ANTI-HUMAN IL6 MONOCLONAL ANTIBODIES, PREPARATION METHOD THEREFOR AND USE THEREOF

Abstract

The present invention provide anti-human IL6 monoclonal antibodies, amino acid sequences of the variable region of the heavy chain and of the variable region of the light chain thereof, and encoding nucleotide sequences thereof. The present invention also provides a method for preparing the anti-human IL6 monoclonal antibodies and use of the anti-human IL6 monoclonal antibodies in the preparation of an antitumor drug. The present anti-human IL6 monoclonal antibodies can inhibit cell proliferation by blocking an IL6 signal pathway, thereby achieving the purpose of tumor immunotherapy.

Claims

1. An anti-human IL6 monoclonal antibody, comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises HCDR1, HCDR2 and HCDR3, and the light chain variable region comprises LCDR1, LCDR2 and LCDR3, wherein the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are selected from one of the following combinations: TABLE-US-00030 (a) the amino acid sequence of HCDR1 is RYWMH; the amino acid sequence of HCDR2 is YINPITGYTENNQKFKD; the amino acid sequence of HCDR3 is GIRGFTY; the amino acid sequence of LCDR1 is RASENVDNSDNSFMH; the amino acid sequence of LCDR2 is RASNLDS; the amino acid sequence of LCDR3 is QQTNEAPLT; (b) the amino acid sequence of HCDR1 is NYWMH; the amino acid sequence of HCDR2 is YVIPSTGYTDYNQSFKD; the amino acid sequence of HCDR3 is LLPGFAY; the amino acid sequence of LCDR1 is RSSQSLVDSNGNTYLH; the amino acid sequence of LCDR2 is KVSNRFS; the amino acid sequence of LCDR3 is SQSTHVPPT; (c) the amino acid sequence of HCDR1 is NYWMH; the amino acid sequence of HCDR2 is YIDPRTASIYYNQKFKD; the amino acid sequence of HCDR3 is ILYGKYDV; the amino acid sequence of LCDR1 is RSSQSLVDSNGNTYLH; the amino acid sequence of LCDR2 is KVSNRFS; the amino acid sequence of LCDR3 is SQSTHVPPT; (d) the amino acid sequence of HCDR1 is DAWMD; the amino acid sequence of HCDR2 is EIRSKTYHPATYYTKSVRG; the amino acid sequence of HCDR3 is PRYYGGYFDY; the amino acid sequence of LCDR1 is RASESVDNYGMSFMN; the amino acid sequence of LCDR2 is TASNQGS; the amino acid sequence of LCDR3 is QQSKEVPYT; (e) the amino acid sequence of HCDR1 is NYIIH; the amino acid sequence of HCDR2 is AIYPGNGDTSYSQKFKD; the amino acid sequence of HCDR3 is GDAGYSAWFAY; the amino acid sequence of LCDR1 is SASESVDSYGNNFMH; the amino acid sequence of LCDR2 is LASKLES; the amino acid sequence of LCDR3 is QQNNEDPLT; (f) the amino acid sequence of HCDR1 is SHTVS; the amino acid sequence of HCDR2 is KMWSNGDTDYDSAIRS; the amino acid sequence of HCDR3 is YYFSSYGGGYFDY; the amino acid sequence of LCDR1 is RASKSVSTYMH; the amino acid sequence of LCDR2 is SASNLES; the amino acid sequence of LCDR3 is QQSDELPDT; and (g) the amino acid sequence of HCDR1 is SFPMA; the amino acid sequence of HCDR2 is TISPSGGTSYSRDSVKG; the amino acid sequence of HCDR3 is ERIYNTYFDY; the amino acid sequence of LCDR1 is LPSEDISSDLA; the amino acid sequence of LCDR2 is NANTLPN; the amino acid sequence of LCDR3 is QQYDSYPYT.

2. The anti-human IL6 monoclonal antibody according to claim 1, wherein the amino acid sequences of its heavy chain variable region and light chain variable region are selected from one of the following combinations: the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 3; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 13, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 17, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 19; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 21, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 23; and the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 25, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 27.

3. The anti-human IL6 monoclonal antibody according to claim 1, wherein the dissociation constant KD between the antibody and IL6 is less than 10 nM.

4. The anti-human IL6 monoclonal antibody according to claim 1, wherein the dissociation constant KD between the antibody and IL6 is less than 1 nM.

5. The anti-human IL6 monoclonal antibody according to claim 1 or 2, wherein the antibody inhibits the promotion of TF-1 cell proliferation by IL6.

6-11. (canceled)

12. the anti-human IL6 monoclonal antibody according to claim 1 to the subject.

