METHOD FOR MEASURING NUCLEIC ACID CONTENT IN LIPID NANOPARTICLES USING ULTRAVIOLET SPECTROMETRY

Abstract

An ultraviolet (UV) absorbance assay for measuring the concentration of large RNA molecules such as mRNA in suspensions comprising RNA-lipid nanoparticles (RNA-LNPs) is described.

Claims

1. A method for measuring the ribonucleic acid (RNA) concentration of a suspension of RNA-lipid nanoparticle (RNA-LNPs) wherein the RNA-LNPs comprise ionizable cationic lipids and the RNA is at least 100 nucleotides in length, the method comprising: (a) mixing a suspension of RNA-LNPs with an assay diluent having a pH of at least pH 11 or a pH of about pH 12 and comprising a surfactant and an alkylamine, wherein the surfactant and the alkylamine are each selected to be optically transparent at λ.sub.max of the RNA, to provide a diluted sample solution; (b) measuring absorbance of the diluted sample solution at lambda maximum of the RNA (λ.sub.max) to provide a Net Absorbance or measuring absorbance of the diluted sample solution at λ.sub.max and at 400 nm and subtracting the absorbance at 400 nm from the absorbance at λ.sub.max to provide an adjusted Net Absorbance; and (c) using the Net Absorbance or the adjusted Net Absorbance to determine the RNA concentration in the suspension of the RNA-LNPs.

2. The method of claim 1, wherein the alkylamine comprises a tertiary amine of the formula NRR′R″ wherein R, R′, and R″ are each independently a C1 to C18 alkyl.

3. The method of claim 1, wherein the alkylamine is selected from the group consisting of N,N-dimethylbutylamine (DMBA; CAS 927-62-8), N,N-diethylethanamine (TEA; CAS 121-44-8), N,N-diisopropylethylamine (DIPEA; CAS 7087-68-5), and hexan-1-amine (1-HA; CAS 111-26-2).

4. The method of claim 1, wherein the surfactant is selected from the group consisting of sodium dodecyl sulfate (SDS; CAS 151-21-3), cetyltrimethylammonium bromide (C-TAB; CAS 57-09-0), and polyethylene glycol alkyl ether (BRIJ).

5. The method of claim 1, wherein the surfactant is sodium dodecyl sulfate (SDS) and the alkylamine is N,N-dimethylbutylamine (DMBA) or the surfactant is a polyethylene glycol alkyl ether and the alkylamine is hexan-1-amine (1-HA).

6. The method of claim 1, wherein the ionizable cationic lipids comprise a tertiary amine.

7. The method of claim 6, wherein the ionizable cationic lipid comprises a tertiary amine and at least one saturated or unsaturated hydrocarbon chain comprising at least nine carbon atoms.

8. The method of claim 1, wherein the ionizable cationic lipid is dilinoleylmethyl-4-dimethylaminobutyrate (D-Lin-MC3-DMA; CAS 1224606-06-7).

9-10 (canceled)

11. The method of claim 1, wherein the assay diluent further includes a metal chelator.

12. (canceled)

13. The method of claim 1, wherein the assay diluent comprises about 750 mM N,N-dimethylbutylamine, about 10% (w/v) SDS, and about 1 mM EDTA.

14-16. (canceled)

17. The method of claim 1, wherein the RNA concentration is determined using the formula $\mathrm{mRNA}\left(\frac{\mathrm{mg}}{\mathrm{mL}}\right)=\left(\frac{\begin{array}{c}\mathrm{Net}\mathrm{Absorbance}\mathrm{or}\\ \mathrm{adjusted}\mathrm{Net}\mathrm{Absorbance}\end{array}}{\mathrm{path}\mathrm{length}\left(\mathrm{cm}\right)}\right)\times \left(40\frac{\mathrm{\mu g}.Math.\mathrm{cm}}{\mathrm{mL}}\right)\times \left(\frac{1\frac{\mathrm{mg}}{\mathrm{mL}}}{1000\frac{\mathrm{\mu g}}{\mathrm{mL}}}\right)\times \mathrm{Dilution}\mathrm{Factor}\mathrm{wherein}\mathrm{Dilution}\mathrm{Factor}=\frac{\mathrm{Diluted}\mathrm{Sample}\mathrm{Solution}\mathrm{volume}\left(\mathrm{\mu L}\right)}{\mathrm{Initial}\mathrm{Sample}\mathrm{Suspension}\mathrm{volume}\left(\mathrm{\mu L}\right)}$

