METHOD FOR IDENTIFYING WHETHER A DIPLOID POTATO IS SELF-COMPATIBLE
20240188520 ยท 2024-06-13
Inventors
- Ling MA (Kunming, CN)
- Yi SHANG (Kunming, CN)
- Sanwen HUANG (Kunming, CN)
- Chunzhi ZHANG (Kunming, CN)
- Dongli GAO (Kunming, CN)
Cpc classification
C12Q1/6809
CHEMISTRY; METALLURGY
International classification
C12Q1/6809
CHEMISTRY; METALLURGY
Abstract
The present application relates to the technical field of genetic breeding, and provides a method for identifying whether a diploid potato is self-compatible. The method relates to identifying whether a StSCI gene in the diploid potato is transcribed and expressed. Also disclosed is a method for identifying whether a StSCI gene is expressed by using molecular marker, and a method of screening for the molecular marker, which includes: obtaining the genome sequence information of parental materials, screening for difference sites of the parental materials, screening for the molecular marker, and identifying whether the screened molecular marker are usable. As for the identification of the self-compatibility of a diploid potato by using the screened molecular marker, the identification workload is small, a lot of time is saved, and the identification result is not affected by the environment, and it is accurate and reliable.
Claims
1. A diploid self-compatible potato plant or part thereof, comprising (i) a genomic locus comprising a sequence having 90% or more identity to SEQ ID NO: 1 or 2 and (ii) the T allele of a single nucleotide polymorphism (SNP) identifiable via KASP marker primers comprising sequences set forth in SEQ ID Nos: 3 and 4, wherein the diploid self-compatible potato plant is not RH89-039-16 or progeny thereof.
2. The diploid self-compatible potato plant or part thereof of claim 1, wherein the genomic locus comprising a sequence having 95% or more identity to SEQ ID NO: 1 or 2.
3. The diploid self-compatible potato plant or part thereof of claim 1, wherein the genomic locus comprising a sequence having 98% or more identity to SEQ ID NO: 1 or 2.
4. The diploid self-compatible potato plant or part thereof of claim 1, wherein the genomic locus comprising a sequence having 100% identity to SEQ ID NO: 1 or 2.
5. The diploid self-compatible potato plant or part thereof of claim 1, wherein the part thereof is selected from the group consisting of seed, fruit, leaf, and flower.
6. The diploid self-compatible potato plant or part thereof of claim 1, wherein the diploid self-compatible potato plant is homozygous for the genomic locus.
7. The diploid self-compatible potato plant or part thereof of claim 1, wherein the diploid self-compatible potato plant is a hybrid.
8. A diploid self-compatible potato plant or part thereof, comprising (i) a homozygous genomic locus comprising a sequence having 90% or more identity to SEQ ID NO: 1 or 2 and (ii) the T allele of a single nucleotide polymorphism (SNP) marker identifiable via KASP primers comprising sequences set forth in SEQ ID Nos: 3 and 4.
9. The diploid self-compatible potato plant or part thereof of claim 8, wherein the genomic locus comprising a sequence having 95% or more identity to SEQ ID NO: 1 or 2.
10. The diploid self-compatible potato plant or part thereof of claim 8, wherein the genomic locus comprising a sequence having 98% or more identity to SEQ ID NO: 1 or 2.
11. The diploid self-compatible potato plant or part thereof of claim 8, wherein the genomic locus comprising a sequence having 100% identity to SEQ ID NO: 1 or 2.
12. The diploid self-compatible potato plant or part thereof of claim 8, wherein the part thereof is selected from the group consisting of seed, fruit, leaf, and flower.
13. The diploid self-compatible potato plant or part thereof of claim 8, wherein the diploid self-compatible potato plant is homozygous for the T allele of the SNP marker.
14. The diploid self-compatible potato plant or part thereof of claim 8, wherein the diploid self-compatible potato plant is not RH89-039-16 or progeny thereof.
