mRNA display antibody library and methods
20240190945 ยท 2024-06-13
Assignee
Inventors
Cpc classification
C40B50/06
CHEMISTRY; METALLURGY
C07K2317/94
CHEMISTRY; METALLURGY
C40B40/08
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
C12N15/1037
CHEMISTRY; METALLURGY
C40B30/04
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N15/1062
CHEMISTRY; METALLURGY
C12N15/1041
CHEMISTRY; METALLURGY
C07K17/00
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
International classification
C07K16/00
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C07K17/00
CHEMISTRY; METALLURGY
C07K16/24
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
C40B40/08
CHEMISTRY; METALLURGY
Abstract
Compositions, methods and uses of high-diversity nucleic acid library that encodes a plurality of antibodies or antibody fragments are presented. The high-diversity nucleic acid library comprises or is derived from (1) a V.sub.H-CDR1/2 sub-library, (2) a plurality of V.sub.H-CDR3 sub-libraries, and (3) a V.sub.L sub-library, each of which comprises a plurality of members. Preferably, each member of the sub-libraries comprises at least one random cassette that has a plurality of degenerate base positions. In an especially preferred embodiment, at least portions of at least two members of the V.sub.H-CDR1/2 sub-library, the plurality of V.sub.H-CDR3 sub-libraries, and the V.sub.L sub-library are recombined to form an expression library member in an expression library, where each member of the expression library encodes a distinct antibody or antibody fragment.
Claims
1. A method of generating a high-affinity antibody or antibody fragment from an expression library member comprising a scFv while substantially retaining specificity and affinity of the expression library member in the high-affinity antibody or antibody fragment, comprising: isolating from an expression library a high-affinity expression library member that has a binding affinity to a target antigen of 100 nM or less; wherein the expression library comprises a plurality of distinct expression library members, each expression library member comprising a scFv; wherein the expression library is constructed from a recombination of at least portions of at least two members of a VH-CDR 1/2 sub-library, a plurality of VH-CDR3 sub-libraries, and a VL sub-library to thereby form respective expression library members; wherein each member of the sub-libraries comprises at least one random cassette that has a plurality of degenerate base positions, and wherein the random cassette is generated using an oligonucleotide selected from SEQ ID NO:1SEQ ID NO:25; and grafting CDRs from the VH and/or VL domains of the high-affinity expression library member onto respective scaffolds of an antibody or antibody fragment, wherein the so generated high-affinity antibody or antibody fragment has a binding affinity that is within two orders of magnitude or less as compared to the binding affinity of the expression library member comprising the scFv.
2. The method of claim 1, wherein the scaffold is a full-length antibody scaffold.
3. The method of claim 2, wherein the full-length antibody is a humanized antibody.
4. The method of any one of claim 2 or 3, wherein the scaffold is an IgG or IgM scaffold.
5. The method of claim 1, wherein the scaffold is a Fab scaffold, a Fab scaffold, a F(ab)2 scaffold, or a Fv scaffold.
6. The method of claim 1, wherein the CDRs are VH-CDR1, VH-CDR2, and VH-CDR3 and VL-CDR1, VL-CDR2, and VL-CDR3.
7. The method of claim 1, wherein the CDRs are VH-CDR1, VH-CDR2, and VH-CDR3.
8. The method of claim 1, wherein the CDRs are VL-CDR1, VL-CDR2, and VL-CDR3.
9. The method of claim 1, wherein the plurality of members of the VH-CDR1/2 sub-library comprises a random cassette corresponding to at least one of a portion of VH CDR1 and at a portion of VH CDR2.
10. The method of claim 1, wherein the plurality of members of the VH-CDR1/2 sub-library comprises a plurality of random cassettes corresponding to at least a portion of VH CDR1 and at a portion of VH CDR2.
11. The method of claim 1, wherein the plurality of the members of the VH-CDR3 sub-libraries comprises a random cassette corresponding to at least a portion of VH CDR3.
12. The method of claim 1, wherein at least two random cassettes of members of the VH-CDR3 sub-libraries encodes peptides with different lengths.
13. The method of claim 12, wherein the peptides have lengths in a range of 10-20 amino acids.
14. The method of claim 1, wherein the plurality of the members of the VL sub-library comprises a random cassette at a portion of VL CDR3.
15. The method of claim 1, wherein the plurality of members of the sub-libraries have common sequences.
16. The method of claim 1, wherein each of the expression library members comprises a plurality of the random cassettes.
17. The method of claim 1, wherein the expression library is a mRNA display library.
18. The method of claim 1, wherein the high-affinity expression library member has a binding affinity to the target antigen of 10 nM or less.
19. The method of claim 1, wherein the generated high-affinity antibody or antibody fragment has a binding affinity that is within one order of magnitude or less as compared to the binding affinity of the expression library member comprising the scFv.
20. The method of claim 18, wherein the generated high-affinity antibody or antibody fragment has a binding affinity that is within one order of magnitude or less as compared to the binding affinity of the expression library member comprising the scFv.
