid pVIC40 is a plasmid obtained by inserting the thrA*BC operon containing a mutant thrA gene encoding an aspartokinase-homoserine dehydrogenase I resistant to feedback inhibition by threonine and the wild-type thrBC genes into an RSF1010-derived vector (U.S. Pat. No. 5,705,371). This mutant thrA gene encodes an aspartokinase-homoserine dehydrogenase I which is substantially desensitized to feedback inhibition by threonine. The B-3996 strain was deposited on Nov. 19, 1987 at the All-Union Scientific Center of Antibiotics (Nagatinskaya Street 3-A, 117105 Moscow, Russia) under the accession number RIA 1867. This strain was also deposited at the Russian National Collection of Industrial Microorganisms (VKPM, FGUP GosNII Genetika, 1 Dorozhny proezd., 1 Moscow 117545, Russia) on Apr. 7, 1987 under the accession number VKPM B-3996.

[0202] The VKPM B-5318 strain is prototrophic with regard to isoleucine, and harbors the plasmid pPRT614, which corresponds to the plasmid pVIC40 of which the regulatory region of the threonine operon is replaced with the temperature-sensitive -phage Cl repressor and PR promoter. The VKPM B-5318 strain was deposited at the Russian National Collection of Industrial Microorganisms (VKPM, FGUP GosNII Genetika, 1 Dorozhny proezd., 1 Moscow 117545, Russia) on May 3, 1990 under the accession number of VKPM B-5318.

[0203] The thrA gene that encodes aspartokinase-homoserine dehydrogenase I of E. coli has been elucidated (nucleotide numbers 337 to 2799, GenBank accession NC 000913.2, gi: 49175990). The thrA gene is located between the thrL and thrB genes on the chromosome of E. coli K-12. The thrB gene which encodes homoserine kinase of Escherichia coli has been elucidated (nucleotide numbers 2801 to 3733, GenBank accession NC 000913.2, gi: 49175990). The thrB gene is located between the thrA and thrC genes on the chromosome of E. coli K-12. The thrC gene which encodes threonine synthase of E. coli has been elucidated (nucleotide numbers 3734 to 5020, GenBank accession NC 000913.2, gi: 49175990). The thrC gene is located between the thrB gene and the yaaX open reading frame on the chromosome of E. coli K-12. The thrA*BC operon containing a mutant thrA gene which encodes an aspartokinase-homoserine dehydrogenase I resistant to feedback inhibition by threonine and the wild-type thrBC genes can be obtained from the well-known plasmid pVIC40, which is present in the threonine-producing E. coli strain VKPM B-3996 (U.S. Pat. No. 5,705,371).

[0204] The rhtA gene of E. coli is located at 18 min on the E. coli chromosome close to the glnHPQ operon, which encodes components of the glutamine transport system. The rhtA gene is identical to ORF1 (ybiF gene, nucleotide numbers 764 to 1651, GenBank accession number AAA218541, gi:440181) and is located between the pexB and ompX genes. The unit expressing a protein encoded by the ORF1 has been designated rhtA gene (rht: resistance to homoserine and threonine). It has also been revealed that the rhtA23 mutation that imparts resistance to high concentration of threonine or homoserine is an A-for-G substitution at position 1 with respect to the ATG start codon (ABSTRACTS of the 17th International Congress of Biochemistry and Molecular Biology in conjugation with Annual Meeting of the American Society for Biochemistry and Molecular Biology, San Francisco, Calif. Aug. 24-29, 1997, abstract No. 457; EP1013765A).

[0205] The asd gene of E. coli has already been elucidated (nucleotide numbers 3572511 to 3571408, GenBank accession NC 000913.1, gi:16131307), and can be obtained by PCR (White, T. J., et al., Trends Genet, 5:185, 1989) utilizing primers prepared on the basis of the nucleotide sequence of the gene. The asd genes of other microorganisms can also be obtained in a similar manner.

[0206] The aspC gene of E. coli has also already been elucidated (nucleotide numbers 983742 to 984932, GenBank accession NC 000913.1, gi:16128895), and can be obtained by PCR utilizing primers prepared on the basis of the nucleotide sequence of the gene. The aspC genes of other microorganisms can also be obtained in a similar manner.

[0207] Furthermore, examples of coryneform bacteria having L-threonine-producing ability can include, for example, Corynebacterium acetoacidophilum AJ12318 (FERM BP-1172, U.S. Pat. No. 5,188,949).

[0208] <L-Lysine-Producing Bacteria>

[0209] Examples of methods for imparting or enhancing L-lysine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-lysine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, dihydrodipicolinate synthase (dapA), aspartokinase III (lysC), dihydrodipicolinate reductase (dapB), diaminopimelate decarboxylase (lysA), diaminopimelate dehydrogenase (ddh) (U.S. Pat. No. 6,040,160), phosphoenolpyruvate carboxylase (ppc), aspartate semialdehyde dehydrogenase (asd), aspartate aminotransferase (aspartate transaminase) (aspC), diaminopimelate epimerase (dapF), tetrahydrodipicolinate succinylase (dapD), succinyl diaminopimelate deacylase (dapE), and aspartase (aspA) (EP1253195A). The activity or activities of one or more of, for example, dihydrodipicolinate reductase, diaminopimelate decarboxylase, diaminopimelate dehydrogenase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, diaminopimelate epimerase, aspartate semialdehyde dehydrogenase, tetrahydrodipicolinate succinylase, and succinyl diaminopimelate deacylase can be enhanced. Furthermore, L-lysine-producing bacteria and parental strains that can be used to derive such bacteria can express an increased level of the gene involved in energy efficiency (cyo) (EP1170376A), the gene encoding nicotinamide nucleotide transhydrogenase (pntAB) (U.S. Pat. No. 5,830,716), the ybjE gene (WO2005/073390), or combinations of these. Since aspartokinase III (lysC) is subject to feedback inhibition by L-lysine, a mutant lysC gene encoding an aspartokinase III desensitized to feedback inhibition by L-lysine (U.S. Pat. No. 5,932,453) may be used for enhancing the activity of this enzyme. Examples of the aspartokinase III desensitized to feedback inhibition by L-lysine can include aspartokinase III derived from Escherichia coli and having one or more mutations, such as a mutation for replacing the methionine residue at position 318 with an isoleucine residue; a mutation for replacing the glycine residue at position 323 with an aspartic acid residue; and a mutation for replacing the threonine residue at position 352 with an isoleucine residue (U.S. Pat. Nos. 5,661,012 and 6,040,160). Furthermore, since dihydrodipicolinate synthase (dapA) is subject to feedback inhibition by L-lysine, a mutant dapA gene encoding a dihydrodipicolinate synthase desensitized to feedback inhibition by L-lysine may be used for enhancing the activity of this enzyme. Examples of the dihydrodipicolinate synthase desensitized to feedback inhibition by L-lysine can include dihydrodipicolinate synthase native to or derived from Escherichia coli and having a mutation for replacing the histidine residue at position 118 with a tyrosine residue (U.S. Pat. No. 6,040,160).

[0210] Examples of methods for imparting or enhancing L-lysine-producing ability also can include, for example, a method of modifying a bacterium so that the bacterium has a reduced activity or activities of one or more kinds of the enzymes that catalyze a reaction branching away from the biosynthetic pathway of L-lysine to generate a compound other than L-lysine. Examples of such enzymes can include, but are not particularly limited to, homoserine dehydrogenase, lysine decarboxylase (U.S. Pat. No. 5,827,698), and malic enzyme (WO2005/010175).

[0211] Furthermore, examples of methods for imparting or enhancing L-lysine-producing ability to or in coryneform bacteria also can include a method of modifying the bacteria so that the activity of a lysine excretion system (lysE) is increased (WO97/23597). The lysE gene of Corynebacterium glutamicum ATCC 13032 corresponds to the sequence complementary to the sequence of the nucleotide numbers 1,329,712 to 1,330,413 in the genome sequence registered as Genbank Accession No. NC_006958 (VERSION NC_006958.1 GI:62388892) in the NCBI database. The LysE protein of Corynebacterium glutamicum ATCC 13032 is registered as GenBank accession No. YP_225551 (YP_225551.1 GI:62390149).

[0212] Examples of L-lysine-producing bacteria and parental strains that can be used to derive such bacteria also can include mutant strains having resistance to an L-lysine analogue. L-Lysine analogues inhibit the growth of bacteria such as bacteria of the family Enterobacteriaceae and coryneform bacteria, but this inhibition is fully or partially released when L-lysine is present in the medium. Examples of these L-lysine analogues can include, but are not particularly limited to, oxalysine, lysine hydroxamate, S-(2-aminoethyl)-L-cysteine (AEC), -methyllysine, and -chlorocaprolactam. Mutant strains having resistance to these lysine analogues can be obtained by subjecting a bacterium to a conventional artificial mutagenesis treatment.

[0213] Specific examples of L-lysine-producing bacteria and parental strains that can be used to derive such bacteria can include E. coli AJ11442 (FERM BP-1543, NRRL B-12185, U.S. Pat. No. 4,346,170) and E. coli VL611. In these strains, aspartokinase is desensitized to feedback inhibition by L-lysine.

[0214] Specific examples of L-lysine-producing bacteria and parental strains that can be used to derive such bacteria also can include the E. coli WC196 strain. The WC196 strain was bred by imparting AEC resistance to the W3110 strain, which was derived from E. coli K-12 (U.S. Pat. No. 5,827,698). The WC196 strain was designated E. coli AJ13069 and deposited at the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology (currently, independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Dec. 6, 1994 and assigned an accession number of FERM P-14690. Then, the deposit was converted to an international deposit under the provisions of the Budapest Treaty on Sep. 29, 1995, and assigned an accession number of FERM BP-5252 (U.S. Pat. No. 5,827,698).

[0215] Examples of L-lysine-producing bacteria can include E. coli WC196cadAldc and E. coli WC196cadAldc/pCABD2 (WO2010/061890). E. coli WC196cadAldc is a strain constructed from the WC196 strain by disrupting the cadA and ldcC genes encoding lysine decarboxylase. The WC196cadAldc/pCABD2 strain was constructed by introducing the plasmid pCABD2 containing lysine biosynthesis enzyme genes (U.S. Pat. No. 6,040,160) into the WC196cadAldc strain. The WC196cadAldc strain, designated as AJ110692, was deposited at the independent administrative agency, National Institute of Advanced Industrial Science and Technology, International Patent Organism Depositary (currently, independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Oct. 7, 2008 as an international deposit, and assigned an accession number of FERM BP-11027. The plasmid pCABD2 contains a mutant dapA gene derived from Escherichia coli and encoding a dihydrodipicolinate synthase (DDPS) having a mutation for desensitization to feedback inhibition by L-lysine (H118Y), a mutant lysC gene derived from Escherichia coli and encoding aspartokinase III having a mutation for desensitization to feedback inhibition by L-lysine (T352I), the dapB gene derived from Escherichia coli and encoding dihydrodipicolinate reductase, and the ddh gene derived from Brevibacterium lactofermentum and encoding diaminopimelate dehydrogenase.

[0216] Examples of L-lysine-producing bacteria also can include E. coli AJIK01 (NITE BP-01520). The AJIK01 strain was designated E. coli AJ111046, and deposited at the independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary (#122, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Jan. 29, 2013. Then, it was converted to an international deposit under the provisions of the Budapest Treaty on May 15, 2014, and assigned an accession number of NITE BP-01520.

[0217] Examples of coryneform bacteria having L-lysine-producing ability can include, for example, the AEC-resistant mutant strains (Corynebacterium glutamicum (Brevibacterium lactofermentum AJ11082) (NRRL B-11470) strain etc., Japanese Patent Publication (Kokoku) Nos. 56-1914, 56-1915, 57-14157, 57-14158, 57-30474, 58-10075, 59-4993, 61-35840, 62-24074, 62-36673, 5-11958, 7-112437, and 7-112438); mutant strains requiring an amino acid such as L-homoserine for their growth (Japanese Patent Publication Nos. 48-28078 and 56-6499); mutant strains showing resistance to AEC and further requiring an amino acid such as L-leucine, L-homoserine, L-proline, L-serine, L-arginine, L-alanine, and L-valine (U.S. Pat. Nos. 3,708,395 and 3,825,472); mutant strains showing resistance to DL--amino--caprolactam, -amino-lauryllactam, aspartic acid analogue, sulfa drug, quinoid, and N-lauroylleucine; mutant strains showing resistance to an oxaloacetate decarboxylase inhibitor or a respiratory chain enzyme inhibitor (Japanese Patent Laid-open (Kokai) Nos. 50-53588, 50-31093, 52-102498, 53-9394, 53-86089, 55-9783, 55-9759, 56-32995, 56-39778, Japanese Patent Publication Nos. 53-43591 and 53-1833); mutant strains requiring inositol or acetic acid (Japanese Patent Laid-open (Kokai) Nos. 55-9784 and 56-8692); mutant strains that are susceptible to fluoropyruvic acid or a temperature of 34 C. or higher (Japanese Patent Laid-open (Kokai) Nos. 55-9783 and 53-86090); and mutant strains showing resistance to ethylene glycol (U.S. Pat. No. 4,411,997).

[0218] <L-Arginine-Producing Bacteria>

[0219] Examples of methods for imparting or enhancing L-arginine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-arginine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, N-acetylglutamate synthase (argA), N-acetylglutamate kinase (argB), N-acetylglutamyl phosphate reductase (argC), acetylornithine transaminase (argD), acetylornithine deacetylase (argE), ornithine carbamoyl transferase (argF, argI), argininosuccinate synthetase (argG), argininosuccinate lyase (argH), ornithine acetyl transferase (argI), and carbamoyl phosphate synthetase (carAB). As the N-acetylglutamate synthase gene (argA), for example, a gene encoding a mutant N-acetylglutamate synthase desensitized to feedback inhibition by L-arginine by substitution for the amino acid residues corresponding to the positions 15 to 19 of the wild type enzyme (EP1170361A) can be used.

[0220] Specific examples of L-arginine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, the E. coli 237 strain (VKPM B-7925, US2002-058315A1), derivative strains thereof introduced with the argA gene encoding a mutant N-acetyl glutamate synthase (Russian Patent Application No. 2001112869, EP1170361A1), E. coli 382 strain derived from the 237 strain and having an improved acetic acid-assimilating ability (VKPM B-7926, EP1170358A1), and E. coli 382ilvA+ strain, which is a strain obtained from the 382 strain by introducing the wild-type ilvA gene from E. coli K-12 strain thereto. The E. coli strain 237 was deposited at the Russian National Collection of Industrial Microorganisms (VKPM, FGUP GosNII Genetika, 1 Dorozhny proezd., 1 Moscow 117545, Russia) on Apr. 10, 2000 under an accession number of VKPM B-7925, and the deposit was converted to an international deposit under the provisions of Budapest Treaty on May 18, 2001. The E. coli 382 strain was deposited at the Russian National Collection of Industrial Microorganisms (VKPM, FGUP GosNII Genetika, 1 Dorozhny proezd., 1 Moscow 117545, Russia) on Apr. 10, 2000 under accession number of VKPM B-7926.

[0221] Examples of L-arginine-producing bacteria and parental strains that can be used to derive such bacteria also can include strains having resistance to amino acid analogues, and so forth. Examples of such strains can include E. coli mutant strains having resistance to -methylmethionine, p-fluorophenylalanine, D-arginine, arginine hydroxamate, S-(2-aminoethyl)-cysteine, -methyl serine, -2-thienylalanine, or sulfaguanidine (Japanese Patent Laid-open (Kokai) No. 56-106598).

[0222] Examples of L-arginine-producing bacteria and parent strains that can be used to derive such bacteria also can include such coryneform bacteria as a strain deficient in ArgR, which is an arginine repressor (US2002-0045223A), and a strain in which glutamine synthetase activity is increased (US2005-0014236A).

[0223] Examples of L-arginine-producing bacteria and parental strains that can be used to derive such bacteria also can include mutant strains of coryneform bacteria, the mutant strains having resistance to an amino acid analogue or the like. Examples of such strains can include, for example, strains having resistance to 2-thiazolealanine and further exhibiting auxotrophy for L-histidine, L-proline, L-threonine, L-isoleucine, L-methionine, or L-tryptophan (Japanese Patent Laid-open (Kokai) No. 54-44096); strains resistant to ketomalonic acid, fluoromalonic acid, or monofluoroacetic acid (Japanese Patent Laid-open (Kokai) No. 57-18989); strains resistant to argininol (Japanese Patent Publication No. 62-24075); strains resistant to X-guanidine (X represents an aliphatic chain or a derivative thereof, Japanese Patent Laid-open (Kokai) No. 2-186995); and strains resistant to arginine hydroxamate and 6-azauracil (Japanese Patent Laid-open (Kokai) No. 57-150381). Specific examples of coryneform bacteria having L-arginine-producing ability can include the following strains:

[0224] Corynebacterium glutamicum (Brevibacterium flavum) AJ11169 (FERM BP-6892)

[0225] Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ12092 (FERM BP-6906)

[0226] Corynebacterium glutamicum (Brevibacterium flavum) AJ11336 (FERM BP-6893)

[0227] Corynebacterium glutamicum (Brevibacterium flavum) AJ11345 (FERM BP-6894)

[0228] Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ12430 (FERM BP-2228)

[0229] <L-Citrulline-Producing Bacteria and L-Ornithine-Producing Bacteria>

[0230] L-citrulline and L-ornithine are intermediates of the biosynthetic pathway of L-arginine. Hence, examples of methods for imparting or enhancing an ability to produce L-citrulline and/or L-ornithine can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-arginine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, N-acetylglutamate synthase (argA), N-acetylglutamate kinase (argB), N-acetylglutamyl phosphate reductase (argC), acetylornithine transaminase (argD), acetylornithine deacetylase (argE), ornithine carbamoyl transferase (argF, argI), ornithine acetyl transferase (argI), and carbamoyl phosphate synthetase (carAB), for L-citrulline. Furthermore, examples of such enzymes can include, but are not particularly limited to, N-acetylglutamate synthase (argA), N-acetylglutamate kinase (argB), N-acetylglutamyl phosphate reductase (argC), acetylornithine transaminase (argD), acetylornithine deacetylase (argE), and ornithine acetyl transferase (argI), for L-ornithine.

[0231] An L-citrulline-producing bacterium can be easily obtained from, for example, an L-arginine bacterium such as the E. coli 382 strain (VKPM B-7926) by decreasing the activity of argininosuccinate synthetase encoded by argG gene. Also, an L-ornithine-producing bacterium can be easily obtained from, for example, an L-arginine bacterium such as the E. coli 382 strain (VKPM B-7926) by decreasing the activity of ornithine carbamoyl transferase encoded by argF and argI genes.

[0232] Specific examples of L-citrulline-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, strains belonging to the genus Escherichia, such as the E. coli strains 237/pMADS11, 237/pMADS12, and 237/pMADS13, which have a mutant N-acetylglutamate synthase (Russian patent No. 2,215,783, U.S. Pat. No. 6,790,647, and EP1170361B1), E. coli strains 333 (VKPM B-8084) and 374 (VKPM B-8086), which have carbamoyl phosphate synthetase resistant to feedback inhibition (Russian patent No. 2,264,459), E. coli strains having an increased activity of -ketoglutarate synthase and having a modified activity of ferredoxin NADP.sup.+ reductase, pyruvate synthase, and/or -ketoglutarate dehydrogenase (EP2133417A); and the P. ananatis NA1sucAsdhA strain, which has a reduced activity of succinate dehydrogenase and -ketoglutarate dehydrogenase (US2009-286290A1).

[0233] <L-Histidine-Producing Bacteria>

[0234] Examples of methods for imparting or enhancing L-histidine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-histidine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, ATP phosphoribosyltransferase (hisG), phosphoribosyl AMP cyclohydrolase (hisI), phosphoribosyl-ATP pyrophosphohydrolase (hisI), phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (hisA), amidotransferase (hisH), histidinol phosphate aminotransferase (hisC), histidinol phosphatase (hisB), and histidinol dehydrogenase (hisD).

[0235] Among these enzymes, the L-histidine biosynthesis enzymes encoded by hisG and hisBHAFI are known to be inhibited by L-histidine. Therefore, the ability to produce L-histidine can be imparted or enhanced by, for example, introducing a mutation for conferring resistance to feedback inhibition into the gene encoding ATP phosphoribosyltransferase (hisG) (Russian Patent Nos. 2,003,677 and 2,119,536).

[0236] Specific examples of L-histidine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, strains belonging to the genus Escherichia, such as the E. coli 24 strain (VKPM B-5945, RU2003677), E. coli NRRL B-12116 to B-12121 (U.S. Pat. No. 4,388,405), E. coli H-9342 (FERM BP-6675) and H-9343 (FERM BP-6676, U.S. Pat. No. 6,344,347), E. coli H-9341 (FERM BP-6674, EP1085087), E. coli AI80/pFM201 (U.S. Pat. No. 6,258,554), E. coli FERM P-5038 and FERM P-5048, which have been introduced with a vector carrying a DNA encoding an L-histidine-biosynthesis enzyme (Japanese Patent Laid-open (Kokai) No. 56-005099), E. coli strains introduced with a gene for amino acid transport (EP1016710A), and E. coli 80 strain, which has been imparted with resistance to sulfaguanidine, DL-1,2,4-triazole-3-alanine, and streptomycin (VKPM B-7270, Russian Patent No. 2119536).

[0237] <L-Cysteine-Producing Bacteria>

[0238] Examples of methods for imparting or enhancing L-cysteine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-cysteine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, serine acetyltransferase (cysE) and 3-phosphoglycerate dehydrogenase (serA). The serine acetyltransferase activity can be enhanced by, for example, introducing a mutant cysE gene encoding a mutant serine acetyltransferase resistant to feedback inhibition by cysteine into a bacterium. Such a mutant serine acetyltransferase is disclosed in, for example, Japanese Patent Laid-open (Kokai) No. 11-155571 and US2005-0112731A. Furthermore, the 3-phosphoglycerate dehydrogenase activity can be enhanced by, for example, introducing a mutant serA gene encoding a mutant 3-phosphoglycerate dehydrogenase resistant to feedback inhibition by serine into a bacterium. Such a mutant 3-phosphoglycerate dehydrogenase is disclosed in, for example, U.S. Pat. No. 6,180,373.

[0239] Furthermore, examples of methods for imparting or enhancing L-cysteine-producing ability also can include, for example, a method of modifying a bacterium so that the bacterium has a reduced activity or activities of one or more of the enzymes that catalyze a reaction branching away from the biosynthesis pathway of L-cysteine to generate a compound other than L-cysteine. Examples of such enzymes can include, for example, enzymes involved in decomposition of L-cysteine. Examples of the enzymes involved in decomposition of L-cysteine can include, but are not particularly limited to, cystathionine--lyase (metC, Japanese Patent Laid-open (Kokai) No. 11-155571; Chandra et al., Biochemistry, 21 (1982) 3064-3069), tryptophanase (tnaA, Japanese Patent Laid-open (Kokai) No. 2003-169668; Austin Newton et al., J. Biol. Chem., 240 (1965) 1211-1218), O-acetylserine sulfhydrylase B (cysM, Japanese Patent Laid-open (Kokai) No. 2005-245311), the malY gene product (Japanese Patent Laid-open (Kokai) No. 2005-245311), the d0191 gene product of Pantoea ananatis (Japanese Patent Laid-open (Kokai) No. 2009-232844), and cysteine desulfhydrase (aecD, Japanese Patent Laid-open (Kokai) No. 2002-233384.

[0240] Furthermore, examples of methods for imparting or enhancing L-cysteine-producing ability also can include, for example, a method of enhancing the L-cysteine excretory system, and a method of enhancing the sulfate/thiosulfate transport system. Examples of proteins of the L-cysteine excretory system can include the protein encoded by the ydeD gene (Japanese Patent Laid-open (Kokai) No. 2002-233384), the protein encoded by the yfiK gene (Japanese Patent Laid-open (Kokai) No. 2004-49237), the proteins encoded by the emrAB, emrKY, yojIH, acrEF, bcr, and cusA genes (Japanese Patent Laid-open (Kokai) No. 2005-287333), and the protein encoded by the yeaS gene (Japanese Patent Laid-open (Kokai) No. 2010-187552). Examples of the proteins of the sulfate/thiosulfate transport system can include the proteins encoded by the cysPTWAM gene cluster.

