Plants with Modified Deoxyhypusine Synthase Genes
20240188521 ยท 2024-06-13
Assignee
Inventors
- Jerald S. Feitelson (San Diego, CA)
- John E. Thompson (Waterloo, CA)
- Catherine A. Taylor (Boundary Creek, CA)
Cpc classification
C12N15/8279
CHEMISTRY; METALLURGY
C12N15/8261
CHEMISTRY; METALLURGY
C12N15/8249
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/8213
CHEMISTRY; METALLURGY
A01H1/06
HUMAN NECESSITIES
C12N9/1085
CHEMISTRY; METALLURGY
International classification
A01H1/06
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The invention relates to methods of producing a plant with delayed senescence comprising inducing at least one nucleotide deletion, insertion or substitution into at least one copy of a gene encoding deoxyhypusine synthase (DHS) in the plant, wherein the nucleotide deletion, insertion or substitution decreases the activity of DHS encoded by the gene in the plant. The invention also relates to plants produced by the methods and progeny thereof.
Claims
1. A method of producing a plant with delayed senescence comprising inducing at least one nucleotide deletion, insertion or substitution into at least one copy of a gene encoding deoxyhypusine synthase (DHS) in the plant, wherein the nucleotide deletion, insertion or substitution decreases the activity of DHS encoded by the gene in the plant.
2. The method of claim 1, wherein the nucleotide deletion, insertion or substitution occurs in a coding region for at least one amino acid which is required for DHS activity.
3. The method of claim 2, wherein the DHS activity is hypusination of eukaryotic translation initiation factor 5A (eIF-5A) in the plant.
4. The method of claim 1, wherein the nucleotide deletion, insertion or substitution decreases the activity of DHS encoded by the gene in the plant.
5. The method of claim 1, wherein the delayed senescence increases seed yield in the plant.
6. The method of claim 1, wherein the delayed senescence increases leaf and root biomass.
7. The method of claim 1, wherein the delayed senescence enhances plant survival during drought or nutrient stress.
8. The method of claim 1, wherein the delayed senescence increases disease resistance of the plant.
9. The method of claim 1, wherein the delayed senescence increases the period of time during which leaves, stems, seeds and fruit of the plant may be stored and remain suitable for use.
10. The method of claim 1, wherein the plant is haploid, diploid, tetraploid or polyploid.
11. The method of claim 1, comprising inducing at least one nucleotide deletion, insertion or substitution into at least two copies of a gene encoding DHS in the plant.
12-61. (canceled)
62. The method of claim 1, wherein the deletion, insertion or substitution into at least one copy of a gene is in a coding region for at least one amino acid selected from the group consisting of K334, K292, K343, E328, A329, V330, S331, W332, G333, K144, D318 of SEQ ID NO: 2 or a corresponding amino acid in a related plant species.
63. The method of claim 1, wherein the senescence is age-related senescence.
64. The method of claim 1, wherein the senescence is environmental stress-induced senescence.
65. A plant produced by the method of claim 1.
66. Progeny of the plant according to claim 65.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DETAILED DESCRIPTION OF THE INVENTION
[0045] As used herein, a corresponding residue refers to any amino acid in a DHS protein, that upon alignment with a second DHS protein amino acid sequence (e.g., human DHS), which is in a different location based on numbering from the N-terminus to C-terminus, and would be in the same location but for the different numbering due to gaps introduced by any sequence alignment. Examples of corresponding residues are described herein and, for example, in
[0046] For purposes of clarification, the cultivated peanut species (Arachis hypogaea) arose from a hybrid between two wild species of peanut: A. duranensis and A. ipaensis [Seijo et al. (2007) Am. J. Bot. 94 (12)1963-71; Kochert et al. (1996) Am. J. Bot. 83:1282-91; Moretzsohn et al. (2013) Ann. Bot. 111:113-126.] The amino acid sequences of the DHS protein between these parental diploids, A. duranensis and A. ipaensis, are identical (SEQ ID NOS: 18 and 20). Thus, the amino acid sequences of the DHS protein of the cultivated peanut (Arachis hypogaea) is expected to be identical to both parents.
[0047] By genome editing endogenous DHS genes to delete or modify specifically defined functionally critical residues, the resulting genome edited plants have no or substantially less DHS protein to activate eIF-5A. As discussed earlier, eIF-5A must be activated by DHS to render it biologically useful. Thus, by inhibiting or reducing the activity of DHS by genome editing, the resulting genome edited plants will have reduced active eIF-5A. These genome-edited plants will exhibit an increase in biomass of the plant, increased seed yield and/or increased seed size, and also be expected to be more tolerant to abiotic stresses and, in the case of plants producing perishable fruits or vegetables, extended post-harvest shelf life.
[0048] Further evidence to support the contention that DHS and eIF-5A play regulatory roles in senescence was provided by treating carnation flowers with inhibitors that are specific for DHS. Spermidine and eIF-5A are the substrates of DHS reaction [Park et al. (1993) Biofactors 4:95-104; Park et al. (1997) Biol. Signals. 6:115-123]. Several mono-, di-, and polyamines that have structural features similar to spermidine inhibit DHS activity in vitro [Jakus et al. (1993) J. Biol. Chem. 268:13151-13159]. Some polyamines, such as spermidine, putrescine, and spermine, have been generally used to extend carnation vase life [Wang and Baker (1980) Hort. Sci. 15:805-806]. Flower petal senescence was delayed 6 days after harvest of carnations that were vacuum infiltrated with a transient infection system expressing antisense DHS compared to untreated flowers [Hopkins et al. (2007) New Phytol. 175:201-214].