15. The diploid self-compatible potato plant or part thereof of claim 8, wherein the diploid self-compatible potato plant is a hybrid.
16. A diploid self-compatible potato plant or part thereof, comprising (i) a genomic locus comprising a sequence having 90% or more identity to SEQ ID NO: 1 or 2 and (ii) the 11 bp deletion self-compatible allele of an InDel molecular marker identifiable via primers comprising sequences set forth in SEQ ID Nos: 5 and 6, wherein the diploid self-compatible potato plant is not RH89-039-16 or progeny thereof.
17. The diploid self-compatible potato plant or part thereof of claim 16, wherein the genomic locus comprising a sequence having 95% or more identity to SEQ ID NO: 1 or 2.
18. The diploid self-compatible potato plant or part thereof of claim 16 wherein the genomic locus comprising a sequence having 98% or more identity to SEQ ID NO: 1 or 2.
19. The diploid self-compatible potato plant or part thereof of claim 16, wherein the genomic locus comprising a sequence having 100% identity to SEQ ID NO: 1 or 2.
20. The diploid self-compatible potato plant or part thereof of claim 16, wherein the part thereof is selected from the group consisting of seed, fruit, leaf, and flower.
21. The diploid self-compatible potato plant or part thereof of claim 16, wherein the diploid self-compatible potato plant is homozygous for the genomic locus.
22. The diploid self-compatible potato plant or part thereof of claim 16, wherein the diploid self-compatible potato plant is a hybrid.
23. A diploid self-compatible potato plant or part thereof, comprising (i) a homozygous genomic locus comprising a sequence having 90% or more identity to SEQ ID NO: 1 or 2 and (ii) the 11 bp deletion self-compatible allele of an InDel molecular marker identifiable via primers comprising sequences set forth in SEQ ID Nos: 5 and 6.
24. The diploid self-compatible potato plant or part thereof of claim 23, wherein the genomic locus comprising a sequence having 95% or more identity to SEQ ID NO: 1 or 2.
25. The diploid self-compatible potato plant or part thereof of claim 23, wherein the genomic locus comprising a sequence having 98% or more identity to SEQ ID NO: 1 or 2.
26. The diploid self-compatible potato plant or part thereof of claim 23, wherein the genomic locus comprising a sequence having 100% identity to SEQ ID NO: 1 or 2.
27. The diploid self-compatible potato plant or part thereof of claim 23, wherein the part thereof is selected from the group consisting of seed, fruit, leaf, and flower.
28. The diploid self-compatible potato plant or part thereof of claim 23, wherein the plant is homozygous for the 11 bp deletion self-compatible allele of the InDel molecular marker.
29. The diploid self-compatible potato plant or part thereof of claim 23, wherein the diploid self-compatible potato plant is not RH89-039-16 or progeny thereof.
30. The diploid self-compatible potato plant or part thereof of claim 23, wherein the diploid self-compatible potato plant is a hybrid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0084]
[0085]
[0086]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0087] The technical solutions in the Examples of the present application will be clearly and completely described below, with reference to the drawings in the Examples of the present application. Obviously, the described examples are only a part of the examples of the present application, rather than all the examples. Based on the examples in this application, all other examples obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of this application.
Definition
[0088] The term self-compatibility refers to the ability to produce seeds through self-pollination and self-fertilization, and the seeds may grow into fertile offspring and produce seeds.
[0089] As used herein, the term diploid refers to that each vegetative cell in a plant includes two sets of chromosomes (2x=2n, where n is the number of chromosomes). A set of chromosomes is provided by two parents.
[0090] As used herein, the term gene refers to a genetic unit (usually represented by a DNA sequence) occupying a specific location in a chromosome and including genetic instructions that contribute to the potential phenotypic characteristics or traits of a plant.
