EBIV nucleic acid composition and application thereof
12013390 ยท 2024-06-18
Assignee
Inventors
- Han XIA (Wuhan, CN)
- Zhiming YUAN (Wuhan, CN)
- Nanjie REN (Wuhan, CN)
- Fei Wang (Wuhan, CN)
- Guilin ZHANG (Wuhan, CN)
Cpc classification
C12N2760/12021
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2760/12052
CHEMISTRY; METALLURGY
C12N2760/12043
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
G01N2333/175
PHYSICS
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
Abstract
The present application discloses a nucleic acid composition for expressing recombinant EBIV-related genes and proteins and the use thereof. The nucleic acid composition includes a nucleic acid molecule having sequences shown in SEQ ID NO. 14, 15, 16, and 17. In the present application, a recombinant EBIV is also constructed with this nucleic acid composition. The virus not only has broad-spectrum infectivity to mammalian and mosquito cells, can be stably passaged, but also has green fluorescence, which can provide a research foundation for in vitro and in vivo virus tracing, virus detection, antiviral drugs, vaccine screening, with significant application prospects.
Claims
1. A method for preparing a recombinant Ebinur Lake virus (EBIV) strain labeled with GFP fluorescence, comprising the following steps: Cloning genes shown in SEQ ID NO. 14-16, wherein primers used for amplifying the gene sequences were shown in SEQ ID NO. 14 are as shown in SEQ ID NO. 1 and 2; primers used for amplifying the genes shown in SEQ ID NO. 15 are shown in SEQ ID NO. 3 and 4; primers used for amplifying the genes shown in SEQ ID NO. 16 are shown in SEQ ID NO. 5 and 6; Ligating the genes shown in SEQ ID NO. 14-16 respectively to a linearized pLCK plasmid to obtain pLCK-EBIV-L, pLCK-EBIV-M, and pLCK-EBIV-S plasmids; Using pcDNA3.1-eGFP as a template, and eGFP-F and eGFP-R as primers to clone an eGFP fragment; Using pLCK-EBIV-S as a template, and CS-F and CS-R as primers to clone a linearized fragment of pLCK-EBIV-S; Ligating the eGFP fragment and the linearized fragment of pLCK-EBIV-S by homologous recombination to obtain a recombinant plasmid pLCK-EBIV-eGFP/S; wherein the eGFP fragment is ligated to pLCK-EBIV-S using P2A; the nucleic acid sequence of the P2A is shown in SEQ ID NO. 13; the nucleotide sequence of the eGFP fragment is shown in SEQ ID NO. 17; Mixing pLCK-EBIV-eGFP/S, pLCK-EBIV-M, and pLCK-EBIV-L in a mass ratio of 1:2:3, and co-transfect them into BSR-T7 cells and culture same, and harvest the transfected culture, wherein the culture contains the recombinant EBIV strain labeled with GFP fluorescence; wherein a method for constructing pLCK-EBIV-eGFP/S comprises: Cloning eGFP using primers eGFP-F and eGFP-R shown in SEQ ID NO. 9 and 10 from plasmid pcDNA3.1-eGFP to obtain the eGFP fragment shown in SEQ ID NO. 17; wherein the PCR reaction system of 50 ?L: 2? Reaction Mix Buffer, 25 ?L, 10 ?M eGFP-F, 2 ?L, 10 ?M eGFP-R, 2 ?L, Template DNA, 1 ?L, and Nuclease-Free Water, 20 ?L; the PCR amplification reaction: 98? C. for 10 s, 57? C. for 5 s, 68? C. for 30 s, 16? C. for 10 min; the number of cycles of 25; Cloning the pLCK-EBIV-S plasmid by using primers CS-F and CS-R shown in SEQ ID NO. 11 and 12 to obtain a linearized pLCK-EBIV-S fragment; wherein the PCR reaction system of 50 ?L: 2? Reaction Mix Buffer, 25 ?L, 10 ?M CS-F, 2 ?L, 10 ?M CS-R, 2 ?L, Template DNA, 1 ?L, and Nuclease-Free Water, 20 ?L; the PCR reaction condition: 98? C. for 10 s, 57? C. for 5 s, 68? C. for 30 s, 16? C. for 10 min; the number of cycles of 25; Ligating the eGFP fragment and the pLCK-EBIV-S linearized fragment by homologous recombination to obtain pLCK-EBIV-eGFP/S, wherein the reaction system for the homologous recombination of 20 ?L: 5? Reaction Buffer, 4 ?L, eGFP fragment, 30 ng, cS fragment, 60 ng, Enzyme, 2 ?L, and Nuclease-Free Water, 33 ?L; the homologous recombination reaction conditions: 37? C. for 30 min, and 16? C. for 10 min.