[0049] A further major loss in agriculture besides the loss of growth due to stress is post-harvest stress-induced senescence [McCabe et al. (2001) Plant Physiol. 127:505-516]. This is especially true for plants that are partially processed, such as cut lettuce. A symptom of cutting lettuce is browning which is a result of phenolics production [Matile et al. (1999) Annu. Rev. Plant Physiol. Mol. Biol. 50:67-95]. A field trial of lettuce with antisense polynucleotides of lettuce eIF-5A (LeIF-5A) or antisense full length DHS demonstrated that the transgenic lettuce was significantly more resistant to browning after cutting than the control lettuce. It appears that even though stress induced senescence due to harvesting has distinct circuitry [Page et al. (2001) Plant Physiol. 125:718-727], the translational control upstream of browning and likely other senescence symptoms is regulated at least in part by DHS and eIF-5A. Downstream of the regulation of senescence are the execution genes. These are the effectors of senescence and cause the metabolic changes that bring on the senescence syndrome. It appears that eIF-5A and DHS when down-regulated or reduced in activity are capable of dampening down a whole range of symptoms caused by senescence.
EXAMPLES
[0050] Example 1: Genomic DNA sequences were identified for 31 DHS genes from 28 plant species and human, and delineated into exons and introns. Two DHS genes are shown for Glycine max (soy), Rosa chinensis (rose), and Zea mays (maize). Other species (e.g., Solanum lycopersicumtomato) may have more than one DHS gene, even if only one is provided. Guide RNAs for editing DHS genes can be targeted to exons or introns within the genomic DNA. The exon-intron boundaries of these genomic DNAs are illustrated in
[0051] A genomic DNA sequence for a DHS gene of Arachis duranensis is SEQ ID NO: 66, and the corresponding exons and introns are SEQ ID NO: 67 to SEQ ID NO: 81. A genomic DNA sequence for a DHS gene of Arachis ipaensis is SEQ ID NO: 82, and the corresponding exons and introns are SEQ ID NO: 83 to SEQ ID NO: 97. A genomic DNA sequence for a DHS gene of Arabidopsis thaliana is SEQ ID NO: 98, and the corresponding exons and introns are SEQ ID NO: 99 to SEQ ID NO: 111. A genomic DNA sequence for a DHS gene of Brassica napus is SEQ ID NO: 112, and the corresponding exons and introns are SEQ ID NO: 113 to SEQ ID NO: 125. A genomic DNA sequence for a DHS gene of Brassica rapa is SEQ ID NO: 126, and the corresponding exons and introns are SEQ ID NO: 127 to SEQ ID NO: 139. A genomic DNA sequence for a DHS gene of Beta vulgaris subsp. Vulgaris is SEQ ID NO: 140, and the corresponding exons and introns are SEQ ID NO: 141 to SEQ ID NO: 153. A genomic DNA sequence for a DHS gene of Cicer arietinum is SEQ ID NO: 154, and the corresponding exons and introns are SEQ ID NO: 155 to SEQ ID NO: 167. A genomic DNA sequence for a DHS gene of Coffea canephora is SEQ ID NO: 168, and the corresponding exons and introns are SEQ ID NO: 169 to SEQ ID NO: 181. A genomic DNA sequence for a DHS gene of Camelina sativa is SEQ ID NO: 182, and the corresponding exons and introns are SEQ ID NO: 183 to SEQ ID NO: 195. A genomic DNA sequence for a DHS gene of Camellia sinensis is SEQ ID NO: 196, and the corresponding exons and introns are SEQ ID NO: 197 to SEQ ID NO: 209. A genomic DNA sequence for a DHS gene of Gossypium hirsutum is SEQ ID NO: 210, and the corresponding exons and introns are SEQ ID NO: 211 to SEQ ID NO: 225. A genomic DNA sequence for a DHS gene of Glycine max is SEQ ID NO: 226, and the corresponding exons and introns are SEQ ID NO: 227 to SEQ ID NO: 240. A second genomic DNA sequence for a DHS gene of Glycine max is SEQ ID NO: 241, and the corresponding exons and introns are SEQ ID NO: 242 to SEQ ID NO: 253. A genomic DNA sequence for a DHS gene of Homo sapiens is SEQ ID NO: 254, and the corresponding exons and introns are SEQ ID NO: 255 to SEQ ID NO: 271. A genomic DNA sequence for a DHS gene of Lactuca sativa is SEQ ID NO: 272, and the corresponding exons and introns are SEQ ID NO: 273 to SEQ ID NO: 285. A genomic DNA sequence for a DHS gene of Musa acuminate is SEQ ID NO: 286, and the corresponding exons and introns are SEQ ID NO: 287 to SEQ ID NO: 299. A genomic DNA sequence for a DHS gene of Manihot esculenta is SEQ ID NO: 300, and the corresponding exons and introns are SEQ ID NO: 301 to SEQ ID NO: 315. A genomic DNA sequence for a DHS gene of Medicago sativa is SEQ ID NO: 316, and the corresponding exons and introns are SEQ ID NO: 317 to SEQ ID NO: 331. A genomic DNA sequence for a DHS gene of Oryza sativa Japonica is SEQ ID NO: 332, and the corresponding exons and introns are SEQ ID NO: 333 to SEQ ID NO: 345. A genomic DNA sequence for a DHS gene of Populus deltoides is SEQ ID NO: 346, and the corresponding exons and introns are SEQ ID NO: 347 to SEQ ID NO: 359. A genomic DNA sequence for a DHS gene of Phalaenopsis equestris is SEQ ID NO: 360, and the corresponding exons and introns are SEQ ID NO: 361 to SEQ ID NO: 373. A genomic DNA sequence for a DHS gene of Phaseolus vulgaris is SEQ ID NO: 374, and the corresponding exons and introns are SEQ ID NO: 375 to SEQ ID NO: 387. A genomic DNA sequence