18. A method for measuring the ribonucleic acid (RNA) concentration of a suspension of RNA-lipid nanoparticle (RNA-LNPs), the method comprising: (a) providing a predetermined volume of a sample suspension comprising RNA-LNPs wherein the RNA-LNPs comprise ionizable cationic lipids and the RNA is at least 100 nucleotides in length; (b) mixing the sample suspension of RNA-LNPs with a predetermined volume of an assay diluent having a pH of at least pH 11 or a pH of about pH 12 and comprising a surfactant and an alkylamine, wherein the surfactant and the alkylamine are each selected to be optically transparent at λ.sub.max of the RNA, to provide a diluted sample solution in which the RNA is denatured and dissociated from the ionizable cationic lipids; (c) measuring absorbance of the diluted sample solution at lambda maximum of the RNA (λ.sub.max) in the diluted sample solution to provide a Net Absorbance or measuring absorbance of the diluted sample solution at λ.sub.max and at 400 nm and subtracting the absorbance at 400 nm from the absorbance at λ.sub.max to provide an adjusted Net Absorbance; and (d) using the Net Absorbance or the adjusted Net Absorbance to determine the RNA concentration in the suspension of the RNA-LNPs.

19. The method of claim 18, wherein the alkylamine comprises a tertiary amine of the formula NRR′R″ wherein R, R′, and R″ are each independently a C1 to C18 alkyl.

20-21. (canceled)

22. The method of claim 18, wherein the surfactant is SDS and the alkylamine is N,N-dimethylbutylamine (DMBA) or the surfactant is a polyethylene glycol alkyl ether and the alkylamine is hexan-1-amine (1-HA).

23. The method of claim 18, wherein the ionizable cationic lipids comprise a tertiary amine.

24. The method of claim 23, wherein the ionizable cationic lipid comprises a tertiary amine and at least one saturated or unsaturated hydrocarbon chain comprising at least nine carbon atoms.

25. The method of claim 18, wherein the ionizable cationic lipid is dilinoleylmethyl-4-dimethylaminobutyrate (D-Lin-MC3-DMA; CAS 1224606-06-7).

26-27. (canceled)

28. The method of claim 18, wherein the assay diluent further includes a metal chelator.

29. The method of claim 28, wherein the metal chelator is ethylenediaminetetraacetic acid (EDTA).

30. The method of claim 18, wherein the assay diluent comprises about 750 mM N,N-dimethylbutylamine, about 10% (w/v) SDS, and about 1 mM EDTA.

31-46. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1A: Illustrates the complex secondary structure that may be adopted by an mRNA molecule in an aqueous solution at physiological pH.

[0026] FIG. 1B: Graph showing the typical UV spectra for varying concentrations of mRNA standards in 50 mM citrate buffer at pH 4.0 at room temperature. Inset chart casts the Net Absorbance values at 260 nm against the concentrations, highlighting the non-linear relationship.

[0027] FIG. 1C: Graph showing the UV spectrum of a typical intact RNA-LNP at room temperature in a Tris/sucrose solution containing no co-solvents or surfactants. When the RNA-LNP is intact, a low broad absorbance band corresponding to RNA appears superimposed on a large exponentially-decaying background caused by scattering from the LNP.

[0028] FIG. 1D: shows a graph plotting the absorbance at A.sub.260 vs. RNA concentration at room temperature and the effect of temperature on A.sub.260 at a particular concentration.

[0029] FIG. 1E: shows a graph plotting the absorbance at A.sub.260 vs. RNA concentration at room temperature for RNA completely denatured in formamide and at room temperature.

[0030] FIG. 2: Graph showing the denaturation of mRNA as a function of pH only. Aqueous solutions containing constant amounts of mRNA and SYBR Green II were prepared having pH values ranging from 7.5 to 13 and the relative fluorescence values were measured.

[0031] FIG. 3: Graph showing the denaturation of mRNA as a function of formamide content. Water-formamide solutions containing constant amounts of mRNA and either SYBR Green II or Ethidium Bromide were prepared having volume fractions of formamide ranging from 0% to 100% and the relative fluorescence values were measured.

[0032] FIG. 4: Graph showing the denaturation of mRNA as a function of temperature. Aqueous solutions containing constant amounts of mRNA and SYBR Green II were subjected to multiple thermal gradients while measuring relative fluorescence. The first derivative of the relative fluorescence with respect to temperature (dF/dT) was plotted against temperature, yielding the complex curves shown here. It is clear from the graph that mRNA undergoes a complex series of unfolding events with increasing temperature, the folded states are not entirely reversible, and that a temperature of at least 70° C. must be maintained to keep the mRNA in a fully denatured state.

[0033] FIG. 5: Graph showing the displacement of cationic lipid MC3 from the mRNA molecule by DMBA as measured by the decrease in light scattering as a function of DMBA concentration.

[0034] FIG. 6: Overlaid UV Spectra for multiple mRNA Standards and mRNA LNP samples prepared in 10% w/v SDS, 750 mM DMBA.