13. The method according to claim 12, wherein the tumor is selected from multiple myeloma, non-small cell lung cancer, colorectal cancer, renal cancer, prostate cancer, breast cancer and ovarian cancer.

14. An antitumor pharmaceutical composition, comprising an effective amount of the anti-human IL6 monoclonal antibody according to any claim 1 and a pharmaceutically acceptable carrier.

15. (canceled)

16. The method according to claim 12, wherein the the amino acid sequences of the heavy chain variable region and light chain variable region of the anti-human IL6 monoclonal antibody are selected from one of the following combinations: the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 3; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 13, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 17, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 19; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 21, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 23; and the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 25, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 27.

17. The method according to claim 12, wherein the dissociation constant KD between the anti-human IL6 monoclonal antibody and IL6 is less than 10 nM.

18. The method according to claim 12, wherein the dissociation constant KD between the anti-human IL6 monoclonal antibody and IL6 is less than 1 nM.

19. The method according to claim 12, wherein the anti-human IL6 monoclonal antibody inhibits the promotion of TF-1 cell proliferation by IL6.

20. The antitumor pharmaceutical composition according to claim 14, wherein the the amino acid sequences of the heavy chain variable region and light chain variable region of the anti-human IL6 monoclonal antibody are selected from one of the following combinations: the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 3; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 13, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 17, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 19; the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 21, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 23; and the heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 25, and the light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 27.

21. The antitumor pharmaceutical composition according to claim 14, wherein the dissociation constant KD between the anti-human IL6 monoclonal antibody and IL6 is less than 10 nM.

22. The antitumor pharmaceutical composition according to claim 14, wherein the dissociation constant KD between the anti-human IL6 monoclonal antibody and IL6 is less than 1 nM.

23. The antitumor pharmaceutical composition according to claim 14, wherein the anti-human IL6 monoclonal antibody inhibits the promotion of TF-1 cell proliferation by IL6.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG. 1 shows the ELISA titer test results of sera from mice immunized with human IL6.

[0040] FIG. 2 shows the ELISA titer test results of sera from rats immunized with human IL6.

[0041] FIG. 3 shows the curve of the specific binding of the anti-IL6 monoclonal antibodies of the present invention to IL6 recombinant protein.

[0042] FIG. 4 shows the curve of the specific inhibition of TF-1 cell proliferation by the anti-IL6 monoclonal antibodies of the present invention.

[0043] FIG. 5 shows the measurement result of the affinity of the anti-IL6 monoclonal antibodies of the present invention for IL6 protein.

DETAILED DESCRIPTION OF THE INVENTION

[0044] Unless otherwise specified, the technical and scientific terms used in the present invention have the same meanings as generally understood by those skilled in the art.

[0045] As used herein, the term “antibody” generally refers to an immunoglobulin molecule, which is usually a tetramer composed of two identical heavy chains and two identical light chains connected to each other via disulfide bonds. According to the differences in the conservation of the amino acid sequences, heavy chains and light chains are divided into a variable region (V) at the amino terminal and a constant region (C) at the carboxy terminal. In each of the variable regions of heavy chains and light chains, there are three local regions, which have a higher degree of variation in the amino acid composition and arrangement order and are the key positions for the binding of an antibody to an antigen, and therefore are also called complementarity determining regions (CDR). In the context, the three heavy chain complementarity determining regions are called HCDR1, HCDR2 and HCDR3, respectively, and the three light chain complementarity determining regions are called LCDR1, LCDR2 and LCDR3, respectively. The variable regions of one heavy chain and one light chain interact with each other to form an antigen binding site (Fv). Depending on the amino acid sequences of the heavy chain constant regions, antibodies can be divided into different classes. There are five main classes of intact antibodies: IgA, IgD, IgE, IgG and IgM, and some of them can be further divided into subclasses, such as IgG1, IgG2, IgG3, IgG4, IgA and IgA2. For different classes of immunoglobulins, their subunit structures and three-dimensional conformations are known in the art. The present invention is intended to include any of the aforementioned classes or subclasses of antibodies.

[0046] As used herein, the term “antibody” is also intended to encompass its digestive fragments or functional variants, for example, antibody fragments capable of binding to IL6 or parts thereof, including, but not limited to Fab (e.g., those obtained by papain digestion of antibodies), F(ab′)2 (e.g., those obtained by pepsin digestion), Fv or scFv (e.g., those obtained by molecular biotechnology).

[0047] As used herein, the term “monoclonal antibody” refers to an antibody that is homogeneous and is directed only against a certain specific antigenic epitope. In contrast to common polyclonal antibody preparations which typically include different antibodies against different antigenic determinants (epitopes), each monoclonal antibody is directed against a single antigenic determinant on the antigen. The term “monoclonal” refers to the homogenous characteristic of antibodies and should not be explained as antibodies produced by any specific method. The monoclonal antibodies of the present invention are preferably produced by recombinant DNA method, or by screening methods described elsewhere herein.