[0241] Specific examples of L-cysteine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli JM15 transformed with different cysE alleles encoding feedback-resistant serine acetyltransferases (U.S. Pat. No. 6,218,168, Russian patent application 2003121601), E. coli W3110 having an over-expressed gene encoding a protein suitable for secretion of a cytotoxic substance (U.S. Pat. No. 5,972,663), E. coli strains having a reduced cysteine desulfohydrase activity (Japanese Patent Laid-open (Kokai) No. 11-155571), and E. coli W3110 having an increased activity of a positive transcriptional regulator for cysteine regulon encoded by the cysB gene (WO01/27307A1).

[0242] Furthermore, examples of coryneform bacteria having L-cysteine-producing ability can include coryneform bacteria having serine acetyltransferase desensitized to feedback inhibition by L-cysteine thereby to show enhanced intracellular serine acetyltransferase activity (Japanese Patent Laid-open (Kokai) No. 2002-233384).

[0243] <L-Serine-Producing Bacteria>

[0244] Examples of methods for imparting or enhancing L-serine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-serine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, 3-phosphoglycerate dehydrogenase (serA), phosphoserine transaminase (serf), and phosphoserine phosphatase (serB) (Japanese Patent Laid-open (Kokai) No. 11-253187). 3-phosphoglycerate dehydrogenase activity can be increased by, for example, introducing a mutant serA gene encoding a mutant 3-phosphoglycerate dehydrogenase resistant to feedback inhibition by L-serine into a bacterium. The mutant 3-phosphoglycerate dehydrogenase is disclosed in, for example, U.S. Pat. No. 6,180,373.

[0245] Examples of L-serine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, coryneform bacteria resistant to azaserine or -(2-thienyl)-DL-alanine and deficient in L-serine decomposition ability (Japanese Patent Laid-open (Kokai) No. 10-248588). Specific examples of such coryneform bacteria can include, for example, Corynebacterium glutamicum (Brevibacterium flavum) AJ13324 (FERM P-16128), which is resistant to azaserine and deficient in L-serine decomposition ability, and Corynebacterium glutamicum (Brevibacterium flavum) AJ13325 (FERM P-16129), which is resistant to -(2-thienyl)-DL-alanine and deficient in L-serine decomposition ability (Japanese Patent Laid-open (Kokai) No. 10-248588).

[0246] <L-Methionine-Producing Bacteria>

[0247] Examples of L-methionine-producing bacteria and parental strains that can be used to derive such bacteria can include L-threonine auxotrophic strains and mutant strains resistant to norleucine (Japanese Patent Laid-open (Kokai) No. 2000-139471). Examples of L-methionine-producing bacteria and parental strains that can be used to derive such bacteria also can include a strain containing a mutant homoserine transsuccinylase resistant to feedback inhibition by L-methionine (Japanese Patent Laid-open (Kokai) No. 2000-139471, US2009-0029424A). Since L-methionine is biosynthesized via L-cysteine as an intermediate, L-methionine-producing ability can also be improved by improving L-cysteine-producing ability (Japanese Patent Laid-open (Kokai) No. 2000-139471, US2008-0311632A).

[0248] Specific examples of L-methionine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli AJ11539 (NRRL B-12399), E. coli AJ11540 (NRRL B-12400), E. coli AJ11541 (NRRL B-12401), E. coli AJ11542 (NRRL B-12402, British Patent No. 2075055), the E. coli 218 strain (VKPM B-8125, Russian Patent No. 2209248) and the 73 strain (VKPM B-8126, Russian Patent No. 2215782), which are resistant to norleucine, which is an analogue of L-methionine, and E. coli AJ13425 (FERMP-16808, Japanese Patent Laid-open (Kokai) No. 2000-139471). The AJ13425 strain is an L-threonine auxotrophic strain derived from the E. coli W3110, in which the methionine repressor is deleted, the intracellular S-adenosylmethionine synthetase activity is attenuated, and the intracellular homoserine transsuccinylase activity, cystathionine -synthase activity, and aspartokinase-homoserine dehydrogenase II activity are enhanced.

[0249] <L-Leucine-Producing Bacteria>

[0250] Examples of methods for imparting or enhancing L-leucine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-leucine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, the enzymes encoded by the genes of the leuABCD operon. Furthermore, for enhancing the activity of such an enzyme, for example, the mutant leuA gene encoding an isopropyl maleate synthase desensitized to feedback inhibition by L-leucine (U.S. Pat. No. 6,403,342) can be used.

[0251] Specific examples of L-leucine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, strains belonging to the genus Escherichia, such as E. coli strains resistant to leucine (for example, the 57 strain (VKPM B-7386, U.S. Pat. No. 6,124,121)), E. coli strains resistant to a leucine analogue such as -2-thienylalanine, 3-hydroxyleucine, 4-azaleucine, and 5,5,5-trifluoroleucine (Japanese Patent Publication (Kokoku) No. 62-34397 and Japanese Patent Laid-open (Kokai) No. 8-70879), E. coli strains obtained by a gene engineering technique described in WO96/06926, and E. coli H-9068 (Japanese Patent Laid-open (Kokai) No. 8-70879).

[0252] Examples of coryneform bacteria having L-leucine-producing ability can include, for example, Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ3718 (FERM P-2516), which is resistant to 2-thiazole alanine and -hydroxyleucine and auxotrophic for isoleucine and methionine.

[0253] <L-Isoleucine-Producing Bacteria>

[0254] Examples of methods for imparting or enhancing L-isoleucine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has increased activity or activities of one or more of the L-isoleucine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, threonine deaminase and acetohydroxy acid synthase (Japanese Patent Laid-open (Kokai) No. 2-458, EP0356739A, U.S. Pat. No. 5,998,178).

[0255] Specific examples of L-isoleucine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, Escherichia bacteria such as mutant strains having resistance to 6-dimethylaminopurine (Japanese Patent Laid-open (Kokai) No. 5-304969), mutant strains having resistance to an isoleucine analogue such as thiaisoleucine and isoleucine hydroxamate, and mutant strains having resistance to such an isoleucine analogue and further having resistance to DL-ethionine and/or arginine hydroxamate (Japanese Patent Laid-open (Kokai) No. 5-130882).

[0256] Examples of coryneform bacteria having L-isoleucine-producing ability can include, for example, the coryneform bacterium in which brnE gene encoding a branched chain amino acid excretion protein is amplified (Japanese Patent Laid-open (Kokai) No. 2001-169788), the coryneform bacterium to which L-isoleucine-producing ability is imparted by protoplast fusion with an L-lysine-producing bacterium (Japanese Patent Laid-open (Kokai) No. 62-74293), the coryneform bacterium in which homoserine dehydrogenase is enhanced (Japanese Patent Laid-open (Kokai) No. 62-91193), the threonine hydroxamate resistant strain (Japanese Patent Laid-open (Kokai) No 62-195293), the -ketomalonic acid resistant strain (Japanese Patent Laid-open (Kokai) No. 61-15695), the methyllysine resistant strain (Japanese Patent Laid-open (Kokai) No. 61-15696), and Corynebacterium glutamicum (Brevibacterium flavum) AJ12149 (FERM BP-759, U.S. Pat. No. 4,656,135).

[0257] <L-Valine-Producing Bacteria>

[0258] Examples of methods for imparting or enhancing L-valine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-valine biosynthesis enzymes. Examples of such enzymes can include, but are not particularly limited to, the enzymes encoded by the genes of the ilvGMEDA operon and the enzymes encoded by the ilvBNC operon. The ilvBN gene encodes acetohydroxy acid synthase, and the ilvC gene encodes isomeroreductase (WO00/50624). Expressions of the ilvGMEDA operon and the ilvBNC operon are suppressed (attenuated) by L-valine, L-isoleucine, and/or L-leucine. Therefore, for enhancing the activity of such an enzyme, it is preferred that the suppression of expression by the produced L-valine is released by removing or modifying a region required for the attenuation. Furthermore, the threonine deaminase encoded by the ilvA gene is an enzyme that catalyzes the deamination reaction of L-threonine resulting 2-ketobutyric acid, which is the rate-limiting step of the L-isoleucine biosynthesis system. Therefore, for L-valine production, the ilvA gene can be, for example, disrupted, and thereby the threonine deaminase activity is decreased.

[0259] Examples of methods for imparting or enhancing L-valine-producing ability also can include, for example, a method of modifying a bacterium so that the bacterium has a reduced activity or activities of one or more of the enzymes that catalyze a reaction branching away from the biosynthesis pathway of L-valine to generate a compound other than L-valine. Examples of such enzymes can include, but are not particularly limited to, threonine dehydratase involved in the L-leucine synthesis, and the enzymes involved in the D-pantothenic acid synthesis (WO00/50624).

[0260] Specific examples of L-valine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli strains modified so as to overexpress the ilvGMEDA operon (U.S. Pat. No. 5,998,178).

[0261] Examples of L-valine-producing bacteria and parental strains that can be used to derive such bacteria also can include mutant strains having a mutation in amino-acyl t-RNA synthetase (U.S. Pat. No. 5,658,766). Examples of such strains can include, for example, E. coli VL1970, which has a mutation in the ileS gene encoding isoleucine t-RNA synthetase. E. coli VL1970 was deposited at the Russian National Collection of Industrial Microorganisms (VKPM, FGUP GosNII Genetika, 1 Dorozhny Proezd, 1 Moscow 117545, Russia) on Jun. 24, 1988 under the accession number of VKPM B-4411. Examples of L-valine-producing bacteria and parental strains that can be used to derive such bacteria also can include mutant strains requiring lipoic acid for growth and/or lacking HtATPase (WO96/06926).

[0262] Examples of L-valine-producing bacteria and parental strains that can be used to derive such bacteria also can include strains resistant to an amino acid analogue or the like. Examples of such strains can include, for example, the coryneform bacterium strains which are auxotrophic for L-isoleucine and L-methionine, and resistant to D-ribose, purine ribonucleoside, or pyrimidine ribonucleoside, and have an ability to produce L-valine (FERM P-1841, FERM P-29) (Japanese Patent Publication No. 53-025034), coryneform bacterium strains resistant to polyketides (FERM P-1763, FERM P-1764) (Japanese Patent Publication No. 06-065314), and coryneform bacterium strains resistant to L-valine in a medium containing acetic acid as the sole carbon source and sensitive to pyruvic acid analogues (fluoropyruvic acid etc.) in a medium containing glucose as the sole carbon source (FERM BP-3006, BP-3007) (Japanese Patent No. 3006929).

[0263] <L-Alanine-Producing Bacteria>

[0264] Examples of L-alanine-producing bacteria and parental strains that can be used to derive such bacteria can include the coryneform bacteria deficient in the HtATPase (Appl. Microbiol. Biotechnol., 2001 November, 57(4):534-40) and coryneform bacteria in which the aspartate 3-decarboxylase activity is enhanced (Japanese Patent Laid-open (Kokai) No. 07-163383).

[0265] <L-Tryptophan-Producing Bacteria, L-Phenylalanine-Producing Bacteria, and L-Tyrosine-Producing Bacteria>

[0266] Examples of methods for imparting or enhancing L-tryptophan-producing ability, L-phenylalanine-producing ability, and/or L-tyrosine-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more of the L-tryptophan, L-phenylalanine, and/or L-tyrosine biosynthesis enzymes.

[0267] Examples of enzymes common to the biosynthesis systems of these aromatic amino acids can include, but are not particularly limited to, 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (aroG), 3-dehydroquinate synthase (aroB), shikimate dehydrogenase (aroE), shikimate kinase (aroL), 5-enolpyruvylshikimate-3-phosphate synthase (aroA), and chorismate synthase (aroC) (EP763127B). The expressions of the genes encoding these enzymes are controlled by the tyrosine repressor (tyrR), and the activities of these enzymes may be enhanced by deleting the tyrR gene (EP763127B).

[0268] Examples of the L-tryptophan biosynthesis enzymes can include, but are not particularly limited to, anthranilate synthase (trpE), tryptophan synthase (trpAB), and phosphoglycerate dehydrogenase (serA). For example, by introducing a DNA containing the tryptophan operon, L-tryptophan-producing ability can be imparted or enhanced. Tryptophan synthase is made up of and subunits encoded by the trpA and trpB genes, respectively. Since the anthranilate synthase is subject to feedback inhibition by L-tryptophan, a gene encoding this enzyme introduced with a mutation for desensitization to feedback inhibition may be used for enhancing the activity of that enzyme. Since the phosphoglycerate dehydrogenase is subject to feedback inhibition by L-serine, a gene encoding this enzyme introduced with a mutation for desensitization to feedback inhibition may be used for enhancing the activity of that enzyme. Furthermore, by increasing the expression of the operon (ace operon) consisting of the maleate synthase gene (aceB), isocitrate lyase gene (aceA), and isocitrate dehydrogenase kinase/phosphatase gene (aceK), L-tryptophan-producing ability may be imparted or enhanced (WO2005/103275).

[0269] Examples of the L-phenylalanine biosynthesis enzymes can include, but are not particularly limited to, chorismate mutase and prephenate dehydratase. The chorismate mutase and prephenate dehydratase are encoded by the pheA gene as a bifunctional enzyme. Since the chorismate mutase and prephenate dehydratase are subject to feedback inhibition by L-phenylalanine, genes encoding these enzymes introduced with a mutation for desensitization to feedback inhibition may be used for enhancing the activities of these enzymes.

[0270] Examples of the L-tyrosine biosynthesis enzymes can include, but are not particularly limited to, chorismate mutase and prephenate dehydrogenase. The chorismate mutase and prephenate dehydrogenase are encoded by the tyrA gene as a bifunctional enzyme. Since the chorismate mutase and prephenate dehydrogenase are subject to feedback inhibition by L-tyrosine, genes encoding these enzymes introduced with a mutation for desensitization to feedback inhibition may be used for enhancing the activities of these enzymes.

[0271] The L-tryptophan, L-phenylalanine, and/or L-tyrosine-producing bacteria may be modified so that biosynthesis of an aromatic amino acid other than the objective aromatic amino acid is reduced. Furthermore, the L-tryptophan, L-phenylalanine, and/or L-tyrosine-producing bacteria may be modified so that a by-product uptake system is enhanced. Examples of the by-product can include aromatic amino acids other than the objective aromatic amino acid. Examples of the gene encoding such a by-product uptake system can include, for example, tnaB and mtr, which are genes encoding the L-tryptophan uptake system, pheP, which is a gene encoding the L-phenylalanine uptake system, and tyrP, which is a gene encoding the L-tyrosine uptake system (EP1484410).

[0272] Specific examples of L-tryptophan-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli JP4735/pMU3028 (DSM10122) and JP6015/pMU91 (DSM10123), which have a mutant trpS gene encoding a partially inactivated tryptophanyl-tRNA synthetase (U.S. Pat. No. 5,756,345), E. coli SV164, which has a trpE allele encoding an anthranilate synthase desensitized to feedback inhibition by tryptophan, E. coli SV164 (pGH5), which has a serA allele encoding a phosphoglycerate dehydrogenase desensitized to feedback inhibition by serine and a trpE allele encoding an anthranilate synthase desensitized to feedback inhibition by tryptophan (U.S. Pat. No. 6,180,373), a strain introduced with a tryptophan operon containing a trpE allele encoding an anthranilate synthase desensitized to feedback inhibition by tryptophan (Japanese Patent Laid-open (Kokai) Nos. 57-71397 and 62-244382, U.S. Pat. No. 4,371,614), E. coli AGX17(pGX44) (NRRL B-12263) and AGX6(pGX50)aroP (NRRL B-12264), which are deficient in tryptophanase (U.S. Pat. No. 4,371,614), E. coli AGX17/pGX50, pACKG4-pps, which has an increased phosphoenolpyruvate-producing ability (WO97/08333, U.S. Pat. No. 6,319,696), and strains belonging to the genus Escherichia having an increased activity of the protein encoded by the yedA or yddG gene (US2003-0148473A1 and US2003-0157667A1).

[0273] Examples of coryneform bacteria having L-tryptophan-producing ability can include, for example, Corynebacterium glutamicum AJ12118 (FERM BP-478, Japanese Patent No. 1681002), which is resistant to sulfaguanidine, the strain introduced with the tryptophan operon (Japanese Patent Laid-open (Kokai) No. 63-240794), and the strain introduced with a gene encoding shikimate kinase derived from a coryneform bacterium (Japanese Patent No. 1994749).

[0274] Specific examples of L-phenylalanine-producing bacteria and parental strains that can be used to derive such bacteria can include, for example, E. coli AJ12739 (tyrA::Tn10, tyrR) (VKPM B-8197), which is deficient in the chorismate mutase-prephenate dehydrogenase and the tyrosine repressor (WO03/044191), E. coli HW1089 (ATCC 55371), which contains a mutant pheA34 gene encoding a chorismate mutase-prephenate dehydratase desensitized to feedback inhibition (U.S. Pat. No. 5,354,672), E. coli MWEC101-b (KR8903681), E. coli NRRL B-12141, NRRL B-12145, NRRL B-12146, and NRRL B-12147 (U.S. Pat. No. 4,407,952). Specific examples of L-phenylalanine-producing bacteria and parental strains that can be used to derive such bacteria also can include, for example, E. coli K-12<W3110(tyrA)/pPHAB> (FERM BP-3566), E. coli K-12 <W3110(tyrA)/pPHAD> (FERM BP-12659), E. coli K-12<W3110(tyrA)/pPHATerm> (FERM BP-12662), and E. coli K-12 AJ12604 <W3110(tyrA)/pBR-aroG4, pACMAB> (FERM BP-3579), which contains a gene encoding a chorismate mutase-prephenate dehydratase desensitized to feedback inhibition (EP488424B1). Specific examples of L-phenylalanine-producing bacteria and parental strains that can be used to derive such bacteria further can include, for example, strains belonging to the genus Escherichia having an increased activity of the protein encoded by the yedA gene or the yddG gene (US2003-0148473A, US2003-0157667A, WO03/044192).

[0275] Examples of coryneform bacteria having L-phenylalanine-producing ability can include, for example, the Corynebacterium glutamicum strains BPS-13 (FERM BP-1777), K77 (FERM BP-2062), and K78 (FERM BP-2063) (EP331145A, Japanese Patent Laid-open (Kokai) No. 02-303495), of which phosphoenolpyruvate carboxylase or pyruvate kinase activity is reduced, and the tyrosine-auxotrophic strain (Japanese Patent Laid-open (Kokai) No. 05-049489).

[0276] Examples of coryneform bacteria having L-tyrosine-producing ability can include, for example, Corynebacterium glutamicum AJ11655 (FERM P-5836, Japanese Patent Publication No. 2-6517), and Corynebacterium glutamicum (Brevibacterium lactofermentum) AJ12081 (FERM P-7249, Japanese Patent Laid-open (Kokai) No. 60-70093).

[0277] Furthermore, examples of methods for imparting or enhancing an L-amino acid-producing ability can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity for secreting an L-amino acid from a bacterial cell. Such an activity for secreting an L-amino acid can be increased by, for example, increasing the expression of a gene encoding a protein responsible for secretion of the L-amino acid. Examples of genes encoding the proteins responsible for secretion of various amino acids can include, for example, b2682 gene (ygaZ), b2683 gene (ygaH), b1242 gene (ychE), and b3434 gene (yhgN) (Japanese Patent Laid-open (Kokai) No. 2002-300874).

[0278] Furthermore, examples of methods for imparting or enhancing an L-amino acid-producing ability also can include, for example, a method of modifying a bacterium so that the bacterium has an increased activity or activities of one or more proteins selected from proteins involved in the glycometabolism and proteins involved in the energy metabolism.

[0279] Examples of the proteins involved in the glycometabolism can include proteins involved in uptake of saccharides and the glycolysis system enzymes. Examples of genes encoding a protein involved in the glycometabolism can include glucose-6-phosphate isomerase gene (pgi, WO01/02542), pyruvate carboxylase gene (pyc, WO99/18228, EP1092776A), phosphoglucomutase gene (pgm, WO03/04598), fructose bisphosphate aldolase gene (pfkB, fbp, WO03/04664), transaldolase gene (talB, WO03/008611), fumarase gene (fum, WO01/02545), non-PTS sucrose uptake gene (csc, EP1149911A), and sucrose assimilation gene (scrAB operon, U.S. Pat. No. 7,179,623).

[0280] Examples of genes encoding the proteins involved in the energy metabolism can include the transhydrogenase gene (pntAB, U.S. Pat. No. 5,830,716) and cytochrome bo-type oxidase gene (cyoB, EP1070376A).

[0281] Furthermore, examples of methods for imparting or enhancing an ability to produce useful substances such as L-amino acids can include, for example, a method of modifying a bacterium so that the activity of phosphoketolase is increased (WO2006/016705). Hence, the bacterium may have been modified so that the activity of phosphoketolase is increased. This method may be effective particularly for imparting or enhancing an ability to produce an L-amino acid of glutamate family such as L-glutamic acid. Examples of phosphoketolase can include D-xylulose-5-phosphate phosphoketolase and fructose-6-phosphate phosphoketolase. Either one of the D-xylulose-5-phosphate phosphoketolase activity and the fructose-6-phosphate phosphoketolase activity may be enhanced, or both may be enhanced.

[0282] The term D-xylulose-5-phosphate phosphoketolase activity can refer to an activity for converting xylulose-5-phosphate into glycelaldehyde-3-phosphate and acetyl phosphate with consuming phosphoric acid to release one molecule of H.sub.2O. This activity can be measured by the method described by Goldberg, M. et al. (Methods Enzymol., 9, 515-520, 1996) or the method described by L. Meile (J. Bacteriol., 183:2929-2936, 2001). Examples of D-xylulose-5-phosphate phosphoketolase can include those of bacteria belonging to the genera Acetobacter, Bifidobacterium, Lactobacillus, Thiobacillus, Streptococcus, Methylococcus, Butyrivibrio, and Fibrobacter, and yeast belonging to the genera Candida, Rhodotorula, Rhodosporidium, Pichia, Yarrowia, Hansenula, Kluyveromyces, Saccharomyces, Trichosporon, and Wingea. Specific examples of D-xylulose-5-phosphate phosphoketolase and genes encoding them are disclosed in WO2006/016705.

[0283] The term fructose-6-phosphate phosphoketolase activity can refer to an activity for converting fructose-6-phosphate into erythrose-4-phosphate and acetyl phosphate with consuming phosphoric acid to release one molecule of H.sub.2O. This activity can be measured by the method described by Racker, E. (Methods Enzymol., 5, 276-280, 1962) or the method described by L. Meile (J. Bacteriol., 183:2929-2936, 2001). Examples of fructose-6-phosphate phosphoketolase can include those of bacteria belonging to the genera Acetobacter, Bifidobacterium, Chlorobium, Brucella, Methylococcus, and Gardnerella, and yeast belonging to the genera Rhodotorula, Candida, and Saccharomyces. Specific examples of fructose-6-phosphate phosphoketolase and genes encoding them are disclosed in WO2006/016705.

[0284] Both the D-xylulose-5-phosphate phosphoketolase activity and the fructose-6-phosphate phosphoketolase activity may also be retained by a single enzyme (i.e. D-xylulose-5-phosphate phosphoketolase/fructose-6-phosphate phosphoketolase).

[0285] The genes and proteins used for breeding L-amino acid-producing bacteria may have, for example, the nucleotide sequences and amino acid sequences of known genes and proteins, such as those exemplified above, respectively. Also, the genes and proteins used for breeding L-amino acid-producing bacteria may be conservative variants of known genes and proteins, such as those exemplified above, respectively. Specifically, for example, the genes used for breeding L-amino acid-producing bacteria may each be a gene encoding a protein having an amino acid sequence of a known protein, but including substitution, deletion, insertion, or addition of one or several amino acid residues at one or several positions, so long as the original function thereof is maintained. For the conservative variants of genes and proteins, the descriptions concerning conservative variants of the carotenoid biosynthesis enzyme gene and carotenoid biosynthesis enzyme mentioned later can be similarly applied.