[0035] FIG. 7: Comparison of stability over time of optical density (OD) at A.sub.260 for mRNA in 10% w/v SDS and 750 mM DMBA at room temperature with and without EDTA.

[0036] FIG. 8: Unity chart for assay results for a set of RNA-LNP test articles by the method of the present invention as compared to assay results obtained with a standard HPLC weak anion exchange (WAX) assay for a set of the same RNA-LNP test articles. Linear regression of the data yields a slope very close to 1 and a correlation coefficient close to 1, indicating good agreement between the two methods.

[0037] FIG. 9: Graph of Net Absorbance by the method of the present invention as a function of the inverse Dilution Factor for a given RNA-LNP test article. Linear regression with these data yields a correlation coefficient very close to 1, indicating excellent method linearity and providing the basis for a range of applicable working Dilution Factors which may be employed for actual RNA-LNP test articles.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0038] The term “alkyl” as used herein refers to saturated, straight- or branched-chain hydrocarbon radicals derived from a hydrocarbon moiety by removal of a single hydrogen atom. Examples of alkyl radicals include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, n-pentyl, neopentyl, n-hexyl, n-heptyl, n-octyl, n-decyl, n-undecyl, and dodecyl.

[0039] The term “alkylamine” as used herein refers to primary, secondary, or tertiary alkylamines. A primary alkylamine may be represented by the formula NH.sub.2R or H.sub.2N—R wherein R is an alkyl or aryl group; a secondary alkylamine may be represented by the formula NHRR′ or

##STR00001##

wherein R and R′ are each independently an alkyl or aryl group; and, a tertiary alkylamine may be represented by the formula NRR′R″ or

##STR00002##

wherein R, R′, and R″ are each independently an alkyl or aryl group.

[0040] The term “amino lipid” as used herein refers to those lipids having one, two, or more fatty acid or fatty alkyl chains and an amino head group (including an alkylamino or dialkylamino group) that may be protonated to form a cationic lipid at or below physiological pH.

[0041] The term “cationic lipid” as used herein include any biodegradable cationic lipid suitable for forming a lipid nanoparticle. Preferably, the cationic lipid will have a net positive charge at about physiological pH. The cationic lipid may be an amino lipid. The amino or cationic lipids have at least one protonatable or deprotonatable group, such that the lipid is predominantly positively charged at a pH at or below physiological pH, and increasingly neutral as the pH is adjusted upward above the physiological pH.

[0042] The term “lipid nanoparticle” or “LNP” refers to a transfer vehicle comprising one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids), which has been formulated to deliver one or more mRNA to one or more target cells.

[0043] The term “messenger RNA” or “mRNA” refers to a nucleotide polymer comprising predominantly ribonucleotides and encoding a polypeptide or protein. mRNA typically comprises from 5′ to 3′, a 5′ guanosine cap structure, a 5′ untranslated (UT) region, an open reading frame (ORF) encoding a protein or polypeptide, a 3′ UT region, and a 3′ poly(A) tail comprising about 100 to 200 adenosine residues. The typical mRNA will comprise about 1,000 to 2,000 nucleotide residues. In particular embodiments, the mRNA molecule may comprise one or more modified or non-natural nucleotide residues.

[0044] The term “optically transparent” refers to having a net absorbance in a one cm path length that is less than 0.1 absorbance units relative to air or water.

[0045] The term “physiological pH” refers to having a pH of about 7.4 pH units.

[0046] The term “ribonucleic Acid” or “RNA” refers to a nucleotide polymer comprising predominantly ribonucleotides. As used herein, the term is intended to encompass any RNA molecule of at least 100 nucleotides in length, including messenger RNA. Typically, an RNA molecule will comprise a combination of nucleotide residues selected from adenosine (A), guanosine (G), uracil (U), and cytosine (C) residues. In particular embodiments, the RNA molecule may comprise one or more modified nucleotides, one or more non-natural nucleotide residues, or both one or more modified nucleotides and one or more non-natural nucleotide residues.

[0047] The term “surfactant” as used herein refers to an organic compound that is amphiphilic, having both hydrophobic groups and hydrophilic groups. The surfactant may be an ionic surfactant such as sodium dodecyl sulfate (SDS) or a non-ionic surfactant such as a polyethylene glycol alkyl ether.

