METHOD FOR QUANTITATIVELY CONTROLLING PLASMID COPY NUMBER IN ANTIBIOTIC-FREE PLASMID MAINTENANCE SYSTEM
20240200108 ยท 2024-06-20
Inventors
- Gyoo Yeol Jung (Gyeongsangbuk-do, KR)
- Sang Woo Seo (Seoul, KR)
- Chae Won Kang (Daegu, KR)
- Hyun Gyu Lim (Chungcheongbuk-do, KR)
Cpc classification
C12P5/026
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12P7/46
CHEMISTRY; METALLURGY
International classification
C12P7/46
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a gene expression cassette including a synthetic 5 untranslated region (5 UTR), a promoter, and a regulatory gene; a recombinant vector including a replication origin and the gene expression cassette; a recombinant microorganism which has the recombinant vector introduced thereinto and shows alleviated segregational instability and; a method for preparing a recombinant microorganism having alleviated segregational instability by introducing the recombinant vector thereinto; and a method for quantitatively controlling a plasmid copy number in a recombinant microorganism. According to the present invention, removal of infA and efp, which are genes indispensable for cells, encoding respectively for a translation initiation factor and a protein elongation factor (EF-P), from a microbial chromosome and introduction of the gene expression cassette including the regulatory gene with Escherichia coli serving as a host allow the stable maintenance of plasmids in an antibiotic-free medium without causing intercellular intrinsic variations. In addition, the precise control of expression levels of infA and efp in the recombinant microorganism by means of a promoter can lead to the quantitative control of PCN at high yield as well. Therefore, the present invention can find a broad spectrum of applications in a variety of industries producing recombinant proteins.
Claims
1. A gene expression cassette containing a synthetic 5 UTR (untranslated region), a promoter, and a regulatory gene.
2. The gene expression cassette of claim 1, wherein the regulatory gene includes at least one selected from a group consisting of iiribF, ileS, lspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, vejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, vqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, vhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, yidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, orn, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT.
3. The gene expression cassette of claim 1, wherein the promoter includes one promoter selected from a group consisting of promoters represented by SEQ ID NOs: 1 to 5.
4. The gene expression cassette of claim 1, wherein the synthetic 5 UTR is configured to down-regulate a gene.
5. The gene expression cassette of claim 1, wherein the synthetic 5 UTR includes one 5 UTR selected from a group consisting of base sequences represented by SEQ ID NOs: 54, 55, 56 and 59.
6. The gene expression cassette of claim 1, wherein the gene expression cassette further includes a target gene.
7. The gene expression cassette of claim 6, wherein the target gene includes an itaconic acid or lycopene-producing gene.
8. The gene expression cassette of claim 1, wherein the gene expression cassette further includes a terminator.
9. The gene expression cassette of claim 8, wherein the terminator is composed of a base sequence represented by SEQ ID NO: 53.
10. A recombinant vector comprising a replication origin and the gene expression cassette of claim 1.
11. The recombinant vector of claim 10, wherein the recombinant vector is a plasmid.
12. The recombinant vector of claim 11, wherein the plasmid includes the replication origin to allow the plasmid to have 1 to 600 copy numbers per cell.
13. The recombinant vector of claim 10, wherein the recombinant vector includes CloDF-13 or PMB1 as the replication origin and includes infA as a regulatory gene.
14. The recombinant vector of claim 10, wherein the recombinant vector includes CloE1 as the replication origin and includes efp as a regulatory gene.
15. A recombinant microorganism having alleviated segregational instability (segregational instability), wherein the recombinant microorganism has the recombinant vector of claim 10 introduced thereto.
16. The recombinant microorganism having alleviated segregational instability (segregational instability) of claim 15, wherein the recombinant microorganism has one or more recombinant vectors introduced thereto selected from a group consisting of the recombinant vector of claim 13 and the recombinant vector of claim 14.
17. The recombinant microorganism having alleviated segregational instability (segregational instability) of claim 15, wherein the recombinant microorganism stably maintains the number of the recombinant vectors therein.
18. The recombinant microorganism having alleviated segregational instability (segregational instability) of claim 15, wherein one or more regulatory genes selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, vejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, yqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, orn, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT on chromosomes in the recombinant microorganism are removed.
19. A method for preparing a recombinant microorganism having alleviated segregational instability (segregational instability), the method comprising introducing the recombinant vector of claim 10 thereto.
20. (a) a step of selecting a promoter having a target transcription amount based on a target plasmid copy number: (b) a step of producing a gene expression cassette, wherein the cassette includes the promoter selected in the step (a), a synthetic 5UTR, and at least one regulatory gene selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, yejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, yqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, om, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT; and (c) a step of introducing the gene expression cassette produced in the step (b) into a microorganism comprising method for quantitatively controlling a plasmid copy number in a recombinant microorganism.
21. The method for quantitatively controlling a plasmid copy number in a recombinant microorganism of claim 20, wherein the gene expression cassette further includes a target gene.
22. The method for quantitatively controlling a plasmid copy number in a recombinant microorganism of claim 20, wherein the gene expression cassette further includes a terminator.
23. The method for quantitatively controlling a plasmid copy number in a recombinant microorganism of claim 20, wherein the promoter includes one promoter selected from a group consisting of promoters represented by SEQ ID NOs: 1 to 5.
24. The method for quantitatively controlling a plasmid copy number in a recombinant microorganism of claim 20, wherein one or more regulatory genes selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, vejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, yqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, rnpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, om, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT on chromosomes in the recombinant microorganism are removed.
25. The method for quantitatively controlling a plasmid copy number in a recombinant microorganism of claim 20, wherein the method further includes culturing the recombinant microorganism in an antibiotic-free medium.
Description
DESCRIPTION OF DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
MODES OF THE INVENTION
[0026] The present invention provides a gene expression cassette containing a synthetic 5 UTR (untranslated region), a promoter and a regulatory gene.
[0027] Hereinafter, the present invention will be described in detail.
[0028] As used herein, a term regulatory gene refers to an essential gene for survival that is directly related to viability of a host cell. When the regulatory gene is expressed in a plasmid rather than a host cell chromosome, the essential gene for survival that is essential for survival of the host cell can be expressed in the plasmid. Thus, a transcription level of the plasmid can be regulated using a mechanism of regulating an expression amount of the essential gene for survival.
[0029] The gene expression cassette according to the present invention may employ a gene known as an essential gene in E. coli as the regulatory gene. Preferably, the regulatory gene may be at least one regulatory gene selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, yejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, yqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, yidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, om, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT. More preferably, the regulatory gene may include infA and efp.
[0030] As used herein, a term promoter is involved in binding of RNA polymerase to initiate transcription into a portion of DNA. Generally, the promoter refers to a sequence located upstream of and adjacent to a target gene and on a same strand as the target gene. In accordance with the present invention, the promoter may include a promoter synthesized to express the regulatory gene including at least one selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, vejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, vqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, orn, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT. The promoter is preferably a constitutive promoter. The constitutive promoter (constitutive promoter) means a promoter capable of expressing a gene at any time regardless of an external stimulus, a growth stage, or tissue characteristics. The constitutive promoter according to the present invention is used for the purpose of continuously inducing the expression of one or more regulatory genes selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, yejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, vqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, vhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, om, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT. Preferably, the constitutive promoter according to the present invention may include a promoter including a sequence set forth in SEQ ID NOS: 1 to 5. A sequence with at least 60%, preferably 70%, more preferably 80% or greater of a sequence homology with the above described sequence has a substantially homogenous function as the above described sequence and thus may be used as the constitutive promoter via appropriate addition, deletion, or substitution by the skilled person to the art. The constitutive promoter according to the present invention may preferably include, for example, J23112, J23116, J23109, J23118 and J23100 promoters, and the promoters may be purchased or synthesized. In accordance with the present invention, a degree of expression of the regulatory gene operably linked to the promoter can be selectively regulated by selecting the promoter having a desired expression intensity and using the selected promoter. This allows control of PCN, and production of a target gene.