2. A plasmid composition for constructing a recombinant EBIV, comprising three recombinant plasmids, pLCK-EBIV-L, pLCK-EBIV-M, and pLCK-EBIV-eGFP/S, wherein the nucleotide sequences of the three recombinant plasmids are successively shown in SEQ ID NO. 18, 19 and 20; wherein the target gene included in the pLCK-EBIV-L recombinant plasmid is EBIV L fragment, the nucleotide sequence of which is shown in SEQ ID NO. 14; the target gene included in the pLCK-EBIV-M recombinant plasmid is the EBIV M fragment, the nucleotide sequence of which is shown in SEQ ID NO. 15; the target gene included in the recombinant plasmid of pLCK-EBIV-eGFP/S is the EBIV S fragment and green fluorescent protein gene fragment, the nucleotide sequences of which are shown in SEQ ID NO. 16 and 17, respectively; three recombinant plasmids are obtained by ligating the target genes and the linearized pLCK plasmid; and in the plasmid composition, pLCK-EBIV-eGFP/S, pLCK-EBIV-M, and pLCK-EBIV-L are transfected into cells at a mass ratio of 1:2:3 to rescue a recombinant EBIV strain.
3. A recombinant EBIV strain prepared by the method of claim 1; the recombinant EBIV strain was deposited at the China Center for Type Culture Collection on Jan. 25, 2022, with the deposit address of Wuhan University, Wuhan, China (address of No. 299, Bayi Road, Wuhan City, Hubei Province), and the deposit number of CCTCC NO. V202204.
4. A recombinant host bacterium comprising the recombinant plasmid of the plasmid composition of claim 2.
5. Use of the plasmid composition of claim 2, comprising at least one of the preparation of a recombinant EBIV, expression of a protein associated with the recombinant EBIV, screening for drugs that antagonize EBIV, in vitro tracing of a recombinant EBIV, preparation of a vaccine against EBIV, and preparation of a product associated with detection of EBIV.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(8) In order that the objects, aspects, and advantages of the present invention will become more apparent, a more particular description of the present invention will be rendered by reference to the embodiments. It should be understood that the particular embodiments described herein are illustrative only and are not restrictive. The reagents not described in detail separately in the present application are all conventional and can be obtained from commercial sources; Methods not specifically described in detail are conventional experimental methods and are known from the prior art.
(9) Acquisition of EBIV Genome Sequence
(10) The original EBIV strain used in the present application was isolated from Culex modestus by the Center for Disease Control and Prevention of Xinjiang Military Command. It was used to clone the L, M, and S segments of EBIV. The specific implementation process was as follows:
(11) 1. Materials
(12) Source of strain: the original strain was isolated from Cx. modestus by the Center for Disease Control and Prevention of Xinjiang Military Command. The Cx. Modestuses were washed with PBS 3 times, added with 2 mL of DMEM medium, and repeatedly ground. The ground product was centrifuged for 5 min at 3000 r/min. The supernatant was filtered by a 0.22 ?m filter membrane. The filtered supernatant (1 mL) was added into BHK-21 cells (the cells were cultured in a 25 cm.sup.2 cell culture flask). After adsorption at 37? C. for 1 h, the supernatant was removed and 5 mL of DMEM medium containing 2% fetal bovine serum (v/v) was added into the cell culture flask. The flask was placed in a 5% CO.sub.2 incubator for culture for more than 3 d. Olympus IX51 microscope was used to observe the cytopathic effect every day. The virus supernatant was absorbed and stored at ?80? C. Source of cells: BHK-21 cells, Item No: C1-0034; specification: 1?10.sup.6 cells/T25 culture flask, Procell Life Science & Technology Co., Ltd., Wuhan.