Description
BRIEF DESCRIPTION OF THE DRAWING
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] The inventors now discovered that specific and effective recombinant antibodies or fragments thereof can be generated or identified by constructing a high-diversity nucleic acid library using targeted diversification of selected domains of the antibodies or fragments thereof encoded by members of the high-diversity nucleic acid library. In order to achieve such goal, the inventors have now discovered that one or more domains or subdomains of antibody/binder can be pre-selected and a plurality of nucleic acid sub-libraries can be generated using random cassettes in a pre-selected domain or subdomain. The inventors further discovered that the members of the sub-libraries can be recombined to construct the high-diversity nucleic acid library that allows high diversity among library members, yet provides higher probabilities of identifying antibodies/binders that are stable, soluble, functional, and adaptable when used in vivo against the cancer antigens or neoepitopes (preferably cancer-specific, patient-specific neoepitopes or neoantigens).
[0036] Indeed, and as shown in more detail below, the libraries presented herein allow for isolation of at least one binder to any arbitrary antigen, typically in a single or two-pass enrichment, where the binder has a K.sub.d of equal or less than 100 nM, and more typically equal or less than 10 nM. Moreover, contemplated systems and methods allow for scFv libraries having a diversity of at least 10.sup.9, at least 10.sup.10, at least 10.sup.11, at least 10.sup.12, at least 10.sup.13, at least 10.sup.14, at least 10.sup.15, or at least 10.sup.16 distinct library members, all in a time frame that is significantly reduced as compared to conventional library construction. Thus, it should be appreciated that the speed of antibody discovery is substantially increased.
[0037] As used herein, the term tumor refers to, and is interchangeably used with one or more cancer cells, cancer tissues, malignant tumor cells, or malignant tumor tissue, that can be placed or found in one or more anatomical locations in a human body.
[0038] As used herein, the term bind refers to, and can be interchangeably used with a term recognize and/or detect, an interaction between two molecules with a high affinity with a K.sub.D of equal or less than 10.sup.?6M, or equal or less than 10.sup.?7M.
[0039] As used herein, the term provide or providing refers to and includes any acts of manufacturing, generating, placing, enabling to use, or making ready to use.
Construction of Nucleic Acid Sub-libraries
[0040] Generally, structural components (heavy chain, light chain, constant domains, variable domains) of antibodies are closely related to their functions. For example, the variable domains in the heavy chain (V.sub.H) and light chain (V.sub.L) constitute, together, the epitope binding domain, which provides specificity to the antibodies. Each of the V.sub.H and V.sub.L includes three complementarity determining regions (CDRs, CDR1-3) with unique amino acid sequences based on their specificity to an antigen. Thus, it had previously been contemplated that a recombinant nucleic acid library for generating or identifying antibodies can be created by randomizing the sequences encoding the CDRs of V.sub.H and V.sub.L However, the inventors found that while complete randomization of all CDRs of V.sub.H and V.sub.L may provide great diversity to the library, it also creates inefficiency in generating all combinations of random sequences and screening all randomized combinations as not all randomized V.sub.H and V.sub.L can be soluble or stably expressed when it is recombined to form an antibody (e.g., IgG1, etc.). Moreover, covering the entire diversity space is not practical due to the extremely large number of possible library members.
[0041] Thus, the inventors contemplate that subdomains of V.sub.H and V.sub.L can be divided into two categories: a framework region that are generally common among V.sub.H and V.sub.L of different antibodies (or genes encoding the antibodies) and a targeted diversification region that can be at least partially or completely randomized without significantly affecting the stability and/or solubility of the final peptide product (e.g., scFv, IgG1, etc.). Preferably, the targeted diversification region of V.sub.H includes at least a portion of CDR1, CDR2-n (N-terminus side of CDR2), CDR2-c (C-terminus side of CDR2), and CDR3. In further preferred aspects, the targeted diversification region of VI. includes at least a portion of CDR3.
[0042] As such, in one exemplary and especially preferred aspect of the inventive subject matter, a nucleic acid library can be created by generating recombinant nucleic acids that include one or more random sequence cassettes in one or more targeted diversification region of V.sub.H and/or V.sub.L. In one preferred embodiment, the inventors contemplate three different sub-libraries having different sets of random sequence cassettes in different targeted diversification regions such that each sub-library retains the diversity within randomized targeted diversification regions while avoiding too many randomized recombinant sequences in a single sub-library that may render the volume of the single sub-library impractical or inefficient to handle for quick or timely screenings. Furthermore, conserved areas between the targeted diversification regions are selected or designed for maximum stability and solubility.
[0043] In one embodiment, the sub-libraries include a V.sub.H-CDR1/2 sub-library. The V.sub.H-CDR1/2 sub-library comprises a plurality of recombinant nucleic acids (e.g., recombinant DNA) having one or more random sequence cassettes corresponding to at least a portion of V.sub.H-CDR1 and/or at a portion of V.sub.H 9CDR2. As used herein, the random cassette corresponding to a portion of V.sub.H CDR1 means that the random cassette is located in an area of the recombinant nucleic acid, in which sequences encoding CDR1 portion should be present in order to encode a portion of V.sub.H domain which is at least structurally or functionally similar to V.sub.H domains of natural antibodies. For example, recombinant nucleic acids in a V.sub.H-CDR1/2 sub-library may have a structure as below (randomized region is underlined, and fixed sequenced region is parenthesized):
5-(Promoter5 UTR?FW1)+CDR1+(FW2)+CDR2+(FW3?CDR3?FW4)
[0044] As used herein, UTR refers to untranslated region and FW refers framework region (e.g., FW1 is the first framework region that may be distinct from the second framework region (FW2)). In this structure, the random sequence cassettes can be inserted in areas of CDR1 or CDR2, or preferably, both CDR1 and CDR2. In some embodiments, more than one random sequence cassettes, preferably two random sequence cassettes can be inserted in the area of CDR2: CDR2-n (for 5-end side of CDR2) and CDR-c (for 3-end side of CDR2).