[0091] As used herein, the term hybridization refers to using male plants (or gametes) to fertilize female plants (or gametes). The term gamete refers to a haploid germ cell (egg or sperm) involved in sexual reproduction produced in a plant by gametophyte mitosis, wherein the two heterosexual gametes fuse to form a diploid zygote during sexual reproduction process. This term generally refers to pollen (including sperm cells) and ovules (including egg cells). Therefore, hybridization usually refers to fertilizing an individual's ovule with the pollen of another individual.
[0092] The term recombination refers to the exchange of information between two homologous chromosomes during meiosis. In a recombinant plant, DNA originally present at a specific location within the chromosome (for example, linked to a gene/site) is exchanged with DNA from another plant (i.e., exchanging between female parent and male parent or vice versa).
[0093] The term single-abase difference site, i.e., single nucleotide polymorphism (SNP), refers to the difference site of a single nucleotide (base) at the genomic level existing in two parents.
[0094] The term KASP marker, KASP is the abbreviation of Kompetitive Allele Specific PCR.
[0095] The term KASP marker primer is a primer designed and developed for a single-base difference site.
[0096] The term insertion-deletion marker, i.e. InDel (insertion-deletion), refers to the difference in the genome between the two parents. Compared with the other parent, a certain number of nucleotide insertions or deletions exist in the genome of one parent.
[0097] The term InDel marker primer refers to a PCR primer designed to amplify the InDel sites according to these InDel sites in the genome.
Example 1
[0098] A method for identifying whether a diploid potato is self-compatible, including the following steps:
(1) Re-Sequencing the Genomes of the Parental Materials RH89-039-16 and PI 225689:
[0099] RH89-039-16 is a self-compatible potato diploid material, and PI 225689 is a self-incompatible diploid potato material; after using these two materials as the parents for hybridization, the offspring have segregated traits of self-compatibility and self-incompatibility. In order to accurately identify the self-compatibility phenotype of the offspring, the parent materials RH89-039-16 and PI 225689 are re-sequenced to obtain the sequence information of the two materials.
(2) Developing Molecular Markers Co-Segregating with StSCI Gene in Parent Materials RH89-039-16 and PI 225689:
[0100] After comparing the sequence information of the chromosome fragments including the StSCI gene in the parent materials RH89-039-16 and PI 225689, it is found that a 538 bp (SEQ ID NO: 2) nucleotide sequence has been inserted into the promoter region of the StSCI gene in RH89-039-16. A pair of InDel molecular markers are designed according to this inserted sequence, and the primer sequences are as follows:
TABLE-US-00001 F: (SEQIDNO:9) 5-CGTCGGATTCAGCAGCAGAGTT-3; R: (SEQIDNO:10) 5-AAGCGAATTACAAGCCTGTTTAGATTGAC-3.
(3) Identifying the Phenotype of Hybrid Offspring Plants by Using InDel Molecular Markers:
[0101] When the hybrid offspring plants grow to the seedling stage, the leaf genome is extracted for PCR amplification reaction by using the primers in step (2), and the genomic DNA to be tested is used as a template.
[0102] A 20 ?l amplification system is used in the PCR reaction: 1 ?l of 10-20 ng/?l template DNA, 1 ?l of 10 pmol/?l primers F and R respectively, 0.4 ?l of 10 mmol/L dNTP mix, 0.3 ?l of 0.5 U/?L Taq DNA polymerase, 2 ?l of 10?PCR reaction buffer, and the rest is water.
[0103] PCR reaction conditions are: 94? C. for 5 min; 94? C. for 20 sec, 55? C. for 20 sec, 72? C. for 30 sec, 35 cycles; 72? C. for 10 min.