for a DHS gene of Rosa chinensis is SEQ ID NO: 388, and the corresponding exons and introns are SEQ ID NO: 389 to SEQ ID NO: 401. A second genomic DNA sequence for a DHS gene of Rosa chinensis is SEQ ID NO: 402, and the corresponding exons and introns are SEQ ID NO: 403 to SEQ ID NO: 415. A genomic DNA sequence for a DHS gene of Sorghum bicolor is SEQ ID NO: 416, and the corresponding exons and introns are SEQ ID NO: 417 to SEQ ID NO: 429. A genomic DNA sequence for a DHS gene of Solanum lycopersicum is SEQ ID NO: 430, and the corresponding exons and introns are SEQ ID NO: 431 to SEQ ID NO: 443. A genomic DNA sequence for a DHS gene of Solanum tuberosum is SEQ ID NO: 444, and the corresponding exons and introns are SEQ ID NO: 445 to SEQ ID NO: 457. A genomic DNA sequence for a DHS gene of Triticum aestivum is SEQ ID NO: 458, and the corresponding exons and introns are SEQ ID NO: 459 to SEQ ID NO: 472. A genomic DNA sequence for a DHS gene of Theobroma cacao is SEQ ID NO: 473, and the corresponding exons and introns are SEQ ID NO: 474 to SEQ ID NO: 484. A genomic DNA sequence for a DHS gene of Vitis vinifera is SEQ ID NO: 485, and the corresponding exons and introns are SEQ ID NO: 486 to SEQ ID NO: 498. A genomic DNA sequence for a DHS gene of Zea mays is SEQ ID NO: 499, and the corresponding exons and introns are SEQ ID NO: 500 to SEQ ID NO: 514. A second genomic DNA sequence for a DHS gene of Zea mays is SEQ ID NO: 515, and the corresponding exons and introns are SEQ ID NO: 516 to SEQ ID NO: 531.
[0052] Example 2: An engineered homing endonuclease known as ARCUS would is
[0053] engineered to produce a nuclease that would be capable of creating a double-stranded cleavage in a region of M. sativa DHS that is required for its deoxyhypusine synthase activity. These regions targeted for cleavage could include the nucleic acids surrounding the regions that, when translated, include, for example either Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). The DNA cleavage created by the engineered ARC nuclease would allow the creation of a small deletion, insertion or single-base pair substitution in a targeted region of plant DHS that is known to be critical for its deoxyhypusine synthase activity. In M. sativa, the activity of the enzyme can be disrupted by deleting one or more of the following residues: Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). In one embodiment, the nucleotide region encoding the region surrounding, and including, Lys.sup.334 of M. sativa DHS would be deleted in order to abolish deoxyhypusine synthase activity. In another embodiment, the nucleotide region encoding the region surrounding, and including, Lys.sup.292 of M. sativa DHS would be deleted in order to abolish deoxyhypusine synthase activity.
[0054] Example 3: An engineered transcription activator-like effector (TALE) combined with a functional domain, for example, a FokI nuclease (TALEN), is engineered to produce a nuclease that would be capable of creating a double-stranded cleavage in a region of M. sativa DHS that is required for its deoxyhypusine synthase activity. These regions targeted for cleavage include the nucleic acids surrounding the region that, when translated, includes, for example either Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). The DNA cleavage created by the engineered nuclease allows for a small deletion, insertion or single-base pair substitution in a targeted region of plant DHS that is known to be critical for its deoxyhypusine synthase activity. In M. sativa, the activity of the enzyme is disrupted by deleting one or more of the following residues: Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). For example, the nucleotide region encoding the region surrounding, and including, Lys.sup.334 of M. sativa DHS is deleted to abolish deoxyhypusine synthase activity. In another example, the nucleotide region encoding the region surrounding, and including, Lys.sup.292 of M. sativa DHS is deleted to abolish deoxyhypusine synthase activity.
[0055] Example 4: A sgRNA is engineered to produce a guide RNA capable of creating a double-stranded cleavage in a region of M. sativa DHS that is required for its deoxyhypusine synthase activity, when introduced into the plant along with Cas9 (CRISPR-Cas9 system). These regions targeted for cleavage include the nucleic acids surrounding the region that, when translated, include, for example, either Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). The DNA cleavage by cas9 allows for the creation of a small deletion, insertion or single-base pair substitution in a targeted region of plant DHS that is known to be critical for its deoxyhypusine synthase activity. In M. sativa, the activity of the enzyme is disrupted by deleting one or more of the following residues: Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). For example, the nucleotide region encoding the region surrounding, and including, Lys.sup.334 of M. sativa DHS is deleted in order to abolish deoxyhypusine synthase activity. In another example, the nucleotide region encoding the region surrounding, and including, Lys.sup.292 of M. sativa DHS is deleted in order to abolish deoxyhypusine synthase activity.