(13) 2. RT-PCR
(14) The EBIV isolate was serially diluted and inoculated into BHK-21 medium (cell concentration: 1?10.sup.6 cells/mL) at an inoculum with a multiplicity of infection (MOI) of 0.01. After 72 h of culture at 37? C., the viruses were harvested. The QIAamp? Viral RNA Mini KIT (Qiagen) was used to extract virus RNA. The GoScript? Reverse Transcription System (Promega) was used to synthesize cDNA, which is used as a template for PCR amplification using KOD One? PCR Master Mix Blue (TOYOBO). The PCR reaction system of 50 ?L: 2? Reaction Mix Buffer, 25 ?L, 10 ?M Forward Primer, 2 ?L, 10 ?M Reverse Primer, 2 ?L, Template DNA, 1 ?L, and Nuclease-Free Water, 20 ?L. The amplification condition: 98? C. for 10 s, 57? C. for 5 s, and 68? C. for 5 s, for 25 cycles. Among them, all the primer were generated and provided by Tsingke Biotechnology Co., Ltd., Beijing.
(15) The results are shown in
(16) Construction of Recombinant Plasmids
(17) 1. Construction of pLCK-EBIV-L, pLCK-EBIV-M and pLCK-EBIV-S
(18) Through the method of homologous recombination, L, M, and S sequence fragments were respectively ligated with linearized pLCK plasmids using ClonExpress? II One Step Cloning Kit (Vazyme) to obtain plasmids pLCK-EBIV-L, pLCK-EBIV-M and pLCK-EBIV-S. The ligation reaction system of 20 ?L: 5?CE II Buffer 4 ?L, Exnase II 2 ?L, pLCK 46 ng, L fragment 280 ng, and ddH.sub.2O to 20 ?L. The reaction condition: 37? C. for 30 min.
(19) Transformation procedures of three plasmids: 5 ?L of each of the three ligation reactants (pLCK-EBIV-L, pLCK-EBIV-M and pLCK-EBIV-S into one of three tubes containing XL10 (Vazyme) was added into competent cells respectively. The tubes containing cells were kept into the ice for 30 min and were heat shock at 42? C. for 90 s. Then they were put into ice for 2 min again. After that, each tube containing cells were then added with 900 mL of LB medium and incubated in a shaker of 200 rpm at 37? C. for 1 h. Subsequently, the bacterial cells was coated on a plate containing kanamycin and cultured in an incubator at 37? C. overnight.
(20) Colony PCR procedures of three plasmids: after the colonies on the plate grew to a visible size, one colony was picked, put into a tube containing 300 ?L of LB medium, and the tubes were shaken at 220 rpm for 3-4 h at 37? C. Then, 2 ?L bacterial solution was aspirated for colony PCR.
(21) Colony PCR: colony PCR amplification reactions were performed using 2? Rapid Taq Master Mix (Vazyme), the reaction system of 50 ?L: 2? Rapid Taq Master Mix 25 ?L, each of upstream and downstream primers (see L-F/R, M-F/R, and S-F/R in the primer table 1) 2 ?L, bacterial solution 2 ?L, ddH.sub.2O 19 ?L. The amplification condition: 95? C. for 3 min, 95? C. for 15 s, 60? C. for 15 s, 72? C. for 1 min, for 35 cycles, and 72? C. for 5 min.
(22) As shown in
(23) 2. Construction of pLCK-EBIV-eGFP/S
(24) In this step, since the length of the self-cleaved polypeptide 2A sequence (P2A sequence) of Porcine teschovirus 1 is too short, only 66 bp, which is not convenient for gel recovery, the sequences were added into primers eGFP-R and CS-F, respectively, and then inserted into the plasmid by homologous recombination. The sequences of the primers used are shown in Table 1.