[0031] The synthetic 5 UTR contained in the expression cassette according to the present invention is intended to down-regulate a gene. 5 UTR having a low intensity representing a predicted expression amount of 100 to 100,000 calculated from UTR Designer (doi:10.1016/j.ymben.2012.10.006, http://sbi.postech.ac.kr/utr_designer) may be used. Preferably, 5UTR having a low intensity representing a predicted expression amount of 1000 to 2000 may be employed. In accordance with the present invention, one synthetic 5UTR selected from a group consisting of base sequences represented by SEQ ID NOS: 54, 55, 56 and 59 may be used in a preferable example.
[0032] The gene expression cassette according to the present invention may further contain a target gene. The term target gene used herein refers to a gene for encoding a metabolite as a target product in a recombinant microorganism that incorporates the gene expression cassette according to the present invention. In accordance with the present invention, the target gene contained in the gene expression cassette may include a gene for encoding a substance required for mass production. In accordance with the present invention, genes for encoding itaconic acid or lycopene may be used, but the present invention is not limited thereto. The gene for encoding itaconic acid may be, but is not limited to, a cad foreign gene derived from Aspergillus terreus. Any sequence capable of achieving production of itaconic acid may be included in the sequence according to the present invention without any limitation. Further, the gene for encoding lycopene may be, but is not limited to, ispA and idi derived from Escherichia coli and crtEBI gene derived from Pantoea agglomerans. Any sequence capable of achieving the production of lycopene may be interpreted to be included in the sequences according to the present invention without any limitation.
[0033] The gene expression cassette according to the present invention may further include a terminator. The terminator contained in the gene expression cassette according to the present invention is linked to a terminal of the gene expression cassette DNA to terminate transcription of the gene expression cassette DNA. The terminator is not particularly limited and may be adopted and used appropriately by the person skilled in the art based on the promoter. In accordance with the present invention, in a preferred example, BBa_B1002 represented by SEQ ID NO: 53 was used.
[0034] Further, the present invention provides a recombinant vector containing a replication origin and the gene expression cassette.
[0035] As used herein, a term vector refers to a gene construct containing a base sequence operably linked to an appropriate regulatory sequence so that the target gene can be expressed in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, and sequences that regulate termination of transcription and translation. The recombinant vector used in accordance with the present invention may be preferably a plasmid.
[0036] In accordance with the present invention, a plasmid may be used in an unrestricted manner regardless of an origin of the plasmid. Preferably, a plasmid containing a replication origin to allow the plasmid to have 1 to 600 copy numbers per cell may be used. More preferably, a plasmid containing a replication origin to allow the plasmid to have 40 to 500 copy numbers per cell may be used.
[0037] The recombinant vector according to the present invention contains a replication origin (replicon). As long as any sequence according to the present invention allows replication of the recombinant vector, the sequence may be used as the replication origin without any limitation. According to the present invention, in a preferred embodiment, when infA is used as the regulatory gene, CloDF-13 or PMB1 may be used as the replication origin. Alternatively, CloE1 may be used as the replicon when efp was used as the regulatory gene.
[0038] Further, the recombinant vector according to the present invention may include a promoter to regulate expression of the regulatory gene to allow the recombinant vector to be used as a cloning vector capable of regulating a copy number, and a restriction enzyme site for inserting the target gene. The recombinant vector according to the present invention may include a selection marker for selection of a cell with the recombinant vector.
[0039] Further, the present invention provides a recombinant microorganism with alleviated segregational instability (segregational instability) which has the recombinant vector introduced thereto.
[0040] As used herein, the phrase alleviated segregational instability means that a microorganism into which a recombinant vector has been introduced can stably maintain the number of recombinant vectors above a certain number within a strain in a series of subcultures.
[0041] According to the present invention, a wild-type E. coli W3110 strain may be used as a preferred example of the recombinant microorganism. However, the present invention is not limited thereto. As used herein, the wild-type Escherichia coli refers to a natural form of Escherichia coli that has not been subjected to artificial gene recombination, substitution, or mutation.
[0042] The recombinant microorganism according to the present invention may be characterized in that one or more regulatory genes selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, rne, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, vejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, vqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, yidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, om, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT on chromosomes in the recombinant microorganism are removed in order to solve the segregational instability and to quantitatively regulate the number of the recombinant vectors, more preferably, the plasmid copy number, using the gene cassette introduced thereto. Preferably, one or more regulatory genes selected from a group consisting of infA and efp may be removed.
[0043] Further, the present invention provides a method for preparing the recombinant microorganism having alleviated segregational instability (segregational instability), in which the method includes a step of introducing the recombinant vector thereto.
[0044] Using the recombinant microorganism production method according to the present invention, the segregational instability can be alleviated, and the recombinant microorganisms can be produced in which the number of recombinant vectors, more preferably the plasmid copy number is quantitatively regulated using the gene cassette introduced thereto.
[0045] Further, the present invention provides a method for quantitatively controlling a plasmid copy number in a recombinant microorganism, in which the method includes: (a) a step of selecting a promoter having a target transcription amount based on a target plasmid copy number: (b) a step of producing a gene expression cassette including a promoter selected in the step (a), a synthetic 5UTR, and at least one regulatory gene selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, sec, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, rne, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, vejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, yqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, or, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT: and (c) a step of introducing the gene expression cassette produced in the step (b) into the microorganism.
[0046] In the method for quantitatively controlling a plasmid copy number in a recombinant microorganism in accordance with the present invention, it is possible to quantitatively control the plasmid copy number by selecting the promoter having the target transcription amount according to the target plasmid copy number. When the promoter having a high intensity is selected in the step (a), the plasmid copy number in the recombinant microorganism can be kept smaller. To the contrary, when selecting the promoter with a low intensity, the plasmid copy number in the recombinant microorganism can be maintained larger. Therefore, in order to control the plasmid copy number in the recombinant microorganism to the desired amount, the plasmid copy number in the recombinant microorganism may be quantitatively controlled by selecting the promoter having the target transcription amount and introducing the selected promoter into the recombinant vector.
[0047] In the method for quantitatively controlling a plasmid copy number in a recombinant microorganism in accordance with the present invention, the gene expression cassette introduced into the recombinant microorganism may further include the target gene or the terminator. Preferably, the promoter according to the present invention contained in the gene expression cassette may include a promoter including a sequence set forth in SEQ ID NOS: 1 to 5. A sequence with at least 60%, preferably 70%, more preferably 80% or greater of a sequence homology with the above described sequence has a substantially homogenous function as the above described sequence and thus may be used as the promoter via appropriate addition, deletion, or substitution by the skilled person to the art. The constitutive promoter according to the present invention may preferably include one promoter (J23112, J23116, J23109, J23118 and J23100) selected from a group consisting of promoters represented by SEQ ID NOS: 1 to 5. The promoters may be purchased or synthesized.