[0045] The sub-libraries can also include a plurality of V.sub.H-CDR3 sub-libraries. Each of V.sub.H-CDR3 sub-library comprises a plurality of recombinant nucleic acids (e.g., recombinant DNA) having one or more random sequence cassettes corresponding to at least a portion of V.sub.H CDR3. Similar to the V.sub.H-CDR 1/2 sub-library, a recombinant nucleic acids in V.sub.H-CDR1/2 sub-library may have a structure as below (randomized region is underlined, and fixed sequenced region is parenthesized):
5-(Promoter5 UTR?FW1+CDR1+FW2+CDR2+FW3?CDR3?(FW4)
[0046] Preferably, the fixed sequences (e.g., Promoter5 UTR?FW1+CDR1+FW2+CDR2+(FW3, FW4) of the recombinant nucleic acids of the V.sub.H-CDR 1/2 sub-library and/or the V.sub.H-CDR3 sub-library are selected to use the most common and/or conserved sequences among the natural antibodies (e.g., IgG1s against various antigens) such that the fixed sequences are most expressable and adaptable to multiple formats including peptides expressed as a single chain variable fragment (scFv), a modified form of scFv, full length immunoglobulin, or a portion of immunoglobulin. Thus, in preferred embodiments, the fixed sequences of the recombinant nucleic acids of V.sub.H-CDR1/2 sub-library and of the recombinant nucleic acids of V.sub.H-CDR3 sub-library are at least 70%, preferably at least 80%, more preferably at least 90% identical (shared) with each other.
[0047] The sub-libraries can also include a V.sub.L sub-library. The V.sub.L sub-library comprises a plurality of recombinant nucleic acids (e.g., recombinant DNA) having one or more random sequence cassettes corresponding to at least a portion of V.sub.L CDR3. Similar to the V.sub.H-CDR 1/2 sub-library, recombinant nucleic acids in V.sub.H-CDR1/2 sub-library may have a structure as below (randomized region is underlined, and fixed sequenced region is parenthesized):
5-(Promoter5 UTR?FW1+CDR1+FW2+CDR2+FW3)?CDR3?(FW4)
Preferably, the fixed sequences of the recombinant nucleic acids of the V.sub.L sub-library are at least 70%, preferably at least 80%, more preferably at least 90% identical (shared) to those of recombinant nucleic acids of the V.sub.H-CDR1/2 sub-library or V.sub.H-CDR3 sub-library.
[0048] While any randomized sequences can be considered to generate the random sequence cassettes, the inventors contemplate that strategized random sequence cassettes for CDR1, CDR2, CDR3 of the Vu and CDR3 of the V.sub.L domain would render a high complexity and large potential binding surface when expressed as a binding peptide (e.g., scFv, etc.). For example, the strategized random sequence cassettes for CDR1, CDR2 of the V.sub.H-CDR 1/2 sub-library may be semi-random sequence cassettes having 3 or less, preferably 2 or less, or more preferably, one random sequence (encoding 3 or less, 2 or less, or one random amino acid per cassette) per cassette. The location of the random sequence in the random cassette may vary depending on the random amino acid in the cassette. In another example, the strategized random sequence cassettes for CDR3 of V.sub.H-CDR3 sub-library may include more randomized sequences such that 4 or more, preferably 5 or more, or more preferably 6 or more random sequences (encoding 4 or more, preferably 5 or more, or more preferably 6 or more random amino acids per cassette) are present per cassette. In yet another example, the strategized random sequence cassettes for CDR3 of V.sub.L sub-library may include more randomized sequences such that 4 or more, preferably 5 or more, or more preferably 6 or more random sequences (encoding 4 or more, preferably 5 or more, or more preferably 6 or more random amino acid per cassette) are present per cassette.
[0049] In an especially preferred aspect of the inventive subject matter, the inventors contemplate that preferred random sequence cassettes for sub-libraries can be generated using oligonucleotides presented in Table 1 (for V.sub.H-CDR1/2 sub-library and V.sub.H-CDR3 sub-library), and Table 2 (for V.sub.L sub-library). As shown in Tables 1 and 2, each oligonucleotide includes a random sequences (highlighted) having degenerate code, shown as IUPAC ambiguity codes. For example, one oligonucleotide for CDR1 random sequence cassette includes a random sequence RVT, which represents A/G,A/C/G,T, whose combination can encode one of threonine (T), alanine (A), asparagine (N), aspartic acid (D), serine (S) or glycine (G). The choice of amino acids encoded by the degenerate codons are depicted to the right and are indicated with X.