Method for Measuring RNA Concentration

[0048] The traditional method for measuring RNA concentration and purity is UV spectroscopy. The absorbance of a diluted RNA sample is measured at λmax of RNA, which is about 260 nm, and at 280 nm and the nucleic acid concentration is calculated using the Beer-Lambert law, which predicts a linear change in absorbance with concentration. However, accurate determination of mRNA content in solutions, particularly in the context of LNPs is experimentally complicated owing to the appearance of manifold secondary structures in solution arising from complementary sequence regions within the RNA that are capable of forming intramolecular and intermolecular base pairing (See FIG. 1A for a representative view of mRNA secondary structure). Temperature, pH, solvents, and other factors are all known to influence the formation of these complex and dynamic secondary structures. Because the optical extinction coefficients for single- versus double-stranded RNA segments are different and because the various folded states exhibit differential binding to ion-exchange media, the experimental determination of mRNA content by means of either UV spectrometry or ion-exchange chromatographic methods is non-trivial and often problematic. Data collected from these techniques frequently demonstrate non-linearity, poor reproducibility, and other technical problems. Compare the ideal UV spectra for differing concentrations of an mRNA denatured in an aqueous solution shown in FIG. 1B to the less than ideal UV spectrum of a typical intact LNP containing the mRNA shown in FIG. 1C. To accurately measure the concentration of RNA, the absorbance vs concentration of the RNA should be linear. As shown in FIG. 1D, the UV absorbance of non-denatured RNA in solution vs RNA concentration is non-linear when measured at the λ.sub.max for the RNA and as can be seen, the absorbance at the λ.sub.max for the RNA changes in response to changes in temperature. FIG. 1E shows that for RNA completely denatured with formamide, the absorbance of the denatured is linear to its concentration. However, formamide is not useful for measuring the concentration of denatured RNA because it absorbs at the λ.sub.max for the denatured RNA.

[0049] To accurately measure mRNA content in solutions comprising mRNA containing LNPs (RNA-LNPs) using UV absorbance, the following four conditions need to be met.

[0050] (1) The measuring conditions must completely disrupt the LNP containing the mRNA either by the action of a surfactant or a strong co-solvent.

[0051] (2) The measuring conditions must completely disrupt the LNP and denature the mRNA, typically by maintaining, for example, at least one of the following conditions: (i) increasing the temperature of an aqueous solution of the RNA-LNP to at least 70° C.; (ii) adding at least 50% v/v of formamide or DMSO to an aqueous solution of the RNA-LNP; or (iii) increasing the pH of the aqueous solution of the RNA-LNP to about 12 pH units.

[0052] (3) The mRNA should also be free of bound ionizable cationic lipids because the UV spectrum of a sample containing partially or even completely denatured LNP and mRNA is slightly altered by the presence of the strongly complexing ionizable cationic lipids comprising the LNP and which constitutes a majority of the LNP by weight.

[0053] (4) The UV absorbance method conditions must provide for sufficient optical transparency at λ.sub.max to allow for measurement of mRNA content, e.g., nominally transparency at about 260 nm.

[0054] The method of the present invention meets all four conditions. The method includes a surfactant that is capable of disrupting or dissociating the RNA-LNP in an aqueous solution into its RNA and other components such as its ionizable cationic lipids and an alkylamine, which (i) raises the pH of the aqueous solution to about pH 12 thereby denaturing the RNA and (ii) displaces ionizable cationic lipids bound to the RNA, to provide an aqueous solution of denatured RNA free of bound ionizable cationic lipids and optically transparent at the λ.sub.max of the RNA. The Examples exemplify an embodiment of the present invention in which the surfactant is SDS and the alkylamine is N,N-dimethylbutylamine (DMBA; CAS 927-62-8).

[0055] Thus, the present invention provides an absorbance method that can measure the RNA content of samples of RNA-LNPs. The method for measuring the RNA concentration of a suspension of RNA-lipid nanoparticle (RNA-LNPs) comprises (a) providing a sample suspension comprising RNA-LNPs wherein the RNA-LNPs comprise ionizable cationic lipids; (b) mixing the sample suspension of RNA-LNPs with an assay diluent comprising a surfactant and an alkylamine to provide a diluted sample solution in which the RNA is denatured and dissociated from or not bound to the ionizable cationic lipids; (c) obtaining (i) a Net Absorbance of the dilute sample solution by measuring absorbance at λ.sub.max of the RNA in the diluted sample solution comprising the dissociated denatured RNA and LNP components or (ii) obtaining an adjusted Net Absorbance by measuring absorbance of the diluted sample solution at λ.sub.max of the RNA in the diluted sample solution and absorbance of the diluted sample solution at 400 nm and subtracting the absorbance at 400 nm from the absorbance from λ.sub.max to provide an adjusted Net Absorbance; and (d) using the Net Absorbance or the adjusted Net Absorbance to provide the RNA concentration of the suspension of RNA-lipid nanoparticle (RNA-LNPs).