[0048] The method for quantitatively controlling a plasmid copy number in a recombinant microorganism in accordance with the present invention may be characterized in that one or more regulatory genes selected from a group consisting of iiribF, ileS, IspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folk, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, sec, secF, ribD, ribE, nusB, thiL, dxs, ispA, ffs, dnaX, adk, hemH, lpxH, cysS, folD, argU, mrdB, mrdA, nadD, holA, rlpB, leuS, lnt, leuW, glnS, fldA, infA, ftsK, lolA, serS, rpsA, msbA, lpxK, kdsB, mukF, mukE, mukB, asnS, fabA, serT, mviN, me, yceQ, fabD, fabG, acpP, tmk, holB, lolC, lolD, lolE, pth, prsA, ispE, lolB, hemA, prfA, prmC, kdsA, topA, ribA, fabI, tyrS, ribC, pheT, pheS, rplT, infC, thrS, nadE, gapA, yeaZ, aspS, argS, leuZ, cysT, pgsA, metG, folE, yejM, gyrA, nrdA, nrdB, folC, accD, fabB, gltX, ligA, zipA, dapE, dapA, hda, der, hisS, ispG, suhB, acpS, era, lepB, pssA, yfiO, rplS, trmD, rpsP, ffh, grpE, yfjB, serV, csrA, alaS, ispF, ispD, ftsB, eno, pyrG, lgt, prfB, fbaA, pgk, metK, vqgF, plsC, parC, parE, ribB, cca, folB, ygjD, dnaG, rpoD, infB, nusA, leuU, glmM, ftsH, obgE, rpmA, rplU, ispB, murA, kdsC, yrbK, yhbN, yhbG, rpsI, rplM, degS, mreD, mreC, mreB, accB, accC, rpoC, rpoB, rplL, rplJ, nusG, secE, glyT, thrU, coaA, birA, murB, murI, priA, ftsN, yihA, polA, hemG, hemC, hemD, proM, hisR, argX, rho, trpT, glmU, glmS, vidC, mpA, rpmH, dnaA, dnaN, gyrB, spoT, gmk, dut, dfp, rpmB, coaD, kdtA, gpsA, glyQ, glyS, ftsY, ftsE, ftsX, rpoH, asd, yrfF, trpS, rpsL, rpsG, fusA, rpsJ, rplC, rplD, rplW, rplB, rpsS, rplV, rpsC, rplP, rpmC, rpsQ, rplN, rplX, rplE, rpsN, rpsH, rplF, rplR, rpsE, rpmD, rplO, secY, rpsM, rpsK, rpsD, rpoA, rplQ, fmt, def, yrdC, ubiA, plsB, lexA, dnaB, ssb, groS, groL, efp, psd, rsgA, om, yjeE, rpsR, ppa, valS, yjgP, yjgQ, dnaC and dnaT on chromosomes in the recombinant microorganism may be removed. When the regulatory gene is removed from the chromosome in the microorganism and expressed in the plasmid, the essential gene for survival which is essential for survival of the host cell may be expressed in the plasmid. Thus, the plasmid transcription level is regulated via regulation mechanism of an expression amount of the essential gene for survival, thereby allowing quantitative regulation of the plasmid copy number in the recombinant microorganism.
[0049] When using the method to quantitatively control the plasmid copy number in the recombinant microorganism according to the present invention, it is possible to control the plasmid copy number in a stable manner when the culturing is carried out in a medium without antibiotics.
[0050] In the method for quantitatively controlling the plasmid copy number in a recombinant microorganism according to the present invention, regulation of the plasmid copy number can be controlled based on the intensity of the selected promoter. When the promoter having a high intensity is selected, the plasmid copy number in the recombinant microorganism can be kept smaller. To the contrary, when selecting the promoter with a low intensity, the plasmid copy number in the recombinant microorganism can be maintained larger. Therefore, in order to control the plasmid copy number in the recombinant microorganism to the desired amount, the plasmid copy number in the recombinant microorganism may be quantitatively controlled by selecting the promoter having the target intensity and introducing the selected promoter into the recombinant vector.
[0051] The present invention will be described in detail with reference to the following Examples. These Examples are merely illustrative of the invention and are not intended to limit the scope according to the present invention.
Strain and Plasmid as Used
[0052] Following Table 1 summarizes the strain and plasmid as used in the following examples.
TABLE-US-00001 TABLE 1 Name Related feature Source Strain Mach-T1.sup.R E. coli F.sup.??80(lacZ)?M15 ?lacX74 Invitrogen hsdR(r.sub.K-mK+) ?recA1398 endA1tonA W3110 E. coli F.sup.??.sup.?rph-1IN(rrnD, rrnE)1 ATCC27325 STG0 W3110/pCDF-eGFP Present invention STG1 W3110 ?infA::Kan.sup.R/pSTAPL_eGFPv1 Present invention STG2 W3110 ?infA::Kan.sup.R/pSTAPL_eGFPv2 Present invention STG3 W3110 ?infA::Kan.sup.R/pSTAPL_eGFPv3 Present invention STG4 W3110 ?infA::Kan.sup.R/pSTAPL_eGFPv4 Present invention STG5 W3110 ?infA::Kan.sup.R/pSTAPL_eGFPv5 Present invention STI0 W3110/pCDF-CAD Present invention STI1 W3110 ?infA::Kan.sup.R/pSTAPL_CADv1 Present invention STI2 W3110 ?infA::Kan.sup.R/pSTAPL_CADv2 Present invention STI3 W3110 ?infA::Kan.sup.R/pSTAPL_CADv3 Present invention STI4 W3110 ?infA::Kan.sup.R/pSTAPL_CADv4 Present invention STI5 W3110 ?infA::Kan.sup.R/pSTAPL_CADv5 Present invention STL0 W3110/pCDF_idi_ispA_crtEBI Prior research STL1 W3110 ?infA::Kan.sup.R/pSTAPL_LYCv1 Present invention STL2 W3110 ?infA::Kan.sup.R/pSTAPL_LYCv2 Present invention STL3 W3110 ?infA::Kan.sup.R/pSTAPL_LYCv3 Present invention STL4 W3110 ?infA::Kan.sup.R/pSTAPL_LYCv4 Present invention STL5 W3110 ?infA::Kan.sup.R/pSTAPL LYCv5 Present invention STGC0 W3110 pCDF-eGFP/pET-mCherry Present invention STGC1 W3110 ?infA Present ?efp::Kan.sup.R/pSTAPL_eGFPv1/pSTAPL_mCherry invention STG6 W3110/pUC19-eGFP Present invention STG7 W3110 ?infA::Kan.sup.R/pSTAPL_eGFPv7 Present invention Plasmid pKD46 Red recombinase expression vector, Amp.sup.R Prior research pCDF_Duet Expression vector, Sm.sup.R, cloDF13ori Novagen pFRT72.sub.variant T-vector containing kanamycin resistance gene Prior research pCDF-eGFP pCDF_Duet/P.sub.J23100-synUTR.sub.egfp-egfp-T.sub.BBa.sub.
Promoter and Primer Sequences as Used
[0053] Following Table 2 and Table 3 summarize promoter and primer sequences used in the following examples.
TABLE-US-00002 TABLE2 Actual Sequence Known measured SED Promoter in relative relative ID name Sequence(5-3) library.sup.* intensity.sup. intensity.sup.,?,? NO J23112 ctgatagctagctcagtc 1 1 1.27? 1 ctagggattatgctagc 0.20 J23109 tttacagctagctcagtc 4 106 2.26? 2 ctagggactgtgctagc 0.42 J23116 ttgacagctagctcagtc 8 396 1.00? 3 ctagggactatgctagc 0.30 J23118 ttgacggctagctcagtc 14 1429 6.41? 4 ctaggtattgtgctagc 2.60 J23100 ttgacggctagctcagtc 19 2547 7.38? 5 ctaggtacagtgctagc 2.64 .sup.*Sequences in the library represent an ascending sequence of 19 promoter intensities. .sup.The known relative intensities are based on fluorescence values (Registry of Standard Biological Parts, http://parts.igem.org/). .sup.The actual measured relative intensities were determined by dividing the amount of infA transcript of STG1-5 strain by the respective PCNs. .sup.?The actual measured relative intensity is normalized to the smallest value and the result is shown. .sup.?The difference between the known intensity of the promoter and the actually measured intensity of the promoter varies depending on the genetic background.