[0286] Furthermore, the bacterium may have an ability to produce a carotenoid. The phrase bacterium may have an ability to produce a carotenoid or carotenoid-producing ability can refer to a bacterium having an ability to generate and accumulate an objective carotenoid in cells of the bacterium, when the bacterium is cultured in a medium. The bacterium having a carotenoid-producing ability may be a bacterium that is able to accumulate an objective carotenoid in cells of the bacterium in an amount larger than that obtainable with a non-modified strain. The term non-modified strain can refer to a control strain that has not been modified so that the activity of a carotenoid biosynthesis enzyme is increased. That is, examples of the non-modified strain can include a wild-type strain and parental strain. The bacterium having a carotenoid-producing ability may be a bacterium that is able to accumulate an objective carotenoid in cells of the bacterium in an amount of 10 g/g-DCW or more, 50 g/g-DCW or more, 100 g/g-DCW or more, 200 g/g-DCW or more, or 500 g/g-DCW or more. The amount of an objective carotenoid accumulated in cells of the bacterium having a carotenoid-producing ability may also be, for example, 100 mg/g-DCW or less, 50 mg/g-DCW or less, 10 mg/g-DCW or less, 5 mg/g-DCW or less, or 1 mg/g-DCW or less. The amount of an objective carotenoid accumulated in cells of the bacterium having a carotenoid-producing ability may also be within a range defined by any combination of the ranges exemplified above. The term DCW refers to dry cell weight. Examples of the carotenoid can include carotenes and xanthophylls. Specific examples of the carotenoid can include, for example, phytoene, phytofluene, zeta-carotene, neurosporene, lycopene, beta-carotene, beta-cryptoxanthin, echinenone, 3-hydroxyechinenone, 3-hydroxyechinenone, zeaxanthin, canthaxanthin, adonixanthin, adonirubin, and astaxanthine. Particular examples of the carotenoid can include beta-carotene, zeaxanthin, canthaxanthin, and astaxanthine. More particular examples of the carotenoid can include astaxanthine. The bacterium may have an ability to produce a single kind of carotenoid, or two or more kinds of carotenoids. The accumulation amount of carotenoid exemplified above may represent, for example, the amount of all the carotenoids, or the amount of one or more selected carotenoids. The bacterium may inherently be able to produce a carotenoid, or may be modified so that it is able to produce a carotenoid. The bacterium having a carotenoid-producing ability can be obtained by imparting a carotenoid-producing ability to such a bacterium as mentioned above, or by enhancing a carotenoid-producing ability of such a bacterium as mentioned above. A carotenoid-producing ability can be imparted or enhanced by, for example, modifying a bacterium so that the bacterium has an increased activity of a carotenoid biosynthesis enzyme.

[0287] <1-2> Enhancement of Carotenoid Biosynthesis Enzyme Activity

[0288] The bacterium as described herein has been modified so that the activity of a carotenoid biosynthesis enzyme is increased. Specifically, the bacterium has been modified so that the activity of a carotenoid biosynthesis enzyme is increased as compared with a non-modified strain. The bacterium can be obtained by modifying a bacterium having an L-amino acid-producing ability so that the activity of a carotenoid biosynthesis enzyme is increased. The bacterium can also be obtained by modifying a bacterium so that the activity of a carotenoid biosynthesis enzyme is increased, and then imparting or enhancing an L-amino acid-producing ability. The bacterium may also be a bacterium that has acquired an L-amino acid-producing ability by being modified so that the activity of a carotenoid biosynthesis enzyme is increased. The bacterium may have, as required, such a property possessed by an L-amino acid-producing bacterium as mentioned above. The modifications for constructing the bacterium can be performed in an arbitrary order.

[0289] By modifying a bacterium so that the activity of a carotenoid biosynthesis enzyme is increased, an L-amino acid-producing ability of the bacterium can be improved, and that is, production of an L-amino acid by using the bacterium can be increased.

[0290] Hereinafter, carotenoid biosynthesis enzymes and genes encoding them will be explained.

[0291] The term carotenoid biosynthesis enzyme can refer to a protein involved in the biosynthesis of a carotenoid. A gene encoding a carotenoid biosynthesis enzyme can also be referred to as carotenoid biosynthesis enzyme gene.

[0292] Carotenoids are biosynthesized via farnesyl pyrophosphate as an intermediate. Hence, examples of the carotenoid biosynthesis enzyme can include enzymes catalyzing the conversion from farnesyl pyrophosphate into carotenoids such as astaxanthine.

[0293] Astaxanthine can be biosynthesized via, for example, the following reactions. That is, farnesyl pyrophosphate can be converted into geranylgeranyl pyrophosphate by the action of geranylgeranyl pyrophosphate synthase. Geranylgeranyl pyrophosphate can be converted into phytoene by the action of phytoene synthase. Phytoene can be converted into lycopene via 4 steps of desaturation by the action of phytoene desaturase. Lycopene can be converted into beta-carotene by the action of lycopene beta-cyclase. Beta-carotene can be converted into astaxanthine via 2 steps of ketolation and 2 steps of hydroxylation by the action of carotene ketolase and carotene hydroxylase. Hence, specific examples of the carotenoid biosynthesis enzyme can include geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, lycopene beta-cyclase, carotene ketolase, and carotene hydroxylase.

[0294] The term geranylgeranyl pyrophosphate synthase can refer to a protein that has the activity of catalyzing the reaction of converting farnesyl pyrophosphate and isopentenyl pyrophosphate into geranylgeranyl pyrophosphate and pyrophosphate (EC 2.5.1.29). This activity can also be referred to as geranylgeranyl pyrophosphate synthase activity. Examples of geranylgeranyl pyrophosphate synthase can include the CrtE protein, which is encoded by the crtE gene.

[0295] The term phytoene synthase can refer to a protein that has the activity of catalyzing the reaction of converting two molecules of geranylgeranyl pyrophosphate into one molecule of phytoene and two molecules of pyrophosphate (EC 2.5.1.32 or EC 2.5.1.99). This activity can also be referred to as phytoene synthase activity. Examples of phytoene synthase can include CrtB protein, which is encoded by crtB gene.

[0296] The term phytoene desaturase can refer to a protein that has the activity of catalyzing the reaction of desaturating a linear carotene such as phytoene, phytofluene, zeta-carotene, or neurosporene. This activity can also be referred to as phytoene desaturase activity. Phytoene can be converted into lycopene via 4 steps of desaturation. Specifically, phytoene can be successively desaturated into phytofluene, zeta-carotene, neurosporene, and lycopene. Specific examples of phytoene desaturase can include phytoene desaturase (lycopene-forming), which catalyzes 4 steps of desaturation from phytoene into lycopene (EC 1.3.99.31 etc.); phytoene desaturase (zeta-carotene-forming), which catalyzes 2 steps of desaturation from phytoene into zeta-carotene (EC 1.3.5.6, EC 1.3.99.29, etc.); and zeta-carotene desaturase, which catalyzes 2 steps of desaturation from zeta-carotene into lycopene (EC 1.3.5.6, EC 1.3.99.26, etc.). Examples of phytoene desaturase (lycopene-forming) can include the CrtI protein, which is encoded by the crtI gene. Examples of phytoene desaturase (zeta-carotene-forming) can include the CrtP protein (synonym: Pds protein), which is encoded by the crtP gene (synonym: pds gene). Examples of zeta-carotene desaturase can include the CrtQ protein, which is encoded by the crtQ gene. As phytoene desaturase, for example, phytoene desaturase (lycopene-forming) may be used, or a combination of phytoene desaturase (zeta-carotene-forming) and zeta-carotene desaturase may be used.

[0297] The term lycopene beta-cyclase can refer to a protein that has the activity of catalyzing the reaction of cyclizing lycopene to generate beta-carotene (EC 5.5.1.19). This activity can also be referred to as lycopene beta-cyclase activity. Examples of lycopene beta-cyclase can include CrtY and CrtL proteins, which are encoded by crtY and crtL genes, respectively.

[0298] The term carotene ketolase can refer to a protein that has the activity of catalyzing the reaction of introducing a keto group into the ionone ring of a cyclic carotene (EC 1.3.5.B4, EC 1.14.11.B16, EC 1.17.5.B2, etc.). This activity can also be referred to as carotene ketolase activity. Examples of carotene ketolase can include CrtW and CrtO proteins, which are encoded by the crtW and crtO genes, respectively.

[0299] The term carotene hydroxylase can refer to a protein that has the activity of catalyzing the reaction of introducing a hydroxyl group into the ionone ring of a cyclic carotene (EC 1.14.13.129). This activity can also be referred to as carotene hydroxylase activity. Examples of carotene hydroxylase can include the CrtZ and CrtR proteins, which are encoded by the crtZ and crtR genes, respectively.

[0300] The activity of one kind of carotenoid biosynthesis enzyme may be increased, or the activities of two or more kinds of carotenoid biosynthesis enzymes may be increased. The number and kind(s) of carotenoid biosynthesis enzyme(s) of which the activity or activities is/are increased are not particularly limited. The carotenoid biosynthesis enzyme(s) of which the activity or activities is/are increased may be selected so that, for example, a carotenoid-producing ability is imparted or enhanced. For example, at least the activity or activities of one or more of geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, and lycopene beta-cyclase may be increased. Also, for example, at least the activities of geranylgeranyl pyrophosphate synthase, phytoene synthase, phytoene desaturase, and lycopene beta-cyclase may be increased. Also, for example, in addition to the activity or activities of this/these enzyme(s), the activity or activities of carotene ketolase and/or carotene hydroxylase may further be increased.

[0301] Examples of the carotenoid biosynthesis enzyme gene can include genes of, or native to, various organisms such as plants, algae, and bacteria. Examples of bacteria having the carotenoid biosynthesis enzyme gene can include, for example, bacteria belonging to the family Enterobacteriaceae, such as Pantoea bacteria; bacteria belonging to the family Caulobacteraceae, such as Brevundimonas bacteria; bacteria belonging to the family Rhodobacteraceae, such as Paracoccus bacteria; bacteria belonging to the family Alcaligenaceae, such as Alcaligenes bacteria; coryneform bacteria such as Corynebacterium bacteria; cyanobacteria such as Nostoc bacteria and Synechococcus bacteria. The nucleotide sequences of the carotenoid biosynthesis enzyme genes derived from these various organisms and the amino acid sequences of the carotenoid biosynthesis enzymes encoded by these genes can be obtained from, for example, public databases such as NCBI. Specific examples of the crtE, crtB, crtI, crtY, and crtZ genes can include, for example, the crtE, crtB, crtI, crtY, and crtZ genes of Pantoea bacteria such as Pantoea ananatis and Pantoea agglomerans. The nucleotide sequences of the crtE, crtB, crtI, crtY, and crtZ genes of Pantoea ananatis AJ13355 are shown in SEQ ID NOS: 11, 13, 15, 17, and 21, respectively. The amino acid sequences of the CrtE, CrtB, CrtI, CrtY, and CrtZ proteins encoded by these genes are shown in SEQ ID NOS: 12, 14, 16, 18, and 22, respectively. Furthermore, specific examples of the crtE, crtB, and crtI genes can include, for example, the crtE, crtB, and crtI genes of Corynebacterium bacteria such as Corynebacterium glutamicum. The nucleotide sequences of the crtE (cg0723), crtB (cg0721), and crtI (cg0720) genes of Corynebacterium glutamicum ATCC 13032 are shown in SEQ ID NOS: 23, 25, and 27, respectively. The amino acid sequences of the CrtE, CrtB, and CrtI proteins encoded by these genes are shown in SEQ ID NOS: 24, 26, and 28, respectively.

[0302] Furthermore, specific examples of crtW gene can include, for example, the crtW genes of Nostoc bacteria such as Nostoc sp. and Nostoc punctiforme and Brevundimonas bacteria such as Brevundimonas aurantiaca. The nucleotide sequence of the crtW gene of Nostoc sp. PCC 7120 and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NOS: 19 and 20, respectively. The nucleotide sequence of the crtW gene of Nostoc punctiforme (codon-optimized for expression in E. coli) and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NOS: 50 and 61, respectively. The nucleotide sequence of the crtW gene of Brevundimonas aurantiaca and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NOS: 29 and 30, respectively. Furthermore, specific examples of the crtZ gene can include, for example, the crtZ genes of Brevundimonas bacteria such as Brevundimonas sp., Paracoccus bacteria such as Paracoccus sp., and Alcaligenes bacteria such as Alcaligenes sp. The nucleotide sequence of the crtZ gene of Brevundimonas sp. SD-212 and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NOS: 37 and 58, respectively. The nucleotide sequence of the crtZ gene of Paracoccus sp. N81106 and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NOS: 42 and 59, respectively. The nucleotide sequence of the crtZ gene of Alcaligenes sp. and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NOS: 46 and 60, respectively. Furthermore, specific examples of the crtP, crtQ, crtO, and crtR genes can include, for example, the crtP (pds), crtQ, crtO, and crtR genes of cyanobacteria such as Synechococcus bacteria. That is, the carotenoid biosynthesis enzyme gene may be, for example, a gene having the nucleotide sequence of any of the carotenoid biosynthesis enzyme genes exemplified above, such as the nucleotide sequence shown as SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 37, 42, 46, or 50. Also, the carotenoid biosynthesis enzyme may be, for example, a protein having the amino acid sequence of any of the carotenoid biosynthesis enzymes exemplified above, such as the amino acid sequence shown as SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 58, 59, 60, or 61. The expression a gene or protein has a nucleotide or amino acid sequence can mean that a gene or protein includes the nucleotide or amino acid sequence unless otherwise stated, and also includes when a gene or protein includes only the nucleotide or amino acid sequence.

[0303] The carotenoid biosynthesis enzyme gene may be a variant of any of the carotenoid biosynthesis enzyme genes exemplified above (e.g. a gene having the nucleotide sequence shown as SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 37, 42, 46, or 50), so long as the original function thereof is maintained. Similarly, the carotenoid biosynthesis enzyme may be a variant of any of the carotenoid biosynthesis enzymes exemplified above (e.g. a protein having the amino acid sequence shown as SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 58, 59, 60, or 61), so long as the original function thereof is maintained. Such a variant that maintains the original function thereof can also be referred to as conservative variant. A gene defined with the above-mentioned gene name and a protein defined with the above-mentioned protein name can include not only the genes and proteins exemplified above, respectively, but also can include conservative variants thereof. Namely, for example, the term the crtE gene includes not only the crtE genes exemplified above, but also can include conservative variants thereof. Similarly, the term CrtE protein includes not only the CrtE proteins exemplified above, but also can include conservative variants thereof. Examples of the conservative variants can include, for example, homologues and artificially modified versions of the carotenoid biosynthesis enzyme genes and carotenoid biosynthesis enzymes exemplified above.

[0304] The expression the original function is maintained can mean that a variant of gene or protein has a function (such as activity or property) corresponding to the function (such as activity or property) of the original gene or protein. The expression the original function is maintained used for a gene means that a variant of the gene encodes a protein that maintains the original function. That is, the expression the original function is maintained used for the carotenoid biosynthesis enzyme gene means that a variant of the gene encodes a protein having the corresponding carotenoid biosynthesis enzyme activity, e.g. geranylgeranyl pyrophosphate synthase activity for a geranylgeranyl pyrophosphate synthase gene. Furthermore, the expression the original function is maintained used for the carotenoid biosynthesis enzyme means that a variant of the protein has the corresponding carotenoid biosynthesis enzyme activity, e.g. geranylgeranyl pyrophosphate synthase activity for geranylgeranyl pyrophosphate synthase.

[0305] Each carotenoid biosynthesis enzyme activity can be measured by, for example, incubating the enzyme with a substrate corresponding to the activity to be measured, and measuring the enzyme- and substrate-dependent generation of a product corresponding to the activity to be measured. For example, geranylgeranyl pyrophosphate synthase activity can be measured by incubating the enzyme with a substrate (i.e. farnesyl pyrophosphate and isopentenyl pyrophosphate), and measuring the enzyme- and substrate-dependent generation of a product (i.e. geranylgeranyl pyrophosphate).

[0306] Hereinafter, examples of the conservative variants will be explained.

[0307] Homologues of the carotenoid biosynthesis enzyme genes or homologues of the carotenoid biosynthesis enzymes can be easily obtained from public databases by, for example, BLAST search or FASTA search using any of the nucleotide sequences of the carotenoid biosynthesis enzyme genes exemplified above or any of the amino acid sequences of the carotenoid biosynthesis enzymes exemplified above as a query sequence. Furthermore, homologues of the carotenoid biosynthesis enzyme genes can be obtained by, for example, PCR using a chromosome of various organisms as the template, and oligonucleotides prepared on the basis of any of the nucleotide sequences of these known carotenoid biosynthesis enzyme genes as primers.

[0308] The carotenoid biosynthesis enzyme gene may be a gene encoding a protein having any of the aforementioned amino acid sequences (e.g. the amino acid sequence shown as SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 58, 59, 60, or 61), but which includes substitution, deletion, insertion, and/or addition of one or several amino acid residues at one or several positions, so long as the original function is maintained. For example, the N-terminus and/or the C-terminus of the encoded protein may be elongated or shortened. Although the number meant by the term one or several mentioned above may differ depending on the positions of amino acid residues in the three-dimensional structure of the protein or the types of amino acid residues, specifically, it is, for example, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, or 1 to 3.

[0309] The aforementioned substitution, deletion, insertion, and/or addition of one or several amino acid residues are/is a conservative mutation that maintains the normal function of the protein. Typical examples of the conservative mutation are conservative substitutions. The conservative substitution is a mutation wherein substitution takes place mutually among Phe, Trp, and Tyr, if the substitution site is an aromatic amino acid; among Leu, Ile, and Val, if it is a hydrophobic amino acid; between Gln and Asn, if it is a polar amino acid; among Lys, Arg, and His, if it is a basic amino acid; between Asp and Glu, if it is an acidic amino acid; and between Ser and Thr, if it is an amino acid having a hydroxyl group. Examples of substitutions considered as conservative substitutions can include, specifically, substitution of Ser or Thr for Ala, substitution of Gln, His, or Lys for Arg, substitution of Glu, Gln, Lys, His, or Asp for Asn, substitution of Asn, Glu, or Gln for Asp, substitution of Ser or Ala for Cys, substitution of Asn, Glu, Lys, His, Asp, or Arg for Gln, substitution of Gly, Asn, Gln, Lys, or Asp for Glu, substitution of Pro for Gly, substitution of Asn, Lys, Gln, Arg, or Tyr for His, substitution of Leu, Met, Val, or Phe for Ile, substitution of Ile, Met, Val, or Phe for Leu, substitution of Asn, Glu, Gln, His, or Arg for Lys, substitution of Ile, Leu, Val, or Phe for Met, substitution of Trp, Tyr, Met, Ile, or Leu for Phe, substitution of Thr or Ala for Ser, substitution of Ser or Ala for Thr, substitution of Phe or Tyr for Trp, substitution of His, Phe, or Trp for Tyr, and substitution of Met, Ile, or Leu for Val. Furthermore, such substitution, deletion, insertion, addition, inversion, or the like of amino acid residues as mentioned above includes a naturally occurring mutation due to an individual difference, or a difference of species of the organism from which the gene is derived (mutant or variant).

[0310] The carotenoid biosynthesis enzyme gene may be a gene encoding a protein having an amino acid sequence showing a homology of, for example, 50% or more, 65% or more, 80% or more, 90% or more, 95% or more, 97% or more, or 99% or more, to the total amino acid sequence of any of the aforementioned amino acid sequences, so long as the original function is maintained. In this description, homology can mean identity.

[0311] The carotenoid biosynthesis enzyme gene may also be a DNA that is able to hybridize under stringent conditions with a probe that can be prepared from any of the aforementioned nucleotide sequences (e.g. the nucleotide sequence shown as SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 37, 42, 46, or 50), such as a sequence complementary to a partial or entire sequence of any of the aforementioned nucleotide sequences, so long as the original function is maintained. The term stringent conditions can refer to conditions under which a so-called specific hybrid is formed, and a non-specific hybrid is not formed. Examples of the stringent conditions can include those under which highly homologous DNAs hybridize to each other, for example, DNAs not less than 50%, 65%, 80%, 90%, 95%, 97%, or 99% homologous, hybridize to each other, and DNAs less homologous than the above do not hybridize to each other, or conditions of washing of typical Southern hybridization, i.e., conditions of washing once, or 2 or 3 times, at a salt concentration and temperature corresponding to 1SSC, 0.1% SDS at 60 C.; 0.1SSC, 0.1% SDS at 60 C.; or 0.1SSC, 0.1% SDS at 68 C.

[0312] The probe used for the aforementioned hybridization may be a part of a sequence that is complementary to the gene as described above. Such a probe can be prepared by PCR using oligonucleotides prepared on the basis of a known gene sequence as primers and a DNA fragment containing any of the aforementioned genes as a template. As the probe, for example, a DNA fragment having a length of about 300 bp can be used. When a DNA fragment having a length of about 300 bp is used as the probe, the washing conditions of the hybridization may be, for example, 50 C., 2SSC and 0.1% SDS.

[0313] Furthermore, since the degeneracy of codons differs depending on the host, arbitrary codons in the carotenoid biosynthesis enzyme gene may be replaced with respective equivalent codons. That is, the carotenoid biosynthesis enzyme gene may be a variant of any of the carotenoid biosynthesis enzyme genes exemplified above due to the degeneracy of the genetic code. For example, the carotenoid biosynthesis enzyme gene may be a gene modified so that it has optimal codons according to codon frequencies in a host to be used.

[0314] The percentage of the sequence identity between two sequences can be determined by, for example, using a mathematical algorithm. Non-limiting examples of such a mathematical algorithm can include the algorithm of Myers and Miller (1988) CABIOS 4:11-17, the local homology algorithm of Smith et al (1981) Adv. Appl. Math. 2:482, the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453, the method for searching homology of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-2448, and an modified version of the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, such as that described in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.

[0315] By using a program based on such a mathematical algorithm, sequence comparison (i.e. alignment) for determining the sequence identity can be performed. The program can be appropriately executed by a computer. Examples of such a program can include, but are not limited to, CLUSTAL of PC/Gene program (available from Intelligenetics, Mountain View, Calif.), ALIGN program (Version 2.0), and GAP, BESTFIT, BLAST, FASTA, and TFASTA of Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wis., USA). Alignment using these programs can be performed by using, for example, initial parameters. The CLUSTAL program is well described in Higgins et al. (1988) Gene 73:237-244, Higgins et al. (1989) CABIOS 5:151-153, Corpet et al. (1988) Nucleic Acids Res. 16:10881-90, Huang et al. (1992) CABIOS 8:155-65, and Pearson et al. (1994) Meth. Mol. Biol. 24:307-331.

[0316] In order to obtain a nucleotide sequence homologous to a target nucleotide sequence, in particular, for example, BLAST nucleotide search can be performed by using BLASTN program with score of 100 and word length of 12. In order to obtain an amino acid sequence homologous to a target protein, in particular, for example, BLAST protein search can be performed by using BLASTX program with score of 50 and word length of 3. See ncbi.nlm.nih.gov for BLAST nucleotide search and BLAST protein search. In addition, Gapped BLAST (BLAST 2.0) can be used in order to obtain an alignment including gap(s) for the purpose of comparison. In addition, PSI-BLAST (BLAST 2.0) can be used in order to perform repetitive search for detecting distant relationships between sequences. See Altschul et al. (1997) Nucleic Acids Res. 25:3389 for Gapped BLAST and PSI-BLAST. When using BLAST, Gapped BLAST, or PSI-BLAST, initial parameters of each program (e.g. BLASTN for nucleotide sequences, and BLASTX for amino acid sequences) can be used. Alignment can also be manually performed.

[0317] The sequence identity between two sequences is calculated as the ratio of residues matching in the two sequences when aligning the two sequences so as to fit maximally with each other.

[0318] The aforementioned descriptions concerning conservative variants of the genes and proteins can be similarly applied to variants of arbitrary proteins such as L-amino acid biosynthesis system enzymes and genes encoding them.

[0319] <1-3> Methods for Increasing Activity of Protein

[0320] Hereinafter, methods for increasing the activity of a protein such as the carotenoid biosynthesis enzyme will be explained.