[0056] The RNA concentration may be determined using the formula

[00002]$\mathrm{mRNA}\left(\frac{\mathrm{mg}}{\mathrm{mL}}\right)=\left(\frac{\begin{array}{c}\mathrm{Net}\mathrm{Absorbance}\mathrm{or}\\ \mathrm{adjusted}\mathrm{Net}\mathrm{Absorbance}\end{array}}{\mathrm{path}\mathrm{length}\left(\mathrm{cm}\right)}\right)\times \left(40\frac{\mathrm{\mu g}.Math.\mathrm{cm}}{\mathrm{mL}}\right)\times \left(\frac{1\frac{\mathrm{mg}}{\mathrm{mL}}}{1000\frac{\mathrm{\mu g}}{\mathrm{mL}}}\right)\times \mathrm{Dilution}\mathrm{Factor}\mathrm{wherein}\mathrm{Dilution}\mathrm{Factor}=\frac{\mathrm{Diluted}\mathrm{Sample}\mathrm{Solution}\mathrm{volume}\left(\mathrm{\mu L}\right)}{\mathrm{Initial}\mathrm{Sample}\mathrm{Suspension}\mathrm{volume}\left(\mathrm{\mu L}\right)}$

Net Absorbance is the absorbance at λ.sub.max and adjusted Net Absorbance is absorbance at λ.sub.max−absorbance at 400 nm.

[0057] In general, the alkylamine selected is an alkylamine that when in the diluted sample solution results in a solution having a pH at about 11 pH units or more or about pH 12 or a pH of at least pH 12. The alkylamine is present in the diluted sample solution at a concentration sufficient to completely displace ionizable cationic lipids from the RNA. In particular embodiments of the method, the alkylamine comprises a tertiary amine of the formula NRR′R″ wherein R, R′, and R″ are each independently a C1 to C18 alkyl. In a further embodiment, the alkylamine is selected from the group consisting of N,N-dimethylbutylamine (DMBA; CAS 927-62-8), N,N-diethylethanamine (TEA; CAS 121-44-8), N,N-diisopropylethylamine (DIPEA; CAS 7087-68-5), and hexan-1-amine (1-HA; CAS 111-26-2).

[0058] In general, the surfactant selected is capable of disrupting or dissociating RNA-LNP complexes into its RNA and lipid components. In particular embodiments, the surfactant is selected from the group consisting of sodium dodecyl sulfate (SDS; CAS 151-21-3), cetyltrimethylammonium bromide (C-TAB; CAS 57-09-0), and polyethylene glycol alkyl ether. In a particular embodiment, the surfactant is SDS and the alkylamine is DMBA or the surfactant is a polyethylene glycol alkyl ether and the alkylamine is 1-HA. In a further embodiment, the surfactant is polyethylene glycol hexadecyl ether (or polyoxyethylene (20) cetyl ether) CAS 9004-95-9 having the formula HO—(CH.sub.2CH.sub.2O).sub.20—(CH.sub.2).sub.15—CH.sub.3 and is marketed as BRIJ®-58.

[0059] In particular embodiments of the method, the assay diluent further includes a metal chelator, which in a further embodiment may be metal chelator is ethylenediaminetetraacetic acid (EDTA).

[0060] In particular embodiments of the method, the assay diluent comprises about 750 mM N,N-dimethylbutylamine, about 10% w/v SDS, and about 1 mM EDTA.

[0061] In particular embodiments of the method, the sample solution is diluted at least two-fold with the assay diluent to provide the diluted sample solution. In a further embodiment, the sample solution is diluted between two-fold and ten-fold with the assay diluent to provide the diluted sample solution.

[0062] In particular embodiments of the method, the diluted sample solution comprises between 4 and 40 μg/mL of the RNA. In particular embodiments, the sample solution comprises RNA at a concentration such that the absorbance of the RNA at λ.sub.max is between 0.1 and 1 absorbance units.

[0063] In particular embodiments of the method, the surfactant and the alkylamine are each selected to be optically transparent at λ.sub.max wherein optically transparent is having a net absorbance in a one cm path length that is less than 0.1 absorbance units relative to air or water.

[0064] In particular embodiments of the method, the diluted sample solution has a pH of at least 11 pH units or a pH of at least or about 12 pH units, which the inventors have discovered is sufficient in the presence of alkylamine (e.g., DBMA) and surfactant (e.g., SDS) to disrupt the RNA-LNPs into its components, denature the RNA of the disrupted LNP, and to displace cationic lipids that may be bound to the RNA.

[0065] In particular embodiments of the method, the λ.sub.max is from about 250 to about 270 nm. In a further embodiment, the λ.sub.max is about 260 nm or about 266 nm.

[0066] In particular embodiments of the method, the λ.sub.max is measured using an apparatus capable of measuring ultra-violet (UV) absorbance of RNA, for example a UV/visible light spectrometer.