[0050] Additionally and preferably, the random sequence cassettes for V.sub.H-CDR3 sub-library may include nucleic acid sequences in different length. For example, the random sequence cassettes for V.sub.H-CDR3 sub-library may be in any length between 10-30 amino acids, preferably between 10-25 amino acids, more preferably between 10-20 amino acids. Thus, as shown in Table 1, the oligonucleotides for generating random sequence cassette for V.sub.H-CDR3 sub-library may include a various repeats (e.g., 4-10 repeats) of NNK (which represents G/A/T/C, G/A/T/C, G/T) between sequences encoding D/G-R/L and A/G (see also
TABLE-US-00001 TABLE1 V.sub.HCDR1 SEQIDNO.1: X=T,A,N,D,S,G GGCTTAGGTCTCATTTCRVTAGTTACGCTATGCATTGGGCGAGACGAGGTCTGAACGG SEQIDNO.2: X=T,A,N,K,D,E, GGCTTAGGTCTCATTTCTCTRVKTACGCTATGCATTGGGCGAGACGAGGTCTGAACGG S,R,G SEQIDNO.3: X=G,W,L,V GGCTTAGGTCTCATTTCTCTAGTTACKKGATGCATTGGGCGAGACGAGGTCTGAACGG SEQIDNO.4: X=S,Y,T,N GGCTTAGGTCTCATTTCTCTAGTTACWMTATGCATTGGGCGAGACGAGGTCTGAACGG SEQIDNO.5: X=S,T,N GGCTTAGGTCTCATTTCTCTAGTTACGCTATGAVTTGGGCGAGACGAGGTCTGAACGG V.sub.HCDR2-n SEQIDNO.6: X=Y,F,S GGCTTAGGTCTCGTTCATHCATTAGTGGTAGTGGACGAGACGAGGTCTGAACGG SEQIDNO.7: X=V,G,I,S,L,R GGCTTAGGTCTCGTTCAVKTATTAGTGGTAGTGGACGAGACGAGGTCTGAACGG SEQIDNO.8: X=W,R GGCTTAGGTCTCGTTCAGCTATTYGGGGTAGTGGACGAGACGAGGTCTGAACGG SEQIDNO.9: X=Y,N,D+N53 GGCTTAGGTCTCGTTCAGCTATTDATGGTAATGGACGAGACGAGGTCTGAACGG SEQIDNO.101: X=Y,S,T,N GGCTTAGGTCTCGTTCAGCTATTAGTWMTAGTGGACGAGACGAGGTCTGAACGG SEQIDNO.11: X=W,G GGCTTAGGTCTCGTTCAGCTATTAGTKGGAGTGGACGAGACGAGGTCTGAACGG SEQIDNO.12: X=D,G,S,N GGCTTAGGTCTCGTTCAGCTATTAGTGGTRRTGGACGAGACGAGGTCTGAACGG V.sub.HCDR2-c SEQIDNO.13: X=S,T,G,A,N,K,D,E GGCTTAGGTCTCGTGGARVKAGTACTTACTACGCGAGACGAGGTCTGAACGG SEQIDNO.14: X=Y,N,D,H GGCTTAGGTCTCGTGGAGGTNATACTTACTACGCGAGACGAGGTCTGAACGG SEQIDNO.15: X=T,K,R,E,A,G GGCTTAGGTCTCGTGGAGGTRVAACTTACTACGCGAGACGAGGTCTGAACGG SEQIDNO.16: X=D,G,N,S,H,R GGCTTAGGTCTCGTGGAGGTAGTACTVRTTACGCGAGACGAGGTCTGAACGG VHCDR3 SEQIDNO.17: (D,G)-(R,L)- GGCTTAGGTCTCTCCGTGRTCKC(NNK)nGSTTTCGCGAGACGAGGTCTGAACGG (Xaa=4-10)-(A,G)
TABLE-US-00002 TABLE2 V.sub.LCDR3 SEQIDNO.18: Q-X.sub.1-X.sub.2-X.sub.3-X.sub.4-P-X.sub.5 GGCTTAGGTCTCTGCAGDSGDMTRVTDSGCCTTWCACTTCGAGACGAGGTCTGAACGG X.sub.1=Y,D,L,A,H,S, SEQIDNO.19: F,R,T,W,G GGCTTAGGTCTCTGCAGBWTDMTRVTDSGCCTTWCACTTCGAGACGAGGTCTGAACGG X.sub.2=Y,N,D,S,T,A SEQIDNO.20: X.sub.3=S,N,T,A,D,G GGCTTAGGTCTCTGCAGDSGDMTRVTNWTCCTTWCACTTCGAGACGAGGTCTGAACGG X.sub.4=Y,F,A,L,T,S, SEQIDNO.21: H,W,I,N,R,V,D,G GGCTTAGGTCTCTGCAGBWTDMTRVTNWTCCTTWCACTTCGAGACGAGGTCTGAACGG X.sub.5=L,Y,W,F,R SEQIDNO.22: GGCTTAGGTCTCTGCAGDSGDMTRVTDSGCCTYKGACTTCGAGACGAGGTCTGAACGG SEQIDNO.23: GGCTTAGGTCTCTGCAGBWTDMTRVTDSGCCTYKGACTTCGAGACGAGGTCTGAACGG SEQIDNO.24: GGCTTAGGTCTCTGCAGDSGDMTRVTNWTCCTYKGACTTCGAGACGAGGTCTGAACGG SEQIDNO.25: GGCTTAGGTCTCTGCAGBWTDMTRVTNWTCCTYKGACTTCGAGACGAGGTCTGAACGG
[0051] Most typically, the oligonucleotides presented in Table 1 and 2 are provided in a single strand DNA, which can be converted using DNA polymerase I (Klenow fragment) into double-stranded DNA fragment to so be inserted into a backbone comprising the fixed sequenced region (e.g., 5-(Promoter5 UTR?FW1+CDR1+FW2+CDR2+FW3)?(FW4) for recombinant nucleic acids of V.sub.L sub-library, etc.). Yet, it is also contemplated that the oligonucleotides presented in Table 1 and 2 are also present with the complementary oligonucleotides to form a double stranded nucleic acids without using polymerase enzymes.