TABLE-US-00003 TABLE3 Primer Polynucleotide SEQ name sequence(5-3).sup.*,,,?,? IDNO C-infA-F gtggcgagtccatgttcagccg 6 C-infA-B aaacctcatgggtggcaacggg 7 D-infA-F tgccgaataatttctgggtaccacgatgcttgttttcaccacaagaatgagcatgac 8 cggcgcgatgc D-infA-B ctcgttctttctcttcgcccatcaggcggtaaaacaatcagcgactacgggctcag 9 cggatctcatgcgc O-eGFP-F2 gagagttcaGAGCTCTTGACGGCTAGCTCAGTCCTAGG 10 TACAGTGCTAGC O-eGFP-B gcatgcggctGAGCTCGCGAAAAAACCCCGCCGAAGCG 11 O-infA-F2 ctgaaaCCTCAGGTTTACAGCTAGCTCAGTCCTAGGG 12 ACTGTGCTAGC O-infA-B CCTGAGGGCGAAAAAACCCCGCCGAAGCGGGGTTT 13 TTTGCGtcagcgactacggaagacaatgcg O-infA-F1v1 ctgaaaCCTCAGGTTGACAGCTAGCTCAGTCCTAGG 14 GACTATGCTAGCgtagtactggaaatgagcatcc O-infA-F1v2 ctgaaaCCTCAGGCTGATAGCTAGCTCAGTCCTAGG 15 GATTATGCTAGCgtagtactggaaatgagcatcc O-infA-F1v3 ctgaaaCCTCAGGTTTACAGCTAGCTCAGTCCTAGGG 16 ACTGTGCTAGCgtagtactggaaatgagcatcc O-infA-F1v4 ctgaaaCCTCAGGTTGACGGCTAGCTCAGTCCTAGGT 17 ATTGTGCTAGCgtagtactggaaatgagcatcc O-infA-F1v5 ctgaaaCCTCAGGTTGACGGCTAGCTCAGTCCTAGGT 18 ACAGTGCTAGCgtagtactggaaatgagcatcc O-eGFP-F1 ctcagtcctaggtacagtgctagcatcctgcattaaaggagcatccattatggctag 19 caagggcgagg Q-pCDF-F catgttagtcatgccccgc 20 Q-pCDF-B ctcactcattaggcaccggg 21 Q-polA-F gcgagcgatccagaagatct 22 Q-polA-B gggtaaaggatgccacagaca 23 Q-infA-F ggaaatgagcatccagtatggcc 24 Q-infA-B gtagtttttgcgcattttaccggag 25 O-cad-F1 ggaattgtgagcggataacaattaaaaaaaacaaaaggagcatcacccatgacc 26 aaacagagcgcagatagca O-cad-F2 catccaGGTCTCgggTTGACAATTAATCATCGGCTCGT 27 ATAATGtgtggaattgtgagcggataacaattaaaaaaa O-cad-B1 aaaaaaaaaccccgccgaagcggggtttttttttggtgcgatttaaaccagcggac 28 ttttaaccggaca O-cad-B2 catccaGGTCTCgccaaaaaaaaaccccgccgaagcgg 29 O-pCDF-F catccaGGTCTCgttggacctcaggcatttgagaagcacac 30 O-pCDF-B catccaGGTCTCctcgaaccaggagtcgcataagggagagcgtc 31 C-efp-F ggcacacgcagggcaaaaag 32 C-efp-B ctggcagcgcgagagatgg 33 D-efp-F gagggccttatggcaacgtactatagcaacgattttcgtgctggtcttaaaccgc 34 atgaccgcgcgatgc D-efp-B ctctgacctgaataagtgatggtgcagcctgcaggccgcaccacaaccgccg 35 cgacgacaggcacatgcg O-mCherry- caggcgcgccGAGCTCTTGACGGCTAGCTCAGTCCTA 36 F1 GGTACAGTGCTAGCccctggattaaaagg O-mCherry- TGCTAGCccctggattaaaaggagcatctttaatggtttccaagggcgag 37 F2 O-mCherry-B attcgaattcGAGCTCGCGAAAAAACCCCGCCGAAGCGG 38 GGTTTTTTGCGtcattatttgtacagctcatccatgccac O-efp-F1 CTAGGGACTATGCTAGCtcctgattctcacataacccagaaaattat 39 ggcaacgtactatagcaacg O-efp-F2 cgtcggtaccctcgagTTGACAGCTAGCTCAGTCCTAGGG 40 ACTATGCTAGCtcctgattc O-efp-B ctttaccagactcgagGCGAAAAAACCCCGCCGAAGCGGGG 41 TTTTTTGCGttacttcacgcgagagacgtattc FRT2161_F ccgcatgaccgcgcgatgcgaagttcctatactctctggagaataggaacttctca 42 agatcccctcacgctgccgc FRT2161_B cgcgacgacaggcacatgcggaagttcctattctccagagagtataggaacttca 43 gagcgcttttgaagctggggtgg O-pUC19-F tttgcgtgaaaCTCGAGcgccaagcttgcatgcctgc 44 O-pUC19-B aggagtttacCCTGAGGggccagcaaaaggccaggaac 45 O-eGFP-F1v2 TGCTAGCagggtgtgcgaaaggagcatctttaatggctagcaagggcgag 46 g O-eGFP-F2v2 tttgctgaaaCCTCAGGTTGACGGCTAGCTCAGTCCTAG 47 GTATTGTGCTAGCagggtgtgcgaaaggag O-eGFP-Bv2 tagaccatttctcgagGCGAAAAAACCCCGCC 48 O-infA-F1v2 GTCCTAGGGATTATGCTAGCgtagtactggatttttgcatccagt 49 atggccaaagaagacaatattg O-infA-F2v2 cccgggtacccccgggtaccGAGCTCCTGATAGCTAGCTCA 50 GTCCTAGGGATTATGCTAGCgtag O-infA-B1v2 TCAGTGAGACCTCAGCGACTACGGAAGACAATG 51 O-infA-B2v2 agtgccacctGACGTCGCGAAAAAACCCCGCCGAAGCGG 52 GGTTTTTTGCGtcagtgagacctcagcgactac .sup.*The sequence of the italic style represents the corresponding gene sequence for recombination. .sup.The underlined lowercase letter sequence represents the 5-UTR sequence. .sup.The underlined uppercase letter sequences represent the promoter sequences. .sup.?The uppercase letter indicates the restriction enzyme sequence. .sup.?The italic styled uppercase letter indicates the terminator sequence.
Plasmid Copy Number in STAPL System
[0054] Table 4 summarizes the plasmid copy numbers in the STAPL system measured in the following examples.
TABLE-US-00004 TABLE 4 eGFP Itaconic acid Lycopene Promoter Sm Strain PCN* Strain PCN* Strain PCN* ? STG0 1 ? 0 STI0 613 ? 74 STL0 21 ? 3 + STG0 176 ? 12 STI0 1365 ? 28 STL0 65 ? 12 J23116 ? STG1 261 221 STI1 3390 ? 105 STL1 684 ? 155 J23112 ? STG2 208 ? 12 STI2 1174 ? 305 STL2 265 ? 43 J23109 ? STG3 251 ? 31 STI3 1373 ? 73 STL3 70 ? 11 J23118 ? STG4 200 ? 10 STI4 663 ? 160 STL4 38 ? 1 J23100 ? STG5 46 ? 6 STI5 726 ? 46 STL5 93 ? 9 *PCN was calculated by dividing the copy number of the chromosome by the copy number of the plasmid.
Terminator and 5-UTR Sequences and Gene Sequences as Used
[0055] The terminator and 5-UTR sequences and gene sequences used in the Example of the present invention are summarized in Table 5 below.