Exemplary Lipid Nanoparticles

[0067] Exemplary RNA-LNPs that may be analyzed according to the present invention comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is a cholesterol. The cationic lipid may comprise a tertiary or secondary amine. In further embodiments, the RNA-LNP comprises a tertiary cationic lipid. In some embodiments, the cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate, and (12Z, 15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine. In particular embodiments, the RNA-LNP may comprise the ionizable cationic lipid dilinoleylmethyl-4-dimethylaminobutyrate (D-Lin-MC3-DMA; CAS 1224606-06-7), which has the structure

##STR00003##

[0068] In particular embodiments, the RNA-LNP may comprise at least one of the ionizable cationic lipids selected from the group consisting of

##STR00004## ##STR00005##

[0069] In particular embodiments, the RNA-LNP may comprise any ionizable cationic lipid suitable for use in preparing RNA-LNPs, for example, the ionizable cationic lipid series disclosed by Sabnis et al. in Molec. Thera. 26: 1509-1519 (2018) and Jayaraman et al. in Angew. Chem. Int. Ed. 51: 8529-8533 (2012). In particular embodiments, the cationic lipids may be selected from any of the cationic lipids disclosed in published International Patent Applications WO2017070622 and WO2018170260, each of which is incorporated herein by reference.

Exemplary Embodiment

[0070] In an exemplary embodiment of the present invention, aqueous solutions of mRNA standards and test samples are provided and mixed with aliquots of a concentrated SDS solution, a DMBA solution, and an EDTA solution to provide an mRNA solution comprising about 10% w/v SDS, about 750 mM DMBA, and about 1 mM EDTA. The resulting aqueous solution, which has a pH of about 11-12 pH units, completely disrupts the mRNA containing LNPs and mRNA secondary structure at ambient temperature, and the SDS and DMBA are sufficiently transparent to allow for direct determination of mRNA content by measuring optical density of the aqueous solution at 266 nm (this value representing the red-shifted λ.sub.max of the mRNA complexed with DMBA and/or the cationic lipid). Moreover, the SDS and DBMA are inexpensive and readily available in pure form. Specifically, the SDS disrupts the LNP structures in the sample and the excess DMBA in the SDS solution helps denature the mRNA and displace LNP ionizable cationic lipids bound to the mRNA.

[0071] As shown in FIG. 6, addition of a large excess of DMBA to SDS solutions comprising mRNA standards or mRNA obtained from RNA-LNPs by the method of the present invention nearly collapses the spectra of the mRNA standard and mRNA in the LNP sample to the same λ.sub.max. Also, as shown in FIG. 5, there is no scattering observed at 750 mM DBMA, which means the DMBA has displaced the cationic lipids bound ionically to the mRNA thereby rendering the mRNA free of bound lipids. The EDTA in solution helps to improve the stability of sample for up to about nine hours (see FIG. 7).

[0072] The following examples are intended to promote a further understanding of the present invention.

EXAMPLE 1

[0073] RNA secondary structure may be disrupted using heat, high pH, or an organic solvent such as formamide or DMSO.

[0074] Representative mRNA comprising the mRNA having the components set forth in Table 1 or variant thereof was incubated in a series of aqueous solutions comprising SYBR Green II over a pH range beginning at pH 7.5 and ending at about pH 13. The relative fluorescence of each of the solutions was measured using a fluorimeter. SYBR Green II is a dye that fluoresces only when intercalated between double-stranded nucleotide base pairs. As shown in FIG. 2, incubating the mRNA at pH 12 completely disrupts the secondary structure of the mRNA as there is no measurable fluorescence at pH 12 or higher indicating there is no secondary structure to intercalate the SYBR Green II. The results indicate that incubating mRNA at pH 12 will completely denature the mRNA with no detectable secondary structure. While the mRNA is completely denatured at pH 12, the mRNA is unstable at pH 12 and has a relatively short half-life; however, as shown in Example 2, adding EDTA can extend the stability of the RNA for up to nine hours.

[0075] Similarly, incubating the mRNA in increasing concentrations of formamide will completely denature the mRNA. For example, mRNA may be incubated in solutions comprising different concentrations of formamide and either SYBR Green II or ethidium bromide (another molecule that fluoresces when intercalated between base pairs of double-stranded regions in mRNA) and fluorescence measured by a fluorimeter. As shown in FIG. 3, mRNA incubated at room temperature in a solution containing formamide and SYBR Green II or ethidium bromide was completely disrupted when the formamide concentration was about 50% v/v. However, formamide is impractical for measuring mRNA content by UV absorbance of its absorbance over the range of wavelengths required to measure RNA concentrations by UV.