[0048] As used herein, the term “an isolated polynucleotide” refers to a polynucleotide in a state that is not naturally occurring in nature, including polynucleotides isolated from nature (including organisms) by biological techniques, and also including artificially synthesized polynucleotides. An isolated polynucleotide can be genomic DNA, cDNA, mRNA or other synthetic RNA, or a combination thereof. The present invention provides multiple nucleotide sequences encoding heavy chain variable regions and light chain variable regions of anti-human IL6 monoclonal antibodies. It should be noted that those skilled in the art, based on the degeneracy of codons, can design nucleotide sequences that are not completely identical to the nucleotide sequences provided above, but encode the same amino acid sequences, according to the amino acid sequences of heavy chain variable regions and light chain variable regions provided herein. These altered nucleotide sequences are also included in the scope of the present invention.

[0049] When relating to polynucleotide, the term “vector” used herein refers to any molecule (e.g., nucleic acids, plasmids, or viruses, etc.) for transferring nucleotide encoding information to a host cell. The term “expression vector” or “expression cassette” refers to a vector suitable for expression of a gene of interest (a nucleotide sequence to be expressed) in a host cell, which generally comprises the elements such as the gene of interest, a promoter, a terminator, and a marker gene.

[0050] As used herein, the term “host cell” refers to a cell that has been or can be transformed with a nucleic acid sequence and thereby expresses the selected gene of interest. The term includes the progeny of parent cells, no matter whether the progeny is identical to the original parent cells in morphology or genetic composition, as long as the selected gene of interest is present in the progeny. Commonly used host cells include bacteria, yeasts, mammalian cells, etc.

[0051] As used herein, the term “transfection” refers to the uptake of foreign or exogenous DNA by the cell. This technique can be used to introduce one or more exogenous DNA parts into a suitable host cell. Cells can be induced by physicochemical methods (such as by calcium chloride treatment) so that they are in a physiological state most suitable for uptaking and accommodating foreign DNA, i.e. “competent”.

[0052] When a pharmaceutical composition is mentioned, the term “an effective amount” used herein refers to an amount that can lead to a function or activity in human and/or animal and can be accepted by human and/or animal. The term “a pharmaceutically acceptable carrier” refers to a carrier for administration, including various excipients, diluents, buffers and the like, which are suitable for administration to human and/or animal without excessive adverse side effects, and meanwhile are suitable for maintaining the activity of the drug or active agent contained therein.

[0053] Some aspects of the present invention will be described in detail by combining the following examples. Unless otherwise specified, the methods and materials in the Examples described below are commercially available conventional products.

EXAMPLES

Example 1: Obtainment of Human IL6 Hybridoma Cell Line

[0054] 1) Animal Immunization

[0055] Tag-free human IL6 recombinant protein (GenScript, Cat. No. Z03034) was used as antigen. Female Balb/c and C57bl/6 mice and Wistar rats were subcutaneously immunized with a 1:1 emulsion of 200 μl Freund's complete adjuvant (Sigma-Aldrich) containing 50 μg IL6 protein. Then, a 1:1 emulsion of Freund's incomplete adjuvant (Sigma-Aldrich) containing 25 μg IL6 was injected intraperitoneally/subcutaneously alternately every two weeks up to three times, thereby boosting the mice. Four days before myeloma fusion, a mouse (#3509) and a rat (#3693) showing the highest antibody titer (see FIG. 1 and FIG. 2, the antibody titer was determined by using serum ELISA method) were boosted by intraperitoneal administration of 25 μg IL6 (without adjuvant).

[0056] 2) Hybridoma Fusion and Screening

[0057] The spleen was extracted and homogenized to produce a single-cell suspension, and meanwhile a single-cell suspension of myeloma cell (SP2/0) was prepared. 8.9×10.sup.7 spleen cells and 4.1×10.sup.7 SP2/0 mouse myeloma cells were fused by electrofusion. The fused cells were re-suspended in 100 ml DMEM/10% FBS medium containing hybridoma cell selectors thymidine, hypoxanthine and aminopterin, and a volume of 100 μl was transferred to a 96-well plate with a pipette. The plate was incubated at 37° C. in 6% CO.sub.2. After incubation for 7 days, the presence of antibodies against IL6 was detected by using the ELISA binding assay described below.