[0056] Example 5: A GRON is engineered to produce an oligonucleotide that creates a mismatch error and subsequent repair using the GRON as a template (RTDS?), so as to create a desired substitution or deletion in a region of M. sativa DHS that is required for its deoxyhypusine synthase activity. These regions targeted for cleavage include the nucleic acids surrounding the region that, when translated, includes, for example either Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). The mismatch created by the GRON produces a small deletion, insertion or single-base pair substitution in a targeted region of plant DHS that is known to be critical for its deoxyhypusine synthase activity. In M. sativa, the activity of the enzyme is disrupted by deleting one or more of the following residues: Lys.sup.334 (corresponds to Lys.sup.329 of human DHSsee Table 3) or Lys.sup.292 (Lys.sup.287 in human DHS). For example, the nucleotide region encoding the region surrounding, and including, Lys.sup.334 of M. sativa DHS is deleted in order to abolish deoxyhypusine synthase activity. In another example, the nucleotide region encoding the region surrounding, and including, Lys.sup.292 of M. sativa DHS is deleted in order to abolish deoxyhypusine synthase activity.
Example 6: Editing Pre-Determined Genomic Loci in Alfalfa (Medicago sativa)
[0057] One or more gRNAs is designed to anneal with a desired site in the alfalfa genome and to allow for interaction with one or more Cms1 or other CRISPR double stranded nuclease proteins. These gRNAs are cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the gRNA cassette). One or more genes encoding a Cms1 or other CRISPR double stranded nuclease protein is cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the CRISPR nuclease cassette). The gRNA cassette and the CRISPR nuclease cassette are each cloned into a vector that is suitable for plant transformation, and this vector is subsequently transformed into Agrobacterium cells. These cells are brought into contact with alfalfa tissue that is suitable for transformation. Following this incubation with the Agrobacterium cells, the alfalfa cells are cultured on a tissue culture medium that is suitable for regeneration of intact plants with selection against Agrobacterium cells. Alfalfa plants are regenerated from the cells that were brought into contact with Agrobacterium cells harboring the vector that contained the CRISPR nuclease cassette and gRNA cassette. Following regeneration of the alfalfa plants, plant tissue is harvested and DNA is extracted from the tissue. T7 endonuclease 1 (T7E1) assays and/or sequencing assays are performed, as appropriate, to determine whether a change in the DNA sequence has occurred at the desired genomic location.
[0058] Alternatively, particle bombardment is used to introduce the CRISPR nuclease cassette and gRNA cassette into alfalfa cells. Vectors containing a CRISPR nuclease cassette and a gRNA cassette are coated onto gold beads or titanium beads that are then used to bombard alfalfa tissue that is suitable for regeneration. Following bombardment, the alfalfa tissue is transferred to tissue culture medium for regeneration of alfalfa plants. Following regeneration of the alfalfa plants, plant tissue is harvested and DNA is extracted from the tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether a change in the DNA sequence has occurred at the desired genomic location.
Example 7: Editing Pre-Determined Genomic Loci in Oryza sativa
[0059] One or more gRNAs is designed to anneal with a desired site in the Oryza sativa genome and to allow for interaction with one or more Cms1 or other CRISPR double stranded nuclease proteins. These gRNAs are cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the gRNA cassette). One or more genes encoding a Cms1 or other CRISPR double stranded nuclease protein is cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the CRISPR nucleasecassette). The gRNA cassette and the CRISPR nucleasecassette are each cloned into a vector that is suitable for plant transformation, and this vector is subsequently transformed into Agrobacterium cells. These cells are brought into contact with Oryza sativa tissue that is suitable for transformation with selection against Agrobacterium cells. Following this incubation with the Agrobacterium cells, the Oryza sativa cells are cultured on a tissue culture medium that is suitable for regeneration of intact plants. Oryza sativa plants are regenerated from the cells that were brought into contact with Agrobacterium cells harboring the vector that contained the CRISPR nuclease cassette and gRNA cassette. Following regeneration of the Oryza sativa plants, plant tissue is harvested and DNA is extracted from the tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether a change in the DNA sequence has occurred at the desired genomic location.
[0060] Alternatively, particle bombardment is used to introduce the CRISPR nuclease cassette and gRNA cassette into Oryza sativa cells. Vectors containing a CRISPR nucleasecassette and a gRNA cassette are coated onto gold beads or titanium beads that are then used to bombard Oryza sativa tissue that is suitable for regeneration. Following bombardment, the Oryza sativa tissue is transferred to tissue culture medium for regeneration of intact plants. Following regeneration of the plants, plant tissue is harvested and DNA is extracted from this tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether a change in the DNA sequence has occurred at the desired genomic location.
Example 8: Editing Pre-Determined Genomic Loci in Brassica napus
[0061] One or more gRNAs is designed to anneal with a desired site in the Brassica napus genome and to allow for interaction with one or more Cms1 or other CRISPR double stranded nuclease proteins. These gRNAs are cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the gRNA cassette). One or more genes encoding a Cms1 or other CRISPR double stranded nuclease protein is cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the CRISPR nucleasecassette). The gRNA cassette and the CRISPR nucleasecassette are each cloned into a vector that is suitable for plant transformation, and this vector is subsequently transformed into Agrobacterium cells. These cells are brought into contact with Brassica napus tissue that is suitable for transformation. Following this incubation with the Agrobacterium cells, the Brassica napus cells are cultured on a tissue culture medium that is suitable for regeneration of intact plants with selection against Agrobacterium cells. Brassica napus plants are regenerated from the cells that were brought into contact with Agrobacterium cells harboring the vector that contained the CRISPR nuclease cassette and gRNA cassette. Following regeneration of the Brassica napus plants, plant tissue is harvested and DNA is extracted from the tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether a change in the DNA sequence has occurred at the desired genomic location.