[0052] In some embodiments, the recombinant nucleic acids of sub-libraries also include a nucleic acid sequence encoding a protein tag such that the peptide encoded by the recombinant nucleic acids can be isolated using the binder against the protein tag. For example, preferred proteins tag include a FLAG tag (with a sequence motif DYKDDDDK), a Myc tag (with a sequence motif EQKLISEEDL), and an HA-tag. In some embodiments, the protein tags can be repeated to strengthen the signal or increase the detection (e.g., three repetitions of FLAG tag (3X FLAG), etc.)
[0053] It is contemplated that some random sequence cassettes inserted in the recombinant nucleic acids of sub-libraries, may introduce frame shifts, nonsense mutations, and sequence(s) that are destabilizing the structure of the peptide encoded by the recombinant nucleic acids. Thus, in some embodiments, the inventors contemplate that the recombinant nucleic acids of sub-libraries are in vitro tested so that any recombinant nucleic acids encoding unstable or misfolded peptides can be removed from the library. For example, the recombinant nucleic acids of the V.sub.H-CDR3 sub-libraries or the V.sub.L sub-library can be tested for their binding affinity to protein A of Staphylococcus aureus or protein L of Finegoldia magna, which binds to structured epitopes of V.sub.H3 domain or V.sub.L (V?) domain of immunoglobulin independently to CDR sequences, respectively.
[0054] Any suitable methods to screen the recombinant nucleic acids by their binding affinities to protein A or protein L are contemplated. In one exemplary embodiment the recombinant nucleic acids of sub-libraries are transcribed into mRNAs by in vitro transcription and the 3-end of the mRNAs are coupled (covalently linked) to puromycin. The puromycin-coupled mRNAs are in vitro translated such that the peptides transcribed from the puromycin-coupled mRNAs are coupled with the mRNAs via the puromycin. Next, the peptides are contacted with protein A or protein L to identify peptides effectively binding to the protein A or protein L. Preferably, peptides binding to protein A or protein L with an affinity with a K.sub.D of equal or less than 10.sup.?6M, preferably equal or less than 10.sup.?7M are selected and isolated. Once the peptides with high affinity to protein A or protein L are isolated, cDNAs of the isolated peptides can be generated via in vitro reverse-transcription of the mRNAs coupled with the puromycin and the peptides. The so generated cDNAs of the isolated peptides can be then inserted as random sequence cassettes to generate selected recombinant nucleic acids of V.sub.H-CDR3 sub-libraries or the VI. sub-library. Alternatively, it is also contemplated that the recombinant nucleic acids of sub-libraries can be present in a form of mRNAs, which is optionally pre-coupled with puromycin molecule such that the in vitro transcription step for the recombinant nucleic acids (in DNA format) may not be needed.
Construction of scFv Library from the Sub-Libraries
[0055] The inventors further contemplate that at least two recombinant nucleic acids (members) of the sub-libraries can be recombined to form recombinant scFv nucleic acids. In a preferred embodiment, each of the at least two recombinant nucleic acids (members) is selected from different sub-libraries. For example, one recombinant nucleic acid may be selected from each of the V.sub.H-CDR1/2 sub-library, the plurality of V.sub.H-CDR3 sub-libraries, and the VI. sub-library. For other example, one recombinant nucleic acid may be selected from each of two of V.sub.H-CDR1/2 sub-library, the plurality of V.sub.H-CDR3 sub-libraries, and the V.sub.L sub-library. Preferably, at least one of, more preferably all of, the recombinant nucleic acid(s) selected from the sub-libraries are pre-selected via affinity binding screening as described above.
[0056] Most typically, the recombinant scFv nucleic acids can be constructed by recombining a portion of the recombinant nucleic acids from sub-libraries. In this embodiment, the portion of the recombinant nucleic acids includes the random sequence cassettes inserted into the recombinant nucleic acids. Thus, for example, as a first step, the portion of the recombinant nucleic acids of the V.sub.H-CDR1/2 sub-library can be 5-[CDR1+(FW2)+CDR2]-3 (random sequence cassettes are underlined), preferably 5-(portion of FW1)-[CDR1+(FW2)+CDR2]-(portion of FW3)-3, more preferably 5-(Promoter5 UTR?FW1)+CDR1+(FW2)+CDR2+(portion of FW3)-3 or 5-(Promoter5 UTR?FW1)+CDR1+(FW2)+CDR2+(a small linker)-3. Similarly, for example, the portion of the recombinant nucleic acids of the V.sub.H-CDR3 sub-libraries can be 5-[CDR3]-3 (random sequence cassettes are underlined), preferably 5-(portion of FW3)?CDR3?(portion of FW4)-3, more preferably, 5-(portion of FW3)?CDR3?(FW4)-3, or 5-(a small linker)?CDR3?(FW4)-3. The portions of the recombinant nucleic acids from the V.sub.H-CDR1/2 sub-library and the V.sub.H-CDR3 sub-libraries are then isolated (e.g., by PCR) and can be recombined (e.g., fused via restriction-ligation methods, generated via a recombinant-PCR, etc.) to form a V.sub.H domain recombinant nucleic acid. Thus, typically, the V.sub.H domain recombinant nucleic acid would be in a structure of 5-Promoter5 UTR?FW1+CDR1+FW2+CDR2+FW3 'CDR3?FW4?3(random sequence cassettes are underlined). Optionally, the V.sub.H domain recombinant nucleic acid may also include a nucleic acid sequence encoding a protein tag (e.g., FLAG tag, Myc tag, HA tag, etc.) in its 3-end as described above. In addition, such generated V.sub.H domain recombinant nucleic acids can be placed in a V.sub.H domain library as V.sub.H domain library members.