TABLE-US-00005 TABLE5 SEQ ID NO Nucletidesequence(5-3) Terminator BBa_1002 cgcaaaaaaccccgcttcggcggggttttttcgc 53 5-UTR infA(STG1-5) gtagtactggaaatgagcatccagt 54 infA(STG7) gtagtactggatttttgcatccagt 55 efp(STGC1) tcctgattctcacataacccagaaaatt 56 eGFP(STG0) atcctgcattaaaggagcatccatt 57 eGFP(STG6) agggtgtgcgaaaggagcatcttta 58 mCherry(STGC0) ccctggattaaaaggagcatcttta 59 Gene Nucletidesequence infA atggccaaagaagacaatattgaaatgcaaggaaccgttcttgaaacgttgc 60 ctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacac atctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaa gtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttcc gtagtcgctga efp atggcaacgtactatagcaacgattttcgtgctggtcttaaaatcatgttagac 61 ggcgaaccttacgcggttgaagcgagtgaattcgtaaaaccgggtaaaggc caggcatttgctcgcgttaaactgcgtcgtctgctgaccggtactcgcgtaga aaaaaccttcaaatctactgattccgctgaaggcgctgatgttgtcgatatgaa cctgacttacctgtacaacgacggtgagttctggcacttcatgaacaacgaaa ctttcgagcagctgtctgctgatgcaaaagcaattggtgacaacgctaaatgg ctgctggatcaggcagagtgtatcgtaactctgtggaatggtcagccgatctc cgttactccgccgaacttcgttgaactggaaatcgttgataccgatccgggcc tgaaaggtgataccgcaggtactggtggcaaaccggctaccctgtctactgg cgctgtggttaaagttccgctgtttgtacaaatcggcgaagtcatcaaagtgg atacccgctctggtgaatacgtctctcgcgtgaagtaa eGFP atggctagcaagggcgaggagctgttcaccggggtggtgcccatcctggtc 62 gagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagg gcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacca ccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacg gcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttctt caagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaa ggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgac accctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacgg caacatcctggggcacaagctggagtacaactacaacagccacaacgtcta tatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccg ccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacct gagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcac atggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggac gagctgtacaagtga mCherry atggtttccaagggcgaggaggataacatggctatcattaaagagttcatgc 63 gcttcaaagttcacatggagggttctgttaacggtcacgagttcgagatcgaa ggcgaaggtgagggccgtccgtatgaaggcacccagaccgccaaactga aagtgactaaaggcggcccgctgccttttgcgtgggacatcctgagcccgc aatttatgtacggttctaaagcttatgttaaacacccagcggatatcccggact atctgaagctgtcttttccggaaggtttcaagtgggaacgcgtaatgaattttg aagatggtggtgtcgtgaccgtcactcaggactcctccctgcaggatggcg agttcatctataaagttaaactgcgtggtactaattttccatctgatggcccggt gatgcagaagaagacgatgggttgggaggcgtctagcgaacgcatgtacc cggaagatggtgcgctgaaaggcgaaattaaacagcgcctgaaactgaaa gatggcggccattatgacgctgaagtgaaaaccacgtacaaagccaagaa acctgtgcagctgcctggcgcgtacaatgtgaatattaaactggacatcacct ctcataatgaagattatacgatcgtagagcaatatgagcgcgcggagggtcg tcattctaccggtggcatggatgagctgtacaaataa codon CGGAAGAACGTCCGATTAGCAGCATTGCAGGT 64 optimized CAGATGAGCGTTGCATATATTCTGGCCGTTCA cad GCTGGTTGATCAGCAGTGTCTGCTGAGCCAGT TTAGCGAATTTGATGATAACCTGGAACGTCCG GAAGTTTGGGATCTGGCACGTAAAGTTACCAG CAGCCAGAGCGAAGAATTTGATCAGGATGGTA ATTGTCTGAGCGCAGGTCGTGTTCGTATTGAA TTTAATGATGGTTCCAGCATTACCGAAAGCGT TGAAAAACCGCTGGGTGTTAAAGAACCGATGC CGAATGAACGTATCCTGCATAAATATCGTACC CTGGCAGGTAGCGTTACCGATGAAAGCCGTGT GAAAGAAATTGAAGATCTGGTTCTGGGTCTGG ATCGTCTGACCGATATTAGTCCGCTGCTGGAA CTGCTGAACTGTCCGGTTAAAAGTCCGCTGGT TTAA idi ATGCAGACCGAACATGTGATTCTGCTGAACGC 65 GCAGGGCGTGCCGACCGGCACCCTGGAAAAA TATGCGGCGCATACCGCGGATACCCGCCTGCA TCTGGCGTTTAGCAGCTGGCTGTTTAACGCGA AAGGCCAGCTGCTGGTGACCCGCCGCGCGCTG AGCAAAAAAGCGTGGCCGGGCGTGTGGACCA ACAGCGTGTGCGGCCATCCGCAGCTGGGCGAA AGCAACGAAGATGCGGTGATTCGCCGCTGCCG CTATGAACTGGGCGTGGAAATTACCCCGCCGG AAAGCATTTATCCGGATTTTCGCTATCGCGCG ACCGATCCGAGCGGCATTGTGGAAAACGAAGT GTGCCCGGTGTTTGCGGCGCGCACCACCAGCG CGCTGCAGATTAACGATGATGAAGTGATGGAT TATCAGTGGTGCGATCTGGCGGATGTGCTGCA TGGCATTGATGCGACCCCGTGGGCGTTTAGCC CGTGGATGGTGATGCAGGCGACCAACCGCGA AGCGCGCAAACGCCTGAGCGCGTTTACCCAGC TGAAATAA ispA ATGGATTTCCCGCAGCAGCTGGAAGCGTGTGT 66 GAAACAGGCGAACCAGGCGCTGAGCCGCTTTA TTGCGCCGCTGCCGTTTCAGAACACCCCGGTG GTGGAAACCATGCAGTATGGCGCGCTGCTGGG CGGCAAACGCCTGCGCCCGTTTCTGGTGTATG CGACCGGCCACATGTTTGGCGTGAGCACCAAC ACCCTGGATGCGCCGGCGGCGGCGGTGGAATG CATTCATGCGTATAGCCTGATTCATGATGATCT GCCGGCGATGGATGATGATGATCTGCGCCGCG GCCTGCCGACCTGCCATGTGAAATTTGGCGAA GCGAACGCGATTCTGGCGGGCGATGCGCTGCA GACCCTGGCGTTTAGCATTCTGAGCGATGCGG ATATGCCGGAAGTGAGCGATCGCGATCGCATT AGCATGATTAGCGAACTGGCGAGCGCGAGCG GCATTGCGGGCATGTGCGGCGGCCAGGCGCTG GATCTGGATGCGGAAGGCAAACATGTGCCGCT GGATGCGCTGGAACGCATTCATCGCCATAAAA CCGGCGCGCTGATTCGCGCGGCGGTGCGCCTG GGCGCGCTGAGCGCGGGCGATAAAGGCCGCC GCGCGCTGCCGGTGCTGGATAAATATGCGGAA AGCATTGGCCTGGCGTTTCAGGTGCAGGATGA TATTCTGGATGTGGTGGGCGATACCGCGACCC TGGGCAAACGCCAGGGCGCGGATCAGCAGCT GGGCAAAAGCACCTATCCGGCGCTGCTGGGCC TGGAACAGGCGCGCAAAAAAGCGCGCGATCT GATTGATGATGCGCGCCAGAGCCTGAAACAGC TGGCGGAACAGAGCCTGGATACCAGCGCGCTG GAAGCGCTGGCGGATTATATTATTCAGCGCAA CAAATAA crtE ATGGTATCTGGCTCAAAGGCTGGCGTCTCGCC 67 ACATCGCGAAATTGAAGTGATGCGCCAGAGCA TTGATGATCATCTGGCGGGCCTGCTGCCGGAA ACCGATAGCCAGGATATTGTGAGCCTGGCGAT GCGCGAAGGCGTGATGGCGCCGGGCAAACGC ATTCGCCCGCTGCTGATGCTGCTGGCGGCGCG CGATCTGCGCTATCAGGGCAGTATGCCGACCC TGCTGGATCTGGCGTGCGCGGTGGAACTGACC CATACCGCGAGCCTGATGCTGGATGATATGCC GTGCATGGATAACGCGGAACTGCGCCGCGGCC AGCCGACCACCCATAAAAAATTTGGCGAAAGC GTGGCGATTCTGGCGAGCGTGGGCCTGCTGAG CAAAGCGTTTGGCCTGATTGCGGCGACCGGCG ATCTGCCGGGCGAACGCCGCGCGCAGGCGGTG AACGAACTGAGCACCGCGGTGGGCGTGCAGG GCCTGGTGCTGGGCCAGTTTCGCGATCTGAAC GATGCGGCGCTGGATCGCACCCCGGATGCGAT TCTGAGCACCAACCATCTGAAAACCGGCATTC TGTTTAGCGCGATGCTGCAGATTGTGGCGATT GCGAGCGCGAGCAGCCCGAGCACCCGCGAAA CCCTGCACGCGTTTGCGCTGGATTTTGGCCAG GCGTTTCAGCTGCTGGATGATCTGCGCGATGA TCATCCGGAAACCGGCAAAGATCGCAACAAA GATGCGGGCAAAAGCACCCTGGTGAACCGCCT GGGCGCGGATGCGGCGCGCCAGAAACTGCGC GAACATATTGATAGCGCGGATAAACATCTGAC CTTTGCGTGCCCGCAGGGCGGCGCGATTCGCC AGTTTATGCATCTGTGGTTTGGCCATCATCTGG CGGATTGGAGCCCGGTGATGAAAATTGCGTAA crtB ATGTCCCAACCCCCCTTGCTAGACCACGCAAC 68 CCAGACGATGGCGAACGGCAGCAAGAGCTTT GCGACCGCGGCGAAACTGTTTGATCCGGCGAC CCGCCGCAGCGTGCTGATGCTGTATACCTGGT GCCGCCATTGCGATGATGTGATTGATGATCAG ACGCATGGCTTTGCGAGCGAAGCGGCGGCGG AAGAAGAAGCGACCCAGCGCCTGGCGCGCCT GCGCACCCTGACCCTGGCGGCGTTTGAAGGCG CGGAAATGCAGGACCCGGCGTTTGCGGCGTTT CAGGAAGTGGCGCTGACCCACGGCATTACCCC GCGCATGGCGCTGGATCATCTGGATGGCTTTG CGATGGATGTGGCGCAGACCCGCTATGTGACC TTTGAAGATACCCTGCGCTATTGCTATCATGTG GCGGGCGTGGTGGGCCTGATGATGGCGCGCGT GATGGGCGTGCGCGATGAACGCGTGCTGGATC GCGCGTGCGATCTGGGCCTGGCGTTTCAGCTG ACCAACATTGCGCGCGATATTATTGATGATGC GGCGATTGATCGCTGCTATCTGCCGGCGGAAT GGCTGCAGGATGCGGGCCTGACCCCGGAAAA CTATGCGGCGCGCGAAAACCGCGCGGCGCTGG CGCGCGTGGCGGAACGCCTGATTGATGCGGCG GAACCGTATTATATTAGCAGCCAGGCGGGCCT GCATGATCTGCCGCCGCGCTGCGCGTGGGCGA TTGCGACCGCGCGCAGCGTGTATCGCGAAATT GGCATTAAAGTGAAAGCGGCGGGCGGCAGCG CGTGGGATCGCCGCCAGCATACCAGCAAAGGC GAAAAAATTGCGATGCTGATGGCGGCGCCGG GCCAGGTGATTCGCGCGAAAACCACCCGCGTG ACCCCGCGCCCGGCGGGCCTGTGGCAGCGCCC GGTGTAA
Example 1. Production of E. coli Based on STAPL System and Assessment of Plasmid Number Maintenance in STAPL System