[0062] Alternatively, particle bombardment is used to introduce the CRISPR nuclease cassette and gRNA cassette into Brassica napus cells. Vectors containing a CRISPR nuclease cassette and a gRNA cassette are coated onto gold beads or titanium beads that are then used to bombard Brassica napus tissue that is suitable for regeneration. Following bombardment, the Brassica napus tissue is transferred to tissue culture medium for regeneration of intact plants. Following regeneration of the plants, plant tissue is harvested and DNA is extracted from this tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether a change in the DNA sequence has occurred at the desired genomic location.
Example 9: Deleting DNA from a Pre-Determined Genomic Locus Using Non Homologous End Joining
[0063] A first gRNA is designed to anneal with a first desired site in the genome of a plant of interest and to allow for interaction with one or more Cms1 or other CRISPR double stranded nuclease proteins. A second gRNA is designed to anneal with a second desired site in the genome of a plant of interest and to allow for interaction with one or more CRISPR nuclease proteins. Each of these gRNAs is operably linked to a promoter that is operable in a plant cell and is subsequently cloned into a vector that is suitable for plant transformation. One or more genes encoding a Cms1 or other CRISPR double stranded nuclease protein is cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the CRISPR nuclease cassette). The CRISPR nuclease cassette and the gRNA cassettes are cloned into a single plant transformation vector that is subsequently transformed into Agrobacterium cells. These cells are brought into contact with plant tissue that is suitable for transformation. Following this incubation with the Agrobacterium cells, the plant cells are cultured on a tissue culture medium that is suitable for regeneration of intact plants with selection against Agrobacterium cells. Alternatively, the vector containing the CRISPR nuclease cassette and the gRNA cassettes is coated onto gold or titanium beads suitable for bombardment of plant cells. The cells are bombarded and are then transferred to tissue culture medium that is suitable for the regeneration of intact plants. The gRNA-CRISPR nuclease complexes effect double-stranded breaks at the desired genomic loci and in some cases the DNA repair machinery causes the DNA to be repaired in such a way that some native DNA sequence that was located near or within the gRNA sequence is deleted. Plants are regenerated from the cells that are brought into contact with Agrobacterium cells harboring the vector that contains the CRISPR nuclease cassette and gRNA cassettes or are bombarded with beads coated with this vector. Following regeneration of the plants, plant tissue is harvested and DNA is extracted from the tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether DNA has been deleted from the desired genomic location or locations.
Example 10: Making Base Substitutions in DNA at a Pre-Determined Genomic Locus Using Homology Directed Repair
[0064] A gRNA is designed to anneal with a desired site in the genome of a plant of interest and to allow for interaction with one or more Cms1 or other CRISPR double stranded nuclease proteins. The gRNA is operably linked to a promoter that is operable in a plant cell and is subsequently cloned into a vector that is suitable for plant transformation. One or more genes encoding a Cms1 or other CRISPR double stranded nuclease protein is cloned in a vector such that they are operably linked to a promoter that is operable in a plant cell (the CRISPR nuclease cassette), along with a highly expressed single or double stranded donor DNA oligonucleotide comprised of a sequence homologous to a targeted DNA in the host genome but containing specific base changes that cause one or more targeted mutations that occur by Homology Directed Repair [Miki et al. (2018) Nature Comm. 9:1967-1975]. The CRISPR nuclease cassette, the gRNA cassette, and the highly expressed oligonucleotide are cloned into a single plant transformation vector that is subsequently transformed into Agrobacterium cells. These cells are brought into contact with plant tissue that is suitable for transformation. Said donor DNA oligonucleotide includes a DNA molecule that is to be inserted at the desired site in the plant genome, flanked by upstream and downstream flanking regions. The upstream flanking region is homologous to the region of genomic DNA upstream of the genomic locus targeted by the gRNA, and the downstream flanking region is homologous to the region of genomic DNA downstream of the genomic locus targeted by the gRNA. The upstream and downstream flanking regions mediate the recombination of DNA into the desired site of the plant genome. Following this incubation with the Agrobacterium cells and introduction of the donor DNA, the plant cells are cultured on a tissue culture medium that is suitable for regeneration of intact plants with selection against Agrobacterium cells. Plants are regenerated from the cells that were brought into contact with Agrobacterium cells harboring the vector that contained the CRISPR nuclease cassette, gRNA cassettes and donor DNA oligonucleotide. Following regeneration of the plants, plant tissue is harvested and DNA is extracted from the tissue. T7EI assays and/or sequencing assays are performed, as appropriate, to determine whether the desired base changes have occurred at the desired genomic location or locations.
Example 11: DHS Editing in Brassica napus Using CRISPR-Cas9
[0065] Brassica napus (Canola) is an important oilseed crop and a dicot. The amphidiploid genome of B. napus has two copies of the DHS gene, one each from the contributing B. rapa (AA) and B. oleracea (CC) genomes. The LOC106419026 DHS gene (DHS1) of B. napus was edited using the CRISPR-Cas9 system to determine if senescence could be delayed. The methods for this example were adapted from previous gene editing studies in B. napus, which are herein incorporated in their entirety [Yang et al., Scientific Reports 7:7489, 2017].