[0057] The so formed V.sub.H domain recombinant nucleic acids can be further recombined with recombinant nucleic acids of the V.sub.L sub-library to form the recombinant scFv nucleic acids.
[0058] Preferably, the portion of V.sub.H domain recombinant nucleic acid and the portion of the recombinant nucleic acid of the V.sub.L sub-library are fused via a nucleic acid encoding a linker (a short peptide spacer fragment) between two portions. Any suitable length and order of peptide sequence for the linker or the spacer can be used. However, it is preferred that the length of the linker peptide is between 3-30 amino acids, preferably between 5-20 amino acids, more preferably between 5-15 amino acids. For example, the inventors contemplate that glycine-rich sequences (e.g., gly-gly-ser-gly-gly, etc.) are employed to provide flexibility of scFv between the V.sub.H and V.sub.I domains.
[0059] Optionally, the recombinant scFv nucleic acids may also include a nucleic acid sequence encoding a protein tag (e.g., FLAG tag, Myc tag, HA tag, etc.) in its 3-end as described above. In addition, such generated recombinant scFv nucleic acids can be placed in an expression library as expression library members.
[0060] In some embodiments, the so formed recombinant scFv nucleic acids are further screened and/or ranked based on their binding affinities to one or more ligands of interest (e.g., cancer antigens, neoepitopes, etc.), stability, pH sensitivity, and/or species cross-reactivity. For example, the stability of the scFv peptides encoded by the recombinant scFv nucleic acids can be analyzed by size exclusion chromatography measuring the size of the peptide over time. For other example, pH sensitivity and binding affinity of the scFv peptides encoded by the recombinant scFv nucleic acids can be analyzed by contacting the scFv peptides with one or more ligands in different buffer conditions (pH, temperature, etc.).
[0061] For those analysis and further isolation of desired recombinant scFv nucleic acids from the expression library, the inventors contemplate that the recombinant scFv nucleic acids can be present in a form of mRNAs, which is optionally pre-coupled with puromycin molecule at the 3-end of the mRNAs. The puromycin-coupled mRNAs can then be in vitro translated such that the peptides transcribed from the puromycin-coupled mRNAs are coupled with the mRNAs via the puromycin. Then, the peptides are contacted with one or more ligands, optionally in different buffer conditions (pH, temperature, etc.). Preferably, peptides binding to the ligand with an affinity with a K.sub.D of equal or less than 10.sup.?6M, preferably equal or less than 10.sup.?7M, between pH 5.0-8.0, preferably between pH 6.0-8.0, more preferably between pH 6.5-8.0 are selected and isolated. Once the peptides with high affinity to the ligand(s) are isolated, cDNAs of the isolated peptides can be generated via in vitro reverse-transcription of the mRNAs coupled with the puromycin and the peptides.
[0062] Additionally, the so generated cDNAs of the isolated peptides encoded by recombinant scFv nucleic acids can be grafted on and replaced the portion of the immunoglobulin to form a recombinant immunoglobulin or fragments thereof. For example, the so generated cDNA can be fused with the backbone of the immunoglobulin heavy chain constant region such that the variable region of heavy and light chain of the immunoglobulin can be replaced with the scFv formed by the isolated peptide. Alternatively, the inventors also contemplate that the V.sub.H portion (or derived from V.sub.H domain recombinant nucleic acid) and V.sub.L portion (or derived from of the recombinant scFv nucleic acid) of the recombinant scFv nucleic acids can be grafted on and replaced the portion of the immunoglobulin to form a recombinant immunoglobulin or fragments thereof. For example, the V.sub.H portion (or derived from V.sub.H domain recombinant nucleic acid) and V.sub.L portion (or derived from of the recombinant scFv nucleic acid) of the recombinant scFv nucleic acids are fused with the backbone of the immunoglobulin heavy chain constant region or light chain constant region, respectively, to form an immunoglobulin with variable regions specific to the desired ligand.
[0063] In these examples, it is contemplated that the immunoglobulin can include any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY) and any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) of heavy chain or constant domain to constitute different types of immunoglobulin. In addition, the antibody can include, but not limited to a human antibody, a humanized antibody, a chimeric antibody, a monoclonal antibody, a polyclonal antibody. In this context, it should be noted that contemplated systems and methods allow for the generation of species-specific antibodies by grafting the isolated V.sub.H and V.sub.L domains onto the remainder of the antibody of a desired species (e.g., human). In another example, the so generated cDNA can be fused with nucleic acids encoding other portion of the immunoglobulin to form a fragment of the immunoglobulin. In this example, it is contemplated that the fragment of the immunoglobulin can be Fab fragments, Fab fragments, F(ab)2, disulfide linked Fvs (sdFvs), and Fvs. The inventors further contemplate that a portion of the so generated cDNA can be fused with nucleic acids encoding other portion of the immunoglobulin to form any fragment comprising either V.sub.H segment and/or V.sub.L segment.