[0076] Fluorimetry was used to determine the minimum temperature required to maintain mRNA in a completely denatured state by purely thermal means. As shown in FIG. 4, the mRNA solution must be held at a minimum of 70° C. to maintain the mRNA in a fully denatured state. This is not practical for measuring mRNA content by UV absorbance.

EXAMPLE 2

[0077] The amount of DBMA acting in concert with SDS to achieve complete disruption of RNA-LNP complexes comprising ionizable cationic lipid MC3 and mRNA secondary structure, and to replace any MC3 complexed with the mRNA was determined as follows.

[0078] Aqueous solutions of RNA-LNPs comprising an mRNA having the components set forth in Table 1 or variant thereof were first diluted in 20% w/v SDS. Quickly and in succession, a constant amount of NaOH was added and increasing amounts of DMBA were then added to give final concentrations of 10% w/v SDS, 25 mM NaOH, and DMBA ranging from 0 mM to 500 mM. UV spectra were then collected for the mixtures and analyzed for residual light scattering by integrating the absorbance data from 320 nm to 800 nm. As shown in FIG. 5, the amount of light scattering decreased as the concentration of DMBA was increased (data represented by the solid diamonds). For the purposes of estimating the minimum amount of DMBA required under these conditions, a 5-parameter curve was fit through the data (result shown by the dashed line). Based upon the results, the concentration of DMBA required to achieve complete disruption of the mRNA secondary structure complex and displacement of the ionizable cationic lipid MC3 from the mRNA was determined to be at least 600 mM, more preferably, about 750 mM.

[0079] In a further experiment, aqueous solutions of mRNA standards and test samples were provided and mixed with aliquots of a concentrated SDS solution, DMBA solution, and an EDTA solution to provide an mRNA solution comprising about 10% w/v SDS, about 750 mM DMBA, and about 1 mM EDTA. The DBMA at 750 mM will raise the pH of the solution to about pH 12. The resulting aqueous solution completely disrupts the LNPs, completely eliminates mRNA secondary structure without heating, displaces ionizable cationic lipids from the mRNA, and remains sufficiently optically transparent to allow for direct determination of mRNA content at 266 nm (this value representing the red-shifted λ.sub.max of the mRNA complexed with DMBA and/or the cationic lipid). Moreover, the constituents are inexpensive and readily available in pure form. Specifically, the SDS and DMBA work in concert to completely disrupt the LNPs, competitively displace LNP cationic lipids bound to the mRNA, and simultaneously raise the pH to a level which completely denatures the mRNA.

[0080] In a further experiment, the role of DMBA in the method of the present invention was further probed by comparing the UV spectra obtained from final working-level preparations of both RNA-LNPs and an mRNA-only standard solutions in 10% w/v SDS containing 750 mM DMBA and 1 mM EDTA. As shown in FIG. 6, spectra for final working-level preparations of RNA-LNPs under these conditions exhibit spectra with a clear absorbance band at about 260 nm corresponding to mRNA and having no residual scatter as evident by the complete lack of absorbance above about 300 nm. This confirms that disruption of self-associated lipids is complete and no intact LNPs remain. However, close inspection of the spectra for both RNA-LNPs and mRNA-only standards shows that the observed λ.sub.max in the RNA-LNP spectra is slightly red-shifted from that of the mRNA-only standard. Whereas only the RNA-LNPs contain lipids, the slight difference could be attributable to some remaining association of one or more LNP lipids with mRNA in solution. Nevertheless, the conditions are clearly sufficient to provide for complete LNP disruption and mRNA denaturation as noted above and the remaining differences appear so slight as to not impart a meaningful difference in the method of the present invention.

[0081] In a further experiment, the role of EDTA in the method of the present invention was further probed by collecting timed UV absorbance data at room temperature for final working-level preparations of an mRNA-only standard solution in 10% w/v SDS containing 750 mM DMBA both with and without 1 mM EDTA added. As shown in FIG. 7, absorbance measurements for both preparations are initially equivalent and stable. However, after about five hours, absorbance data for the preparation lacking EDTA begins to rise steadily whereas the absorbance data for the preparation comprising EDTA remains closer to initial OD. Thus, the data shows that EDTA in solution helps to improve the stability of sample for up to about eight hours at room temperature, which is adequate for practical analytical work (see FIG. 7).

EXAMPLE 3

[0082] The amount of formamide required to achieve complete denaturation of mRNA secondary structure was determined as follows.

