RHABDOVIRUS-NEGATIVE SPODOPTERA FRUGIPERDA INSECT CELL LINE, AND SCREENING, IDENTIFICATION AND APPLICATION THEREOF

Abstract

The invention pertains to the technical fields of genetic engineering and cell engineering, and in particular relates to a rhabdovirus-negative Spodoptera frugiperda insect cell line, and screening, identification and application thereof. According to the invention, the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9, with a CCTCC accession number C202246, is obtained through screening and identification. The cell line is verified through various high-sensitivity test methods such as nested PCR, transcriptome next-generation sequencing, real-time fluorescence quantitative PCR and TAQMAN probe-based real-time PCR, and finally obtained the Sf-rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9. The cell is tested for sterility, mycoplasma, exogenous virus and tumorigenicity according to pharmacopeial requirements, and the results show that all indicators satisfy the requirements, and the cell can be used in or for the production of recombinant proteins and recombinant protein vaccines based on the baculovirus expression system.

Claims

1. A Rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9, with a CCTCC accession number C202246.

2. A method for producing a composition comprising a recombinant protein, said method comprising expressing the recombmant protein using the Rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-SP9 according to claim 1.

3. The method according to claim 2, where the composition is a medicine or a vaccine.

4. The method according to claim 3, wherein the medicine comprises a cytokine, a hormone, a recombinant enzyme or an antibody.

5. The method according to claim 3, wherein the medicine comprises a cytokine selected from the group consisting of a recombinant human interleukin, a recombinant human epidermal growth factor, a recombinant human interferon, a recombinant human fibroblast growth factor, a recombinant human erythropoietin and a recombinant human granulocyte macrophage stimulating factor.

6. The method according to claim 3, wherein the medicine comprises a hormone selected from the group consisting of a recombinant human growth hormone, a recombinant human insulin, an insulin analog and a recombinant human follicle maturing hormone.

7. The method according to claim 3, wherein the medicine comprises a recombinant enzyme selected from the group consisting of a recombinant human alpha-glucosidase and a recombinant human prourokinase.

8. The method according to claim 3, wherein the medicine comprises an antibody selected from the group consisting of a monoclonal antibody, a Fab antibody, a scFv antibody and a nanobody.

9. The method according to claim 3, wherein the vaccine comprises a recombinant protein vaccine or a virus-like particle vaccine.

10. The method according to claim 3, wherein the vaccine comprises a recombinant protein vaccine selected from the group consisting of a SARS-COV-2 protein vaccine, an influenza virus protein vaccine, a syncytial virus recombinant protein vaccine, a hepatitis B virus protein vaccine and a rabies virus protein vaccine.

11. The method according to claim 3, wherein the vaccine comprises a virus-like particle vaccine selected from the group consisting of a SARS-COV-2 virus-like particle vaccine, a human papillomavirus-like particle vaccine, an influenza virus-like particle vaccine, a poliovirus-like particle vaccine, a respiratory syncytial virus-like particle vaccine and a hand-foot-mouth disease virus-like particle vaccine.

12. The method according to claim 3, wherein the vaccine comprises a recombinant SARS-COV-2 protein vaccine.

13. The method according to claim 3, wherein the vaccine comprises a SARS-CoV-2 virus-like particle vaccine.

14. The method according to claim 2, wherein the composition consists of the recombinant protein.

Description

DESCRIPTION OF THE DRAWINGS

[0022] FIG. 1 shows the result of nested PCR agarose gel electrophoresis for identification of WSK-Sf9 cells according to the invention;

[0023] FIG. 2 shows the morphological characteristics of the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 obtained through screening according to the invention;

[0024] FIG. 3 shows the karyotype analysis of the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 obtained through screening according to the invention;

[0025] FIG. 4 shows a growth curve of the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 obtained through screening according to the invention;

[0026] FIG. 5 shows a continuous subculturing curve of the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 obtained through screening according to the invention;

[0027] FIG. 6 shows a time gradient test of an exogenous recombinant protein expressed by the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 obtained through screening according to the invention.

DETAILED DESCRIPTION OF THE EMBODIMENTS OF THE INVENTION

[0028] The following will explain the solutions of the present invention with reference to specific embodiments. A person skilled in the art will understand that the following embodiments are intended to illustrate the invention only and should not be considered as limiting the scope of the invention. In case that specific technologies or conditions are not specified in the embodiments, technologies or conditions described in the literature in the art or the product specification shall prevail. If a manufacturer is not indicated in reagents or instruments used, they are all conventional products that can be purchased from the commercial reagent companies.