[0104] The PCR reaction product is detected by agarose gel electrophoresis, and the results are shown in
(4) Identifying the Expression of StSCI Gene in Individual Offspring Plant by Quantitative PCR:
[0105] In order to verify the expression of the StSCI gene in the self-compatible individual plant identified by molecular markers, as for the hybrid offspring when the individual hybrid plant A which is identified as self-incompatible and the individual hybrid plant B which is identified as self-incompatible by molecular markers grow to full flowering stage, the pollen of the plants is removed out by tweezers, and the total RNA in the pollen and leaves is extracted by using a total RNA extraction kit (Cat. No. DP419) from Tiangen Biotech Co. Ltd. according to the operation instructions, conducting reverse transcription by using TaKaRa Reverse Kit (Cat. No. RR047A) to obtain cDNA, then detecting the expression of StSCI gene by qRT-PCR with the TaKaRa Quantitative Kit (Cat. No. RR820A) according to the operation instructions. The results of the quantitative detection are shown in
[0106] The primer sequences of the quantitative detection are as follows:
TABLE-US-00002 F: (SEQIDNO:11) 5-ATCAGCTAGAGAACTTGCTATTTCATGGG-3; R: (SEQIDNO:12) 5-CGTGCCTCGTATGTCTAGCCAACTTA-3.
[0107] Reverse transcription reaction system and the conditions:
[0108] Reaction for removing the genomic DNA: 2 ?l of 5?gDNA Eraser Buffer, 1 ?l of gDNA Eraser, 1 ?l of total RNA (1 ?g/?l), 6 ?l of RNase Free ddH2O, 42? C. for 2 min.
[0109] Reverse transcription reaction: 10 ?l product of the reaction for removing genomic DNA, 1 ?l of PrimeScript RT Enzyme Mix I, 1 ?l of RT Prime Mix, 4 ?l of 5?PrimeScript Buffer2, 4 ?l of RNase Free ddH2O, 37? C. for 15 min, 85? C. for 5 sec.
Quantitative Reaction System and the Conditions:
[0110] 20 ?l of system for the quantitative PCR reaction: 10 ?l of TB Green Premix Ex Taq II, 0.8 ?l of PCR Forward Primer, 0.8 ?l of PCR Reverse Primer, 0.4 ?l of ROX Reference Dye, 2 ?l of DNA template, and 6 ?l of RNase Free ddH2O.
[0111] Reaction conditions: 95? C. for 30 sec; 95? ? C. for 5 sec, 60? C. for 30 sec, 40 cycles; 95? C. for 15 sec, 60? ? C. for 1 min, 95? ? C. for 15 sec.
[0112] It may be seen from the results in
(5) Identifying the Self-Compatibility Phenotype:
[0113] The self-compatible individual plant A and the self-incompatible individual plant B are routinely self-pollinated, and the fruit setting after pollination is observed. The results are shown in
Example 2
[0114] A method of screening for molecular markers for identifying whether a diploid potato is self-compatible, including the following steps:
(1) Obtaining the Genome Sequence Information of the Parent Materials:
[0115] Self-compatible diploid potato RH89-039-16 and self-incompatible diploid potato PI 225689 are used as parent materials to perform hybridization to obtain hybrid offspring, re-sequencing the genome of RH89-039-16 and PI 225689 to obtain the genome sequence information.
(2) Screening for the Single-Base Difference Sites of the Parental Materials:
[0116] The nucleotide sequence of the StSCI gene and the nucleotide sequence of the StSCI gene linkage are analyzed and screened to find that, a T base is located at 58030614 bp on chromosome 12 of RH89-039-16, while a C base is located at the corresponding position on the PI 225689 material.
[0117] The StSCI gene has a nucleotide sequence represented by SEQ ID NO: 1; the genetic distance of gene linkage is less than 20 cM.
(3) Designing KASP Molecular Markers:
[0118] 50 bp of base sequence is retained respectively in the upstream and downstream of the different single base sequence, and a total of 101 bp of KASP primer sequence is designed including the different single base in the middle; the primer sequence is:
TABLE-US-00003 TTATGATCTTGATAAACTATATATTATCAATATGAATGTTGTAATTGATA [T:C]ATTATTTTGAACTTTGTCCAATCTATATTAGTTATTTAAGTCATC ATATT,(SEQIDNO:3)and(SEQIDNO:4);[T:C] positionistheSNPsiteatposition58030614;
(4) Identifying Whether the Screened Molecular Markers are Usable:
[0119] The screened KASP molecular markers are identified whether they are identical to the genome sequencing results of RH89-039-16 and PI 225689 parent materials, and the test results show that they are identical. The KASP molecular markers may be used for subsequent identification.