[0321] The expression the activity of a protein is increased can mean that the activity of the protein is increased as compared with a non-modified strain. Specifically, the expression the activity of a protein is increased may mean that the activity of the protein per cell is increased as compared with that of a non-modified strain. The term non-modified strain can refer to a control strain that has not been modified so that the activity of an objective protein is increased. Examples of the non-modified strain can include a wild-type strain and parent strain. Specific examples of the non-modified strain can include the respective type strains of the species of microorganisms. Specific examples of the non-modified strain also can include strains exemplified above in relation to the description of microorganisms. That is, in an embodiment, the activity of a protein may be increased as compared with, for example, the same type of strain of the species to which the microorganism as described herein belongs. In another embodiment, the activity of a protein may also be increased as compared with the E. coli MG1655 strain. In another embodiment, the activity of a protein may also be increased as compared with the P. ananatis AJ13355 strain. In another embodiment, the activity of a protein may also be increased as compared with the C. glutamicum ATCC 13869 strain. The state that the activity of a protein is increased may also be expressed as the activity of a protein is enhanced. More specifically, the expression the activity of a protein is increased may mean that the number of molecules of the protein per cell is increased, and/or the function of each molecule of the protein is increased as compared with those of a non-modified strain. That is, the term activity in the expression the activity of a protein is increased is not limited to the catalytic activity of the protein, but may also mean the transcription amount of a gene (i.e. the amount of mRNA) encoding the protein, or the translation amount of the gene (i.e. the amount of the protein). Furthermore, the state that the activity of a protein is increased includes not only a state that the activity of an objective protein is increased in a strain inherently having the activity of the objective protein, but also a state that the activity of an objective protein is imparted to a strain not inherently having the activity of the objective protein. Furthermore, so long as the activity of the protein is eventually increased, the activity of an objective protein inherently contained in a host may be attenuated and/or eliminated, and then an appropriate type of the objective protein may be imparted to the host.

[0322] The degree of the increase in the activity of a protein is not particularly limited, so long as the activity of the protein is increased as compared with a non-modified strain. The activity of the protein may be increased to, for example, 1.5 times or more, 2 times or more, or 3 times or more of that of a non-modified strain. Furthermore, when the non-modified strain does not have the activity of the objective protein, it is sufficient that the protein is produced as a result of introduction of the gene encoding the protein, and for example, the protein may be produced to such an extent that the activity thereof can be measured.

[0323] The modification for increasing the activity of a protein can be attained by, for example, increasing the expression of a gene encoding the protein. The expression the expression of a gene is increased means that the expression of the gene is increased as compared with a non-modified strain such as a wild-type strain and parent strain. Specifically, the expression the expression of a gene is increased may mean that the expression amount of the gene per cell is increased as compared with that of a non-modified strain such as a wild-type strain and parent strain. More specifically, the expression the expression of a gene is increased may mean that the transcription amount of the gene (i.e. the amount of mRNA) is increased, and/or the translation amount of the gene (i.e. the amount of the protein expressed from the gene) is increased. The state that the expression of a gene is increased may also be referred to as the expression of a gene is enhanced. The expression of a gene may be increased to, for example, 1.5 times or more, 2 times or more, or 3 times or more of that of a non-modified strain. Furthermore, the state that the expression of a gene is increased can include not only a state that the expression amount of an objective gene is increased in a strain that inherently expresses the objective gene, but also a state that the gene is introduced into a strain that does not inherently express the objective gene, and expressed therein. That is, the phrase the expression of a gene is increased may also mean, for example, that an objective gene is introduced into a strain that does not possess the gene, and is expressed therein.

[0324] The expression of a gene can be increased by, for example, increasing the copy number of the gene.

[0325] The copy number of a gene can be increased by introducing the gene into the chromosome of a host. A gene can be introduced into a chromosome by, for example, using homologous recombination (Miller, J. H., Experiments in Molecular Genetics, 1972, Cold Spring Harbor Laboratory). Examples of the gene transfer method utilizing homologous recombination can include, for example, a method of using a linear DNA such as Red-driven integration (Datsenko, K. A., and Wanner, B. L., Proc. Natl. Acad. Sci. USA, 97:6640-6645 (2000)), a method of using a plasmid containing a temperature sensitive replication origin, a method of using a plasmid capable of conjugative transfer, a method of using a suicide vector not having a replication origin that functions in a host, and a transduction method using a phage. Only one copy, or two or more copies of a gene may be introduced. For example, by performing homologous recombination using a sequence which is present in multiple copies on a chromosome as a target, multiple copies of a gene can be introduced into the chromosome. Examples of such a sequence which is present in multiple copies on a chromosome can include repetitive DNAs, and inverted repeats located at the both ends of a transposon. Alternatively, homologous recombination may be performed by using an appropriate sequence on a chromosome such as a gene unnecessary for production of an objective substance as a target. Furthermore, a gene can also be randomly introduced into a chromosome by using a transposon or Mini-Mu (Japanese Patent Laid-open (Kokai) No. 2-109985, U.S. Pat. No. 5,882,888, EP805867B1).

[0326] Introduction of a target gene into a chromosome can be confirmed by Southern hybridization using a probe having a sequence complementary to the whole gene or a part thereof, PCR using primers prepared on the basis of the sequence of the gene, or the like.

[0327] Furthermore, the copy number of a gene can also be increased by introducing a vector containing the gene into a host. For example, the copy number of a target gene can be increased by ligating a DNA fragment containing the target gene with a vector that functions in a host to construct an expression vector of the gene, and transforming the host with the expression vector. The DNA fragment containing the target gene can be obtained by, for example, PCR using the genomic DNA of a microorganism having the target gene as the template. As the vector, a vector autonomously replicable in the cell of the host can be used. The vector can be a multi-copy vector. Furthermore, the vector can have a marker such as an antibiotic resistance gene for selection of transformant. Furthermore, the vector may have a promoter and/or terminator for expressing the introduced gene. The vector may be, for example, a vector derived from a bacterial plasmid, a vector derived from a yeast plasmid, a vector derived from a bacteriophage, cosmid, phagemid, or the like. Specific examples of vector autonomously replicable in Enterobacteriaceae bacteria such as Escherichia coli can include, for example, pUC19, pUC18, pHSG299, pHSG399, pHSG398, pBR322, pSTV29 (all of these are available from Takara Bio), pACYC184, pMW219 (NIPPON GENE), pTrc99A (Pharmacia), pPROK series vectors (Clontech), pKK233-2 (Clontech), pET series vectors (Novagen), pQE series vectors (QIAGEN), pCold TF DNA (Takara Bio), pACYC series vectors, and the broad host spectrum vector RSF1010. Specific examples of vector autonomously replicable in coryneform bacteria can include, for example, pHM1519 (Agric. Biol. Chem., 48, 2901-2903 (1984)); pAM330 (Agric. Biol. Chem., 48, 2901-2903 (1984)); plasmids obtained by improving these and having a drug resistance gene; plasmid pCRY30 (Japanese Patent Laid-open (Kokai) No. 3-210184); plasmids pCRY21, pCRY2KE, pCRY2KX, pCRY31, pCRY3KE, and pCRY3KX (Japanese Patent Laid-open (Kokai) No. 2-72876 and U.S. Pat. No. 5,185,262); plasmids pCRY2 and pCRY3 (Japanese Patent Laid-open (Kokai) No. 1-191686); pAJ655, pAJ611, and pAJ1844 (Japanese Patent Laid-open (Kokai) No. 58-192900); pCG1 (Japanese Patent Laid-open (Kokai) No. 57-134500); pCG2 (Japanese Patent Laid-open (Kokai) No. 58-35197); pCG4 and pCG11 (Japanese Patent Laid-open (Kokai) No. 57-183799); pVK7 (Japanese Patent Laid-open (Kokai) No. 10-215883); pVK9 (US2006-0141588); pVC7 (Japanese Patent Laid-open (Kokai) No. 9-070291); pVS7 (WO2013/069634).

[0328] When a gene is introduced, it is sufficient that the gene is expressibly harbored by a host. Specifically, it is sufficient that the gene is harbored by a host so that it is expressed under control by a promoter sequence that functions in the host. The promoter is not particularly limited so long as it functions in the host. The term promoter that functions in a host can refer to a promoter that shows a promoter activity in the host. The promoter may be a promoter derived from the host, or a heterogenous promoter. The promoter may be the native promoter of the gene to be introduced, or a promoter of another gene. As the promoter, for example, such a stronger promoter as mentioned later may also be used.

[0329] A terminator for termination of gene transcription may be located downstream of the gene. The terminator is not particularly limited so long as it functions in the host. The terminator may be a terminator derived from the host, or a heterogenous terminator. The terminator may be the native terminator of the gene to be introduced, or a terminator of another gene. Specific examples of the terminator can include, for example, T7 terminator, T4 terminator, fd phage terminator, tet terminator, and trpA terminator.

[0330] Vectors, promoters, and terminators available in various microorganisms are disclosed in detail in Fundamental Microbiology Vol. 8, Genetic Engineering, KYORITSU SHUPPAN CO., LTD, 1987, and those can be used.

[0331] Furthermore, when two or more of genes are introduced, it is sufficient that the genes each are expressibly harbored by the host. For example, all the genes may be carried by a single expression vector or a chromosome. Furthermore, the genes may be separately carried by two or more expression vectors, or separately carried by a single or two or more expression vectors and a chromosome. An operon constituted by two or more genes may also be introduced. The case of introducing two or more genes can include, for example, cases of introducing respective genes encoding two or more kinds of proteins (such as enzymes), introducing respective genes encoding two or more subunits constituting a single protein complex (such as enzyme complex), and a combination of the foregoing cases.

[0332] The gene to be introduced is not particularly limited so long as it encodes a protein that functions in the host. The gene to be introduced may be a gene derived from the host, or may be a heterogenous gene. The gene to be introduced can be obtained by, for example, PCR using primers designed on the basis of the nucleotide sequence of the gene, and using the genomic DNA of an organism having the gene, a plasmid carrying the gene, or the like as a template. The gene to be introduced may also be totally synthesized, for example, on the basis of the nucleotide sequence of the gene (Gene, 60(1), 115-127 (1987)). The obtained gene can be used as it is, or after being modified as required. That is, a variant of a gene may be obtained by modifying the gene. A gene can be modified by a known technique. For example, an objective mutation can be introduced into an objective site of DNA by the site-specific mutation method. That is, the coding region of a gene can be modified by the site-specific mutation method so that a specific site of the encoded protein can include substitution, deletion, insertion, and/or addition of amino acid residues. Examples of the site-specific mutation method can include the method utilizing PCR (Higuchi, R., 61, in PCR Technology, Erlich, H. A. Eds., Stockton Press (1989); Carter, P., Meth. in Enzymol., 154, 382 (1987)), and the method utilizing phage (Kramer, W. and Frits, H. J., Meth. in Enzymol., 154, 350 (1987); Kunkel, T. A. et al., Meth. in Enzymol., 154, 367 (1987)). Alternatively, a variant of a gene may be totally synthesized.

[0333] Incidentally, when a protein functions as a complex consisting of a plurality of subunits, a part or all of the plurality of subunits may be modified, so long as the activity of the protein is eventually increased. That is, for example, when the activity of a protein is increased by increasing the expression of a gene, the expression of a part or all of the plurality of genes that encode the subunits may be enhanced. It is usually preferable to enhance the expression of all of the plurality of genes encoding the subunits. Furthermore, the subunits constituting the complex may be derived from a single kind of organism or two or more kinds of organisms, so long as the complex has a function of the objective protein. That is, for example, genes of the same organism encoding a plurality of subunits may be introduced into a host, or genes of different organisms encoding a plurality of subunits may be introduced into a host.

[0334] Furthermore, the expression of a gene can be increased by improving the transcription efficiency of the gene. In addition, the expression of a gene can also be increased by improving the translation efficiency of the gene. The transcription efficiency of the gene and the translation efficiency of the gene can be improved by, for example, modifying an expression control sequence of the gene. The term expression control sequence collectively can refer to sites that affect the expression of a gene. Examples of the expression control sequence can include, for example, promoter, Shine-Dalgarno (SD) sequence (also referred to as ribosome binding site (RBS)), and spacer region between RBS and the start codon. Expression control sequences can be identified by using a promoter search vector or gene analysis software such as GENETYX. These expression control sequences can be modified by, for example, a method of using a temperature sensitive vector, or the Red driven integration method (WO2005/010175).

[0335] The transcription efficiency of a gene can be improved by, for example, replacing the promoter of the gene on a chromosome with a stronger promoter. The term stronger promoter can refer to a promoter providing an improved transcription of a gene compared with an inherently existing wild-type promoter of the gene. Examples of stronger promoters can include, for example, the known high expression promoters such as T7 promoter, trp promoter, lac promoter, thr promoter, tac promoter, trc promoter, tet promoter, araBAD promoter, rpoH promoter, msrA promoter, Pm1 promoter (derived from the genus Bifidobacterium), PR promoter, and PL promoter. Examples of stronger promoters usable in coryneform bacteria can include, for example, the artificially modified P54-6 promoter (Appl. Microbiol. Biotechnol., 53, 674-679 (2000)), pta, aceA, aceB, adh, and amyE promoters inducible in coryneform bacteria with acetic acid, ethanol, pyruvic acid, or the like, cspB, SOD, and tuf (EF-Tu) promoters, which are potent promoters capable of providing a large expression amount in coryneform bacteria (Journal of Biotechnology, 104 (2003) 311-323; Appl. Environ. Microbiol., 2005 December; 71 (12):8587-96), as well as lac promoter, tac promoter, and trc promoter. Furthermore, as the stronger promoter, a highly-active type of an existing promoter may also be obtained by using various reporter genes. For example, by making the 35 and 10 regions in a promoter region closer to the consensus sequence, the activity of the promoter can be enhanced (WO00/18935). Examples of highly active-type promoter can include various tac-like promoters (Katashkina J I et al., Russian Federation Patent Application No. 2006134574) and pnlp8 promoter (WO2010/027045). Methods for evaluating the strength of promoters and examples of strong promoters are described in the paper of Goldstein et al. (Prokaryotic Promoters in Biotechnology, Biotechnol. Annu. Rev., 1, 105-128 (1995)), and so forth.

[0336] The translation efficiency of a gene can be improved by, for example, replacing the Shine-Dalgarno (SD) sequence (also referred to as ribosome binding site (RBS)) for the gene on a chromosome with a stronger SD sequence. The stronger SD sequence can mean a SD sequence that provides an improved translation of mRNA compared with the inherent wild-type SD sequence of the gene. Examples of stronger SD sequences can include, for example, RBS of the gene 10 derived from phage T7 (Olins P. O. et al, Gene, 1988, 73, 227-235). Furthermore, it is known that substitution, insertion, or deletion of several nucleotides in a spacer region between RBS and the start codon, especially in a sequence immediately upstream of the start codon (5-UTR), significantly affects the stability and translation efficiency of mRNA, and hence, the translation efficiency of a gene can also be improved by modifying them.

[0337] The translation efficiency of a gene can also be improved by, for example, modifying codons. For example, the translation efficiency of the gene can be improved by replacing a rare codon present in the gene with a more frequently used synonymous codon. That is, the gene to be introduced may be modified, for example, so as to contain optimal codons according to the frequencies of codons observed in a host to be used. Codons can be replaced by, for example, the site-specific mutation method. Alternatively, a gene fragment in which objective codons are replaced may be totally synthesized. Frequencies of codons in various organisms are disclosed in the Codon Usage Database (kazusa.or.jp/codon; Nakamura, Y. et al, Nucl. Acids Res., 28, 292 (2000)).

[0338] Furthermore, the expression of a gene can also be increased by amplifying a regulator that increases the expression of the gene, or deleting or attenuating a regulator that reduces the expression of the gene.

[0339] Such methods for increasing the gene expression as mentioned above may be used independently or in an arbitrary combination.

[0340] Furthermore, the modification that increases the activity of a protein can also be attained by, for example, enhancing the specific activity of the protein. Enhancement of the specific activity also includes desensitization to feedback inhibition. That is, when a protein is subject to feedback inhibition by a metabolite, the activity of the protein can be increased by making the bacterium harbor a gene encoding a mutant protein that has been desensitized to the feedback inhibition. The term desensitization to feedback inhibition can include complete elimination of the feedback inhibition, and attenuation of the feedback inhibition, unless otherwise stated. Also, a state of being desensitized to feedback inhibition, i.e. a state that feedback inhibition is eliminated or attenuated, may also be referred to as tolerant to feedback inhibition. A protein showing an enhanced specific activity can be obtained by, for example, searching various organisms. Furthermore, a highly-active type of an existing protein may also be obtained by introducing a mutation into the existing protein. The mutation to be introduced may be, for example, substitution, deletion, insertion, or addition of one or several amino acid residues at one or several position of the protein. The mutation can be introduced by, for example, such a site-specific mutation method as mentioned above. The mutation may also be introduced by, for example, a mutagenesis treatment. Examples of the mutagenesis treatment can include irradiation of X-ray, irradiation of ultraviolet, and a treatment with a mutation agent such as N-methyl-N-nitro-N-nitrosoguanidine (MNNG), ethyl methanesulfonate (EMS), and methyl methanesulfonate (MMS). Furthermore, a random mutation may be induced by directly treating DNA in vitro with hydroxylamine. Enhancement of the specific activity may be independently used, or may be used in an arbitrary combination with such methods for enhancing gene expression as mentioned above.

[0341] The method for the transformation is not particularly limited, and conventionally known methods can be used. There can be used, for example, a method of treating recipient cells with calcium chloride so as to increase the permeability thereof for DNA, which has been reported for the Escherichia coli K-12 strain (Mandel, M. and Higa, A., J. Mol. Biol., 1970, 53, 159-162), and a method of preparing competent cells from cells which are in the growth phase, followed by transformation with DNA, which has been reported for Bacillus subtilis (Duncan, C. H., Wilson, G. A. and Young, F. E., Gene, 1997, 1:153-167). Alternatively, there can also be used a method of making DNA-recipient cells into protoplasts or spheroplasts, which can easily take up recombinant DNA, followed by introducing a recombinant DNA into the DNA-recipient cells, which is known to be applicable to Bacillus subtilis, actinomycetes, and yeasts (Chang, S. and Choen, S. N., 1979, Mol. Gen. Genet., 168:111-115; Bibb, M. J., Ward, J. M. and Hopwood, O. A., 1978, Nature, 274:398-400; Hinnen, A., Hicks, J. B. and Fink, G. R., 1978, Proc. Natl. Acad. Sci. USA, 75:1929-1933). Furthermore, the electric pulse method reported for coryneform bacteria (Japanese Patent Laid-open (Kokai) No. 2-207791) can also be used.

[0342] An increase in the activity of a protein can be confirmed by measuring the activity of the protein.

[0343] An increase in the activity of a protein can also be confirmed by confirming an increase in the expression of a gene encoding the protein. An increase in the expression of a gene can be confirmed by confirming an increase in the transcription amount of the gene, or by confirming an increase in the amount of a protein expressed from the gene.

[0344] An increase of the transcription amount of a gene can be confirmed by comparing the amount of mRNA transcribed from the gene with that of a non-modified strain such as a wild-type strain or parent strain. Examples of the method for evaluating the amount of mRNA can include Northern hybridization, RT-PCR, and so forth (Sambrook, J., et al., Molecular Cloning A Laboratory Manual/Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (USA), 2001). The amount of mRNA may be increased to, for example, 1.5 times or more, 2 times or more, or 3 times or more of that of a non-modified strain.

[0345] An increase in the amount of a protein can be confirmed by Western blotting using antibodies (Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (USA), 2001). The amount of the protein may be increased to, for example, 1.5 times or more, 2 times or more, or 3 times or more of that of a non-modified strain.

[0346] The aforementioned methods for increasing the activity of a protein can be used for enhancement of the activities of arbitrary proteins such as L-amino acid biosynthesis enzymes, and enhancement of the expression of arbitrary genes such as genes encoding those arbitrary proteins, besides enhancement of carotenoid biosynthesis enzyme activity.

[0347] <1-4> Method for Reducing Activity of Protein

[0348] Hereinafter, the methods for reducing the activity of a protein will be explained.

[0349] The expression the activity of a protein is reduced can mean that the activity of the protein is reduced as compared with a non-modified strain. Specifically, the expression the activity of a protein is reduced may mean that the activity of the protein per cell is reduced as compared with that of a non-modified strain. The term non-modified strain can refer to a control strain that has not been modified so that the activity of an objective protein is reduced. Examples of the non-modified strain can include a wild-type strain and parent strain. Specific examples of the non-modified strain can include the respective type strains of the species of microorganisms. Specific examples of the non-modified strain also can include strains exemplified above in relation to the description of microorganisms. That is, in an embodiment, the activity of a protein may be reduced as compared with a type strain, i.e. the type strain of the species to which the microorganism as described herein belongs. In another embodiment, the activity of a protein may also be reduced as compared with the E. coli MG1655 strain. In another embodiment, the activity of a protein may also be reduced as compared with the P. ananatis AJ13355 strain. In another embodiment, the activity of a protein may also be reduced as compared with the C. glutamicum ATCC 13869 strain. The state that the activity of a protein is reduced also can include a state that the activity of the protein has completely disappeared. More specifically, the expression the activity of a protein is reduced may mean that the number of molecules of the protein per cell is reduced, and/or the function of each molecule of the protein is reduced as compared with those of a non-modified strain. That is, the term activity in the expression the activity of a protein is reduced is not limited to the catalytic activity of the protein, but may also mean the transcription amount of a gene (i.e. the amount of mRNA) encoding the protein or the translation amount of the protein (i.e. the amount of the protein). The state that the number of molecules of the protein per cell is reduced also includes a state that the protein does not exist at all. The state that the function of each molecule of the protein is reduced also includes a state that the function of each protein molecule has completely disappeared. The degree of the reduction in the activity of a protein is not particularly limited, so long as the activity is reduced as compared with that of a non-modified strain. The activity of a protein may be reduced to, for example, 50% or less, 20% or less, 10% or less, 5% or less, or 0% of that of a non-modified strain.

[0350] The modification for reducing the activity of a protein can be attained by, for example, reducing the expression of a gene encoding the protein. The expression the expression of a gene is reduced can mean that the expression of the gene is reduced as compared with a non-modified strain such as a wild-type strain and parent strain. Specifically, the expression the expression of a gene is reduced may mean that the expression of the gene per cell is reduced as compared with that of a non-modified strain such as a wild-type strain and parent strain. More specifically, the expression the expression of a gene is reduced may mean that the transcription amount of the gene (i.e. the amount of mRNA) is reduced, and/or the translation amount of the gene (i.e. the amount of the protein expressed from the gene) is reduced. The state that the expression of a gene is reduced also can include a state that the gene is not expressed at all. The state that the expression of a gene is reduced is also referred to as the expression of a gene is attenuated. The expression of a gene may be reduced to, for example, 50% or less, 20% or less, 10% or less, 5% or less, or 0% of that of a non-modified strain.

[0351] The reduction in gene expression may be due to, for example, a reduction in the transcription efficiency, a reduction in the translation efficiency, or a combination of them. The expression of a gene can be reduced by modifying an expression control sequence of the gene such as promoter, Shine-Dalgarno (SD) sequence (also referred to as ribosome-binding site (RBS)), and spacer region between RBS and the start codon of the gene. When an expression control sequence is modified, one or more nucleotides, two or more nucleotides, or three or more nucleotides, of the expression control sequence are modified. The transcription efficiency of a gene can be reduced by, for example, replacing the promoter of the gene on a chromosome with a weaker promoter. The term weaker promoter can mean a promoter providing an attenuated transcription of a gene compared with an inherent wild-type promoter of the gene. Examples of weaker promoters can include, for example, inducible promoters. That is, an inducible promoter may function as a weaker promoter under a non-induced condition, such as in the absence of the corresponding inducer. Furthermore, a part or the whole of an expression control sequence may be deleted. The expression of a gene can also be reduced by, for example, manipulating a factor responsible for expression control. Examples of the factor responsible for expression control can include low molecules responsible for transcription or translation control (inducers, inhibitors, etc.), proteins responsible for transcription or translation control (transcription factors etc.), nucleic acids responsible for transcription or translation control (siRNA etc.), and so forth. Furthermore, the expression of a gene can also be reduced by, for example, introducing a mutation that reduces the expression of the gene into the coding region of the gene. For example, the expression of a gene can be reduced by replacing a codon in the coding region of the gene with a synonymous codon used less frequently in a host. Furthermore, for example, the gene expression may be reduced due to disruption of a gene as described later.

[0352] The modification for reducing the activity of a protein can also be attained by, for example, disrupting a gene encoding the protein. The expression a gene is disrupted can mean that a gene is modified so that a protein that can normally function is not produced. The state that a protein that normally functions is not produced can include a state that the protein is not produced at all from the gene, and a state that the protein of which the function (such as activity or property) per molecule is reduced or eliminated is produced from the gene.