(25) TABLE-US-00001 TABLE1 Primer Name Sequence eGFP-F ctttttcaatggtgagcaagggcgaggag,asshown inSEQIDNO.9 eGFP-R ctccagcctgcttcagcaggctgaggttagtagctccgc ttcccttgtacagctcgtccatgccgag,asshown inSEQIDNO.10;Theunderlinerepresents thefirst43nucleotidesoftheP2A sequenceinthe5to3direction;The boldrepresentsthepartoverlappingwith theCS-Fprimer; CS-F cctgctgaagcaggctggagacgtggaggagaaccctggac ctttggagctagaatttgaagatgtccctactaac,as showninSEQIDNO.11;Theunderline representsthelast43nucleotidesofthe P2Asequenceinthe5to3direction; Theboldrepresentstheportion overlappingtheeGFP-Rprimer. CS-R cgcccttgctcaccattgaaaaagaaagaataagtcaaagact caaatcctctagtag,asshowninSEQIDNO.12 P2A ggaagcggagctactaacttcagcctgctgaagcaggctggag acgtggaggagaaccctggacct,asshowninSEQ IDNO.13
(26) (1) Obtain eGFP Fragment
(27) The plasmid pcDNA3.1-eGFP (Biofeng) carrying eGFP was used as a template for amplification using KOD One? PCR Master Mix-Blue (TOYOBO) and the primers (eGFP-F and eGFP-R) shown in the primer table 1 to obtain a specific fragment of eGFP (as shown in SEQ ID NO. 17). As shown in
(28) The PCR reaction system of 50 ?L: 2? Reaction Mix Buffer, 25 ?L, 10 ?M eGFP-F, 2 ?L, 10 ?M eGFP-R, 2 ?L, Template DNA, 1 ?L, and Nuclease-Free Water, 20 ?L. The amplification condition: 98? C. for 10 s, 57? C. for 5 s, 68? C. for 30 s, for 25 cycles.
(29) (2) Obtain Linearized pLCK-EBIV-S Fragment
(30) The pLCK-EBIV-S plasmid was used as a template for amplification using KOD One? PCR Master Mix-Blue-(TOYOBO) and the primers (CS-F and CS-R) as shown in Table 1. The result is shown in
(31) The PCR reaction system of 50 ?L: 2? Reaction Mix Buffer, 25 ?L, 10 ?M CS-F, 2 ?L, 10 ?M CS-R, 2 ?L, Template DNA, 1 ?L, and Nuclease-Free Water, 20 ?L. The amplification condition included: 98? C. for 10 s, 57? C. for 5 s, 68? C. for 30 s, for 25 cycles.
(32) (3) Construction of pLCK-EBIV-eGFP/S Plasmid
(33) Since P2A was only 66 bp, it was added to primers eGFP-R and CS-F and both were inserted into the vector by homologous recombination. The reaction system for homologous recombination of 20 ?L: 5? Reaction Buffer, 4 ?L, eGFP fragment, 30 ng, cS fragment, 60 ng, Enzyme, 2 ?L, and Nuclease-Free Water, 33 ?L. The reaction condition: 37? C. for 30 min. Transformation of the ligation product was performed by using XL10 competent cells. The cultured single colony was subjected to colony PCR using primers eGFP-F and eGFP-R. The results are shown in
(34) Preparation of Recombinant EBIV
(35) In this example, the sequences of pLCK-EBIV-L, pLCK-EBIV-M, and pLCK-EBIV-eGFP/S after sequencing are as shown in SEQ ID NO. 18-20. The three plasmids were co-transfected into BSR-T7 cells (RE59683, Sciencell) to generate the recombinant EBIV.