[0029] The screening, identification and application of the rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 will be further illustrated in the following embodiments, and the invention will be further described with reference to the attached drawings.

Embodiment 1: Screening and Identification of Sf-rhabdovirus-negative Spodoptera frugiperda Insect Cell Line WSK-Sf9

[0030] The only commercially available Sf-rhabdovirus-negative Sf-RVN cells (Sf-rhabdovirus-negative Sf9) were screened from Sf9 by Prof. Jarvis' team through a limited dilution method combined with antiviral drug treatment (Maghodia AB, et al. Protein expression and purification. 2016;122:45-55.), and verified to be Sf-rhabdovirus-negative by nested PCR for an L gene, and the cells are attributed to GlycoBac (http://www.glycobac.com/sf-rvn-cells) which has entered into a partnership with Millipore/Sigma Inc. to entrust Millipore/Sigma to sell them.

[0031] According to non-patent references: Ma H, Nandakumar S, Bae EH, Chin PJ, Khan AS, the Spodoptera frugiperda Sf9 cell line is a heterogeneous population of rhabdovirus-infected and virus-negative cells: Isolation and characterization of cell clones containing rhabdovirus X-gene variants and virus-negative cell clones. According to Virology 2019;536:125-33, Spodoptera frugiperda Sf9 cell line is a heterogeneous cell population, which includes two types of cell populations: Sf-rhabdovirus-infected cells and Sf-rhabdovirus-negative cells. A single Sf-rhabdovirus-negative cell population can be obtained by the limited dilution method. According to the invention, a monoclonal cell is selected by the limited dilution method, and then Sf-rhabdovirus-negative cells are screened and identified by methods such as nested PCR, transcriptome next-generation sequencing, real-time fluorescence quantitative PCR and TAQMAN probe-based real-time PCR and the like. [0032] 1) The parental cell line of Sf9 was purchased from ThermoFisher Company (Lot No .: 2043331), and the purchased cells were defined as passage zero (PO). The passage used in this screening experiment was passage 4 (P4), and the cell culture medium was SIM SF serum-free medium (Sino Biological, Inc., MSF1). The suspended Sf9 cells were diluted in a 10-times gradient and plated onto well plates, and the cells were observed every a few days. When distinct monoclonal cells became noticeable, they were transferred to a new well plate for expansion. Then, appropriate cells were collected, total RNA was extracted, and candidate cells were preliminarily identified by a nested PCR primer (Table 1) for Sf-rhabdovirus specific M gene.

TABLE-US-00001 TABLE1 NestedPCRprimersequenceinformationforSf-rhabdovirusspecificM gene Primer amplification Primername Primersequence(5to3) zonent Sf-M-NEST-01-for AGGAGAACTCCAAAGACTCAGC(SEQIDNO.1) 3142-4426 Sf-M-NEST-01-for AAAAGGAGTCCCCACTCAGC(SEQIDNO.2) Sf-M-NEST-02-for CCACATCTCCGCTATCACCA(SEQIDNO.3) 3240-3813 Sf-M-NEST-02-rev AGGAGAAGGAGCGGTTGGA(SEQIDNO.4) [0033] 2) The candidate Sf-rhabdovirus-negative cells were continuously subcultured, and cell samples were collected and frozen at ?80? C. for later use. After 45 passages of continuous culture, the nested PCR technology was used to detect the cell samples, and the results showed that Sf-rhabdovirus M genes in P1-P45 of the WSK-Sf9 were consistently negative (FIG. 1). [0034] 3) Transcriptome next-generation sequencing: 5*10.sup.6 parental Sf9 cells and 5*10.sup.6 WSK-Sf9 cells were collected separately for next-generation sequencing, and the results showed that the RNA gene information of Sf-Rhabdovirus was detected in the transcriptome of the parental Sf9 cells (GenBank: KF947078.1), but not in that of WSK-Sf9 cells. [0035] 4) Realtime fluorescence quantitative PCR: Two pairs of quantitative PCR primers for Sf-rhabdovirus M genes were designed (Table 2), a Bio-Rad SSOFASTEVAGREENSUPERMIX kit was used for fluorescence quantitative PCR test, and the results showed that no fluorescence signal was detected in WSK-Sf9 P3 generation and P28 generation, proving that the WSK-Sf9 cells were Sf-rhabdovirus-negative (Table 3).