[0353] Disruption of a gene can be attained by, for example, deleting the gene on a chromosome. The term deletion of a gene can refer to deletion of a partial or the entire region of the coding region of the gene. Furthermore, the whole of a gene including sequences upstream and downstream from the gene on a chromosome may be deleted. The region to be deleted may be any region such as an N-terminus region, an internal region, or a C-terminus region, so long as the activity of the protein can be reduced. Deletion of a longer region can usually more surely inactivate the gene. The region to be deleted may be, for example, a region having a length of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the total length of the coding region of the gene. Furthermore, the reading frames of the sequences upstream and downstream from the region to be deleted do not have to be the same.

[0354] Disruption of a gene can also be attained by, for example, introducing a mutation for an amino acid substitution (missense mutation), a stop codon (nonsense mutation), a frame shift mutation which adds or deletes one or two nucleotide residues, or the like into the coding region of the gene on a chromosome (Journal of Biological Chemistry, 272:8611-8617 (1997); Proceedings of the National Academy of Sciences, USA, 95 5511-5515 (1998); Journal of Biological Chemistry, 26 116, 20833-20839 (1991)).

[0355] Disruption of a gene can also be attained by, for example, inserting another sequence into a coding region of the gene on a chromosome. Site of the insertion may be in any region of the gene, and insertion of a longer region can usually more surely inactivate the gene. The reading frames of the sequences upstream and downstream from the insertion site do not have to be the same. The other sequence is not particularly limited so long as a sequence that reduces or eliminates the activity of the encoded protein is chosen, and examples thereof can include, for example, a marker gene such as antibiotic resistance genes, and a gene useful for production of an objective substance.

[0356] Such modification of a gene on a chromosome as described above can be attained by, for example, preparing a deficient type gene modified so that it is unable to produce a protein that normally functions, and transforming a host with a recombinant DNA containing the deficient type gene to cause homologous recombination between the deficient type gene and the wild-type gene on a chromosome and thereby substitute the deficient type gene for the wild-type gene on the chromosome. In this procedure, if a marker gene selected according to the characteristics of the host such as auxotrophy is included in the recombinant DNA, the operation becomes easier. Examples of the deficient-type gene can include a gene including deletion of all or a part of the gene, gene including a missense mutation, gene including a nonsense mutation, gene including a frame shift mutation, and gene including insertion of a transposon or marker gene. The protein encoded by the deficient-type gene has a conformation different from that of the wild-type protein, even if it is produced, and thus the function thereof is reduced or eliminated. Such gene disruption based on gene substitution utilizing homologous recombination has already been established, and there are methods of using a linear DNA such as a method called Red driven integration (Datsenko, K. A, and Wanner, B. L., Proc. Natl. Acad. Sci. USA, 97:6640-6645 (2000)), and a method utilizing the Red driven integration in combination with an excision system derived from phage (Cho, E. H., Gumport, R. I., Gardner, J. F., J. Bacteriol., 184:5200-5203 (2002)) (refer to WO2005/010175), a method of using a plasmid having a temperature sensitive replication origin, a method of using a plasmid capable of conjugative transfer, a method of utilizing a suicide vector not having a replication origin that functions in a host (U.S. Pat. No. 6,303,383, Japanese Patent Laid-open (Kokai) No. 05-007491), and so forth.

[0357] Modification for reducing activity of a protein can also be attained by, for example, a mutagenesis treatment. Examples of the mutagenesis treatment can include irradiation of X-ray or ultraviolet and treatment with a mutation agent such as N-methyl-N-nitro-N-nitrosoguanidine (MNNG), ethyl methanesulfonate (EMS), and methyl methanesulfonate (MMS).

[0358] When a protein functions as a complex that is made up of a plurality of subunits, some or all of the subunits may be modified, so long as the activity of the protein is eventually reduced. That is, for example, some or all of the genes that encode the respective subunits may be disrupted or the like. Furthermore, when there is a plurality of isozymes of a protein, a part or all of the activities of the plurality of isozymes may be reduced, so long as the activity of the protein is eventually reduced. That is, for example, a part or all of a plurality of genes that encode the respective isozymes may be disrupted or the like.

[0359] A reduction in the activity of a protein can be confirmed by measuring the activity of the protein.

[0360] A reduction in the activity of a protein can also be confirmed by confirming a reduction in the expression of a gene encoding the protein. A reduction in the expression of a gene can be confirmed by confirming a reduction in the transcription amount of the gene or a reduction in the amount of the protein expressed from the gene.

[0361] A reduction in the transcription amount of a gene can be confirmed by comparing the amount of mRNA transcribed from the gene with that of a non-modified strain. Examples of the method for evaluating the amount of mRNA can include Northern hybridization, RT-PCR, and so forth (Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (USA), 2001). The amount of mRNA can be reduced to, for example, 50% or less, 20% or less, 10% or less, 5% or less, or 0% of that of a non-modified strain.

[0362] A reduction in the amount of a protein can be confirmed by Western blotting using antibodies (Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (USA) 2001). The amount of the protein can be reduced to, for example, 50% or less, 20% or less, 10% or less, 5% or less, or 0% of that of a non-modified strain.

[0363] Disruption of a gene can be confirmed by determining nucleotide sequence of a part or the whole of the gene, restriction enzyme map, full length, or the like of the gene depending on the means used for the disruption.

[0364] The aforementioned methods for reducing the activity of a protein as mentioned above can be applied to reduction in the activities of arbitrary proteins such as an enzyme that catalyzes a reaction branching away from the biosynthesis pathway of an objective L-amino acid to generate a compound other than the objective L-amino acid, and reduction in the expression of arbitrary genes such as genes encoding those arbitrary proteins.

[0365] <2> Method

[0366] <2-1> Method for Producing L-Amino Acid

[0367] An embodiment of the method as described herein (also referred to as first embodiment of the method) is a method for producing an L-amino acid including the steps of culturing the bacterium as described herein in a medium (a culture medium) to accumulate an L-amino acid in the medium, and collecting the L-amino acid from the medium. In the first embodiment of the method, one kind of L-amino acid may be produced, or two or more kinds of L-amino acids may be produced.

[0368] The medium is not particularly limited, so long as the bacterium as described herein can proliferate in it, and an objective L-amino acid can be produced. As the medium, for example, a usual medium used for culture of bacteria such as coryneform bacteria and Enterobacteriaceae bacteria can be used. As the medium, for example, a medium containing carbon source, nitrogen source, phosphorus source, and sulfur source, as well as components selected from other various organic components and inorganic components as required can be used. Types and concentrations of the medium components can be appropriately determined according to various conditions such as the type of chosen bacterium.

[0369] Specific examples of the carbon source can include, for example, saccharides such as glucose, fructose, sucrose, lactose, galactose, xylose, arabinose, blackstrap molasses, hydrolysates of starches, and hydrolysates of biomass, organic acids such as acetic acid, fumaric acid, citric acid, and succinic acid, alcohols such as glycerol, crude glycerol, and ethanol, and aliphatic acids. As the carbon source, plant-derived materials can be used. Examples of the plant can include, for example, corn, rice, wheat, soybean, sugarcane, beet, and cotton. Examples of the plant-derived materials can include, for example, organs such as root, stem, trunk, branch, leaf, flower, and seed, plant bodies including them, and decomposition products of these plant organs. The forms of the plant-derived materials at the time of use thereof are not particularly limited, and they can be used in any form such as unprocessed product, juice, ground product, and purified product. Pentoses such as xylose, hexoses such as glucose, or mixtures of them can be obtained from, for example, plant biomass, and used. Specifically, these saccharides can be obtained by subjecting a plant biomass to such a treatment as steam treatment, hydrolysis with concentrated acid, hydrolysis with diluted acid, hydrolysis with an enzyme such as cellulase, and alkaline treatment. Since hemicellulose is generally more easily hydrolyzed compared with cellulose, hemicellulose in a plant biomass may be hydrolyzed beforehand to liberate pentoses, and then cellulose may be hydrolyzed to generate hexoses. Furthermore, xylose may be supplied by conversion from hexoses by, for example, imparting a pathway for converting hexose such as glucose to xylose to the bacterium as described herein. As the carbon source, a single kind of carbon source may be used, or two or more kinds of carbon sources may be used in combination.

[0370] Specific examples of the nitrogen source can include, for example, ammonium salts such as ammonium sulfate, ammonium chloride, and ammonium phosphate, organic nitrogen sources such as peptone, yeast extract, meat extract, and soybean protein decomposition products, ammonia, and urea. Ammonia gas or aqueous ammonia used for adjusting pH may also be used as the nitrogen source. As the nitrogen source, a single kind of nitrogen source may be used, or two or more kinds of nitrogen sources may be used in combination.

[0371] Specific examples of the phosphate source can include, for example, phosphoric acid salts such as potassium dihydrogenphosphate and dipotassium hydrogenphosphate, and phosphoric acid polymers such as pyrophosphoric acid. As the phosphate source, a single kind of phosphate source may be used, or two or more kinds of phosphate sources may be used in combination.

[0372] Specific examples of the sulfur source can include, for example, inorganic sulfur compounds such as sulfates, thiosulfates, and sulfites, and sulfur-containing amino acids such as cysteine, cystine, and glutathione. As the sulfur source, a single kind of sulfur source may be used, or two or more kinds of sulfur sources may be used in combination.

[0373] Specific examples of other various organic components and inorganic components can include, for example, inorganic salts such as sodium chloride and potassium chloride; trace metals such as iron, manganese, magnesium, and calcium; vitamins such as vitamin B1, vitamin B2, vitamin B6, nicotinic acid, nicotinamide, and vitamin B12; amino acids; nucleic acids; and organic components containing those such as peptone, casamino acid, yeast extract, and soybean protein decomposition product. As other various organic components and inorganic components, a single kind of component may be used, or two or more kinds of components may be used in combination.

[0374] Furthermore, when an auxotrophic mutant that requires an amino acid or the like for growth thereof is used, the required nutrient can be added to the medium. For example, in many of L-lysine-producing bacteria, the L-lysine biosynthetic pathway is enhanced and the L-lysine decomposition ability is attenuated. When such an L-lysine-producing bacterium is cultured, for example, L-threonine, L-homoserine, L-isoleucine, and/or L-methionine can be added to the medium.

[0375] Furthermore, the amount of biotin can be restricted in the medium, or a surfactant or penicillin can be added to the medium.

[0376] The culture conditions are not particularly limited so long as the bacterium as described herein can proliferate, and an objective L-amino acid can be produced. The culture can be performed, for example, under usual conditions used for culturing bacteria such as coryneform bacteria and Enterobacteriaceae bacteria. The culture conditions can be appropriately set according to various conditions such as the type of bacterium that is chosen.

[0377] The culture can be performed by using a liquid medium. At the time of the culture, the bacterium cultured on a solid medium such as agar medium may be directly inoculated into a liquid medium, or the bacterium cultured in a liquid medium as seed culture may be inoculated into a liquid medium for main culture. That is, the culture may be performed separately as seed culture and main culture. In such a case, the culture conditions of the seed culture and the main culture may be or may not be the same. Amount of the bacterium contained in the medium at the time of the start of the culture is not particularly limited. The main culture may be performed by, for example, inoculating a seed culture broth to a medium for main culture at an amount of 1 to 50% (v/v).

[0378] The culture can be performed as batch culture, fed-batch culture, continuous culture, or a combination of these. The medium used at the time of the start of the culture can also be referred to as starting medium. The medium supplied to a culture system (fermentation tank) in fed-batch culture or continuous culture can also be referred to as feed medium. Furthermore, to supply a feed medium to a culture system in fed-batch culture or continuous culture can also be referred to as to feed. Furthermore, when the culture is performed separately as seed culture and main culture, for example, both the seed culture and the main culture may be performed as batch culture. Alternatively, for example, the seed culture may be performed as batch culture, and the main culture may be performed as fed-batch culture or continuous culture.

[0379] The medium components may be present in the starting medium, feed medium, or both. The components present in the starting medium may be or may not be the same as the components present in the feed medium. The concentration of each component present in the starting medium may be or may not be the same as the concentration of the component present in the feed medium. Furthermore, two or more kinds of feed media containing different types and/or different concentrations of components may be used. For example, when medium is intermittently fed a plurality of times, the types and/or concentrations of components contained in the feed media may be or may not be the same for each feeding.

[0380] The concentration of the carbon source in the medium is not particularly limited, so long as the bacterium can proliferate and produce an L-amino acid. The concentration of the carbon source in the medium may be as high as possible within such a range that production of the L-amino acid is not inhibited. The concentration of the carbon source in the medium may be, as the initial concentration (the concentration in the starting medium), for example, 1 to 30% (w/v), or 3 to 10% (w/v). Furthermore, the carbon source may be additionally supplied to the medium as required. For example, the carbon source may be additionally supplied to the medium in proportion to consumption of the carbon source accompanying progress of the fermentation.

[0381] The culture can be performed, for example, under an aerobic condition. The term aerobic condition can refer to when the dissolved oxygen concentration in the liquid medium is not lower than 0.33 ppm, which is the detection limit for the detection with an oxygen membrane electrode, or may be when the dissolved oxygen concentration in the liquid medium is not lower than 1.5 ppm. The oxygen concentration can be controlled to, for example, 5 to 50%, or about 10%, of the saturated oxygen concentration. Specifically, the culture under an aerobic condition can be performed by aeration culture, shaking culture, stirring culture, or a combination thereof. The pH of the medium may be, for example, 3 to 10, or 4.0 to 9.5. During the culture, the pH of the medium can be adjusted as required. The pH of the medium can be adjusted by using various alkaline and acidic substances such as ammonia gas, aqueous ammonia, sodium carbonate, sodium bicarbonate, potassium carbonate, potassium bicarbonate, magnesium carbonate, sodium hydroxide, calcium hydroxide, and magnesium hydroxide. The culture temperature may be, for example, 20 to 40 C., or 25 to 37 C. The culture period may be, for example, 10 to 120 hours. The culture may be continued, for example, until the carbon source contained in the medium is consumed, or until the bacterium loses the activity. By culturing the bacterium as described herein under such conditions as described above, an L-amino acid is accumulated in the medium.

[0382] For producing a basic amino acid such as L-lysine, the culture step, also called the fermentation step, may be carried out so that bicarbonate ions and/or carbonate ions serve as counter ions for the basic amino acid. Such a fermentation mode can also be referred to as carbonate fermentation. By the carbonate fermentation, a basic amino acid can be produced by fermentation while reducing the amounts of sulfate ions and/or chloride ions to be used, which have been conventionally used as counter ions for a basic amino acid.

[0383] The carbonate fermentation can be carried out, for example, as described in US2002-0025564A, EP1813677A, and Japanese Patent Laid-open (Kokai) No. 2002-65287.

[0384] Specifically, the carbonate fermentation can be carried out so that, for example, there is a culture period where 20 mM or more, 30 mM or more, or 40 mM or more, of bicarbonate ions and/or carbonate ions are present in the medium. The above-exemplified concentrations each are interpreted as the total concentration of bicarbonate ions and carbonate ions. The phrase there is a culture period where bicarbonate ions and/or carbonate ions are present in a medium at a certain concentration can mean that bicarbonate ions and/or carbonate ions are present in the medium at the certain concentration during at least a partial period of culture. That is, bicarbonate ions and/or carbonate ions may be present in the medium at the above-exemplified concentration over the whole period of culture or during a partial period of culture. The partial period is not particularly limited so long as a desired productivity of the basic amino acid is attained. The partial period may be, for example, a period of 10% or more, 20% or more, 30% or more, 50% or more, 70% or more, or 90% or more of that of the whole period of culture. When the culture is performed separately as seed culture and main culture, the term whole period of culture can refer to the whole period of the main culture. Bicarbonate ions and/or carbonate ions can be present in the medium at the above-exemplified concentration while the basic amino acid is produced. That is, for example, when the culture step includes a stage of proliferating the basic amino acid-producing bacterium (growth period) and a stage of producing the basic amino acid (production period), the bicarbonate ions and/or carbonate ions can be present in the medium at the above-exemplified concentration at least during the production period. The term growth period can refer to a period where the carbon source is utilized mainly for cell growth, and may specifically refer to a period until the time point of 3 hr, 6 hr, or 10 hr after the start of culture. The term production period can refer to a period where the carbon source is utilized mainly for production of a substance, and may specifically refer to a period from the time point of 3 hr, 6 hr, or 10 hr after the start of culture.

[0385] Bicarbonate ions and/or carbonate ions can be maintained in the medium by controlling the internal pressure of the fermentation tank to be positive, supplying carbon dioxide gas into the medium, or a combination thereof. The internal pressure of the fermentation tank during fermentation can be controlled to be positive by, for example, making the gas supply pressure higher than the exhaust pressure. If the internal pressure of the fermentation tank is controlled to be positive, the carbon dioxide gas generated by fermentation dissolves in the medium to generate bicarbonate ions and/or carbonate ions, and these can serve as counter ions for the basic amino acid. The internal pressure of the fermentation tank may specifically be, for example, 0.03 to 0.2 MPa, 0.05 to 0.15 MPa, or 0.1 to 0.3 MPa, in terms of the gage pressure (pressure difference with respect to the atmospheric pressure). Carbon dioxide gas can be supplied to the medium by, for example, bubbling pure carbon dioxide gas or a mixed gas containing carbon dioxide gas into the medium. Examples of the mixed gas containing carbon dioxide gas can include a mixed gas containing 5 volume % or more of carbon dioxide gas. The internal pressure in the fermentation tank, supply volume of carbon dioxide gas, and limited aeration volume can be appropriately set according to various conditions such as pH of the medium, bicarbonate and/or carbonate ion concentration in the medium, and ammonia concentration in the medium.

[0386] In conventional methods for producing a basic amino acid, a sufficient amount of ammonium sulfate and/or ammonium chloride is usually added to the medium as a source of counter ions for the basic amino acid, or sulfuric acid decomposition products and/or hydrochloric acid decomposition products of proteins etc. as nutrient components are added to the medium. Therefore, large amounts of sulfate ions and/or chloride ions are present in the medium, and the concentration of the weakly acidic carbonate ions is extremely low, i.e., it is at a ppm order.

[0387] On the other hand, the carbonate fermentation is characterized in that the amounts of sulfate ions and/or chloride ions to be used are reduced so that carbon dioxide gas released by a bacterium during fermentation and/or carbon dioxide gas externally supplied is dissolved in the medium, and used as counter ions for the basic amino acid. That is, in the carbonate fermentation, one of the objects is to reduce the amounts of sulfate ions and/or chloride ions to be used, and therefore, it is not necessary to add sulfate ions or chloride ions to the medium in an amount larger than that required for growth of the basic amino acid-producing bacterium. The ammonium sulfate or the like can be fed to the medium at an early stage of the culture at an amount required for growth, and the feeding is terminated in the middle of the culture. Alternatively, ammonium sulfate or the like may be fed to the medium while maintaining the balance with respect to the amounts of carbonate ions and/or bicarbonate ions dissolved in the medium. By reducing the amounts of sulfate ions and/or chloride ions, the concentrations of sulfate ions and/or chloride ions in the medium can be lowered. By lowering the concentrations of sulfate ions and/or chloride ions, the presence of bicarbonate ions and/or carbonate ions can induced more easily in the medium. That is, in the carbonate fermentation, the pH of the medium for inducing the presence of bicarbonate ions and/or carbonate ions in the medium in an amount required to act as the counter ions for the basic amino acid can be suppressed to be lower compared with the conventional methods. The total molar concentration of sulfate ions and chloride ions contained in the medium may specifically be, for example, 900 mM or lower, 700 mM or lower, 500 mM or lower, 300 mM or lower, 200 mM or lower, or 100 mM or lower.

[0388] In the carbonate fermentation, the pH of the medium is not particularly limited so long as bicarbonate ions and/or carbonate ions are present in the medium at a desired concentration, and a desired productivity of the basic amino acid is attained. The pH of the medium can be appropriately set according to various conditions such as the type of bacterium to be used, bicarbonate and/or carbonate ion concentration in the medium, and ammonia concentration in the medium. The pH of the medium may be controlled to, for example, 6.5 to 9.0, or 7.2 to 9.0, during the culture. The pH of the medium may be controlled to the above-exemplified value during at least a partial period of culture. That is, the pH of the medium may be controlled to the above-exemplified value over the whole period of culture or during a partial period of culture. The descriptions concerning the culture period where bicarbonate ions and/or carbonate ions are present in a medium can be similarly applied to the partial period during which the pH of the medium is controlled. That is, for example, the pH of the medium may be controlled to the above-exemplified value during a period where the basic amino acid is produced. Furthermore, the pH of the medium may be, for example, 7.2 or higher, or 7.2 to 9.0, at the completion of culture. That is, the pH of the medium may be controlled so as to attain the above-exemplified value of pH at the completion of culture. The pH of the medium may be controlled, for example, directly by using the pH value per se as an indicator, or indirectly by controlling the total ammonia concentration (WO2006/038695).

[0389] Furthermore, the medium may contain anions other than bicarbonate ions and/or carbonate ions (also referred to as other anions). The concentrations of the other anions in the medium can be low so long as they are present in amounts required for growth of the basic amino acid-producing bacterium. Examples of the other anions can can include chloride ions, sulfate ions, phosphate ions, organic acid ions, and hydroxide ions. The total molar concentration of these other anions may specifically be, for example, 900 mM or lower, 700 mM or lower, 500 mM or lower, 300 mM or lower, 200 mM or lower, 100 mM or lower, 50 mM or lower, or 20 mM or lower.

[0390] Furthermore, the medium may contain cations other than the basic amino acid (also referred to as other cations). Examples of the other cations can include K ions, Na ions, Mg ions, and Ca ions originating in medium components. The total molar concentration of the other cations may specifically be, for example, 50% or lower, 10% or lower, 5% or lower, or 2% or lower, of the molar concentration of the total cations.

[0391] In the carbonate fermentation, the total ammonia concentration in the medium can be controlled to be a concentration at which production of the basic amino acid is not inhibited (WO2006/038695, WO2015/050234). The term total ammonia concentration can refer to the total concentration of non-dissociated ammonia (NH.sub.3) and ammonium ions (NH.sub.4.sup.+). Examples of the total ammonia concentration at which production of the basic amino acid is not inhibited can include, for example, a total ammonia concentration providing yield and/or productivity corresponding to 50% or more, 70% or more, or 90% or more, of the yield and/or productivity obtainable in the production of the basic amino acid under optimal conditions. The total ammonia concentration in the medium may specifically be, for example, 300 mM or lower, 250 mM or lower, 200 mM or lower, 100 mM or lower, or 50 mM or lower. The dissociation degree of ammonia decreases as the pH becomes higher. Non-dissociated ammonia is more toxic to bacteria compared with ammonium ions. Therefore, the upper limit of the total ammonia concentration also depends on the pH of the medium. That is, as the pH of the medium increases, the acceptable total ammonia concentration decreases. Therefore, the total ammonia concentration at which production of the basic amino acid is not inhibited can be determined for each specific pH value. However, the total ammonia concentration range that is acceptable at the highest pH level during the culture can be used as the total ammonia concentration range over the whole period of culture. The total ammonia concentration in the medium may be controlled to the above-exemplified concentration during at least a partial period of culture. That is, the total ammonia concentration in the medium may be controlled to the above-exemplified concentration over the whole period of culture or during a partial period of culture. The descriptions concerning the culture period where bicarbonate ions and/or carbonate ions are present in a medium can be similarly applied to the partial period during which the total ammonia concentration in the medium is controlled. That is, for example, the total ammonia concentration in the medium may be controlled to the above-exemplified concentration during a period where the basic amino acid is produced. Furthermore, specific examples of the partial period during which the total ammonia concentration in the medium can include a period during which the pH of the medium increases (e.g. the pH of the medium increases to 7.2 or higher) due to the shortage of counter ions such as sulfate ions and chloride ions with respect to accumulation of the basic amino acid.

[0392] The total concentration of ammonia as a source of nitrogen required for growth of the basic amino acid-producing bacterium and production of the basic amino acid is not particularly limited, and can be appropriately set, so long as depletion of ammonia does not continue during the culture, and decrease in the productivity of the basic amino acid due to the shortage of the nitrogen source does not occur. For example, the ammonia concentration can be measured over time during the culture, and if ammonia in the medium is depleted, a small amount of ammonia can be added to the medium. The ammonia concentration after the addition of ammonia may specifically be, for example, 1 mM or higher, 10 mM or higher, or 20 mM or higher, as the total ammonia concentration.