[0058] ELISA binding assay: antibodies in the supernatant were evaluated for the binding ability to IL6 by indirect ELISA. The ELISA plate (Nunc) was coated with 0.5 μg/ml recombinant IL6 protein in PBS at 100 μl/well at 4° C. overnight. The plate was washed with PBS-T (0.05% Tween) and blocked with PBST containing 1% BSA at 200 μl/well at 37° C. for 0.5 h. The blocking solution was then discarded, and 100 μl hybridoma cell culture supernatant was added to each plate. The incubation was then performed for 1 h at room temperature. The plate was washed with PBST for three times and was incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (Fab-specific) (GenScript) at 100 μl/well at 37° C. for 0.5 h. The plate was washed with PBST for five times, and TMB chromogenic solution (GenScript) was then added. Incubation was performed at room temperature in dark for 15 min. The reaction was stopped by adding 50 μl 1M HCl stop solution (Sigma). The plate was read at 450 nm by a Microplate Reader.

[0059] 3) Hybridoma Subcloning

[0060] Subcloning was performed by limiting dilution method. A hemocytometer was used and cells were subjected to serial dilution in DMEM/10% FBS medium containing hybridoma cell selectors thymine, hypoxanthine and aminopterin to determine the number of cells until the cell density reached 5-15 cells/ml. For each hybridoma, 200 μl cell solution was pipetted into 96 wells at a density of 1-3 cells/well. After culturing the cultures at 37° C. in 5% CO.sub.2 for 1 week, the supernatant was subjected to the ELISA binding assay described above to evaluate the presence of antibodies against IL6.

Example 2: Sequencing of Variable Regions of Monoclonal Antibodies and Recombinant Production of Antibodies

[0061] After identifying the subtypes of antibodies in the hybridoma cell culture supernatant with a rapid ELISA mouse antibody subtype identification kit (Clonotyping System-HRP, SouthernBiotech), total RNA was extracted from 3×10.sup.6-5×10.sup.6 hybridoma cells by using TRIzol (Ambion), and was reverse-transcribed into cDNA by using antibody subtype-specific primers and universal primers (PrimeScript™ 1stStrand cDNA Synthesis Kit, Takara). The mouse immunoglobulin heavy and light chain V-region fragments were then amplified by RACE PCR (GenScript), and the resulting PCR fragments were subcloned into pMD18-T vector system (Takara), and the inserted fragments were sequenced using vector-specific primer pairs. The unique V-region nucleotide/amino acid sequences of the clones 8H10B7E6, 23A9H3, 29D6B5, 41A10B8, 49F10H6, 53A2F9 (rat), and 61G1D8 (rat) were finally obtained. In the amino acid sequences of the heavy chain and light chain, the CDR1 regions are underlined with solid line, the CDR2 regions are underlined with dotted line, and the CDR3 regions are underlined with wavy line.

[0062] The amino acid sequence of heavy chain variable region of 8H10B7E6: SEQ ID NO: 1

TABLE-US-00002 [00001] [00002] LVTVSA

[0063] The nucleotide sequence of heavy chain variable region of 8H10B7E6: SEQ ID NO: 2

TABLE-US-00003 CAGGTCCAGCTTCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTC AGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTAACTAGGTACTGGA TGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATAC ATTAATCCTATCACTGGTTATACTGAGAACAATCAGAAGTTCAAGGACAA GGCCACATTGACTGCAGACAAGTCCTCCAGCACAGCCTATATACAACTGA GCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAGAGGGATA CGGGGGTTTACTTACTGGGGCCATGGGACTCTGGTCACTGTCTCTGCA

[0064] The amino acid sequence of light chain variable region of 8H10B7E6: SEQ ID NO: 3

TABLE-US-00004 [00003] [00004]

[0065] The nucleotide sequence of light chain variable region of 8H10B7E6: SEQ ID NO: 4

TABLE-US-00005 GACATTGTGCTGACCCAATCTCCAGCTTCTTTGGCTGTGTCTCTAGGGCA GAGGGCCACCATATCCTGCAGAGCCAGTGAGAATGTTGATAACTCTGACA ATAGTTTTATGCACTGGTACCAACAGAAACCAGGACAGCCACCCAAACTC CTCATCTATCGTGCATCCAACCTAGATTCTGGGATCCCTGCCAGGTTCAG TGGCAGTGGGTCTAGGACAGACTTCACCCTCACCATTAATCCTGTGGAGG CTGATGATGTTGCAACCTATTACTGTCAGCAAACTAATGAGGCTCCGCTC ACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAA

[0066] The amino acid sequence of heavy chain variable region of 23A9H3: SEQ ID NO: 5

TABLE-US-00006 [00005] [00006] GTLVTVSA

[0067] The nucleotide sequence of heavy chain variable region of 23A9H3: SEQ ID NO: 6