[0066] Vector construction: The DNA sequences of the B. napus DHS gene that were selected for targeting by guide RNAs are identified
[0067] Step 1) To reduce subcloning background, the AtU6-based cassette donor vector was digested first with Bgl II and Sal I restriction endonucleases, followed by a second digestion with Esp3I per the published protocol for assembly of a multiplex CRISPR-Cas9 T-DNA vector (www.plantphysiol.org/content/plantphysiol/suppl/2015/08/21/pp. 15.00636.DC1/PP2015-00636R1_Supplemental_Materials_and_methods.pdf). Sense and antisense oligonucleotides with sequences corresponding to the three DHS guide RNAs were synthesized, annealed, and then individually inserted into donor vectors. The sequences of the resulting plasmids, pYPQ131A, pYPQ132A and pYPQ133A, were confirmed by Sanger sequencing.
[0068] Step 2) All three guide sequences were assembled into pYPQ143 using the Golden Gate? recombination system. Insertion of a Cas9 expression module into pYPQ143 yielded recombinant plasmid vector pYPQ150, which contained all CRISPR components required for targeted editing of the B. napus DHS gene.
[0069] Step 3) The CRISPR cassettes were incorporated into a plant delivery vector using the Gateway? recombination system to create a binary destination plasmid that contains a third module with PAT and kanamycin selection markers for recovering the transformants. The sequences of the CRISPR cassettes in the transformation vector were confirmed by Sanger sequencing. This derivative recombinant binary vector was introduced into Agrobacterium MP90 carrying a disarmed Ti plasmid with vir functions provided in trans.
[0070] Production of transgenic lines: The recombinant T-DNA was delivered into receptive B. napus cells. Cotyledonary petioles were collected from 4-5 days old B. napus seedlings grown in jars under sterile conditions and expanded in tissue culture [Moloney et al., Plant Cell Reports 8:238-42, 1989; Babic et al., Plant Cell Reports 17:183-88, 1998]. The cotyledonary explants were placed on filter paper and co-cultivated with Agrobacterium carrying the CRISPR-based DHS targeting construct in medium containing 1 mg/l 2,4-Dichlorophenoxyacetic acid (2-4 D) for 2 days at 22? C. followed by 4 days at 4? C. The explants were then transferred to selection medium (MS) with 4 mg/l 6-benzyl aminopurine (BAP), 25 mg/l Kanamycin and 2.5 mg/l PPT. After 4-6 weeks, some of the explants produced green shoots from the petioles on the selection medium. To increase the number of putative transformed shoots, these steps were repeated 4 times using ?700 explants in each experiment. Green shoots recovered from these experiments were transferred to elongation medium containing 0.05 mg/l BAP and 0.02 mg/l Gibberellin A3 (GA3). Shoots that were not vitrified were transferred to rooting medium containing 50% MS plus 0.1 mg/l BAP, 25 mg/l kanamycin and 5 mg/l phosphinotricin (PPT). Shoots that successfully produced roots were transferred to pots to establish TO plants, which were analysed by PCR for the presence of transgenes. A total of 55 B. napus transgenic lines were identified. The stringent double selection and confirmative molecular analysis ensured that these transgenic lines carry the recombinant DHS constructs. The DHS genes from 38 of these lines were amplified by PCR, subcloned into a plasmid, and then sequenced. All but one were identical to wild type. The exception, clone #16, had a 1 bp deletion adjacent to the sequence targeted by a guide RNA, resulting in a truncated DHS protein (
[0071] Phenotype resulting from an edited B. napus DHS gene: The transgenic DHS lines were grown in pots under controlled greenhouse conditions at 22? C. with a 16h light/8 hrs dark cycle. Their development and growth was compared with non-transgenic control lines. The majority of the transgenic lines had DHS gene sequences identical to wild type and had normal growth and development patterns. In contrast, B. napus line #16, with an edited DHS gene, produced dwarf plants with darker leaves. Line #16 also displayed delayed leaf senescence and took 15-20 days longer to complete the growth and seed production cycle (
[0072] Beneficial effects of editing the B. napus DHS gene: The compact dwarf phenotype, darker green leaves, and delayed senescence of B. napus plants with an edited DHS gene offer agronomic advantages. The compact dwarf phenotype offers less lodging and better shoot architecture for capturing sunlight. This could improve photosynthetic efficiency, thereby increasing oil production and seed yields in this important oil seed crop. The darker green leaves suggest a higher chlorophyll content and increased photosynthetic capacity. Delayed senescence results in staying green longer, especially during critical and final phases of reproductive development, and is expected to enhance seed filling and production in B. napus, as observed in other diverse crop species.
Example 12: DHS1 Editing in Japonica Rice Using CRISPR-Cms1 with a Guide RNA Targeting the Intron Upstream of K149
[0073] Oryza sativa cv. Kitaake (Japonica rice) is a monocot. Edits were generated in the intron upstream of the NADY-binding site adjacent to K149 of the DHS1 gene of O. sativa cv. Kitaake. Most resulted in 3-21 bp deletions that do not affect the exon sequence, but may cause mis-splicing of the mRNA. Several larger (>50nt) deletions and deletion with insertions were also observed. These would be predicted to affect the protein product, potentially resulting in a loss of function. TO events generated with larger modifications were compared to T0 events generated at the same time with smaller modifications. The larger modifications were associated with a delay in flowering and an increase in chlorophyll content.
[0074] Guide RNA design: Kitaake rice has a highly-expressed DHS1 gene (OsKitaake 03g332300 (DHS1) on Chr3 at 31549616-31554176) and a homologous but rarely-expressed DHS2 gene (OsKitaake 09g102400 (DHS2) on Chr9 at 14897349-14900826). A guide RNA specific to the DHS1 gene and compatible with (CRISPR-Cms1 chemistry was designed to target the intron between the second and third exons. It had the following sequence, AATTTCTACTGTTGTAGATAAGGGGGATTAGCTACATCATAGG [SEQ ID NO: 532], with underlining indicating a crRNA hairpin structure.