Example 3
[0120] A method of screening for molecular markers for identifying whether a diploid potato is self-compatible, including the following steps:
(1) Obtaining the Genome Sequence Information of the Parent Materials:
[0121] Self-compatible diploid potato RH89-039-16 and self-incompatible diploid potato PI 225689 are used as parent materials to perform hybridization to obtain hybrid offspring, re-sequencing the genome of RH89-039-16 and PI 225689 to obtain the genome sequence information.
(2) Screening for the InDel Markers of the Parental Materials:
[0122] The nucleotide sequence of the StSCI gene and the nucleotide sequence of the StSCI gene linkage are analyzed to screen out that an 11 bp nucleotide sequence is missing at position 58136285 in chromosome 12 of RH89-039-16 as compared with PI 225689.
[0123] The StSCI gene has a nucleotide sequence represented by SEQ ID NO: 1; and the genetic distance of gene linkage is less than 20 cM.
(3) Designing the InDel Molecular Markers:
[0124] An appropriate primer fragment is designed respectively upstream and downstream of the InDel site, and primers for amplifying a total of 108 bp fragment including the 11 bp missing sequence are designed. The primer sequences at both ends are as follows:
TABLE-US-00004 F: (SEQIDNO:5) 5-GGTGTATCGAGTCGGAATAA-3; R: (SEQIDNO:6) 5-GATTCGGGAAATTGTACTCA-3.
(4) Identifying Whether the Screened Molecular Markers are Usable:
[0125] The screened InDel molecular markers are identified whether they are identical to the genome sequencing results of RH89-039-16 and PI 225689 parent materials, and the test results show that they are identical. The InDel molecular markers may be used for subsequent identification.
Example 4
[0126] A method of screening for molecular markers for identifying whether a diploid potato is self-compatible, including the following steps:
(1) Sequencing the Genome of Parent Materials RH89-039-16 and C:
[0127] Self-compatible diploid potato RH89-039-16 and self-incompatible diploid potato PI 225689 are used as parent materials to perform hybridization to obtain hybrid offspring, re-sequencing the genome of RH89-039-16 and PI 225689 to obtain the genome sequence information.
(2) Screening for the InDel Markers of the Parental Materials:
[0128] The nucleotide sequence of the StSCI gene and the nucleotide sequence of the StSCI gene linkage are analyzed to screen out that a 538 bp nucleotide sequence is inserted in the promoter region of the StSCI gene.
[0129] The inserted nucleotide sequence has the nucleotide sequence represented by SEQ ID NO: 2; and the genetic distance of gene linkage is less than 10 cM.
(3) Designing the InDel Molecular Markers:
[0130] An appropriate first primer pair is designed upstream and downstream of the inserted sequence; an appropriate second primer pair is also designed upstream of the inserted sequence and in the inserted sequence. A first primer pair for amplifying a sequence including the inserted sequence in the promoter region and a second primer pair for amplifying part of the insertion sequence in the promoter region are designed; and the sequences of the two primer pairs are as follows:
TABLE-US-00005 thefirstupstreamprimer1F: (SEQIDNO:7) 5-CGTCGGATTCAGCAGCAGAGTT-3; thefirstdownstreamprimer1R: (SEQIDNO:8) 5-TCCACATGAGTTGTTTGTTTGGTGTAT-3 thesecondupstreamprimer2F: (SEQIDNO:9) 5-CGTCGGATTCAGCAGCAGAGTT-3; theseconddownstreamprimer2R: (SEQIDNO:10) 5-AAGCGAATTACAAGCCTGTTTAGATTGAC-3.