TABLE-US-00007 CAGGTCCAGCTTCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTC AGTGAAGATGTCCTGCAAGACTTCTGGCTACACCTTTACTAACTACTGGA TGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAGTGGATTGGATAC GTTATTCCTAGCACTGGTTATACTGACTACAATCAGAGTTTCAAGGACAA GGCCACATTGACTGCAGACAAATCCTCCAACACAGCCTACATGCAAGTGA ACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGCCTACTG CCAGGTTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA

[0068] The amino acid sequence of light chain variable region of 23A9H3: SEQ ID NO: 7

TABLE-US-00008 [00007] [00008]

[0069] The nucleotide sequence of light chain variable region of 23A9H3: SEQ ID NO: 8

TABLE-US-00009 GATGTTGTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGA TCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCCTTGTGGACAGTAATG GAAACACTTATTTACATTGGTACCTGCAGAAGCCAGGCCAGTCTCCAAAG CTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTT CAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTGG AGGCTGAGGATCTGGGGGTTTATTTCTGCTCTCAAAGTACACATGTTCCT CCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA

[0070] The amino acid sequence of heavy chain variable region of 29D6B5: SEQ ID NO: 9

TABLE-US-00010 [00009] [00010] AGTTVIVSS

[0071] The nucleotide sequence of heavy chain variable region of 29D6B5: SEQ ID NO: 10

TABLE-US-00011 CAGGTCCAGCTTCAGCAGTCTGGGGCTGAACTGGCAGAACCTGGGGCCTC AGTGAAGATGTCCTGCAAGGCTTCTGGCTACAACTTTAATAACTATTGGA TGCACTGGGTAAAACAGGGGCCTGGCCAGGGTCTGGAATGGATTGGATAC ATTGATCCTAGGACTGCTTCTATTTATTACAATCAGAAGTTCAAAGACAA GGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGA GCAGCCTGACATCTGAAGACTCTGCAGTCTATTACTGTGCAAGAATCCTC TATGGTAAATATGATGTCTGGGGCGCAGGGACCACGGTCATCGTCTCCTC A

[0072] The amino acid sequence of light chain variable region of 29D6B5: SEQ ID NO: 11

TABLE-US-00012 [00011] [00012]

[0073] The nucleotide sequence of light chain variable region of 29D6B5: SEQ ID NO: 12

TABLE-US-00013 GATGTTGTGCTGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAAA TCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCCTTGTAGACAGTAATG GAAACACCTATTTACATTGGTACCTGCAGAAGCCAGGCCAGTCTCCAAAG GTCCTGATCCACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTT CAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTGG AGGCTGAGGATCTGGGAGTTTATTTCTGCTCTCAAAGTACACATGTTCCT CCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA

[0074] The amino acid sequence of heavy chain variable region of 41A10B8: SEQ ID NO: 13

TABLE-US-00014 [00013] [00014] WGQGTTLTVSS

[0075] The nucleotide sequence of heavy chain variable region of 41A10B8: SEQ ID NO: 14

TABLE-US-00015 GAAGTGAAACTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATC CATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGA TGGACTGGGTCCGCCAGTCTCCAGACAAGGGGCTTGAGTGGGTTGCTGAA ATTAGAAGCAAAACTTATCATCCTGCAACATACTATACTAAGTCTGTGAG AGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGC AGATGAACAACTTAGGAGCTGAAGACACTGGCATTTATTACTGTACCAGG CCGAGATACTACGGGGGTTACTTTGACTACTGGGGCCAAGGCACCACTCT CACAGTCTCCTCA

[0076] The amino acid sequence of light chain variable region of 41A10B8: SEQ ID NO: 15

TABLE-US-00016 [00015] [00016]

[0077] The nucleotide sequence of light chain variable region of 41A10B8: SEQ ID NO: 16

TABLE-US-00017 GACATTGTGCTGACCCAATCTCCAGCTTCTTTGGCTGTGTCTCTAGGGCA GAGGGCCACCATCTCCTGCAGAGCCAGCGAAAGTGTTGACAATTATGGCA TGAGTTTTATGAACTGGTTCCAACAGAAACCAGGACAGCCACCCAAACTC CTCATCTATACTGCTTCCAACCAAGGATCCGGGGTCCCTGCCAGGTTTAG TGGCAGTGGGTCTGGGACAGACTTCAGCCTCAACATCCATCCTATGGAGG AGGATGATACTGCAATGTATTTCTGTCAACAAAGTAAGGAGGTCCCGTAT ACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA

[0078] The amino acid sequence of heavy chain variable region of 49F10H6: SEQ ID NO: 17

TABLE-US-00018 [00017] [00018] WGQGTLVTVSA

[0079] The nucleotide sequence of heavy chain variable region of 49F10H6: SEQ ID NO: 18