[0075] Production of gene edited rice plants: Callus derived from immature O. sativa cv. Kitaake seeds was bombarded with three plasmids separately containing a CRISPR nuclease, a guide RNA, and a marker providing resistance to hygromycin. After four weeks of selection, the callus material was screened for the presence of edits with a T7 Enoduclease I assay. Next Generation Sequencing of DNA from callus material with apparent edits revealed deletions at the target site ranging from 3 to 65 base pairs (
[0076] Phenotype of T0 rice plants: T0 rice plants were regenerated, grown under greenhouse conditions, and compared with other T0 plants regenerated from the same callus material and transplanted to soil on the same date. Chlorophyll content was measured with a SPAD 502 Plus Chlorophyll Meter (www.specmeters.com/nutrient-management/chlorophyll-meters/chlorophyll/spad502p/#description). Lines C30S, C31G, C31H, and C31I all had a 10-day delay in flowering relative and a ?11% increase in chlorophyll content compared to line C30T, indicating that large insertion/deletions cause delayed flowering and increased chlorophyll content (Table 4). No significant phenotypic differences were observed between lines derived from a separate callus piece (GE568-8) that had either small internal deletions in the intron or no detected edits (Table 5).
TABLE-US-00004 TABLE 4 Phenotypes of Kitaake Rice GE0568 T0 plants regenerated from callus 30 and 31. Days to Chlorophyll content T0 plant ID Edit Reproduction (average SPAD reading) GE0568 30T 3 bp deletion 21 32.9 GE0568 30S 10 bp deletion & 31 36.6 99 bp insertion GE0568 31G Insertion 31 39.9 GE0568 31H 10 bp deletion & 31 38.1 99 bp insertion GE0568 31I Insertion 31 39.15
TABLE-US-00005 TABLE 5 Phenotypes of Kitaake Rice GE0568 T0 plants regenerated from callus 8. Days to Chlorophyll content T0 plant ID Edit Reproduction (average SPAD reading) GE0568 8W Small indel 28 36 GE0568 8S None 31 42.8 GE0568 8T None 28 42.8 GE0568 8U None 28 42.8 GE0568 8X None 31 34.85
[0077] To confirm the phenotypic differences observed with T0 rice plants, T1 plants are generated and genotyped by DNA sequencing. For each DNA editing event heterozygous plants are compared to null segregant and wild-type controls. In the unlikely event that homozygous mutant plants survive, they are also tested. For each genotype, twelve plants are grown in a greenhouse and phenotyped for biomass, flowering time, days to senescence, chlorophyll content and seed yield.
Example 13: DHS1 Editing in Japonica Rice Using CRISPR-Cms1 with a Guide RNA Targeting the Active Site Lysine
[0078] Guide RNA: A guide RNA [SEQ ID NO: 581] was designed to introduce a mutation in the conserved active site (EAVSWGK; SEQ ID NO: 546) in exon 6 of the Oryza sativa cv. Kitaake DHS1 gene, as illustrated in
[0079] Production of gene edited rice plants: The plant delivery vector was transferred into Agrobacterium for transformation of Kitaake rice. Seven hygromycin-resistant T0 plants were regenerated and genotyped for mutations at the targeted site. One T0 plant (#2) was a monoallelic (or heterozygous) mutant with one wild-type allele and the other allele carrying a 10 bp deletion at the targeted active site. Other T0 plants were either wild type (homozygous normal) or too weak to survive for genotyping (homozygous mutant). Sequencing DNA extracted from plant #2 revealed a 10 bp deletion resulting in a frameshift that leads to a stop codon (
[0080] Phenotype of rice plants carrying C-terminally truncated DHS1: The heterozygous T0 line #2 grew normally in the greenhouse with no apparent morphological differences other than a significant increase in seed size compared to homozygous wild type plants. The T1 progeny included four heterozygotes and six homozygous wild-types, but no homozygous DHS1 truncation mutants, suggesting that the homozygous truncation is lethal. T1 plants were grown to maturity in the greenhouse. Compared to wild-type controls, the heterozygous T1 plants are shorter, have a slightly higher tiller number, a similar spikelet number, and have seed that are about 25% larger (Table 6). Additionally, T1 plants carrying the C-terminally truncated DHS1 allele have a darker green appearance, suggesting higher chlorophyll content (
[0081] The phenotypes observed in rice with a heterozygous C-terminally truncated DHS1 allele demonstrate the beneficial effects of reducing DHS activity through introducing specific mutations or deletions in genome edited crops, consistent with previous observations of reducing DHS expression using RNAi in Arabidopsi thaliana, tomato, and canola using antisense RNA [Duguay 2007; Wang 2001; Wang et al. (2003) Plant Mol. Biol. 52, 1223-1235; Wang et al. (2005) Physiol. Plant. 124, 493-503; Wang et al. (2005) Plant Physiol. 138, 1372-1382]. A 50% reduction in DHS activity using genome editing methods to make critical mutations seems to be in the sweet spot that these authors were able to obtain using very different transgenic antisense derivatives of wild-type DHS in several crops. DHS assembles into tetramers, so a reduction in activity might be caused by the formation of tetramers with a mix of full-length (active) and C-terminally truncated (inactive) subunits, segregation of full-length and C-terminally truncated DHS polypeptides into separate tetramers, or the premature degradation of C-terminally truncated polypeptides.