[0056] In order to construct an auxotrophic complementation (auxotrophic complementation) system based on STAPL, an experiment where an essential gene in the chromosome (chromosome) was removed and the essential gene was expressed in the plasmid was conducted. IF-1 protein is directly related to the viability of the cell, thus minimizing the cross-feeding effect (cross-feeding effect). Thus, infA for encoding the translation initiation factor-1(IF-1) was selected as the regulatory gene. Then, a plasmid containing an expression cassette expressing the regulatory gene was designed. The plasmid for introducing infA into the strain employed pCDFduet known to have an intermediate copy (40 copies per cell) and CloDF13 was employed as the replication origin (replicon).
[0057] First, the infA expressing cassette was constructed to include the intermediate intensity constitutive promoter (J23116) and the low intensity 5-UTR exhibiting 1115.3 value computationally designed by the UTR designer, and a synthetic terminator (BBa_B1002). Thus, the expression cassette was designed so that the infA expression level was low because the plasmid-based expression system exists in multiple copy numbers, and thus cloning the infA in the same amount as the expression amount thereof on the chromosome may put the stress on the cell and interfere with the growth thereof. In order to indirectly observe the plasmid copy number (PCN), eGFP was expressed as a reporter protein under the strong constitutive promoter (J23100) and 5-UTR in the same plasmid.
[0058] To this end, the infA gene was amplified by using a chromosome of the W3110 strain of Escherichia coli as a template and using the O-infA-Flv1/O-infA-F2/O-infA-B primer set of Table 3. The amplified infA gene was inserted into the plasmid via cloning using Bsu36I restriction enzyme sequence. Subsequently, eGFP was amplified using the O-eGFP-F1/O-eGFP-F2/O-eGFP-B primer set. The amplified eGFP was inserted into the plasmid via cloning using SacI restriction enzyme sequence. In this way, pSTAPL_eGFPv1 plasmid was finally constructed.
[0059] The completed plasmid was inserted into the W3110 strain of Escherichia coli. Then, to remove the infA gene from the chromosome of the strain for the auxotrophic complementation system, the previously known Lambda-Red recombination system was used and pKD46 plasmid was used. A DNA fragment for the infA removal employed FRT-KanR-FRT as a template. Amplification using a primer set of D-infA-F/D-infA-B was conducted. Thus, the recombinant E. coli strain STG1 in which infA was removed was produced.
[0060] To evaluate the long term stability of the plasmid in the recombinant E. coli to which the STAPL was applied, the recombinant E. coli was subjected to the cell culture together with E. coli(STG0) with a conventional antibiotic-dependent plasmid maintenance system.
[0061] All recombinant strains, including recombinant E. coli pSTAPL_eGFPv1, were seeded in 3 ml of modified glucose M9 medium as a medium condition for plasmid stability testing (In this connection, the medium contained 100 mM phosphate buffer, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O, 2 g/L NH.sub.4Cl, 2 g/L NaCl and 1 g/L casamino acid, and employed only 20 g/L glucose as the carbon source). Thereafter, the recombinant strains were incubated at 37? ? C. at 250 rpm, and a series of subculture was performed thereto every 5 generations for 40 generations. An initial cell concentration was diluted to an OD.sub.600 concentration of 0.05 in order to be identical to that of the cells prepared previously via culture in the same medium. An antibiotic for plasmid maintenance employed 50 ?g/ml of streptomycin.
[0062] Cell growth during the culturing was quantitated by measuring absorbance at 600 nM wavelength using UV-1700 spectrophotometer. Cell fluorescence was measured using a VICTOR 1420 multilabel plate reader and a 486 nm wavelength filter and a 535 nm emission filter. The cells were washed with phosphate-buffered saline (phosphate-buffered saline, PBS), and then fluorescence per cell was measured using S3e cell sorter.
[0063] As shown in
Example 2. Application of STAPL System to Multiple Plasmid System
[0064] To construct an auxotrophic complementation system based on the STAPL for two plasmids, two essential genes on chromosome were removed and the essential genes were expressed in each of the plasmids. The infA for encoding the translation initiation factor-1(IF-1) directly related to cell viability and thus minimizing the cross-feeding effect and efp for encoding a protein elongation factor (EF-P) were selected as a regulatory gene in the expression cassette. Thus, the present STAPL system was constructed. The plasmid for introducing efp into the strain which the STAPL system using infA was applied to employed pETduet, which is known to have an intermediate copy level (40 copies per cell). The replication origin (replicon) employed CloE1.
[0065] The efp expression cassette contained in the plasmid to introduce the efp was constructed to include an intermediate intensity constitutive promoter (J23116), a 5-UTR of low intensity of 1169.4 as designed by the UTR designer, and a synthetic terminator (BBa_B1002). In this connection, cloning the efp in the same amount in the plasmid as the expression amount on the chromosome may put the stress on the cell and interfere with growth of the cell. For this reason, the expression cassette was designed so that the efp expression level was low. To observe the PCN indirectly, mCherry was expressed as a reporter protein under the strong constitutive promoter (J23100) and 5-UTR in the same plasmid.
[0066] A control plasmid with mCherry as a template was amplified using the O-mCherry-F1/O-mCherry-F2/O-mCherry-B primer set of Table 2, and then was inserted into pET plasmid via cloning using SacI restriction enzyme sequence. Thus, pET-mCherry plasmid was constructed. To apply the pET plasmid to the STAPL system, the efp gene was amplified by using the chromosome of the W3110 strain of Escherichia coli as a template and using the O-efp-F1/O-efp-F2/O-efp-B primer set in Table 3. Then, cloning of the efp gene was performed using the XhoI restriction enzyme sequence such that the efp gene was inserted into the pET-mCherry plasmid as prepared above. The, the thus produced plasmid was inserted into the STG1 strain having the infA expression cassette introduced thereto including J23116 as a constitutive promoter having an intensity similar to that of the promoter in the expression cassette of the STG1 strain of Example 1 in which the infA gene was used as a regulatory gene and to which the STAPL system was applied.