[0393] The total ammonia concentration in the medium can be controlled by, for example, using an apparatus for controlling ammonia and a method for controlling ammonia described in WO2015/050234.

[0394] Moreover, when L-glutamic acid is produced, the culture can be performed by using a liquid medium adjusted to satisfy a condition under which L-glutamic acid is precipitated, while precipitating L-glutamic acid in the medium. Examples of the condition under which L-glutamic acid is precipitated can include, for example, pH 5.0 to 4.0, pH 4.5 to 4.0, pH 4.3 to 4.0, or around pH 4.0 (EP1078989A).

[0395] Production of an L-amino acid can be confirmed by known methods used for detection or identification of compounds. Examples of such methods can include, for example, HPLC, LC/MS, GC/MS, and NMR. These methods can be independently used, or can be used in an appropriate combination.

[0396] The produced L-amino acid can be collected (harvested) from the fermentation broth by known methods used for separation and purification of compounds. Examples of such methods can include, for example, ion-exchange resin method (Nagai, H. et al., Separation Science and Technology, 39(16), 3691-3710), precipitation, membrane separation (Japanese Patent Laid-open (Kokai) No. 9-164323 and Japanese Patent Laid-open (Kokai) No. 9-173792), and crystallization (WO2008/078448 and WO2008/078646). These methods can be independently used, or can be used in an appropriate combination. The L-amino acid to be collected may be a free compound, a salt thereof, or a mixture thereof. Examples of the salt can include, for example, sulfate, hydrochloride, carbonate, ammonium salt, sodium salt, and potassium salt. When L-lysine is produced, L-lysine to be collected may specifically be, for example, free L-lysine, L-lysine sulfate, L-lysine hydrochloride, L-lysine carbonate, or a mixture of these. When L-glutamic acid is produced, L-glutamic acid to be collected may specifically be, for example, free L-glutamic acid, sodium L-glutamate (monosodium L-glutamate, MSG), ammonium L-glutamate (monoammonium L-glutamate), or a mixture of these. For example, monosodium L-glutamate (MSG) can be obtained by adding an acid to the fermentation broth to crystallize ammonium L-glutamate contained therein, and then by adding an equimolar of sodium hydroxide to the crystals. In addition, decolorization can be performed by using activated carbon before and/or after the crystallization (see, Tetsuya KAWAKITA, Industrial Crystallization for Monosodium L-Glutamate., Bulletin of the Society of Sea Water Science, Japan, Vol. 56:5). The monosodium L-glutamate crystal can be used as, for example, an umami seasoning. The monosodium L-glutamate crystal may also be used as a seasoning in combination with a nucleic acid such as sodium guanylate and sodium inosinate, which also have umami taste.

[0397] When the L-amino acid is precipitated in the medium, it can be collected by centrifugation, filtration, or the like. The L-amino acid precipitated in the medium may also be isolated together with the L-amino acid dissolving in the medium, after the L-amino acid dissolving in the medium is crystallized.

[0398] The collected L-amino acid may contain such components as bacterial cells, medium components, moisture, and by-product metabolites of the bacterium in addition to the L-amino acid. The collected L-amino acid may also be purified to a desired extent. Purity of the collected L-amino acid may be, for example, 50% (w/w) or higher, 85% (w/w) or higher, or 95% (w/w) or higher (JP1214636B, U.S. Pat. Nos. 5,431,933, 4,956,471, 4,777,051, 4,946,654, 5,840,358, 6,238,714, and US2005/0025878). The L-amino acid may also be provided as a dried granulated product containing the L-amino acid. For example, examples of methods for producing a dried granulated product containing L-lysine can include a method described in U.S. Pat. No. 7,416,740.

[0399] In addition, by culturing the bacterium under such conditions as described above, a carotenoid can be accumulated in cells of the bacterium. Specifically, when the bacterium has a carotenoid-producing ability, a carotenoid can be accumulated in cells of the bacterium by culturing the bacterium. One kind of carotenoid may be accumulated in cells of the bacterium, or two or more kinds of carotenoids may be accumulated in cells of the bacterium.

[0400] When a carotenoid is accumulated in cells of the bacterium, the cells (i.e. bacterial cells containing a carotenoid) can be collected. That is, the first embodiment of the method as described herein may further include collecting the cells (i.e. bacterial cells containing a carotenoid). That is, the first embodiment of the method as described herein can include a method for producing bacterial cells containing a carotenoid. Methods for collecting the cells from the fermentation broth are not particularly limited. The cells can be collected from the fermentation broth by known methods. Examples of methods for collecting the cells from the fermentation broth can include, for example, spontaneous precipitation, centrifugation, and filtration. These methods can be independently used, or can be used in an appropriate combination.

[0401] <2-2> Method for Producing Bacterial Cells Containing Carotenoid

[0402] As described above, when a carotenoid is accumulated in cells of the bacterium, bacterial cells containing the carotenoid can be obtained. That is, another embodiment of the method as described herein (also referred to as second embodiment of the method) is a method for producing bacterial cells containing a carotenoid including the steps of culturing the bacterium as described herein having a carotenoid-producing ability in a medium to accumulate a carotenoid in cells of the bacterium, and collecting the cells of the bacterium. One kind of carotenoid may be accumulated in the cells, or two or more kinds of carotenoids may be accumulated in the cells.

[0403] Furthermore, the bacterium can have the ability to produce L-amino acids. Hence, in the second embodiment of the method as described herein, by culturing the bacterium as described herein, an L-amino acid can be accumulated in a medium. When an L-amino acid is accumulated in the medium, the L-amino acid can be collected (harvested). That is, the second embodiment of the method as described herein may further include a step of collecting the L-amino acid from the medium. That is, the second embodiment of the method as described herein can include a method for producing an L-amino acid. In the second embodiment as described herein, one kind of L-amino acid may be produced, or two or more kinds of L-amino acids may be produced.

[0404] Conditions for carrying out the second embodiment of the method as described herein, such as medium composition, culture conditions, and methods for collecting the cells, are not particularly limited so long as bacterial cells containing a carotenoid are obtained. The descriptions concerning the conditions for carrying out the first embodiment of the method as described herein can be similarly applied to the conditions for carrying out the second embodiment of the method as described herein.

[0405] In an embodiment, the first embodiment of the method as described herein and the second embodiment of the method as described herein may be identical to each other. Specifically, when both an L-amino acid and bacterial cells containing a carotenoid are produced in the first and second embodiments of the method as described herein, both the embodiments may be identical to each other.

[0406] <3> Bacterial Cells and Use of the Same

[0407] The bacterial cells as described herein can contain a carotenoid. The bacterial cells may be cells of the bacterium containing a carotenoid. Specifically, when the bacterium has a carotenoid-producing ability, cells of the bacterium can contain a carotenoid. That is, more specifically, the bacterial cells may be cells of a bacterium, wherein the cells contain a carotenoid, the bacterium has an L-amino acid-producing ability and a carotenoid-producing ability, and the bacterium has been modified so that the activity of a carotenoid biosynthesis enzyme is increased. The bacterial cells may contain one kind of carotenoid, or two or more kinds of carotenoids. The bacterial cells can be produced by, for example, culturing the bacterium and collecting (harvesting) the cells of the bacterium. That is, the bacterial cells can be produced by, for example, the method as described herein. The amount of the carotenoid in the cells can be measured according to the usual manner. The amount of the carotenoid present in the cells can be measured by, for example, the method described in the Examples section. The bacterial cells can be used in any form such as wet cells or dry cells.

[0408] The purpose of the bacterial cells is not particularly limited. The bacterial cells can be used for, for example, in the culturing (breeding) of organisms such as aquatic organisms. Examples of aquatic organisms can include, for example, fishes and crustaceans. Specific examples of aquatic organisms can include, for example, salmon, shrimp (prawn), and seabream. The term salmon collectively can refer to fishes belonging to the family Salmonidae. Specific examples of salmon can include, for example, chum salmon (Oncorhynchus keta), sockeye salmon (Oncorhynchus nerka), coho salmon (Oncorhynchus kisutsh), Atlantic salmon (Salmo salar), king salmon (Oncorhynchus tshawytscha), and rainbow trout (Oncorhynchus mykiss).

[0409] That is, the present invention provides a feed, such as a feed for an aquatic organism, containing the bacterial cells as described herein. This feed is also referred to as feed as described herein.

[0410] The composition of the feed as described herein is not particularly limited, except that it contains the bacterial cells. The types and amounts of ingredients contained in the feed as described herein can be appropriately chosen according to various conditions such as the type and growth stage of the objective organism, and the usage scheme of the feed as described herein.

[0411] The feed as described herein may contain, for example, ingredient(s) similar to those contained in feeds such as usual feeds for aquatic organisms, in addition to the bacterial cells. Examples of such ingredient(s) can include animal feed ingredients, vegetable feed ingredients, and other various feed ingredients. Specific examples of the animal feed ingredients can include, for example, fish meal, fish soluble, powdered bone, and chicken meal. Specific examples of the vegetable feed ingredients can include, for example, cereal powder (wheat flour etc.), vegetable protein (wheat gluten, corn gluten, etc.), starch (cornstarch etc.), and vegetable oil meal (soybean meal etc.). Specific examples of the other ingredients can include, for example, amino acid fermentation meal (lysine fermentation meal, etc.), thickening agent (carboxymethylcellulose, alginic acid, etc.), yeast, eicosapentaenoic acid, and docosahexaenoic acid. Specific examples of the other ingredients also can include, for example, additives for fishery such as drugs for fishery, vitamins, and amino acids.

[0412] The amount of the bacterial cells present in the feed as described herein, for example, may be 1% (w/w) or more, 2% (w/w) or more, 3% (w/w) or more, 4% (w/w) or more, 5% (w/w) or more, 7% (w/w) or more, or 10% (w/w) or more, may be 50% (w/w) or less, 30% (w/w) or less, 20% (w/w) or less, 15% (w/w) or less, 10% (w/w) or less, 7% (w/w) or less, or 5% (w/w) or less, or may be within a range defined as a non-contradictory combination thereof, in terms of dry cell weight. Specifically, the amount of the bacterial cells present in the feed as described herein may be, for example, 1% (w/w) to 10% (w/w).

[0413] The amount of the bacterial cells present in the feed as described herein may also be, for example, such an amount that the amount of total carotenoids present in the feed as described herein comes to be within a predetermined range. The amount of total carotenoids present in the feed as described herein, for example, may be 2 mg/100 g or more, 3 mg/100 g or more, 4 mg/100 g or more, 5 mg/100 g or more, or 10 mg/100 g or more, may be 30 mg/100 g or less, 20 mg/100 g or less, 15 mg/100 g or less, 10 mg/100 g or less, or 5 mg/100 g or less, or may be within a range defined as a non-contradictory combination thereof. Specifically, the amount of total carotenoids present in the feed as described herein may be, for example, 2 mg/100 g to 10 mg/100 g.

[0414] The amount of the bacterial cells present in the feed as described herein may also be, for example, such an amount that the amount of astaxanthine present in the feed as described herein comes to be within a predetermined range. The amount of astaxanthine present in the feed as described herein, for example, may be 0.3 mg/100 g or more, 0.5 mg/100 g or more, 1 mg/100 g or more, 1.5 mg/100 g or more, 2 mg/100 g or more, or 3 mg/100 g or more, may be 20 mg/100 g or less, 15 mg/100 g or less, 10 mg/100 g or less, 5 mg/100 g or less, or 2 mg/100 g or less, or may be within a range defined as a non-contradictory combination thereof. Specifically, the amount of astaxanthine present in the feed as described herein may be, for example, 0.3 mg/100 g to 5 mg/100 g.

[0415] The feed as described herein can be produced by combining the bacterial cells and the other ingredient(s) so that the bacterial cells are present at a desired concentration in the feed. Methods for producing the feed as described herein are not particularly limited. For example, the feed as described herein can be produced by the same method as that for usual feeds for organisms using the same raw materials as those for usual feeds for organisms except that the bacterial cells are added (blended).

[0416] The form of the feed as described herein is not particularly limited, so long as it can be ingested by an objective organism. That is, the feed as described herein may be in any form such as powder, granule, crumble, pellet, cube, paste, and liquid. The feed as described herein may be produced in the form of, for example, a pellet such as dry pellet and moist pellet. The form of the feed as described herein can be appropriately chosen depending on various conditions such as the type and growth stage of the objective organism. For example, for fry, the feed in the form of powder or crumble can usually be used. For adult fish, dry pellets can usually be used.

[0417] The present invention also provides a composition for culturing (breeding) of an organism such as an aquatic organism, containing the bacterial cells as described herein. This composition is also referred to as composition as described herein.

[0418] The composition as described herein is not particularly limited, except that it includes the bacterial cells as described herein. The types and amounts of ingredients contained in the composition as described herein can be appropriately chosen according to various conditions such as the type and growth stage of the objective organism, and the usage scheme of the composition as described herein.

[0419] The composition as described herein may include only the bacterial cells as described herein, or may contain one or more other ingredients. Examples of the other ingredients can include, for example, ingredients usually used for use in foods, feeds, drugs, and so forth. Specific examples of such ingredients can include, for example, additives such as excipients, binders, disintegrants, lubricants, stabilizers, flavoring agent, odor improving agents, perfumes, diluents, and surfactants. Specific examples of the other ingredients also can include, for example, such ingredients in the feed as described herein as described above other than the bacterial cells as described herein. That is, the composition as described herein may be constituted as a feed for an aquatic organism. That is, an embodiment of the composition as described herein may be such a composition as described herein as described above. The composition as described herein may be in any form such as powder, granule, crumble, pellet, cube, paste, and liquid.

[0420] The amount of the bacterial cells present in the composition as described herein, for example, may be 1% (w/w) or more, 2% (w/w) or more, 3% (w/w) or more, 4% (w/w) or more, 5% (w/w) or more, 7% (w/w) or more, or 10% (w/w) or more, may be 100% (w/w) or less, 99.9% (w/w) or less, 70% (w/w) or less, 50% (w/w) or less, 30% (w/w) or less, 20% (w/w) or less, 15% (w/w) or less, 10% (w/w) or less, 7% (w/w) or less, or 5% (w/w) or less, or may be within a range defined as a non-contradictory combination thereof, in terms of dry cell weight.

[0421] The composition as described herein may be used, for example, in combination with a feed such as a feed for an aquatic organism. The composition as described herein may be used in combination with a feed so that, for example, the amount of the bacterial cells, total carotenoids, or astaxanthine is such an amount of the bacterial cells, total carotenoids, or astaxanthine as described above in the feed as described herein. To such a feed, the descriptions concerning the feed as described herein mentioned above can be similarly applied. When the composition as described herein is constituted as a feed, the composition as described herein itself may be used as the feed as described herein.

[0422] A method for culturing an organism such as an aquatic organism is also described, including the step of feeding the bacterial cells as described herein to the organism. By culturing an organism, the organism can be produced. That is, the term method for culturing an organism may be synonymous to method for producing an organism. By culturing an organism with feeding of the bacterial cells as described herein, the color tone of the organism can be improved. By culturing an organism with feeding of the bacterial cells as described herein, particularly, the reddish color of the organism can be enhanced. That is, the organism to be produced may be an organism having an improved color tone, or may particularly be an organism having an enhanced reddish color. The color tone and reddish color may be, for example, color tone and reddish color inside of the organism, such as those of fresh, or color tone and reddish color outside of the organism, such as those of scale or exoskeleton. Specifically, the color tone and reddish color may be improved or enhanced as compared with cases of feeding of a usual feed (i.e. a feed not added with the bacterial cells as described herein or a carotenoid).

[0423] The bacterial cells as described herein can be fed to an organism by, for example, utilizing the feed as described herein (namely, by feeding the feed as described herein). The expression to feed the feed as described herein can include not only to feed the feed as described herein prepared beforehand, but also to feed the bacterial cells as described herein and other ingredient(s) in combination so that they satisfy the requirement(s) of the feed as described herein described above. For example, the bacterial cells for addition and a feed before addition of the bacterial cells as described herein may be separately provided, and fed as a mixture prepared before or at the time of feeding, or fed separately. The feeding amount of the bacterial cells can be chosen so that, for example, the amount of the bacterial cells, total carotenoids, or astaxanthine is such an amount of the bacterial cells, total carotenoids, or astaxanthine as described above in the feed as described herein.

[0424] The amount of feed that is fed can be appropriately chosen according to various conditions such as the type of the objective organism. The amount of feed may be, for example, the satiation amount. The feed may be fed once a day, or two or more times a day as divided portions. The feed may also be fed once over several days. The amount of the feed fed at the time of each feeding may or may not be constant in terms of the amount of the bacterial cells, total carotenoids, or astaxanthine. The amount of the bacterial cells, total carotenoids, or astaxanthine in the feed as described herein at the time of each feeding may or may not be constant.

[0425] The feeding period can be appropriately chosen according to various conditions such as the type of the objective organism. The feed may be continuously fed over the entire period of culturing (breeding), or may be fed only in a partial period of culturing (breeding). The term partial period may refer to, for example, a period consisting of 10% or more, 20% or more, 30% or more, 50% or more, 70% or more, or 90% or more of the entire period of culturing (breeding). The period of feeding of the feed as described herein, for example, may be 3 days or longer, one week or longer, 2 weeks or longer, 3 weeks or longer, 4 weeks or longer, 2 months or longer, or 3 months or longer, may be one year or shorter, 6 months or shorter, 4 months or shorter, 3 months or shorter, 2 months or shorter, 4 weeks or shorter, or 3 weeks or shorter, or may be within a range defined by any uncontradictory combination of these ranges. Specifically, the period of feeding of the feed may be, for example, 2 weeks to 6 months. Feeding of the feed may be repeatedly continued and interrupted for arbitrary periods and with arbitrary intervals.

[0426] Cultivation (breeding) of an organism can be performed by the same method as usual methods for culturing (breeding) organisms except that the feed is fed. The culturing (breeding) of aquatic organisms can be performed in, for example, a fish pen in the sea or fish tank on land. The term culturing can include propagation culturing in which only production of seed organism (fry production etc.) is performed, and culturing for production of adult organism (parent fish etc.).

[0427] Similarly, the bacterial cells can be fed to an organism by, for example, using the composition as described herein (namely, by feeding the composition as described herein). The composition can be fed to an organism, for example, independently or together with a feed. The descriptions concerning the feeding scheme of the feed described above can be similarly applied to feeding scheme of the composition. That is, the composition as described herein can be fed, for example, together with a feed so that the amount of the bacterial cells, total carotenoids, or astaxanthine is such that a amount of the bacterial cells, total carotenoids, or astaxanthine as described above is present in the feed.

[0428] Such descriptions concerning the feeding scheme described above may be similarly applied to any other case of feeding the bacterial cells as described herein.

EXAMPLES

[0429] Hereinafter, the present invention will be more specifically explained with reference to the following non-limiting examples.

Example 1: L-Lysine Production and Carotenoid Accumulation Using E. coli Strain Having Enhanced Expression of Carotenoid Biosynthesis Enzyme Genes (1)

[0430] In this Example, L-lysine was produced by using an L-lysine-producing strain of E. coli into which carotenoid biosynthesis enzyme genes (crtEYIB) had been introduced, and the effect of an enhanced expression of carotenoid biosynthesis enzyme genes on L-lysine production and carotenoid accumulation was evaluated.

[0431] (1) Materials

[0432] Materials used in this Example are as follows.

TABLE-US-00001 TABLE 1 <Strains used> Strain Description Escherichia coli MG1655 ATCC 47076, a wild-type strain WC196LC FERM BP-11027, also referred to as WC196cadAldc, a model strain for L-lysine production WC196LC_crtEYIB WC196LCargT::P.sub.tac_crtEYIB_Km.sup.r (present application) Pantoea ananatis SC17(0) VKPM B-9246 SC17(0)::Ptac-kdp A strain corresponding to P. ananatis SC17(0) except that attL_Km.sup.r_attR_P.sub.tac sequence has been inserted into an upstream portion of kdp operon (WO2008/090770) SC17(0)crtEX::P.sub.tac_crtE_Km.sup.r A strain corresponding to P. ananatis SC17(0) except that crtX gene has been deleted and the promoter of crtE gene has been replaced with tac promoter (present application)

TABLE-US-00002 TABLE2 <Primersused> Primer SEQIDNO NucleotideSequence(5.fwdarw.3) crtE-attL-F 1 ccgcatctttcgcgttgccgtaaatgtatccgtttataag gacagcccgatgaagcctgcttttttatactaagttggca crtE-Ptac407X-R 2 gtgtttttttgcgcagaccgtcatggcagtctccttgtgt gaaattgttatccg Ptac407X-crtE-F 3 cggataacaatttcacacaaggagacttgccatgacggtc tgcgcaaaaaaacac crtY-SD-crtE-R 4 cgcgagtccagcccccacgagaatcagatcataatgcggt tgcatagccgtctcctgtcgattaactgacggcagcgagt argT_attL_fw 5 cacaacacaatacacaacataaaaaagccattttcacttg agggttatgttgaagcctgcttttttatactaagttggca argT_crtB_rv 6 ggcgtgcaccatgatgatcattccatcaggtacagcttcc cagcgacgtactagagcgggcgctgccagagatgcgcagg

[0433] <Medium Composition>

[0434] LB medium: 10 g/L Bacto tryptone, 5 g/L yeast extract, 5 g/L NaCl, pH 7.0 (adjusted with NaOH). Agar (15 g/L) was further present in the case of an agar medium.

[0435] LBGM9 medium: the composition of LB medium was added with a minimal medium components (5 g/L glucose, 2 mM magnesium sulfate, 3 g/L potassium dihydrogen phosphate, 0.5 g/L sodium chloride, 1 g/L ammonium chloride, 6 g/L disodium hydrogen phosphate), pH 7.0 (adjusted with KOH). Agar (15 g/L) was further present in the case of an agar medium.

[0436] MS medium: 40 g/L glucose, 1 g/L MgSO.sub.4.7H.sub.2O, 24 g/L (NH.sub.4).sub.2SO.sub.4, 1 g/L KH.sub.2PO.sub.4, 2 g/L yeast extract, 10 mg/L FeSO.sub.4.7H.sub.2O, 8 mg/L MnSO.sub.4.5H.sub.2O, pH 7.0 (adjusted with KOH).

[0437] (2) Construction of Strains

[0438] (2-1) Construction of P. ananatis SC17(0)crtEX::P.sub.tac.sub._crtE_Km.sup.r

[0439] PCR was performed using the chromosomal DNA of the P. ananatis SC17(0)::Ptac-kdp strain (WO2008/090770) as the template, and primers crtE-attL-F and crtE-Ptac407X-R, to amplify a DNA fragment attL_Km.sup.r_attR_P.sub.tac (WO2008/090770), which contains a kanamycin resistance gene added with attL and attR sequences at the respective ends and the tac promoter sequence. Separately, PCR was performed using the chromosomal DNA of the P. ananatis SC17(0) strain (VKPM B-9246) as the template, and primers Ptac407X-crtE-F and crtY-SD-crtE-R, to amplify a DNA fragment containing a crtE gene. The SC17(0) strain was deposited in Russian National Collection of Industrial Microorganisms (VKPM, FGUP GosNII Genetika, Russian Federation, 117545 Moscow, Pt Dorozhny proezd, 1) on Sep. 21, 2005 under the accession number VKPM B-9246. The PCRs were performed by using PrimeSTAR GXL polymerase (Takara Bio) according to the protocol attached to the enzyme. Cross-over PCR was performed using both the obtained DNA fragments as the template, and primers crtE-attL-F and crtY-SD-crtE-R, to obtain a DNA fragment attL_Km.sup.rattR_P.sub.tac.sub._crtE, which contains a nucleotide sequence consisting of the crtE gene sequence and the attL_Km.sup.r_attR_P.sub.tac sequence ligated to the 5 end side of the crtE gene.