[0064] Additionally, the inventors contemplate that the scFv portions may also be used as targeting entities for various proteins and non-protein molecules. For example, the scFv portions may be coupled (typically as chimeric protein) to an ALT-803 type molecule to form a TxM entity that has specific targeting capability (see e.g., J Biol Chem. 2016 Nov 11;291(46):23869-23881). In another example, the scFv portion may be coupled to a carrier protein (e.g., albumin) to allow target specific delivery of one or more drugs to a specific location in a tumor microenvironment where the drugs are coupled to the carrier.
[0065] The inventors further contemplate that by construction the sub-libraries via targeted diversification of random sequences, and/or preselecting the members of the sub-libraries, the expression library can achieve approximately 10.sup.12 complexity with minimal sacrifice of diversity by removing unstable, non-binding, or misfolded sequences. Thus, the above described approach to generate expression library provides meaningful size of sequence complexity, yet is practical to screen binders/antibodies in a small volume. In addition, the above described approach to generate expression library simplified the screening procedure of the binders/antibodies. Traditionally, in vitro validation of any nucleic acid sequences (e.g., randomized sequences) encoding binding domain (or motif) required the nucleic acid sequences converted to Fab domain, then the binding affinity could be tested via pull-down assay with the ligand of interest. The methods presented herein allows in vitro validation of nucleic acid sequences encoding binding domain (or motif) via ranking by affinity (e.g., Kd value), pH sensitivity, and species cross-reactivity (e.g., via surface plasmon resonance assay, etc.) without converting the nucleic acid sequences into Fab domain. Further, pre-selection of members from each library based on stability and sensitivity reduces the pool to be tested in the library such that the desired binders/scFv/antibody domains can be identified more quickly and efficiently. Therefore, the inventors also contemplate methods for isolation of high-affinity binders (e.g., with nano- and picomolar K.sub.d) from a high-diversity pool using mRNA display techniques in which library members after in vitro translation are screened against a solid phase bound antigen. Once binders are identified, they can be further characterized by surface plasmon resonance spectroscopy with respect to affinity and K.sub.on/K.sub.off characteristics as is further described below. Viewed form a different perspective, contemplated systems and methods allow for rapid detection of binders and generation of scFv or antibodies in a process that is entirely independent from an in vivo immune system.
EXAMPLES
[0066] While any suitable diversification scheme to identify targeted diversification region(s) can be contemplated to maximize diversity while maintaining efficiency, the inventors found that VH3/Vk1 can be one of the good candidate regions for randomization among the various domains of immunoglobulin, VH3 is considered by far most stable and soluble VH domain, and Vk1 of light chain is stable and soluble. Thus, it is contemplated that the VH3/Vk1 randomized pairs would convert to a full size immunoglobulin more efficiently. Accordingly, the inventors developed pre-selection strategy using VH3 and Vk1 frameworks.
[0067] Based on the randomization strategy, the inventors further generated targeted diversified sequences (randomized sequences, random oligos) for CDR1, CDR2-n, CDR2-c of V.sub.H domain (see
[0068] Using the targeted diversification scheme and methods of generating recombinant scFv nucleic acids as described in
[0069] The inventors found that the recombinant ?-B7-H4.sub.801 comprises antibody components of substantially similar to other commercially available ?-B7-H4 antibodies (Rituxan?, LEAF?). The fragments of the recombinant ?-B7-H4.sub.801 and two commercially available a-B7-H4 antibodies (Rituxan?, LEAF?) were analyzed via Capillary electrophoresis sodium dodecyl sulfate (CE-SDS). As shown in
[0070] The inventors further found that various recombinant ?-B7-H4.sub.801 antibodies may show different binding characters (e.g., affinities, specificities, etc.) to the target ligand.
[0071] The recombinant ?-B7-H4.sub.801 antibodies were further tested to determine specific and effective binding to the ligands (B7-H4) expressed on the antigen presenting cells (APCs) using flow cytometry. As shown in
[0072] The inventors also found that scFv peptide against B7-H4 (scFv B7-H4.sub.801) and recombinant ?-B7-H4 antibodies (IgG ?-B7-H4.sub.801 ) generated by the same scFv peptide with the scFv B7-H4.sub.801 are functionally compatible using the surface plasmon resonance assay. In this assay, Flag-tagged scFv B7-H4.sub.801 are immobilized on the surface via ?-Flag biotinylated antibody, which is coupled with surface-linked neutravidin. The surface immobilized scFv B7-H4.sub.801 peptides are then contacted with analyte including B7-H4. Similar assay was performed with ?-B7-H4 antibodies. As shown in
TABLE-US-00003 TABLE 3 Ka Kd KD Res sd IgG 1.2e.sup.6 2.0e.sup.?4 175 pm 0.391 scFv 1.2e.sup.6 1.7e.sup.?4 141 pm 0.353
[0073] Among a plurality of scFv peptides against B7-H4 having various random sequence cassettes in CDR1-3 of V.sub.H and CDR3 of V.sub.L, the inventors examined whether similarities in specific domains (specific random sequence cassettes) may render the scFv peptides to have similar binding characteristics to the ligand. Five scFv peptides (801, 802, 905, 906, and 817) were examined for their binding affinities to B7-H4. Among those, as shown in Table 4, four scFv peptides (clone 801, 802, 905, 906) have similar CDR3 sequences. Those four scFv peptides having similar random sequence cassettes in CDR3 of V.sub.H show similar binding affinities to B7-H4 (as shown in Table 5) in both 25? C. and 37? C., indicating that at least in scFv peptides against B7-H4, sequences in CDR3 of VH may be critical in binding to the ligand.