TABLE-US-00019 CAGGTGCAACTGCAGCAGCCTGGGGCTGAACTGGTGAAGCCTGGGGCCTC AGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAATTACATTA TCCACTGGATAAAACAGACACCTGGACAGGGCCTGGAATGGATTGGAGCT ATTTATCCAGGAAATGGTGATACTTCCTACAGTCAGAAGTTCAAAGACAA GGCCACATTGACTGCAGACAGATCCTCCAGCACAGCCTACATGCAGCTCA GCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAGAGGGGAT GCGGGTTACTCCGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCAC TGTCTCTGCA

[0080] The amino acid sequence of light chain variable region of 49F10H6: SEQ ID NO: 19

TABLE-US-00020 [00019] [00020]

[0081] The nucleotide sequence of light chain variable region of 49F10H6: SEQ ID NO: 20

TABLE-US-00021 AACATTGTACTGACCCAATCTCCAGCTTCTTTGGCTGTGTCTCTAGGACA GAGGGCCACCATATCCTGCAGTGCCAGTGAAAGTGTTGATAGTTATGGCA ATAATTTTATGCACTGGTATCAGCAGAGACCAGGACAGCCACCCAAACTC CTCATTTATCTTGCATCCAAGCTAGAATCTGGGGTCCCTGCCAGGTTCAG TGGCAGTGGGTCTAGGACAGAGTTCACCCTCACCATTGACCCTGTGGAGG CTGAAGATGCTGCAACCTATTACTGTCAGCAAAATAATGAGGATCCGCTC ACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAA

[0082] The amino acid sequence of heavy chain variable region of 53A2F9: SEQ ID NO: 21

TABLE-US-00022 [00021] [00022] GQGVMVTVSS

[0083] The nucleotide sequence of heavy chain variable region of 53A2F9: SEQ ID NO: 22

TABLE-US-00023 CAAGTCCAACTAAAGGAGTCAGGACCTGGTCTGGTACAGCCATCACAGAC CCTGTCTCTCACCTGCACTGTCTCTGGGTTTTCATTAACCAGCCATACTG TAAGCTGGATTCGGCAGCCTCCAGGAAGGGGTCTGGAGTGGATGGGAAAA ATGTGGAGTAATGGAGACACAGATTATGATTCAGCTATCAGATCCCGACT GAGCATCACCAGGGACACCTCGAAGAGCCAAGTTTTCTTAAAGATAAACA GTCTGCAAACTGAAGACACAGCCATGTACTTCTGTGCCAGATATTACTTT AGCAGCTATGGAGGTGGCTACTTTGATTACTGGGGCCAAGGAGTCATGGT CACAGTCTCCTCA

[0084] The amino acid sequence of light chain variable region of 53A2F9: SEQ ID NO: 23

TABLE-US-00024 [00023] [00024]

[0085] The nucleotide sequence of light chain variable region of 53A2F9: SEQ ID NO: 24

TABLE-US-00025 GACACTGTGCTGACCCAGTCTCCTGCTTTGGCTGTGTCTCTAGGACAGAG GGTCACCATCTCTTGTAGGGCCAGCAAAAGTGTCAGTACATATATGCACT GGTACCAACAGAAATCGGGACAGCAACCCAAACTCCTGATCTATAGTGCA TCCAACCTAGAATCTGGAGTCCCTTCCAGGTTCAGTGGGAGTGGGTCTGG GACAGACTTTACCCTCACCATAGATCCTGTGGAGGCTGATGACATAGCAA ACTATTACTGTCAGCAGAGTGATGAACTTCCGGACACCTTTGGAGCTGGG ACCAAGCTGGAACTGAAA

[0086] The amino acid sequence of heavy chain variable region of 61G1D8: SEQ ID NO: 25

TABLE-US-00026 [00025] [00026] GVMVTVSS

[0087] The nucleotide sequence of heavy chain variable region of 61G1D8: SEQ ID NO: 26

TABLE-US-00027 GAGGTGCAGCTGCTAGAATCTGGGGGCGGTTTAGTGCAGCCTGGAAGGTC CATGAAACTCTCCTGTGCGGCCTCAGGATTCACTTTCAGTAGCTTTCCAA TGGCCTGGGTCCGCCAGACTCCATCGAAGGCTCTGGAGTGGGTCGCAACC ATTAGTCCTAGTGGTGGTACCTCTTACTCTCGAGACTCCGTGAAGGGCCG ATTCACTATCTCCAGAGATAATGCAAACAGCACCCTATGTCTACACATGG ACAGTCTGAAGTCTGAGGACACGGCCACTTATTATTGTTTACGAGAAAGG ATTTATAACACTTACTTTGATTACTGGGGCCAAGGAGTCATGGTCACAGT CTCCTCA

[0088] The amino acid sequence of light chain variable region of 61G1D8: SEQ ID NO: 27