TABLE-US-00006 TABLE 6 Phenotypic comparison of T1 rice plants. Values are presented as mean ? standard deviation. Trait Truncated DHS Control Height (cm) 56.8 ? 16.6 69.4 ? 3.8 Tiller number 8.0 ? 2.6 6.0 ? 1.7 Spikelet number 36.7 ? 9.1 37.2 ? 5.5 Seed mass (g/20 seeds) 0.75 ? 0.03 0.59 ? 0.02
Example 14: General Strategy for Base Editing DHS in Various Plants
[0082] DHS activity is disrupted by genome or base editing the NAD.sup.+-binding site adjacent to Lys149 and/or the active site near the C-terminus. Lys149 can be edited by replacing the second adenine in a Lys codon with a guanine to form an Arg codon, or by deletion. The 21 nucleotides encoding the active site can be altered by a specific mutation or deleted as part of a C-terminal truncation (Table 7).
TABLE-US-00007 TABLE7 Site-SpecificcodonchangestoNAD.sup.+-bindingsitesnearLys.sub.149ingenomicExon3/4ofDHSgenes and21-NTactivesitesequences. Species Common Lys.sub.149 Lys.sub.149 Arg Active Sequencecodingforthe SEQ ID Speciesname name Exon codon codon SiteExon 7-aminoacidActiveSite IDNO Adur Arachisduranensis peanutparent1 4 AAG AGG 7 GAAGCTGTTTCCTGGGGAAAA 547 Aipa Arachisipaensis peanutparent2 4 AAG AGG 7 GAAGCTGTTTCCTGGGGAAAA 548 Atha Arabidopsis Arabidopsis 3 AAA AGA 6 GAAGCCGTGTCTTGGGGTAAA 549 thaliana Bnap Brassicanapus canola 3 AAA AGA 6 GAAGCAGTGTCTTGGGGTAAA 550 Brap Brassicarapa rape 3 AAA AGA 6 GAGGCAGTGTCTTGGGGTAAA 551 Bvul Betavulgaris sugarbeet 3 AAA AGA 6 GAGGCCGTGTCCTGGGGAAAG 552 subsp.vulgaris Cari Cicerarietinum chickpea 3 AAG AGG 6 GAGGCTGTTTCATGGGGGAAA 553 Ccan Coffeacanephora coffee 3 AAG AGG 6 GAAGCTGTATCATGGGGAAAG 554 Csat Camelinasativa camelina 3 AAA AGA 6 GAAGCCGTATCTTGGGGTAAA 555 Csin Camelliasinensis tea 3 AAA AGA 6 GAAGCTGTATCATGGGGAAAA 556 Ghir Gossypiumhirsutum cotton 4 AAA AGA 7 GAAGCTGTTTCATGGGGGAAA 557 Gmax1 Glycinemax soybean 4 AAG AGG 7 GAAGCTGTTTCATGGGGAAAG 558 Gmax2 Glycinemax soybean 4 AAG AGG 7 GAAGCTGTTTCATGGGGAAAG 559 Hsap Homosapiens human 3 AAG 8 GAGGCTGTCTCCTGGGGCAAG 560 Lsat Lactucasativa lettuce 3 AAA AGA 6 GAAGCTGTCTCCTGGGGGAAA 561 Macu Musaacuminate banana 3 AAA AGA 6 GAGGCGATTTCATGGGGAAAG 562 Mesc Manihotesculenta cassava 4 AAA AGA 7 GAGGCTGTATCATGGGGAAAA 563 Msat Medicagosativa alfalfa 4 AAG AGG 7 GAGGCTGTTTCATGGGGGAAA 564 Osat Oryzasativa rice 3 AAA AGA 6 GAAGCAGTTTCATGGGGAAAG 565 Japonica Pdel Populusdeltoides cottonwood 3 AAA AGA 6 GAGGCTGTATCGTGGGGGAAA 566 Pequ Phalaenopsis orchid 3 AAG AGG 6 GAGGCTGTTTCATGGGGAAAA 567 equestris Pvul Phaseolusvulgaris commonbean 3 AAG AGG 6 GAGGCTGTTTCGTGGGGGAAA 568 Rchi1 Rosachinensis rose 3 AAA AGA 6 GAGGCTGTCTCCTGGGGGAAA 569 Rchi2 Rosachinensis rose 3 AAA AGA 6 GAGGCTGTCTCCTGGGGGAAA 570 Sbic Sorghumbicolor sorghum 3 AAA AGA 6 GAAGCAGTCTCATGGGGCAAG 571 Slyc Solanum tomato 3 AAG AGG 6 GAAGCTGTATCATGGGGAAAG 572 lycopersicum Stub Solanumtuberosum potato 3 AAG AGG 6 GAAGCTGTATCATGGGGAAAG 573 Taes Triticumaestivum wheat 3 AAA AGA 6 GAAGCAGTTTCATGGGGAAAG 574 Tcac Theobromacacao cocoa 4 AAG AGG 6 GAGGCTATTTCATGGGGGAAA 575 Vvin Vitisvinifera grape 3 AAA AGA 6 GAGGCTGTGTCATGGGGGAAA 576 Zmay1 Zeamays corn 3(5) AAA AGA 6(8) GAAGCAGTCTCATGGGGCAAG 577 Zmay2 Zeamays corn 3(6) AAA AGA 6(9) GAAGCGGTTTCATGGGGAAAG 578