TABLE-US-00002 TABLE2 SpecificQ-PCRprimerforSf-rhabdovirusMgene Primer amplification Primername Primersequence(5to3) zonent SFV-M1-qPCR-for TGAAAACCTTCGCACAGCAC(SEQIDNO.5) 3566-3752 SFV-M1-qPCR-rev CGAGACCCCTTTGGACCTTT(SEQIDNO.6) SFV-M2-qPCR-for GGATTGCACGGAGCCTATCA(SEQIDNO.7) 3104-3291 SFV-M2-qPCR-rev TGCCCAAGCTAAGGAAAGGG(SEQIDNO.8)

TABLE-US-00003 TABLE 3 Q-PCR experimental data Ct value WSK-Sf9 P3 WSK-Sf9 P28 Sf9 (+) H.sub.2O(?) M1 N.D. N.D. 19.76 N.D. M1 N.D. N.D. 19.74 N.D. M1 N.D. N.D. 19.75 N.D. M2 N.D. N.D. 19.12 N.D. M2 N.D. N.D. 19.23 N.D. M2 N.D. N.D. 19.13 N.D. Note: the data in the table 3 represents the results of three replicate samples. [0036] 5) Quantitative PCR by probe method: A TAQMAN probe for Sf-rhabdovirus M genes was designed (Table 4), and the results of quantitative PCR showed that no fluorescence signal was tested in a main cell bank (MCB) and a working cell bank (WCB) of WSK-Sf9, proving that the WSK-Sf9 cells were Sf-rhabdovirus-negative (Table 5).

TABLE-US-00004 TABLE4 SpecificTAQMANprobeprimerforSf-rhabdovirusMgene Primer amplification Primername Primersequence(5to3) Modified zonent Sf-taqM-F TGACATGTGGTCTCCAACCG(SEQIDNO.9) 3783-3887 Sf-taqM-R GTATGCAGGTGGTTGAGGCT(SEQIDNO.10) Sf-taqM-pro CTCCTTCTCCTCCACCCACAT(SEQIDNO.11) 5-FAM 3-MGB

TABLE-US-00005 TABLE 5 TAQMAN Q-PCR experimental data Ct value WSK-Sf9 MCB WSK-Sf9 WCB Sf9 (+) H.sub.2O(?) N.D. N.D. 20.96 N.D. N.D. N.D. 20.53 N.D. N.D. N.D. 20.77 N.D. Note: the data in the table 5 represents the results of three replicate samples.

Embodiment 2: Growth Characteristics of Sf-rhabdovirus-negative Spodoptera frugiperda Insect Cell Line WSK-Sf9

[0037] 1) Culture characteristics of WSK-Sf9: The cell could grow in a serum-free medium at 27? C. in a way of adherence or suspension, with an average diameter in suspension growth of 16.28?0.34 ?m and morphological characteristics of WSK-Sf9 as shown in FIG. 2 [0038] 2) Karyotype analysis of WSK-Sf9: A karyotype analysis was carried out on the parental Sf9 cells, and the results showed that among 60 metaphase cells, the number of chromosomes was mainly distributed between 180-250, with an average of 215 chromosomes per cell; Meanwhile, karyotype analysis was also carried out on WSK-Sf9 cells, and the results showed that among 60 metaphase cells, the number of chromosomes was mainly distributed between 191-538, with an average of 299 chromosomes per cell (FIG. 3). This also means that the Sf-rhabdovirus-negative cell line WSK-Sf9 is different from its parental Sf9 cells. [0039] 3) WSK-Sf9 cell growth curve: WSK-Sf9 cells in logarithmic growth phase were diluted to approximately 1?10.sup.6 cells/ml and passaged into 250 ml vented shake flasks. The cultivation volume was 100 ml, and the flasks were placed in a constant temperature shaker at 27? C. for continuous cultivation. Cell density and viability were counted every 24 hours. After three different batches of cultivation, the growth curve and viability are shown in FIG. 4. The cell density reached approximately 1?10.sup.7 cells/ml after 96 hours and remained at this level for 6 days. The highest cell density approached 1.2?10.sup.7 cells/ml, and the cell viability gradually decreased from the 11th day, and the average doubling time was around 23 hours. [0040] 4) Continuous subculturing curve of WSK-Sf9 cells: WSK-Sf9 cells in logarithmic growth phase were diluted to approximately 1?10.sup.6 cells/ml and passaged into 250 ml vented shake flasks. The cultivation volume was 100 ml, and the flasks were placed in a constant temperature shaker at 27? C. for continuous cultivation. Cell density and viability were counted every 3 days, and passaging was performed. Generally, after 3 days of cultivation, the cell density could reach 6?8?10.sup.6 cells/ml, with a viability of over 98%. The continuous subculturing growth curve and viability are shown in FIG. 5. After 100 consecutive passages, the cell growth characteristics remained stable.