[0067] Thereafter, prior to removal of efp on the chromosome of the STG1 strain for auxotrophic complementation system, recombination was carried out using pCP20 plasmid to remove the kanamycin resistance gene on the chromosome. The previously known Lambda-Red recombination system and the pKD46 plasmid were used to remove the efp on the chromosome. The recombinant Escherichia coli STGC1 in which the efp on the chromosome was removed for auxotrophic complementation system was produced by amplifying the DNA fragment for removing efp on the chromosome using pFRT2161 as a template and using D-efp-F/D-efp-B primer set in Table 3. In order to evaluate the long-term stability of plasmid in the recombinant E. coli to which the thus produced multiple plasmid STAPL was applied, the recombinant E. coli was subjected to the cell culture together with E. coli(STGC0) with a conventional antibiotic-dependent plasmid maintenance system.
[0068] The STGC0 and STGC1 strains were seeded in 3 ml of modified glucose M9 medium as a medium condition for plasmid stability testing (In this connection, the medium contained 100 mM phosphate buffer, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O, 2 g/L NH.sub.4Cl, 2 g/L NaCl and 1 g/L casamino acid, and employed only 4 g/L glucose as the carbon source). Thereafter, the recombinant strains were incubated at 37? C. at 250 rpm, and a series of subculture was performed thereto every 5 generations for 40 generations. An initial cell concentration was diluted to an OD.sub.600 concentration of 0.05 in order to be identical to that of the cells prepared previously via culture in the same medium. For a conventional antibiotic-dependent plasmid maintenance system (STGC0) used as a positive control, streptomycin and ampicillin of 50 ?g/ml were added to the medium as an antibiotic for plasmid maintenance. In this state, the culturing was conducted.
[0069] Cell growth during the culturing was quantitated by measuring absorbance at 600 nM wavelength using UV-1700 spectrophotometer. eGFP fluorescence was measured using a VICTOR 1420 multilabel plate reader and a 486 nm wavelength filter and a 535 nm emission filter. The mCherry fluorescence was measured using a Hidex Sense microplate reader, a 575 nm wavelength filter and a 610 nm emission filter, and the measured fluorescence results are shown in
[0070] As shown in
Example 3. Application of STAPL System to High Copy Number Plasmid
[0071] It is common that, in the high copy number plasmid (high copy plasmid), the copy number decreases sharply because of the large probability variation of the plasmid. However, experiments were conducted to determine whether the PCN is maintained stably in the high copy number plasmid when applying the STAPL system according to the present invention to the high copy number plasmid. To introduce the STAPL system into the high copy plasmid system, essential genes were expressed in the plasmid and the same essential genes on the chromosome were removed. The infA gene for encoding the translation initiation factor-1(IF-1), which is directly associated with cell viability and can minimize the cross-feeding effect, was selected as the regulatory gene of the expression cassette. Thus, the STAPL system was constructed. The plasmid for introducing the infA gene employed pUC19, which is known to have a high copy number (500 copies per cell). The replication origin (replicon) employed pMB1.
[0072] The infA expression cassette included in the plasmid for introducing infA was constructed to include a low intensity constitutive promoter (J23112), 5-UTR of a low intensity of 263.75 designed by the UTR designer, and a synthetic terminator (BBa_B1002). Cloning this gene in the same amount as the expression amount on the chromosome may put stress on the cell and interfere with growth of the cell. Thus, the expression cassette was designed to have a low infA expression level. To observe PCN indirectly, eGFP was expressed as a reporter protein under the strong constitutive promoter (J23118) and 5-UTR in the same plasmid.
[0073] The control plasmid having pUC19 as a template was amplified using a pUC19-F/O-pUC19-B primer set of Table 3. eGFP having eGFP as a template was amplified using O-eGFP-F1v2/O-eGFP-F2v2/O-eGFP-Bv2 primer set in Table 3. Then, the amplified eGFP was inserted into the pUC19 plasmid via cloning using Bsu36I and XhoI restriction enzyme sequences. Thus, the pUC19-eGFP plasmid was constructed. In order to apply the pUC19 plasmid to the STAPL system, infA gene was amplified using the chromosome of W3110 strain of Escherichia coli as a template and using the O-infA-Flv2/O-infA-F2v2/O-infA-B1v2/O-infA-B2v2 primer set of Table 3. Subsequently, cloning of the gene was performed using SacI and AatII restriction enzyme sequences and then was inserted into the previously prepared pUC19-eGFP plasmid, thereby to construct pSTAPL_eGFPv7.
[0074] Subsequently, in order to remove the infA on the chromosome of the STG6 strain for the auxotrophic complementation system, the pKD46 plasmid was used and the previously known Lambda-Red recombination system was used. The recombinant Escherichia coli STG7 in which the infA on the chromosome was removed for auxotrophic complementation system was produced by amplifying the DNA fragment for removing infA on the chromosome using pFRT72 as a template and using D-infA-F/D-infA-B primer set in Table 3. In order to evaluate the long-term stability of plasmid in the recombinant E. coli to which the thus produced multiple plasmid STAPL was applied, the recombinant E. coli was subjected to the cell culture together with E. coli(STG6) with a conventional antibiotic-dependent plasmid maintenance system.
[0075] Then, the STG6 and STG7 strains were seeded in 3 ml of modified glucose M9 medium as a medium condition for plasmid stability testing (In this connection, the medium contained 100 mM phosphate buffer, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O, 2 g/L NH.sub.4Cl, 2 g/L NaCl and 1 g/L casamino acid, and employed only 4 g/L glucose as the carbon source). Thereafter, the recombinant strains were incubated at 37? C. at 250 rpm, and a series of subculture was performed thereto every 5 generations for 40 generations. An initial cell concentration was diluted to an OD.sub.600 concentration of 0.05 in order to be identical to that of the cells prepared previously via culture in the same medium. For a conventional antibiotic-dependent plasmid maintenance system (STG6) used as a positive control, ampicillin of 50 ?g/ml was added to the medium as an antibiotic for plasmid maintenance. In this state, the culturing was conducted.
[0076] Cell growth during the culturing was quantitated by measuring absorbance at 600 nM wavelength using UV-1700 spectrophotometer. eGFP fluorescence was measured using a VICTOR 1420 multilabel plate reader and a 486 nm wavelength filter and a 535 nm emission filter. The measured fluorescence results are shown in
[0077] As shown in
Example 4. PCN Control in STAPL
[0078] The expression amount of infA, which is essential for cell survival, has been determined. Thus, experiments were conducted to determine whether PCN could be regulated by controlling the level of transcription using a mechanism of regulating the amount of infA expression in the cells. Additional STG2-5 strains with four different infA expression amounts based on the infA expression amount of E. coli STG1 used in Example 1 were produced.
[0079] InfA cassettes with promoters of different intensities were amplified with O-infA-Flv2-5/O-infA-B primer set. Then, the amplified infA cassettes were inserted into the plasmid via cloning using Bsu36I restriction enzyme sequence. Thus, the pSTAPL_eGFPv2-5 plasmid was finally constructed. The completed plasmid was inserted into the W3110 strain of Escherichia coli, and then the infA on the chromosome was removed for the auxotrophic complementation system. To remove the infA gene, the conventionally known Lambda-Red recombination system was used and pKD46 plasmid was used. The DNA fragment for the infA removal was amplified using the FRT-KanR-FRT template and the D-infA-F/D-infA-B primer set. In addition to the STG1 produced in Example 1, additional recombinant Escherichia coli STG2-5 strains in which infA on the chromosome was removed were produced.