(4) Identifying Whether the Screened Molecular Markers are Usable:
[0131] The screened two pairs of InDel molecular markers are identified whether they are identical to the genome sequencing results of RH89-039-16 and PI 225689 parent materials, and the test results show that they are identical. The InDel molecular markers may be used for subsequent identification.
Example 5
[0132] A method for identifying whether a diploid potato is self-compatible, including the following steps: [0133] (1) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato PI 225689 as the parent materials to obtain the hybrid offspring; [0134] (2) extracting the leaf genome of the hybrid offspring plants when they grow to the seedling stage; [0135] (3) identifying the leaf genome by using the KASP molecular markers obtained by the method of Example 2, if the [T:T] or [T:C] exists at position 58030614 bp in chromosome 12 of the hybrid offspring, then it is self-compatible; otherwise, if [C:C] exists at such a position, then it is self-incompatible. Since the hybrid offspring plant has the same base at the same position in the chromosome of RH89-039-16, it indicates that this offspring plant has obtained the chromosome including the StSCI gene.
Example 6
[0136] A method for identifying whether a diploid potato is self-compatible, including the following steps: [0137] (1) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato PI 225689 as the parent materials to obtain the hybrid offspring; [0138] (2) extracting the leaf genome of the hybrid offspring plants when they grow to the seedling stage; [0139] (3) identifying the leaf genome by using the InDel molecular markers obtained by the method of Example 3; since the StSCI gene included in RH89-039-16 is heterozygous, and the 11 bp is missing in chromosome 12, two bands of the 97 bp and 108 bp fragments are amplified in RH89-039-16 by the InDel molecular marker primers, while there is only a band of the 108 bp fragment amplified in PI 225689.
[0140] Therefore, when the PCR products amplified by InDel molecular marker primers from the diploid potato hybrid offspring are subjected to PAGE electrophoresis, if the resulting band type is consistent with that of RH89-039-16, the hybrid offspring plant is self-compatible; otherwise, if the resulting band type is consistent with that of PI 225689, the hybrid offspring plant is self-incompatible.
Example 7
[0141] A method for identifying whether a diploid potato is self-compatible, including the following steps: [0142] (1) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato PI 225689 as the parent materials to obtain the hybrid offspring; [0143] (2) extracting the leaf genome of the hybrid offspring plants when they grow to the seedling stage; [0144] (3) identifying the leaf genome by using the two pairs of InDel molecular markers obtained by the method of Example 4; wherein the genomic DNA to be tested is used as a template, the first primer pair (1F and 1R) in Example 4 is used as a group, and the second primer pair (2F and 2R) in Example 4 is used a group, performing PCR amplification reaction separately.
[0145] A 20 ?l amplification system is used in the PCR reaction: 1 ?l of 10-20 ng/?l template DNA, 1 ?l of 10 pmol/?l primers F and R respectively, 0.4 ?l of 10 mmol/L dNTP mix, 0.3 ?l of 0.5 U/?L Taq DNA polymerase, 2 ?l of 10?PCR reaction buffer, and the rest is water.
[0146] PCR reaction conditions are: 94? C. for 5 min; 94? C. for 20 sec, 55? ? C. for 20 sec, 72? C. for 30 sec, 35 cycles; 72? C. for 10 min. [0147] (4) Detecting the PCR amplification products, i.e., detecting the PCR reaction products by agarose gel electrophoresis. If the size of the fragment amplified by the first primer pair is 500 bp, and there is no any band amplified by the second primer pair, it indicates that the hybrid offspring material is self-incompatible; otherwise, if the size of the fragment amplified by the first primer pair is 500 bp, and a band of 400 bp fragment is amplified by the second primer, it indicates that the hybrid offspring material is heterozygous and self-compatible, since the plant is self-compatible, after self-crossing the offspring of this plant will have a separation of self-compatibility phenotype.
[0148] The above descriptions are only preferred examples of this application, and are not intended to limit this application. Any modification, equivalent replacement, etc. made within the spirit and principle of this application shall be covered in the protection scope of this application.