Embodiment 3: Safety Test of Sf-rhabdovirus-negative Spodoptera frugiperda Insect Cell Line WSK-Sf9

[0041] The following tests were conducted on WSK-Sf9 cells according to Part III of China Pharmacopoeia (Edition 2020). [0042] 1) Species identification: A DNA Barcoding method was used to detect the WSK-Sf9 cells, and the results showed that the WSK-SF9 cells were from the Spodoptera frugiperda; [0043] 2) Aseptic test: A membrane filtration method was adopted to carry out the aseptic test, and the results showed that the growth of the WSK-Sf9 cells was aseptic; [0044] 3) Mycobacterium test: A culture method was adopted to test mycobacterium, and the results showed that mycobacterium was negative; [0045] 4) Mycoplasma test: A culture method, an indicator cell culture method and a Touchdown PCR method were adopted to test mycoplasma, and the results showed that mycoplasma was negative; [0046] 5) Spiroplasma test: A fluorescence PCR method was adopted to test spiroplasma, and the results showed that spiroplasma was negative; [0047] 6) Exogenous virus test: [0048] (1) An in vitro cell observation method, an erythrocyte adsorption test and hemagglutination inhibition test were adopted to test subculturing of different cells of monkey-derived Vero cells, human MRC-5 cells, Sf9 cells, BHK-21 cells, mosquito-derived cells Aedes and Drosophila-derived cells D.Mel, and all the cells showed normal morphology and tested negative. [0049] (2) Suckling mice, adult mice and chicken embryos (5-6 days old chicken embryos and 9-11 days old chicken embryos) were inoculated by the in vivo method, and the results showed that they all satisfied the requirements. [0050] 7) Retrovirus test: No virus-like particles were found by a transmission electron microscope, a HEK293 cell inoculation subculturing infection test and chemical reagent induced virus test, and the results showed that they all satisfied the requirements; [0051] 8) The cells in bovine-derived virus test and pig-derived virus test were negative; [0052] 9) Other specific viruses were tested, including Baculoviruses, T.ni flock house virus variant (FHVvar), Rhabdoviruses, Reoviridae, Togaviruses, Flaviviruses, Bunyaviruses, Asfaviruses, Ascoviridae, Iridoviridae, Poxviridae, Baculoviridae, Poldnaviridae, Parvoviridae, Birnaviridae, Reoviridae, Picornaviralses, Dicistrovitidae, Nodaviridae and Tetraviridae; and the results showed that they were all negative and satisfied the requirements. [0053] 10) Tumorigenicity test: Experimental mice were inoculated with the WSK-Sf9 cells, and the results showed that the cells were not tumorigenic and could satisfy the requirements.

[0054] In conclusion, the Sf-rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 satisfies the requirements for all safety tests and the requirements for cellular matrices for the production of biologics.

Embodiment 4: Exogenous Recombination Protein Expressed by Sf-rhabdovirus-negative Spodoptera frugiperda Insect Cell Line WSK-Sf9

[0055] A baculovirus expression vector containing an RBD structural domain of SARS-COV-2 was constructed, and WSK-Sf9 cells were used to package the recombinant protein-expressing baculovirus. Sf9 and WSK-Sf9 cells were cultured separately; when the density reached 2.5?10.sup.6/ml, they were infected separately with viruses at a ratio of MOI=0.5.Supernatants were collected before infection (0 hr) and after infection (24.sup.th hr, 48.sup.th hr, 72.sup.nd hr, and 96.sup.th hr), which were detected by western-blot using antibodies against the His tag, and the results showed that the expression level of the recombinant protein in the WSK-Sf9 cells was up-regulated as compared to that in the Sf9 cells. After production and purification in a GMP workshop and subsequent adjuvant formulation, the recombinant protein can be used to prevent infection of SARS-COV-2. This demonstrates that the Sf-rhabdovirus-negative Spodoptera frugiperda insect cell line WSK-Sf9 can be used to express and produce exogenous recombinant proteins such as protein vaccines, and the expression level is higher than the Sf9 cells.