[0440] According to a previous report (WO2010/027022A1), the P. ananatis SC17(0) strain was transformed with attL_Km.sup.r_attR_P.sub.tac .sub._crtE by the -red method (US2006-0160191A; Datsenko, K. A, and Wanner, B. L. Proc. Natl. Acad. Sci. USA. 97:6640-6645 (2000)), and transformants were selected on LBGM9 agar medium containing 40 g/mL kanamycin. Among the obtained transformants, a strain in which the crtX gene on the crtEXYIB operon has been deleted and the promoter of crtE gene has been replaced with the tac promoter was designated as P. ananatis SC17(0)crtEX::P.sub.tac.sub._crtE_Km.sup.r strain.

[0441] (2-2) Construction of E. coli WC196LC_crtEYIB

[0442] PCR was performed using the DNA extracted from the P. ananatis SC17(0)crtEX::P.sub.tac.sub._crtE_Km.sup.r strain as the template, and primers argT_attL_fw and argT_crtB_rv, to amplify a DNA fragment attL_Km.sup.r_attR_P.sub.tac crtEYIB, which contains a nucleotide sequence consisting of the attL_Km.sup.r_attR_P.sub.tac sequence and the crtEYIB genes ligated to the downstream of the attL_Km.sup.r_attR_P.sub.tac sequence.

[0443] According to a previous report, the E. coli MG1655 strain was transformed with attL_Km.sup.r_attR_P.sub.tac crtEYIB by the -red method (US2006-0160191A; Datsenko, K. A, and Wanner, B. L. Proc. Natl. Acad. Sci. USA. 97:6640-6645 (2000)), and transformants were selected on LB agar medium containing 50 g/mL kanamycin. Among the obtained transformants, a strain in which insertion of attL_Km.sup.r_attR_P.sub.tac crtEYIB in the argT gene on the chromosome was confirmed was designated as E. coli MG1655argT::P.sub.tac .sub._crtEYIB_Km.sup.r strain.

[0444] P1 transduction was performed using the E. coli MG1655argT::P.sub.tac .sub._crtEYIB_Km.sup.r strain as the donor and an E. coli L-lysine-producing strain WC196LC (FERM BP-11027) as the recipient according to the usual manner, to obtain the E. coli WC196LCargT::P.sub.tac .sub._crtEYIB_Km.sup.r strain (hereinafter, referred to as WC196LC_crtEYIB strain), which has been introduced with carotenoid biosynthesis enzyme genes (crtEYIB).

[0445] (3) Extraction and Quantification of Carotenoids

[0446] The strains WC196LC and WC196LC_crtEYIB each were cultured on LB agar medium for 48 hr at 37 C. Cells were scraped off in an amount corresponding to about 8-cm diameter of the cultured plate, and suspended in 1 mL of sterilized water. A part of the obtained cell suspension was separated, and used for measuring dry cell weight. The remaining part of the cell suspension was centrifuged, and the obtained cells were re-suspended in an equal volume of ethanol. The cell suspension in ethanol was added with an equal volume of 0.5 mm glass beads (YGBLA05, YASUI KIKAI), and then cells were disrupted by repeating a step consisting of treating for 30 sec at 2,700 rpm and thereafter leaving at rest for 30 sec by using Multi Beads ShockerR (YASUI KIKAI) for 20 cycles. The cell disruption product was centrifuged for 2 min at 20,000g, to obtain a supernatant. The obtained supernatant was diluted twice with ethanol, and A450 was measured. The amount of carotenoids was calculated from the measured value of A450 according to the following formula (I) (Britton G., Geteral carotenoid methods., Methods. Enzymol., 111: 113-149 (1985)).


Amount of total carotenoids (g/L)=A4502/(2620100)10001000000(I)

[0447] Results are shown in Table 3. While accumulation of carotenoids was not observed for the strain WC196LC, accumulation of carotenoids was observed for the strain WC1196LC_crtEYIB.

TABLE-US-00003 TABLE 3 Accumulated amount of carotenoids in E. coli L-lysine-producing bacterium Strain Carotenoids (g/g-DCW) WC196LC N.D. WC196LC_crtEYIB 21.6 0.8 (n = 3)

[0448] (4) L-Lysine Production Culture

[0449] The strains WC196LC and WC196LC_crtEYIB each were uniformly applied to LB agar medium, and cultured for 24 hr at 37 C. Cells were scraped off in an amount corresponding to about 1-cm square of the cultured plate, and suspended in 0.5 mL of physiological saline. The turbidity at a wavelength of 620 nm (OD620) was measured for the obtained cell suspension by using a spectrophotometer U-2800 (Hitachi High-Technologies). The cell suspension was inoculated into 20 mL of MS medium contained in a 500-mL-volume Sakaguchi flask so as to obtain a final OD620 of 0.15, and 0.6 g of Japanese Pharmacopeia CaCO.sub.3 preliminarily sterilized by dry heating was added thereto. Culture was performed for about 48 hr at 37 C. with stirring at 120 rpm by using a reciprocal shaking culture apparatus. After completion of the culture, the amount of L-lysine accumulated in the medium and the amount of residual glucose in the medium were quantified by using a Biotech-analyzer AS-210 (SAKURA SI).

[0450] Results are shown in FIG. 1. The strain WC196LC_crtEYIB showed an improved L-lysine production as compared to the strain WC196LC.

Example 2: L-Lysine Production and Carotenoid Accumulation Using E. coli Strain Having Enhanced Expression of Carotenoid Biosynthesis Enzyme Genes (2)

[0451] In this Example, L-lysine production was performed by using an L-lysine-producing strain of E. coli introduced with carotenoid biosynthesis enzyme genes (crtZ and/or crtW as well as crtEYIB), and the effect of an enhanced expression of carotenoid biosynthesis enzyme genes on L-lysine production and carotenoid accumulation was evaluated.

[0452] (1) Construction of Strains

[0453] (1-1) Introduction of crtZ Gene into E. coli

[0454] The crtZ genes derived from the P. ananatis SC17 strain, Brevundimonas sp. SD-212 strain, Paracoccus sp. N81106 strain, and Alcaligenes sp. were each introduced into the chromosome of the E. coli MG1655 strain as described below.

[0455] (1-1-1) Introduction of crtZ Gene of P. ananatis SC17 Strain

[0456] PCR was performed using the chromosomal DNA of the P. ananatis SC17 strain (FERM BP-11091) as the template, and primers CrtZ-FwP-tac40 and CrtZ-RvP (SEQ ID NOS: 31 and 32), to amplify a DNA fragment containing the crtZ gene (SEQ ID NO: 21). The SC17 strain was deposited at the independent administrative agency, National Institute of Advanced Industrial Science and Technology, International Patent Organism Depository (currently independent administrative agency, National Institute of Technology and Evaluation, International Patent Organism Depositary, #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba-ken, 292-0818, Japan) on Feb. 4, 2009, and assigned an accession number of FERM BP-11091. Then, PCR was performed using the chromosomal DNA of the P. ananatis SC17(0)::Ptac-kdp strain as the template, and primers yhfK-crtZ-Fw1 and 71_Pa_rv (SEQ ID NOS: 34 and 35), to amplify a DNA fragment containing attL_Km.sup.r_attR_P.sub.tac sequence. These two kinds of PCR products obtained above were purified, and then, PCR was performed using a mixture thereof as the template, and primers yhfK-crtZ-Fw1 and Pa_crtZ_yhfK_rv (SEQ ID NOS: 34 and 36), to obtain a fragment attL_Km.sup.r_attR_P4071_crtZ(Pa). The E. coli MG1655 strain was transformed with the obtained DNA fragment by the -red method, to obtain a strain MG1655yhfK::P4071_crtZ(Pa), in which the crtZ gene derived from the P. ananatis SC17 strain was inserted into a yhfK gene region on the chromosome.

[0457] (1-1-2) Introduction of crtZ Gene of Brevundimonas sp. SD-212 Strain

[0458] The crtZ gene derived from the Brevundimonas sp. SD-212 strain (SEQ ID NO: 37) was totally-synthesized (Eurofins Genomics). PCR was performed using the obtained DNA fragment as the template, and primers 71_Bre212_crtZ_fw and Bre212_crtZ_yhfK_rv (SEQ ID NOS: 38 and 39), to amplify a DNA fragment containing the crtZ gene. Then, PCR was performed using the chromosomal DNA of the P. ananatis SC17(0)::Ptac-kdp strain as the template, and primers yhfK_P4071_fw and 71 Bre212_rv (SEQ ID NOS: 40 and 41), to amplify a DNA fragment containing attL_Km.sup.r_attR_P.sub.tac sequence. These two kinds of PCR products obtained above were purified, and then, PCR was performed using a mixture thereof as the template, and primers yhfK_P4071_fw and Bre212_crtZ_yhfK_rv (SEQ ID NOS: 40 and 39), to obtain a fragment attL_Km.sup.r_attR_P4071_crtZ(Br). The E. coli MG1655 strain was transformed with the obtained DNA fragment by the -red method, to obtain a strain MG1655yhfK::P4071_crtZ(Br), in which the crtZ gene derived from the Brevundimonas sp. SD-212 strain was inserted into a yhfK gene region on the chromosome.

[0459] (1-1-3) Introduction of crtZ Gene of Paracoccus sp. N81106 Strain

[0460] The crtZ gene derived from the Paracoccus sp. N81106 strain (SEQ ID NO: 42) was totally-synthesized (Eurofins Genomics). PCR was performed using the obtained DNA fragment as the template, and primers 71_Pc_crtZ_fw and Pc_crtZ_yhfK_rv (SEQ ID NOS: 43 and 44), to amplify a DNA fragment containing the crtZ gene. Then, PCR was performed using the chromosomal DNA of the P. ananatis SC17(0)::Ptac-kdp strain as the template, and primers yhfK_P4071_fw and 71 Pc_rv (SEQ ID NOS: 40 and 45), to amplify a DNA fragment containing attL_Km.sup.r_attR_P.sub.tac sequence. These two kinds of PCR products obtained above were purified, and then, PCR was performed using a mixture thereof as the template, and primers yhfK_P4071_fw and Pc_crtZ_yhfK_rv (SEQ ID NOS: 40 and 44), to obtain a fragment attL_Km.sup.r_attR_P.sub.4071.sub._crtZ(Pc). The E. coli MG1655 strain was transformed with the obtained DNA fragment by the -red method, to obtain a strain MG1655yhfK::P4071_crtZ(Pc), in which the crtZ gene derived from the Paracoccus sp. N81106 strain was inserted into a yhfK gene region on the chromosome.

[0461] (1-1-4) Introduction of crtZ Gene of Alcaligenes sp.

[0462] The crtZ gene derived from the Alcaligenes sp. (SEQ ID NO: 46) was totally-synthesized (Eurofins Genomics). PCR was performed using the obtained DNA fragment as the template, and primers 71_Al_crtZ_fw and Al_crtZ_yhfK_rv (SEQ ID NOS: 47 and 48), to amplify a DNA fragment containing the crtZ gene. Then, PCR was performed using the chromosomal DNA of the P. ananatis SC17(0)::Ptac-kdp strain as the template, and primers yhfK_P4071_fw and 71_Al_rv (SEQ ID NOS: 40 and 49), to amplify a DNA fragment containing attL_Km.sup.r_attR_P.sub.tac sequence. These two kinds of PCR products obtained above were purified, and then, PCR was performed using a mixture thereof as the template, and primers yhfK_P4071_fw and Al_crtZ_yhfK_rv (SEQ ID NOS: 40 and 48), to obtain a fragment attL_Km.sup.r_attR_P.sub.4071.sub._crtZ(Al). The E. coli MG1655 strain was transformed with the obtained DNA fragment by the -red method, to obtain a strain MG1655yhfK::P4071_crtZ(Al), in which the crtZ gene derived from the Alcaligenes sp. was inserted into a yhfK gene region on the chromosome.

[0463] (1-2) Construction of Plasmid pMIV-Pnlp8-crtW

[0464] The crtW gene derived from Nostoc punctiforme (codon-optimized for expression in E. coli; SEQ ID NO: 50) was totally-synthesized (Takara BIO). PCR was performed using the obtained DNA fragment as the template, and primers nlp-crtW-fw and nlp-crtW-Rv (SEQ ID NO: 51 and 52), to amplify a DNA fragment containing the crtW gene. Separately, PCR was performed using pMIV-Pnlp8 (Japanese Patent Laid-open (Kokai) No. 2010-187552) as the template, and primers pMIV-Pnlp8-Fw and pMIV-Rv (SEQ ID NO: 53 and 54), to amplify a vector fragment. These two kinds of obtained DNA fragments were mutually ligated by using In-Fusion HD Cloning Kit (Takara BIO), to obtain pMIV-Pnlp8-crtW, an expression plasmid for the crtW gene derived from Nostoc punctiforme.

[0465] (1-3) Construction of Plasmid pMW_Ptac_crtW

[0466] A DNA (SEQ ID NO: 56) consisting of tac promoter sequence, the crtW gene derived from Brevundimonas aurantiaca, and rrnB terminator sequence ligated in this order was totally-synthesized (Eurofins Genomics). The obtained DNA was cloned between BamHI (5-terminal side) and XbaI (3-terminal side) of pMW219, to obtain pMW_Ptac_crtW, an expression plasmid for the crtW gene derived from B. aurantiaca.

[0467] (1-4) Introduction of crtZ Gene and crtW Gene into E. coli L-Lysine-Producing Bacterium Having Beta-Carotene-Producing Ability

[0468] In order to remove the kanamycin resistance marker gene from the E. coli WC196LC_crtEYIB strain, which is an L-lysine-producing bacterium having beta-carotene-producing ability, the WC196LC_crtEYIB strain was transformed with pMW-int-xis (WO2007/037460 and Japanese Patent Laid-open (Kokai) No. 2005-058827) by the electroporation method. Transformants were selected by culturing on LB agar medium containing 50 mg/L ampicillin for 24 hr at 30 C. Obtained colonies of the transformants were subcultured on LB agar medium and cultured for 24 hr at 42 C. A strain sensitive to kanamycin and resistant to ampicillin was selected from obtained colonies, and designated as strain WC196LC_crtEYIB(ML).

[0469] Then, a P1 lysate was obtained from each of the strains MG1655yhfK::P4071_crtZ(Pa), MG1655yhfK::P4071_crtZ(Br), MG1655yhfK::P4071_crtZ(Pc), and MG1655yhfK::P4071_crtZ(Al), and P1 transduction was performed using the WC196LC_crtEYIB(ML) strain as the host. Transformants were selected by culturing on LB agar medium containing 40 mg/L kanamycin for 24 hr at 37 C. From the obtained transformants, there were obtained strains

WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa),
WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Br),
WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pc), and
WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Al), in which the crtZ genes derived from the P. ananatis SC17 strain, Brevundimonas sp. SD-212 strain, Paracoccus sp. N81106 strain, and Alcaligenes sp., respectively, were inserted into the chromosome.

[0470] Then, the WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa) strain was transformed with pMIV-Pnlp8-crtW and pMW_Ptac_crtW by the electroporation method, to obtain strains WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa)/pMIV-Pnlp8-crtW and WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa)/pMW_Ptac_crtW, respectively, into which the crtZ genes were introduced.

[0471] Similarly, the WC196LC strain was transformed with pMIV5JS (Japanese Patent Laid-open (Kokai) No. 2008-99668) and pMW219 by the electroporation method, to obtain vector control strains WC196LC/pMIV5JS and WC196LC/pMW219, respectively.

[0472] Hereinafter, unless otherwise stated, strains having plasmids were cultured using a medium added with the following antibiotic: 25 mg/L chloramphenicol for strains having pMIV5JS and pMIV-Pnlp8-crtW, and 50 mg/L kanamycin for strains having pMW219 and pMW_Ptac_crtW.

[0473] (2) Extraction and Quantification of Carotenoids

[0474] Carotenoids were extracted from bacterial cells with ethanol, and quantified by using HPLC. The procedure is described below.

[0475] Each strain was cultured on LB agar medium for 48 hr at 37 C. Cells were scraped off in an amount corresponding to about 8-cm diameter of the cultured plate, and suspended in 1 mL of sterilized water. A part of the obtained cell suspension was separated, and used for measuring dry cell weight. The remaining part of the cell suspension was also centrifuged, and the obtained cells were re-suspended in an equal volume of ethanol. The cell suspension in ethanol was added with an equal volume of 0.5 mm glass beads (YGBLA05, YASUI KIKAI), and then cells were disrupted by repeating a step consisting of treating for 30 sec at 2,700 rpm and thereafter leaving at rest for 30 sec by using Multi Beads Shocker (YASUI KIKAI) for 20 cycles. The cell disruption product was centrifuged for 2 min at 20,000g, to obtain a supernatant. The obtained supernatant was subjected to HPLC, to quantify the amount of carotenoids. The conditions of HPLC were as follows:

[0476] UHPLC system: solvent delivery unit LC-30AD, autosampler SIL-30AC, degasser DGU-20A5R, column oven CTO-20AC, and detector SPD-20A UV-VIS (Shimadzu Corporation);

[0477] Column: phenomenex kinetex 2.6 m C18 100A 754.6 mm (Shimadzu Corporation);

[0478] Analysis conditions:

[0479] Mobile phase, (A) Acetonitrile/H.sub.2O/Formate (43/5/2), (B) Ethyl acetate/Formate (24/1);

[0480] Gradient, 0.0 min, 0% B, 0.0-6.0 min, to 100% B, 6.0 min-7.4 min, 100% B, 7.4-9.2 min, to 0% B, 9.2-10 min, 0% B;

[0481] Flow rate, 2.0 mL/min;

[0482] Column temperature, 30 C.

[0483] (3) L-Lysine Production Culture

[0484] Each strain was uniformly applied to LB agar medium, and cultured for 24 hr at 37 C. Cells were scraped off in an amount corresponding to about 1-cm square of the cultured plate, and suspended in 1 mL of physiological saline. The turbidity at a wavelength of 620 nm (OD620) was measured for the obtained cell suspension by using a spectrophotometer U-2800 (Hitachi High-Technologies). The cell suspension was inoculated into 20 mL of MS medium contained in a 500-mL-volume Sakaguchi flask so as to obtain a final OD620 of 0.126, and 0.6 g of Japanese Pharmacopeia CaCO.sub.3 preliminarily sterilized by dry heating was added thereto. Culture was performed for about 48 hr at 37 C. with stirring at 120 rpm by using a reciprocal shaking culture apparatus. After completion of the culture, the amount of L-lysine accumulated in the medium and the amount of residual glucose in the medium were quantified by using a Biotech-analyzer AS-210 (SAKURA SI).

[0485] (4) Results

[0486] (4-1) Effect of Introduction of crtZ Gene

[0487] As a result of extraction and quantification of carotenoids, accumulation of zeaxanthin was confirmed in the strains introduced with crtEYIB genes and crtZ gene (Table 4). In addition, as a result of L-lysine production culture, the strains introduced with crtEYIB genes and crtZ gene each showed an improved L-lysine accumulation as compared to the control strain WC196LC (FIG. 2).

TABLE-US-00004 TABLE 4 Accumulated amount of carotenoids in E. coli L-lysine-producing bacterium Zeaxanthin Astaxanthin Strain (g/g-DCW) (g/g-DCW) WC196LC N.D. N.D. WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa) 34.3 4.7 N.D. WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Br) 16.2 0.6 N.D. WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pc) 17.1 1.6 N.D. WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Al) 20.9 1.4 N.D. N.D., Not Detected.

[0488] (4-2) Effect of Introduction of crtW Gene

[0489] As a result of extraction and quantification of carotenoids, accumulation of astaxanthin was confirmed in the strains introduced with crtW gene as well as crtEYIB genes and crtZ gene (Table 5). In addition, as a result of L-lysine production culture, the strains introduced with crtW gene as well as crtEYIB genes and crtZ gene each showed an improved L-lysine accumulation as compared to the corresponding vector control strain (FIG. 3).

TABLE-US-00005 TABLE 5 Accumulated amount of carotenoids in E. coli L-lysine-producing bacterium (n = 3) Zeaxanthin Astaxanthin Strain (g/g-DCW) (g/g-DCW) WC196LC/pMIV5JS N.D. N.D. WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa)/ 13.2 1.1 25.4 4.9 pMIV-Pnlp8-crtW WC196LC/pMW219 N.D. N.D. WC196LC_crtEYIB(ML)_yhfK::P4071_crtZ(Pa)/ N.D. 28.6 3.0 pMW_Ptac_crtW N.D., Not Detected.

Example 3: L-Threonine Production and Carotenoid Accumulation Using E. coli Strain Having Enhanced Expression of Carotenoid Biosynthesis Enzyme Genes

[0490] In this Example, L-threonine production was performed by using an L-threonine-producing strain of E. coli introduced with carotenoid biosynthesis enzyme genes (crtEYIB), and the effect of an enhanced expression of carotenoid biosynthesis enzyme genes on L-threonine production and carotenoid accumulation was evaluated.

[0491] (1) Construction of Strains

[0492] (1-1) Construction of pMW119-crtEYIB

[0493] PCR was performed using the chromosomal DNA of the WC196LC_crtEYIB(ML) strain as the template, and primers infu-1F and infu-2R (SEQ ID NOS: 56 and 57), to amplify a DNA fragment Ptac-crtEYIB, which contains a nucleotide sequence consisting of Ptac promoter sequence and the crtEYIB genes ligated to the downstream of the Ptac promoter sequence. PCR was performed by using PrimeSTAR MAX DNA polymerase (Takara BIO) according to the protocol attached to the enzyme. Separately, pMW119 was treated with XbaI and KpnI, and then mixed with Ptac-crtEYIB. The mixture was subjected to a reaction using In-Fusion HD Cloning Kit, to obtain pMW119-crtEYIB, an expression plasmid for the crtEYIB genes in which Ptac-crtEYIB was inserted into the pMW119 vector.

[0494] (1-2) Introduction of Carotenoid Biosynthesis Genes into E. coli L-Threonine-Producing Bacterium

[0495] The E. coli VKPM B-3996 strain (U.S. Pat. No. 5,175,107) was transformed with pMW119-crtEYIB by the electroporation method, to obtain a strain VKPM B-3996/pMW119-crtEYIB, which is an L-threonine-producing bacterium introduced with carotenoid biosynthesis genes.

[0496] Similarly, the VKPM B-3996 strain was transformed with pMW119, to obtain a vector control strain VKPM B-3996/pMW119.

[0497] Hereinafter, unless otherwise stated, these transformants were cultured using a medium added with 50 mg/L ampicillin.

[0498] (2) Extraction and Quantification of Carotenoids

[0499] Carotenoids were extracted from bacterial cells with ethanol, and quantified by using HPLC. The procedure was the same as that described in Examples 2(2).

[0500] (3) L-Threonine Production Culture

[0501] Each strain was uniformly applied to LB agar medium, and cultured for 24 hr at 37 C. Cells were scraped off in an amount corresponding to about 1-cm square of the cultured plate, and suspended in 1 mL of physiological saline. The turbidity at a wavelength of 620 nm (OD620) was measured for the obtained cell suspension by using a spectrophotometer U-2800 (Hitachi High-Technologies). The cell suspension was inoculated into 20 mL of MS medium contained in a 500-mL-volume Sakaguchi flask so as to obtain a final OD620 of 0.126, and 0.6 g of Japanese Pharmacopeia CaCO.sub.3 preliminarily sterilized by dry heating was added thereto. Culture was performed for about 48 hr at 37 C. with stirring at 120 rpm by using a reciprocal shaking culture apparatus. After completion of the culture, the amount of L-threonine accumulated in the medium was quantified by using a biosensor BF-7 (Oji Scientific Instruments).

[0502] (4) Results

[0503] As a result of extraction and quantification of carotenoids, accumulation of beta-carotene was confirmed in the strain introduced with pMW119-crtEYIB (Table 6). In addition, as a result of L-threonine production culture, the strain introduced with pMW119-crtEYIB showed an improved L-threonine accumulation as compared to the vector control strain (FIG. 4).

TABLE-US-00006 TABLE 6 Accumulated amount of carotenoids in E. coli L-threonine-producing bacterium Strain beta-carotene (g/g-DCW) VKPM B-3996/pMW119 N.D. VKPM B-3996/pMW119-crtEYIB 37.5 1.6 N.D., Not Detected.

Example 4: L-Lysine Production and Carotenoid Accumulation Using C. Glutamicum Strain Having Enhanced Expression of Carotenoid Biosynthesis Enzyme Genes

[0504] In this Example, L-lysine production was performed by using an L-lysine-producing strain of C. glutamicum introduced with carotenoid biosynthesis enzyme genes (crtYZ), and the effect of an enhanced expression of carotenoid biosynthesis enzyme genes on L-lysine production and carotenoid accumulation was evaluated.