(36) 1. Preparation Method
(37) The concentrations of plasmids pLCK-EBIV-eGFP/S, pLCK-EBIV-M, and pLCK-EBIV-L were determined by Nanodrop; BSR-T7 cells were prepared and inoculated into 12-well cell culture plate (the number of cells in each well was 2?10.sup.5). The cells were cultured in a cell incubator with a temperature of 37? C. and a CO.sub.2 concentration of 5% until the cell confluence was 40-50%. The plasmids pLCK-EBIV-eGFP/S, pLCK-EBIV-M, and pLCK-EBIV-L were mixed in a mass ratio of 1:1:1 and 1:2:3 (the total mass of mixed plasmids was 1.5 mg). Then the mixed plasmids were added into 100 ?L of serum-free medium (Gibco Opti-MEM), and then added with 4.5 ?L of transfection reagent (Item No. MIR 2305, specification 5?1 mL, Minis). The mixture was gently mixed well and then incubated at room temperature for 15-30 min. The medium of BSR-T7 cell was changed into the DMEM medium containing 2% FBS. Then, the above-mentioned transfection mixture was gently dropped into the wells. The control group cells were added with the same amount of null vector plasmid transfection mixture. The cell plate was placed into a cell incubator with a temperature of 37? C. and a CO.sub.2 concentration of 5% for culture. After transfection, the cell status and fluorescence expressions of the experimental group and control group were observed by Olympus inverted fluorescence microscope every 24 h. Rescue efficiency (%)=the number of wells showing cytopathic effect/number of experimental wells?100%.
(38) The detection of virus titer: the rescued virus was diluted to 10.sup.?6 with a 10-fold gradient with DMEM medium. Add 100 ?L of virus dilution into a 24-well cell culture plate containing BHK-21 cell monolayer at 37? C. After incubation for 1 h, remove virus dilution and add 500 ?L DMEM cover containing 1.0% sodium carboxymethyl cellulose. The culture was performed in a 37? C. incubator for 3 d. After that, cells were immobilized with 3.7% formaldehyde overnight, and stained with 2% crystal violet to count the number of plaques. Virus titer (PFU/mL)=the number of plaques/(dilution factor?inoculation volume per well).
(39) 2. Results
(40) As a result, as shown in
(41) TABLE-US-00002 TABLE 2 Three- Number of wells plasmid showing the Total number rescue cytopathic of experiment Rescue Average virus ratio effect wells efficiency titer (PFU/mL) 1:1:1 3 10 30% 4.20 ? 10.sup.5 1:2:3 7 10 70% 4.15 ? 10.sup.5
(42) At the same time, according to the results in Table 2, when the co-transfection ratio of pLCK-EBIV-eGFP/S, pLCK-EBIV-M and pLCK-EBIV-L plasmids is 1:2:3, the rescue efficiency of recombinant EBIV is higher than that of the co-transfection ratio of 1:1:1. Furthermore, in the present application, the constructed recombinant EBIV (named as green fluorescent-labeled recombinant EBIV, rEBIV/eGFP/S) was deposited at the China Center for Type Culture Collection on Jan. 25, 2022, with the deposit address of Wuhan University, Wuhan, China (address of No. 299, Bayi Road, Wuhan City, Hubei Province), and Deposit Number of CCTCC NO. V202204.
(43) Continuous Passage of Recombinant EBIV
(44) Furthermore, the present application also studies the stability of the fluorescence signal of the continuous passaged recombinant EBIV. The specific steps were as follows.
(45) 1. Materials and Methods
(46) (1) A 6-well plate for BHK-21 cells (hamster kidney cells, Procell Life Science&Technology Co., Ltd, Wuhan) was prepared. DMEM medium (Gibco) containing 10% FBS (Gibco) was used as a culture medium. The experiment would be conducted when the cells grew to 40-50%.
(47) (2) 100 ?l of the recombinant EBIV obtained above was added into BHK-21 cells, which were then incubated in a 37? C. incubator for 1 h. Remove the cell supernatant and add DMEM medium containing 2% FBS. The cell plate was placed in an incubator with a temperature of 37? C. and a CO.sub.2 concentration of 5% for culture. Cell fluorescence and cell status were observed every 24 hours. After the cells developed the cytopathic effect, the cell supernatant was inoculated into new cells. The virus was serially passaged for 10 generations to observe whether its fluorescence was stable.
(48) (3) the RNA of each generation of the P1-P10 virus was extracted to RT-PCR.