TABLE-US-00028 [00027] [00028]

[0089] The nucleotide sequence of light chain variable region of 61G1D8: SEQ ID NO: 28

TABLE-US-00029 GATATCCGGATGACACACTCTCCAGCTTCCCTGTCTGCATCTCTGGGAGA GACTGTCAGCATCGAATGTCTACCAAGTGAGGACATTTCCAGTGATTTAG CATGGTATCAGCAGAAGCCAGGGAAATCTCCTCAGCTCCTCATCTATAAT GCAAATACTTTGCCAAATGGGGTCCCTTCACGGTTTAGTGGCAGTAGATC TGGCGCACAGTATTTTCTAAAAATAAACAGCCTGCAATCTGAGGATGTCG CGACTTATTTCTGTCAGCAATATGACAGTTATCCGTACACGTTTGGAACT GGGACCAAGCTGGAACTGAAA

[0090] DNA fragment comprising light chain variable region+constant region and DNA fragment comprising heavy chain variable region+constant region were synthesized, respectively, and were inserted into pTT5 expression vectors to form expression plasmids, respectively.

[0091] HEK293-6E cells were co-transfected with the expression plasmids above and cultured in a shake flask at 37° C. for 10 days. The supernatant was collected for antibody purification. Prior to purification, the tube and protein A column were depyrogenated with 0.2 M NaOH. The column was re-equilibrated with a buffer containing 0.05 M Tris and 1.5 M NaCl (pH 8.0). The harvested cell culture supernatant was then 1:1 diluted with 2× the buffer above and sterilized by filtration. The filtered supernatant and the protein A column were incubated at room temperature for 2 h. After washing the column with 1× the buffer above, IgG was eluted with sterile 0.1 M sodium citrate (pH 3.5). The eluate was collected and neutralized with one-ninth volume of sterile 1M Tris-HCl (pH9). Under sterile conditions, the buffer of the product was exchanged for PBS (pH7.4) to remove any elution buffer and the sample was concentrated. After concentration, antibodies were quantified by OD280 nm using an extinction coefficient Ec of 1.43 (0.1%).

[0092] Purified antibodies were analyzed by SDS-PAGE using 10% precast gel (GenScript) in BioRad electrophoresis system. The gel was stained with Estin2.0 (GenScript), and the molecular size and purity were estimated by comparing the staining bands with Protein Ladder (GenScript).

Example 3: Binding of Monoclonal Antibodies to Human IL6 Recombinant Protein

[0093] The purified antibodies were evaluated for the binding ability to IL6 by indirect ELISA. The ELISA plate (Nunc) was coated with 0.5 μg/ml recombinant IL6 protein in PBS at 100 μl/well at 4° C. overnight. The plate was washed with PBS-T (0.05% Tween) and was blocked with PBST containing 1% BSA at 200 μl/well at 37° C. for 0.5 h. The blocking solution was then discarded. 100 μl 10 μg/ml purified antibody was added to the first well, and 3-fold gradient dilution was performed for 11 test concentration gradients in total. Incubation was then performed at room temperature for 1 h. The plate was washed with PBST for three times and incubated with horseradish peroxidase-conjugated goat anti-mouse/rat IgG (Fab-specific) (GenScript) at 100 μl/well at 37° C. for 0.5 h. The plate was washed with PBST for five times, and TMB chromogenic solution (GenScript) was then added and incubation was performed in dark for 15 min at room temperature. The reaction was stopped by adding 50 μl 1M HCl stop solution (Sigma). The plate was read at 450 nm by a microplate reader. The binding ability of the clones 8H10B7E6, 23A9H3, 29D6B5, 41A10B8, 49F10H6, 53A2F9 (rat), and 61G1D8 (rat) for recombinant protein IL6 was shown in FIG. 3. EC50, as calculated according to ELISA concentration gradient experiments, showed that these antibodies exhibited relatively high affinity for the antigen (ELISA EC50 was less than 25 ng/ml; especially reached 6.32 ng/ml for 53A2F9, which was equivalent to 0.04 nM).