[0080] The amount of an actually transferred infA transcript was measured by performing RT-qPCR with the StepOnePlus real-time PCR system while the promoter intensities in the actual system varied. In order to amplify the infA transcript, Q-infA-F/Q-infA-B primer set was used. hcaT and cysG as chromosomal housekeeping genes were defined as a reference. Q-hcaT-F/Q-hcaT-B and Q-cysG-F/Q-cysG-B primer sets were used to amplify the hcaT and cysG transcripts. The relative amount of the infA transcript was quantified using the CT comparison method and the relative intensities were shown in Table 2. The predicted intensities of the promoters as used and the actual expression levels were slightly different from each other, but substantial trends are the same therebetween.
[0081] The PCN was defined as the number of plasmids per chromosome. The PCN was measured by using the StepOnePlus Real-time PCR system and by performing quantitative polymerase chain reaction (qPCR). Q-pCDF-F/Q-pCDF-B and Q-polA-F/Q-polA-B primer sets were used to amplify the plasmid and specific portions of the chromosome. Finally, STAPL strains with infAs inserted thereto with 5 different expression amounts were cultured in the same medium as that used in Example 1 of 20 ml. The mechanism of PCN regulation via the mechanism of expression amount adjustment of infA is shown in
[0082] As shown in
[0083] As shown in
[0084] Thus, it was confirmed that the STAPL system according to the present invention is able to precisely control the amount of expression of infA, such that PCN can be quantitatively regulated up to 5.6 times without imposing additional metabolic stress on the cells expressing the STAPL system.
Example 5. Production of Target Product Via STAPL
5.1 Production of Itaconic Acid Using STAPL System
[0085] When using the STAPL system according to the present invention, the strain applied to the system can maintain the plasmid stably for a long time while minimizing the intercellular variation, as compared with the conventional antibiotic-dependent plasmid maintenance system. Further, the present STAPL system can finely tune the PCN by adjusting the infA expression amount or level. Therefore, we have conducted an experiment to check that the itaconic acid (itaconic acid) which is a target product, can be produced efficiently by using the present STAPL system. In order to produce the itaconic acid as the target product from E. coli. cad foreign gene derived from Aspergillus terreus was purchased in a codon-optimized form from Thermo Fisher company. To maximize the amount of the gene expression, we used an expression cassette including the tac promoter and synthetic 5 UTR. The synthetic 5 UTR was designed to maximize the expression amount of the gene. We used the synthetic 5 UTR designed to have more than 1 million predicted expression amount using the UTR Designer. To construct the pCDF-CAD plasmid, a pCDFDuet plasmid having an intermediate copy number was used as a template and was amplified using the O-pCDF-F/O-pCDF-B primer set shown in Table 3. The cad gene was sequentially amplified using O-cad-F1/O-cad-B1 and O-cad-F2/O-cad-B2 primer sets. The amplified gene was inserted into the plasmid via cloning using BsaI restriction enzyme sequence. The pCDF-CAD plasmid was finally constructed. To construct pSTAPL_CAD_v1-5 with the STAPL system applied to the plasmid, the infA gene was amplified by using the chromosome of W3110 strain of Escherichia coli as a template and using the O-infA-Flv1-5/O-infA-F2/O-infA-B primer set of Table 3. Then, the amplified gene was inserted into the plasmid via cloning using Bsu36I restriction enzyme sequence. The completed plasmid was inserted into the W3110 strain of Escherichia coli. Next, in order to remove the infA on the chromosome in the strain for the auxotrophic complementation system, the previously known Lambda-Red recombination system was used and pKD46 plasmid was used. The DNA fragment for the infA removal was amplified using FRT-KanR-FRT as a template and by using D-infA-F/D-infA-B primer set. Thus, the infA-removed recombinant E. coli STI1-5 strains were produced.
[0086] To analyze the production amount of itaconic acid produced from the recombinant E. coli, the above recombinant E. coli was cultured together with a negative control and positive control (STI0). The recombinant E. coli strains STI 0-5 were input in 25 ml of modified glucose M9 (In this connection, the medium contained 100 mM phosphate buffer, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O, 2 g/L NH.sub.4Cl, 2 g/L NaCl, 2 g/L yeast extract, and 10 mL/L ATCC trace mineral solution, and employed only 20 g/L glucose as the carbon source). Thereafter, the recombinant strains were incubated at 30? C. at 200 rpm for 48 hours. An initial cell concentration was diluted to an OD.sub.600 concentration of 0.05 in order to be identical to that of the cells prepared previously via culture in the same medium. Only for a conventional antibiotic-dependent plasmid maintenance system (STI0) used as a positive control, streptomycin of 50 ?g/ml was added to the medium as an antibiotic for plasmid maintenance. In this state, the culturing was conducted. After incubation, itaconic acid and other organics in the medium were measured using the Aminex HPX-87H column and 0.6 ml of 5 mM H.sub.2SO.sub.4 per minute in the mobile phase. Shodex RI-101 instrument was used for detection. The STAPL system and corresponding plasmids for the production of itaconic acid are shown in
[0087] As shown in
Example 5.2 Production of Lycopene Using STAPL System
[0088] An experiment was conducted to evaluate whether the present STAPL system could be used to efficiently produce the target product lycopene (Lycopene), based on the analysis of the STAPL-applied strains in the Examples 1 to 3. The production aspect of lycopene by using the present STAPL system was compared and analyzed while the lycopene was defined as the target product. For production of lycopene, ispA and idi derived from Escherichia coli and crtEBI derived from Pantoea agglomerans were purchased in a codon-optimized form Thermo Fisher company. To construct pSTAPL_LYCv1-5 with the STAPL applied thereto using the pCDF_idi_ispA_crtEBI plasmid shown in Table 1, infA gene was amplified using the chromosome of W3110 strain of Escherichia coli as a template and by using the O-infA-Flv1-5/O-infA-F2/O-infA-B primer set of Table 3. Then, the amplified gene was inserted into the plasmid via cloning using Bsu36I restriction enzyme sequence. The completed plasmid was inserted into the W3110 strain of Escherichia coli. Next, in order to remove the infA on the chromosome in the strain for the auxotrophic complementation system, the previously known Lambda-Red recombination system was used and pKD46 plasmid was used. The DNA fragment for the infA removal was amplified using FRT-KanR-FRT as a template and by using D-infA-F/D-infA-B primer set. Thus, the infA-removed recombinant E. coli STI1-5 stains were produced.
[0089] To analyze the production amount of lycopene produced from the recombinant E. coli, the above recombinant E. coli was cultured together with a negative control and positive control (STL0). The recombinant E. coli strains STL0-5 were seeded in 20 ml of modified glucose 2? M9 medium (In this connection, the medium contained 200 mM phosphate buffer, 1 g/L MgSO.sub.4.Math.7H.sub.2O, 4 g/L NH.sub.4Cl, and 4 g/L NaCl, and employed only 4 g/L glucose as the carbon source). Thereafter, the recombinant strains were incubated at 37? ? C. at 250 rpm for 24 hours. An initial cell concentration was diluted to an OD.sub.600 concentration of 0.05 in order to be identical to that of the cells prepared previously via culture in the same medium. Only for a conventional antibiotic-dependent plasmid maintenance system (STL0) used as a positive control, streptomycin of 50 ?g/ml was added to the medium as an antibiotic for plasmid maintenance. In this state, the culturing was conducted. After incubation, the amount of lycopene production was measured using a known modified colorimetric assay (colorimetric assay) and quantified via a 475 nm absorbance measurement using a VICTOR 1420 Multilabel Plate Reader. The STAPL system for the lycopene production and the corresponding plasmids are shown in
[0090] As shown in
[0091] According to the present embodiment, when the STAPL system using the infA and having Escherichia coli as a host cell is applied, the PCN can be finely and quantitatively regulated according to the expression level of the infA. Thus, the present system has been applied to solve the conventional problem that the expensive antibiotics must be added to the medium and to effectively control the PCN.
[0092] Although the present invention has been described with reference to the preferred embodiments, the skilled person to the art may make various modifications and variations without departing from the spirit and scope of the invention. Further, the appended claims include such modifications or variations that fall within the spirit of the present invention.