[0505] (1) Media Used

[0506] CM-Dex medium: 10 g/L polypeptone, 10 g/L yeast extract, 5 g/L glucose, 1 g/L KH.sub.2PO.sub.4, 3 g/L urea, 0.4 g/L MgSO.sub.4.7H.sub.2O, 0.01 g/L FeSO.sub.4.7H.sub.2O, 0.01 g/L MnSO.sub.4.5H.sub.2O, 1.2 g/L(T-N) filtrated soybean hydrolysate, pH 7.5 (adjusted with KOH). Agar (15 g/L) was further contained in the case of an agar medium.

[0507] Coryne.-Lys production medium: 100 g/L glucose, 55 g/L (NH.sub.4).sub.2SO.sub.4, 1.05 g/L(T-N) filtrated soybean hydrolysate, 1 g/L KH.sub.2PO.sub.4, 1 g/L MgSO.sub.4.7H.sub.2O, 0.01 g/L FeSO.sub.4. 7H.sub.2O, 0.01 g/L MnSO.sub.4.5H.sub.2O, 2 mg/L vitamin B1-HCl, 0.5 mg/L biotin, 5 mg/L nicotinamide, pH 7.0 (adjusted with KOH).

[0508] (2) Construction of Strains

[0509] (2-1) Construction of pVS7_PmsrA_crtYZ

[0510] A DNA (PmsrA_crtYZ; SEQ ID NO: 33) that includes an operon structure consisting of a promoter sequence of msrA gene (PmsrA) and crtY and crtZ genes derived from P. ananatis ligated to the downstream of PmsrA was totally-synthesized (Eurofins Genomics). PmsrA_crtYZ was inserted into pVS7 (WO2013/069634), to construct pVS7 PmsrA_crtYZ, an expression plasmid for the crtY and crtZ genes derived from P. ananatis. Upon insertion into pVS7, the 5-terminal and 3-terminal sides of PmsrA_crtYZ were ligated to PstI and BamHI sites of pVS7, respectively.

[0511] (2-2) Introduction of pVS7 PmsrA_crtYZ into C. glutamicum

[0512] The C. glutamicum AJ3990 strain (ATCC 31269) was transformed with pVS7_PmsrA_crtYZ by the electroporation method, and cultured on CM-Dex agar medium containing 25 mg/L spectinomycin at 31.5 C., to obtain a strain AJ3990/pVS7_PmsrA_crtYZ, which is a transformant introduced with crtY and crtZ genes derived from P. ananatis.

[0513] Similarly, the AJ3990 strain was transformed with pVS7, to obtain a vector control strain AJ3990/pVS7.

[0514] (3) Extraction and Quantification of Carotenoids

[0515] Carotenoids were extracted from bacterial cells with an ethanol/acetone mixture (ethanol:acetone=7:3), and quantified by using HPLC. The procedure is described below.

[0516] Each strain was cultured on CM-Dex agar medium for 48 hr at 31.5 C. The subsequent procedure was the same as that described in Examples 2(2), except that the ethanol/acetone mixture was used instead of ethanol.

[0517] (4) L-Lysine Production Culture

[0518] Each strain was uniformly applied to CM-Dex agar medium containing 25 mg/L spectinomycin, and cultured for 24 hr at 31.5 C. Cells were scraped off in an amount corresponding to about 1-cm square of the cultured plate, and suspended in 1 mL of physiological saline. The turbidity at a wavelength of 620 nm (OD620) was measured for the obtained cell suspension by using a spectrophotometer U-2800 (Hitachi High-Technologies). The cell suspension was inoculated into 20 mL of Coryne.-Lys production medium contained in a 500-mL-volume Sakaguchi flask so as to obtain a final OD620 of 0.126, and 1.0 g of Japanese Pharmacopeia CaCO.sub.3 preliminarily sterilized by dry heating was added thereto. Culture was performed for about 48 hr at 37 C. with stirring at 120 rpm by using a reciprocal shaking culture apparatus. After completion of the culture, the amount of L-lysine accumulated in the medium was quantified by using a Biotech-analyzer AS-210 (SAKURA SI).

[0519] (5) Results

[0520] As a result of extraction and quantification of carotenoids, accumulation of beta-carotene was confirmed in the strain introduced with pVS7 PmsrA_crtYZ, and this strain also showed an increased amount of total carotenoids as compared to the vector control strain (FIG. 5). In addition, as a result of L-lysine production culture, the strain introduced with pVS7_PmsrA_crtYZ showed an improved L-lysine accumulation as compared to the vector control strain (FIG. 6).

Example 5: L-Glutamic Acid Production and Carotenoid Accumulation Using P. Ananatis Strain Having Enhanced Expression of Carotenoid Biosynthesis Enzyme Gene(s)

[0521] In this Example, L-glutamic acid production was performed by using an L-glutamic acid-producing strain of P. ananatis having an enhanced expression of carotenoid biosynthesis enzyme gene(s) (crtE and/or crtW), and the effect of an enhanced expression of carotenoid biosynthesis enzyme gene(s) on L-glutamic acid production and carotenoid accumulation was evaluated.

[0522] (1) Medium Used

[0523] MSII medium: 40 g/L glucose, 0.5 g/L MgSO.sub.4.7H.sub.2O, 20 g/L (NH.sub.4).sub.2SO.sub.4, 2 g/L KH.sub.2PO.sub.4, 0.5 g/L NaCl, 2 g/L yeast extract, 0.25 g/L CaCl.sub.2.7H.sub.2O, 20 mg/L FeSO.sub.4.7H.sub.2O, 20 mg/L MnSO.sub.4.nH.sub.2O, 4 mL/L Trace element (0.66 g/L CaCl.sub.2.2H.sub.2O, 0.18 g/L ZnSO.sub.4.7H.sub.2O, 0.16 g/L CuSO.sub.4.5H.sub.2O, 0.15 g/L MnSO.sub.4.4H.sub.2O, 0.18 g/L CoCl.sub.2.6H.sub.2O, 0.10 g/L H.sub.3BO.sub.3, 0.30 g/L Na.sub.2MoO.sub.4), 200 mg/L L-Lys, 200 mg/L DL-Met, 200 mg/L DAP, pH 7.0 (adjusted with KOH). Japanese Pharmacopeia CaCO.sub.3 preliminarily sterilized by dry heating was added at a concentration of 50 g/L immediately before culture.

[0524] (2) Construction of Strains

[0525] (2-1) Enhanced Expression of crtE Gene

[0526] The chromosomal DNA of the P. ananatis SC17(0)crtEX::P.sub.tac .sub._crtE_Km.sup.r strain was extracted, and the P. ananatis NA1sdhA strain (Japanese Patent Laid-open (Kokai) No. 2010-041920) was transformed with this chromosomal DNA by the electroporation method. The NA1sdhA strain is an L-glutamic acid-producing strain derived from the P. ananatis AJ13601 strain (FERM BP-7207). Transformants were selected by culturing on LBGM9 agar medium containing 40 mg/L kanamycin for 24 hr at 34 C. Among the obtained strains, a strain in which insertion of the attL_Km.sup.r_attR_P.sub.tac crtE sequence was confirmed was designated as NA1sdhAcrtEX::P.sub.tac crtE_Km.sup.r strain.

[0527] (2-2) Introduction of crtW Gene

[0528] The NA1sdhAcrtEX::P.sub.tac .sub._crtE_Km.sup.r strain was transformed with pMIV_Pnlp8_crtW by the electroporation method. Transformants were selected by culturing on LBGM9 agar medium containing 25 mg/L chloramphenicol for 24 hr at 34 C., and one of them was designated as NA1sdhAcrtEX::P.sub.tac crtE_Km.sup.r/pMIV_Pnlp8_crtW strain. Similarly, the NA1sdhA strain was transformed with pMIV5JS, to obtain a vector control strain NA1sdhA/pMIV5JS.

[0529] Hereinafter, unless otherwise stated, these transformants were cultured using a medium added with 25 mg/L chloramphenicol.

[0530] (3) Extraction and Quantification of Carotenoids

[0531] Carotenoids were extracted from bacterial cells with ethanol, and quantified by using HPLC. The procedure is described below.

[0532] Each strain was cultured on LBGM9 agar medium for 48 hr at 34 C. The subsequent procedure was the same as that described in Examples 2(2).

[0533] (4) L-Glutamic Acid Production Culture

[0534] Each strain was uniformly applied to LBGM9 agar medium, and cultured for 24 hr at 34 C. Cells were scraped off in an amount corresponding to about 1-cm square of the cultured plate, inoculated into 5 mL of MSII medium contained in a large test tube, and cultured for 24 hr at 34 C. at 120 rpm. After completion of the culture, the amount of L-glutamic acid accumulated in the medium was quantified by using a Biotech-analyzer AS-210 (SAKURA SI).

[0535] (5) Results

[0536] (5-1) Effect of Enhanced Expression of crtE Gene

[0537] As a result of extraction and quantification of carotenoids, accumulation of zeaxanthin was confirmed in the strain having an enhanced expression of crtE gene (NA1sdhAcrtEX::P.sub.tac.sub._crtE_Km.sup.r strain), and this strain also showed an increased amount of total carotenoids as compared to the control strain NA1sdhA (FIG. 7). No accumulation of canthaxanthin or astaxanthin was confirmed for any strain. In addition, as a result of L-glutamic acid production culture, the strain having an enhanced expression of crtE gene (NA1sdhAcrtEX::P.sub.tac.sub._crtE_Km.sup.r strain) showed an improved L-glutamic acid accumulation as compared to the control strain NA1sdhA (FIG. 8).

[0538] (5-2) Effect of Introduction of crtW Gene

[0539] As a result of extraction and quantification of carotenoids, accumulation of canthaxanthin and astaxanthin was confirmed in the strain introduced with the crtW gene derived from N. punctiforme (NA1sdhAcrtEX::P.sub.tac.sub._crtE_Km.sup.r/pMIV_Pnlp8_crtW strain), and this strain also showed an increased amount of total carotenoids as compared to the vector control strain NA1sdhA/pMIV5JS (FIG. 9). No accumulation of zeaxanthin was confirmed for any strain. In addition, as a result of L-glutamic acid production culture, the strain introduced with the crtW gene (NA1sdhAcrtEX::P.sub.tac.sub._crtE_Km.sup.r/pMIV_Pnlp8_crtW strain) showed an improved L-glutamic acid accumulation as compared to the vector control strain NA1sdhA/pMIV5JS (FIG. 10).

Example 6: Culturing of Rainbow Trout Using Astaxanthin-Containing Bacterial Cells (1)

[0540] In this Example, astaxanthin was quantified by using a high performance chromatography (HPLC, LC-20AT, Shimadzu Corporation). The column used was Luna 3 Silica 4.6 mm150 mm. A mixture of hexane and acetone (82:18) as the mobile phase was passed through at a flow rate of 1.2 ml/min at a constant temperature, and detection was carried out at a wavelength of 470 nm. The amount of total carotenoids was quantified by extraction of the carotenoids with acetone and detection at wavelength of 478 nm using a spectrophotometer.

[0541] For test groups, a common feed for trout mainly containing fishmeal was ground, and then amino acid cells (dry cells of an L-lysine-producing strain of E. coli having an enhanced expression of astaxanthin-biosynthesis enzyme genes) in an amount of 3.3% or 5.5% were added to the feed. They were mixed, and the mixture was re-pelletized, to obtain feeds for rainbow trout of test groups (amino acid cell groups). As a positive control, the same common feed for trout after grinding was added and mixed with commercially-available synthesized astaxanthin (CAROPHYLL Pink; DSM) in such an amount that the addition amount of astaxanthin to the feed should be equal to that of the group added with 5.5% amino acid cells. The mixture was re-pelletized, to obtain a feed for rainbow trout of control group (synthesized product group). As a negative control, a feed not added with astaxanthin (control group) was prepared. This feed for control group was prepared by re-pelletizing without addition of any additive after grinding.

[0542] Results of analysis of the amounts of total carotenoids and astaxanthin in the feeds used in the experiment are shown in Table 7. The synthesized product group and the 5.5% and 3.3% amino acid cell groups showed higher amounts of total carotenoids and astaxanthin than the control group. Meanwhile, the 5.5% amino acid cell group contained almost the same amount of astaxanthin with that in the synthesized product group, and showed a higher amount of total carotenoids than the synthesized product group.

TABLE-US-00007 TABLE 7 Contained amounts of carotenoids in feeds used in the experiment Control Synthesized 5.5% amino 3.3% amino group product group acid cell group acid cell group Total 1.49 2.91 4.93 3.8 carotenoids (mg/100 g) Astaxanthin 0.26 1.84 1.79 1.39 (mg/100 g)

[0543] Two hundred and fifty (250) rainbow trout having a body weight of about 100 g were introduced into 10 water tanks (200 L) of closed recirculating system so that each tank contained 25 rainbow trout, and cultured for 3 months. Due to the limited number of the tanks, 2 tanks were used for the control group, 2 tanks were used for the synthesized product group, 3 tanks were used for the 3.3% amino acid cell group, and 3 tanks were used for the 5.5% amino acid cell group. As an evaluation item, the body weight of all individuals was measured after 1 month, 2 months, and 3 months. The mean body weight of each group during the experimental period is shown in Table 8. Four (4) individuals per tank having a body weight close to the mean value were sampled, and the color tone of fillet was measured at 2 positions, i.e. at a head-side position and a tail-side position, by using a spectrophotometer (CM-700d, Konica Minolta). The mean values thereof are shown in Table 9. The spectrophotometer enables measurement of L, brightness; a, redness; and b, yellowness, and a higher value of a indicates a higher degree of coloring of an object toward reddish color. In addition, the amounts of carotenoids and astaxanthin in fillet of the same individuals were analyzed. The mean values thereof are shown in Table 10.

[0544] No difference in the mean body weight during the experimental period was observed among the test groups (Table 8).

[0545] The a value of fillet of individuals of the 5.5% amino acid cell group was higher than that of the synthesized product group containing an equal amount of astaxanthin.

[0546] The amount of astaxanthin present in fillet of individuals of the 5.5% amino acid cell group was equal to that of the synthesized product group containing an equal amount of astaxanthin, and the amounts of total carotenoids in fillet of individuals of the 5.5% amino acid cell group was higher than that of the synthesized product group.

TABLE-US-00008 TABLE 8 Mean body weight (g) during experimental period After 1 After 2 After 3 At start month months months Control group 106.4 142.6 182.8 241.7 Synthesized product group 106.6 146.8 184.7 233.9 5.5% amino acid cell group 105.9 143.0 195.7 254.1 3.3% amino acid cell group 105.5 147.5 202.5 257.3

TABLE-US-00009 TABLE 9 Color tone of fillet 3.3% amino Control Synthesized 5.5% amino acid cell group product group acid cell group group After 1 month Head side L 51.2 48.2 47.1 49.2 a 0.6 2.3 3.8 1.9 b 4.8 8.5 7.8 6.4 Tail side L 51.3 48.8 45.5 49.0 a 1.0 4.7 7.0 4.7 b 6.5 9.4 10.5 8.8 After 2 months Head side L 48.8 47.6 47.9 47.7 a 0.1 3.5 4.1 3.1 b 6.3 6.9 7.3 7.1 Tail side L 48.0 46.0 46.3 46.4 a 1.6 6.8 7.1 5.9 b 7.0 9.0 9.7 8.5 After 3 months Head side L 51.1 47.6 43.6 44.4 a 0.4 4.0 5.5 4.6 b 6.7 7.7 7.4 7.3 Tail side L 48.4 44.9 42.8 54.4 a 2.2 7.5 8.4 7.7 b 8.0 10.8 10.3 10.1

TABLE-US-00010 TABLE 10 Amount of carotenoids in fillet 3.3% amino Control Synthesized 5.5% amino acid cell group product group acid cell group group After 1 month 0.04 0.16 0.13 0.11 Astaxanthin mg/100 g Total 0.07 0.17 0.22 0.17 carotenoids mg/100 g After 2 months Astaxanthin 0.06 0.31 0.20 0.16 mg/100 g Total 0.07 0.30 0.30 0.24 carotenoids mg/100 g After 3 months Astaxanthin 0.08 0.33 0.31 0.27 mg/100 g Total 0.10 0.34 0.46 0.40 carotenoids mg/100 g

Example 7: Culturing of Rainbow Trout Using Astaxanthin-Containing Bacterial Cells (2)

[0547] For tests, a common feed for trout mainly containing fishmeal is ground, and then amino acid cells (dry cells of an L-lysine-producing strain of E. coli having an enhanced expression of astaxanthin-biosynthesis enzyme genes) are added to the feed. They are mixed, and the mixture is re-pelletized, to obtain a feed for rainbow trout of test group (amino acid cell group). A feed blended with astaxanthin derived from Phaffia yeast (Phaffia yeast group), a feed blended with astaxanthin derived from Paracoccus (Paracoccus group), and a feed blended with astaxanthin derived from Haematococcus (Haematococcus group) are prepared by a similar manner so that the amount of astaxanthin is equal to that in the feed of the amino acid cell group, to obtain test feeds. A feed for control group is prepared by re-pelletizing without addition of any additive after grinding. 5 test groups are used: control group, amino acid cell group, Phaffia yeast group, Paracoccus group, and Haematococcus (Haematococcus group.

[0548] Two hundred and fifty (250) rainbow trout having a body weight of about 100 g are introduced into 10 water tanks (200 L) of closed recirculating system so that each tank contained 25 rainbow trout, and cultured for 3 months. 2 tanks are used for each group. As an evaluation item, the body weight of each individual trout is measured after 1 month, 2 months, and 3 months, and the mean body weights during the experimental period are compared among the groups. Four (4) individual trout per tank having a body weight close to the mean value are sampled, the color tone of each fillet is measured at 2 positions, i.e. at a head-side position and a tail-side position, by using a spectrophotometer (CM-700d, Konica Minolta), and the mean values thereof are compared.

Example 8: Culturing of Atlantic Salmon Using Astaxanthin-Containing Bacterial Cells (1)

[0549] Feed is prepared for 5 test groups: a feed for salmon without astaxanthin (control group), a feed for salmon added with 50 ppm of synthesized astaxanthin (synthesized product group), feed for salmon added with amino acid cells (dry cells of an L-lysine-producing strain of E. coli having an enhanced expression of astaxanthin-biosynthesis enzyme genes) in terms of 25, 50, and 75 ppm of astaxanthin (amino acid cell groups; 25 ppm, 50 ppm, and 75 Ppm).

[0550] Atlantic salmon having a body weight of about 200 g at the start of the test are introduced into 10 water tanks containing 850 L of seawater so that each tank contained 30 Atlantic salmon, and are cultured for 84 days. 2 tanks are used for each group. As evaluation items, the body weight and the feeding amount of the feed are measured once every 4 weeks, and the feed efficiency is calculated. In addition, Atlantic salmon are sampled once every 4 weeks, the color tone of each fillet is measured and compared by using a spectrophotometer and SalmoFan, and the amount of astaxanthin present in each fillet is measured and compared.

Example 9: Culturing of Atlantic Salmon Using Astaxanthin-Containing Bacterial Cells (2)

[0551] Feed is prepared for 6 test groups: a feed for salmon without astaxanthin (control group), a feed for salmon added with amino acid cells (dry cells of an L-lysine-producing strain of E. coli having an enhanced expression of astaxanthin-biosynthesis enzyme genes) in the optimal amount determined in Example 8 (amino acid cell group), a feed for salmon added with astaxanthin derived from Phaffia yeast (Phaffia yeast group), a feed for salmon added with astaxanthin derived from Paracoccus (Paracoccus group), and a feed for salmon added with astaxanthin derived from Haematococcus (Haematococcus group).

[0552] Atlantic salmon each having a body weight of about 200 g at the start of test are introduced into 12 water tanks containing 850 L of seawater so that each tank contained 30 Atlantic salmon, and are cultured for 84 days. 2 tanks are used for each group. As evaluation items, the body weight and the feeding amount of the feed are measured once every 4 weeks, and the feed efficiency is calculated. In addition, Atlantic salmon are sampled once every 4 weeks, the color tone of each fillet is measured and compared by using a spectrophotometer and SalmoFan, and the contained amount of astaxanthin in each fillet is measured and compared.

INDUSTRIAL APPLICABILITY

[0553] According to the present invention, an L-amino acid-producing ability of a bacterium can be improved, and an L-amino acid can be efficiently produced. In addition, in an embodiment as described herein, by allowing an L-amino acid-producing bacterium to produce a carotenoid, bacterial cells containing the carotenoid can be obtained and used as a by-product of L-amino acid production.

EXPLANATION OF SEQUENCE LISTING

[0554] SEQ ID NOS:

[0555] 1-6: Primers

[0556] 7: Nucleotide sequence of yggB gene of Corynebacterium glutamicum 2256 (ATCC 13869)

[0557] 8: Amino acid sequence of YggB protein of Corynebacterium glutamicum 2256 (ATCC 13869)

[0558] 9: Nucleotide sequence of mutant yggB gene (V419::IS) of Corynebacterium glutamicum 2256 (ATCC 13869)

[0559] 10: Amino acid sequence of protein encoded by mutant yggB gene (V419::IS) of Corynebacterium glutamicum 2256 (ATCC 13869)

[0560] 11: Nucleotide sequence of crtE gene of Pantoea ananatis AJ13355

[0561] 12: Amino acid sequence of CrtE protein of Pantoea ananatis AJ13355

[0562] 13: Nucleotide sequence of crtB gene of Pantoea ananatis AJ13355

[0563] 14: Amino acid sequence of CrtB protein of Pantoea ananatis AJ13355

[0564] 15: Nucleotide sequence of crtI gene of Pantoea ananatis AJ13355

[0565] 16: Amino acid sequence of CrtI protein of Pantoea ananatis AJ13355

[0566] 17: Nucleotide sequence of crtY gene of Pantoea ananatis AJ13355

[0567] 18: Amino acid sequence of CrtY protein of Pantoea ananatis AJ13355

[0568] 19: Nucleotide sequence of crtW gene of Nostoc sp. PCC 7120

[0569] 20: Amino acid sequence of CrtW protein of Nostoc sp. PCC 7120

[0570] 21: Nucleotide sequence of crtZ gene of Pantoea ananatis AJ13355

[0571] 22: Amino acid sequence of CrtZ protein of Pantoea ananatis AJ13355

[0572] 23: Nucleotide sequence of crtE gene of Corynebacterium glutamicum ATCC 13032

[0573] 24: Amino acid sequence of CrtE protein of Corynebacterium glutamicum ATCC 13032

[0574] 25: Nucleotide sequence of crtB gene of Corynebacterium glutamicum ATCC 13032

[0575] 26: Amino acid sequence of CrtB protein of Corynebacterium glutamicum ATCC 13032

[0576] 27: Nucleotide sequence of crtI gene of Corynebacterium glutamicum ATCC 13032

[0577] 28: Amino acid sequence of CrtI protein of Corynebacterium glutamicum ATCC 13032

[0578] 29: Nucleotide sequence of crtW gene of Brevundimonas aurantiaca

[0579] 30: Amino acid sequence of CrtW protein of Brevundimonas aurantiaca

[0580] 31-32: Primers

[0581] 33: Nucleotide sequence of PmsrA_crtYZ

[0582] 34-36: Primers

[0583] 37: Nucleotide sequence of crtZ gene of Brevundimonas sp. SD-212

[0584] 38-41: Primers

[0585] 42: Nucleotide sequence of crtZ gene of Paracoccus sp. N81106

[0586] 43-45: Primers

[0587] 46: Nucleotide sequence of crtZ gene of Alcaligenes sp.

[0588] 47-49: Primers

[0589] 50: Nucleotide sequence of crtW gene of Nostoc punctiforme (codon-optimized for expression in E. coli)

[0590] 51-54: Primers

[0591] 55: Nucleotide sequence of DNA containing crtW gene of Brevundimonas aurantiaca

[0592] 56-57: Primers

[0593] 58: Amino acid sequence of CrtZ protein of Brevundimonas sp. SD-212

[0594] 59: Amino acid sequence of CrtZ protein of Paracoccus sp. N81106

[0595] 60: Amino acid sequence of CrtZ protein of Alcaligenes sp.

[0596] 61: Amino acid sequence of CrtW protein of Nostoc punctiforme