Example 4: Identification of the Epitopes of Monoclonal Antibodies

[0094] The antigen epitopes of the purified antibodies were evaluated by competitive ELISA. The ELISA plate (Nunc) was coated with 0.5 μg/ml recombinant IL6 protein in PBS at 100 μl/well at 4° C. overnight. The plate was washed with PBS-T (0.05% Tween) and was blocked with PBST containing 1% BSA at 200 μl/well at 37° C. for 0.5 h. The blocking solution was then discarded. A pair of antibodies to be tested (one of which was biotin-labeled) for competitive experiment were added to each well at 100 μl (10 μg/ml) for each purified antibody. Incubation was then performed at 37° C. for 1 h. The plate was washed with PBST for three times and incubated with streptavidin HRP (SA-HRP, GenScript) at 100 μl/well at 37° C. for 10 min. The plate was washed with PBST for five times, and TMB chromogenic solution (GenScript) was then added and incubation was performed in dark for 15 min at room temperature. The reaction was stopped by adding 50 μl 1M HCl stop solution (Sigma). The plate was read at 450 nm by a microplate reader. The measurement results show that the clones 8H10B7E6, 23A9H3, 29D6B5 are directed against the same epitope, while 41A10B8, 49F10H6, 53A2F9 (rat), and 61G1D8 (rat) are directed against other four different epitopes, respectively. These results show that the obtained antibodies specific for IL6 have multiple different antigen recognition epitopes. Therefore, the antibodies screened out in the present invention have higher diversity.

Example 5: Detection of the Functions of Monoclonal Antibodies

[0095] The growth of TF-1 cells is granulocyte macrophage colony-stimulating factor (GM-CSF)-dependent. If this factor is deficient or its function is blocked, the proliferation, differentiation and maturation of the cells will be significantly suppressed. In this monoclonal antibody function experiment, the GM-CSF in the medium was replaced with IL6 protein having the same function, and then anti-IL6 monoclonal antibodies were added to determine whether the monoclonal antibodies could block the biological function of IL6 protein by determining the number of live TF-1 cells after a certain period of culture. TF-1 cells were normally cultured in a medium containing GM-CSF, and the cells were collected prior to the experiment, washed twice with a basal medium without GM-CSF and counted. The cells were plated onto several wells in a 96-well plate at 5,000 cells/well (100 μl). IL6 protein was diluted to 0.4 μg/ml with the basal medium, and was added at 50 μl per well, wherein the protein content per well was 20 ng. The antibody was on another plate, and the dilution was started from 100 μg/ml in a 2-fold manner for 10 gradients. Finally, 50 μl was added to the well. Incubation was performed at 37° C. in 5% CO.sub.2 for 7-10 days. 20 μl Promega Substrate Cell Titer 96 Aqueous One Solution Reagent was added to each well. Incubation was performed at 37° C., and the plate was read at 490 nm every half an hour. The best linear data was selected and edited. The inhibitory effect of IL6 antibodies on the growth of TF-1 cells was shown in FIG. 4. These results show that the antibodies screened out by the present invention could effectively inhibit cell proliferation, and especially the inhibitory IC50 reached 3.95 μg/ml, and 4.54 μg/ml for the clones 53A2F9 and 61G1D8 antibodies, respectively.

Example 6: Measurement of Affinity of Monoclonal Antibodies

[0096] The chip surface was equilibrated with HBS-EP buffer at a flow rate of 10 μl/min for 5 min, and then the chip was activated by injecting a 1:1 mixture of “NHS+EDC” at a flow rate of 10 μl/min for 7 min. The capture antibody (Goat anti-mouse IgG) diluted in 10 mM sodium acetate buffer was injected at a flow rate of 10 μl/min for about 7 min for coupling, and finally ethanolamine was injected at a flow rate of 10 μl/min for 7 min for surface blocking.

[0097] HBS-EP buffer was used as a sample to perform three pre-cycles to equilibrate the chip so as to make the baseline stable, and the antibodies diluted in HBS-EP buffer was injected at a flow rate of 10 μl/min for 0 to 5 min (the binding signal of the antibody and the antigen was controlled at ˜100RU by adjusting the capture time), and the chip was equilibrated with buffer for 1 min. The low-concentration antigen 0.33 nM IL6 was injected at a flow rate of 30 μl/min for 5 min to enable the binding between the antigen and the antibody, and then the buffer was injected at a flow rate of 30 μl/min for 15 min to perform dissociation. 50 mM HCl was injected at a flow rate of 100 μl/min for four times and 10s each time for regeneration, and one cycle was completed. The antigen concentration (such as ln IL6) was changed for another cycle of determination at the next gradient concentration until the determination was completed for all the gradient concentrations (0.33 nM, 1 nM, 3 nM, 9 nM, 27 nM IL6) and repeated concentrations (e.g. 9 nM IL6).

[0098] After double deduction of experimental data (control channel and zero concentration), the fitting of a “1:1 Binding” model was performed in Biacore 8K evaluation software. Biacore 8K was used to determine the affinity of antibodies for IL recombinant protein. As shown in FIG. 5, the affinity of monoclonal antibodies specific for IL6 as measured by Biacore reached the magnitude of sub-nM to pM. These results show that the antibodies screened out by the present invention have a very high affinity.

[0099] It should be understood by those skilled in the art to which the present invention pertains that the methods and materials described above are merely exemplary and should not be considered as limiting the scope of the present invention.