(49) (4) RNA Extraction: 200 ?L of each generation of P1-P10 virus was collected. S-48 flux nucleic acid extractor (NanoMagBio) and its matching kit, magnetic bead method virus RNA extraction kit (NanoMagBio) were used to perform RNA extraction.
(50) (5) RT-PCR: RT-PCR amplification reactions were performed using PrimeScript? One Step RT-PCR Kit Ver. 2 (Dye Plus) (Takara). The system of 50 ?L: 2? One Step Buffer (Dye Plus), 25 ?L, PrimeScript one Step Enzyme Mix, 2 ?L, each of upstream and downstream primers (see eGFP-Test-F/R in Primer Table 1), 1 ?L, each of RNA of P1-P10, 1 ?L, and RNase Free dH.sub.2O, 20 ?L. The amplification condition: 50? C. for 30 min, 94? C. for 2 min, 94? C. for 30 s, 55? C. for 30 s, for 35 cycles, and 72? C. for 1 min.
(51) 2. Results
(52) The results shown in
(53) Application of Antiviral Drug Screening
(54) Further, the recombinant EBIV disclosed in the examples of the present application can also be used for the screening of antiviral drugs, for example for the screening of antiviral compounds. The specific steps were as follows.
(55) (1) A 96-well plate for BHK-21 cells was prepared. The cells were planked at 10.sup.4 cells/well. The plate was cultured in a cell incubator with a temperature of 37? C. and a CO.sub.2 concentration of 5%. The drug screening test was conducted when the cells grew to 40-50%. The drug to be tested was dissolved in dimethyl sulfoxide. Then the drug was diluted to 100 ?M with DMEM medium containing 2% FBS. After that, the drug was subjected to serial 2-fold dilution to obtain the dilution gradient with the concentration of 100 ?M, 50 ?M, 25 ?M, 12.5 ?M, 6.25 ?M, 3.125 ?M, and 1.5625 ?M, respectively (the concentration of DMSO in the diluted drug shall be <0.1%).
(56) (2) The original culture medium was removed from the 96-well plate. The virus was inoculated into the 96-well plate at an MOI of 0.01 and a volume of 100 ?L/well. At the same time, the diluted drugs to be tested were respectively added into the same 96-well plate at 100 ?L/well and mixed well with the virus solution. The plate was incubated in a cell incubator with a temperature of 37? C. and a CO.sub.2 concentration of 5% for 36 hours before detection.
(57) (3) The 96-well plate was photographed and data was analyzed using a high content screening (HCS) system to determine the amount of fluorescence per well and calculate the Z-factor for each compound:
(58)
where the four parameters ?.sub.s, ?.sub.c, ?.sub.s, and ?.sub.c represent the standard deviation and mean of the sample to be tested (s) and the negative (c) control, respectively. The stability and sensitivity of the screening system were then assessed using the Z-factor:
(59)
where the four parameters ?.sub.p, ?.sub.n, ?.sub.p, and ?.sub.n represent the standard deviation and mean of the positive sample (p) and the negative (n) control, respectively.
(60) (4) Cell viability per well (and the percentage of cells remaining per well) was observed under a microscope and the half-maximal effect concentration (EC50) of the drug was calculated using GraphPad Prism 9 software and an EC50 graph was plotted.
(61) As can be seen in
(62) TABLE-US-00003 TABLE 3 Drug Name Z-factor Cell viability Psoralidin 0.46 50% Isobavachalcone 0.58 30% Epigallocatechol 0.51 0% Cantharidin 0.50 50% Chenodeoxycholic acid 0.59 70% Beta, beta-dimethyl acryl shikonin 0.53 70% Clinodiside Aogenin A 0.54 100% Diosmin 0.58 100% Secoxyloganin 0.56 100%
(63) The above experimental results prove that the recombinant EBIV stably carrying the green fluorescent protein in the present application can provide a research basis for in vivo and in vitro virus tracing, virus detection, antiviral drugs, and vaccine screening, and has a very important application prospect.
(64) The above is only the preferred specific implementation method of this application, and the scope of this application is not limited to this. Any changes or replacements that can be easily thought of by technical personnel familiar with the technical field within the scope of the disclosure in this application should be covered within the scope of this application.