TABLE-US-00004 TABLE4 Clone CDR1 CDR2 CDR3 CDRL3 801 NSYAMH(SEQID AISGNGGSTR(SEQID DRFRKVHG(SEQID DATFPL(SEQID NO:26) NO:27) NO:28) NO:29) 802 GSYAMH(SEQID AISGSGGSTR(SEQID DLYRRVHG(SEQID DYGFPL(SEQID NO:30) NO:31) NO:32) NO:33) 905 SSYLMH(SEQID VISGSGGSTR(SEQID DLYRRVAG(SEQID DYALPL(SEQID NO:34) NO:35) NO:36) NO:37) 906 SNYAMH(SEQID AISGNGGSTH(SEQID DRFRRVYG(SEQID DYTFPL(SEQID NO:38) NO:39) NO:40) NO:41) 817 SSYAMH(SEQID AISGSGGSTR(SEQID GRWSKWG(SEQID TDNFPY(SEQID NO:42) NO:43) NO:44) NO:45)
TABLE-US-00005 TABLE 5 Temp scFv ka kd KD 25? C. 801 1.20E+06 2.00E?04 174 pM 802 4.50E+05 2.40E?05 54 pM 905 4.10E+05 1.20E?04 290 pM 906 1.70E+05 1.00E?05 59 pM 37? C. 801 6.10E+05 7.30E?04 1.2 nM 802 5.70E+05 5.50E?04 1.0 nM 905 5.80E+05 9.70E?04 1.7 nM 906 2.80E+05 3.80E?04 1.4 nM
[0074] The inventors also generated a plurality of scFv peptides binding to interleukin-8 (IL-8) (scFv IL-8) using the sub-libraries and expression library, and examined the affinity to IL-8 in different conditions (temperatures and pH). Exemplary scFv IL-8 peptides and their binding affinities measured in various conditions are shown in Table 6. Among the clones shown in Table 6, clones 49-7, 49-1 and 49-12 contain similar V.sub.H CDR3 sequences, and clones 49-19, 49-37, and 49-25 contain similar V.sub.H CDR3 sequences. In addition, clones 49-3 and 43-2 contain similar V.sub.H CDR3 sequences. In contrast to the scFv peptides against B7-H4, the inventors found that the binding affinity of scFv IL-8 peptides may not be critically dependent on the similarities in random sequences in CDR3 of V.sub.H. For example, while clone 49-18, 49-37, and 49-25 contain similar V.sub.H CDR3 sequences, the binding affinity (unit measured in K.sub.D?10.sup.?9 M) of those sequences varies between 0.894?10.sup.?9 M and 25?10.sup.?9 M.
TABLE-US-00006 TABLE 6 clone count 25? C. pH 6 25? C. pH 6 37? C. 49-31 1/36 0.012 0.0025 49-22 3/36 0.113 0.328 49-7 1/36 0.166 0.462 49-32 1/36 0.239 0.714 49-34 1/36 0.618 0.342 49-18 1/36 0.894 2.23 49-3 4/36 1.26 6.68 2.14 3.14 9.19 43-2 5/16 1.41 1.3 0.79 0.96 0.89 49-37 1/36 1.46 4.01 43-12 3/16 1.5 11.04 49-10 6/36 1.65 8.58 2.21 8.7 3.45 49-1 1/36 2.66 6.13 49-6 1/36 4.8 17.6 49-12 3/36 10.1 11.9 49-25 2/36 25 7.26
[0075] The inventors further tested whether the scFv IL-8 can effectively trap IL-8 to thereby neutralize the effect of IL-8 by measuring neutrophil size. Generally, neutrophils are enlarged (e.g., having a larger diameter, etc.) upon being stimulated by IL-8 (as shown in
[0076] IL-8 is a neutrophil chemotactic factor that causes neutrophils to migrate toward the site of IL-8 release (e.g., site of infection). In order to evaluate the functional effect of scFv IL-8 peptides, neutrophils were placed on the bottom of the insert having a porous membrane and placed in the media including various concentration of IL-8 such that attracted neutrophils by IL-8 can trans-migrate out of the insert through the porous membrane toward the media. As shown in
[0077]
[0078] It should be apparent to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein. The inventive subject matter, therefore, is not to be restricted except in the scope of the appended claims. Moreover, in interpreting both the specification and the claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms comprises and comprising should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the referenced elements, components, or steps may be present, or utilized, or combined with other elements, components, or steps that are not expressly referenced. As used in the description herein and throughout the claims that follow, the meaning of a, an, and the includes plural reference unless the context clearly dictates otherwise. Also, as used in the description herein, the meaning of in includes in and on unless the context clearly dictates otherwise. Where the specification claims refers to at least one of something selected from the group consisting of A, B, C . . . and N, the text should be interpreted as requiring only one element from the group, not A plus N, or B plus N, etc.