[0083] Aqueous solutions were prepared containing constant amounts of an mRNA having the components set forth in Table 1 or variant thereof and either SYBR Green II or Ethidium Bromide but with increasing volume fractions of formamide. Fluorescence of either SYBR Green II or Ethidium Bromide was then measured for each solution using a spectrofluorimeter. Relative fluorescence values for either SYBR Green II or Ethidium Bromide were then compared to the values for each solution prepared in 100% v/v formamide. Both SYBR Green II and Ethidium Bromide act as probes of RNA denaturation because they exhibit very little fluorescence in aqueous solution but yield greatly enhanced fluorescence in the presence of folded RNA states owing to the propensity of these molecules to intercalate, fitting between stacked base pairs. As shown in FIG. 3, the relative fluorescence of both probes is maximal in the presence of the mRNA when the RNA is prepared in aqueous solutions having very little or no formamide. As the volume fraction of formamide increases, the mRNA is progressively denatured, which diminishes the population of stacked base pairs and thereby leads to a loss of fluorescence for the intercalating probes. Above about 60% v/v formamide, the relative fluorescence is effectively zero indicating complete denaturation of the mRNA.

EXAMPLE 4

[0084] FIG. 8: Unity chart for assay results for a set of RNA-LNP test articles by the method of the present invention as compared to assay results obtained with a standard HPLC weak anion exchange (WAX) assay for a set of the same RNA-LNP test articles. Linear regression of the data yields a slope very close to 1 and a correlation coefficient close to 1, indicating good agreement between the two methods. FIG. 9: Graph of Net Absorbance by the method of the present invention as a function of the inverse Dilution Factor for a given RNA-LNP test article. Linear regression with these data yields a correlation coefficient very close to 1, indicating excellent method linearity and providing the basis for a range of applicable working Dilution Factors which may be employed for actual RNA-LNP test articles.

TABLE-US-00001 TABLE 1 SEQ ID NO: Description Sequence 5’ Cap m7G(5)ppp(5′)G-2′-O-methyl 1 mRNA GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAG CCACCAUGGAACUGCUCAUUUUGAAGGCAAACGCUAUCACGAC AAUACUCACUGCAGUGACCUUCUGUUUUGCCUCAGGCCAGAAC AUAACCGAGGAGUUUUAUCAAUCUACAUGCAGCGCUGUAUCU AAAGGCUACCUGAGUGCGCUCCGCACAGGAUGGUACACCUCCG UGAUCACCAUCGAGCUCAGCAAUAUUAAAGAGAACAAGUGCA AUGGUACCGACGCUAAAGUCAAACUUAUCAAGCAGGAACUCGA CAAAUAUAAGAACGCUGUGACCGAGCUGCAGUUAUUGAUGCA GAGUACACCUGCCACCAAUAACAGAGCUAGGAGGGAGUUGCCU AGGUUUAUGAACUACACUCUCAACAACGCGAAGAAAACCAAUG UGACGCUAUCCAAGAAACGGAAGAGGAGGUUCCUGGGGUUUC UUUUAGGGGUGGGCUCUGCCAUUGCUUCCGGCGUGGCUGUAU GUAAAGUUCUCCACCUCGAGGGAGAGGUUAAUAAGAUUAAGU CGGCCCUGCUGAGUACUAACAAAGCAGUGGUGUCGCUGAGUAA CGGAGUAAGUGUGUUAACAUUUAAGGUGCUGGACCUCAAGAA UUAUAUUGACAAACAGUUGCUUCCUAUUCUAAACAAACAGAG CUGUUCAAUAAGUAAUAUUGAAACUGUUAUUGAGUUUCAGCA GAAGAACAACAGGCUUCUUGAGAUUACACGCGAGUUCAGUGU CAAUGCCGGCGUUACAACACCCGUGUCUACCUACAUGCUGACG AAUUCUGAGCUUCUCUCUCUCAUAAACGACAUGCCCAUUACGA AUGACCAAAAGAAACUUAUGUCCAACAACGUGCAGAUUGUGC GACAGCAAUCCUAUAGCAUUAUGUGUAUCAUCAAGGAAGAGG UACUCGCUUAUGUUGUGCAGCUACCACUCUAUGGUGUGAUUG ACACCCCCUGUUGGAAGCUGCAUACCAGUCCACUCUGCACCAC UAACACAAAGGAAGGGAGCAAUAUUUGCCUCACUCGAACCGAC AGGGGGUGGUAUUGCGAUAAUGCGGGCUCCGUGUCCUUCUUU CCACAGGCUGAAACUUGUAAGGUACAGUCAAACCGCGUGUUCU GUGAUACUAUGAAUUCUCUGACUCUUCCCAGCGAGGUUAAUCU CUGCAACGUCGACAUUUUCAAUCCUAAAUAUGACUGCAAGAUC AUGACCAGCAAGACCGACGUCUCCAGCUCAGUAAUCACUAGCC UAGGGGCCAUUGUAAGCUGCUAUGGCAAAACCAAGUGUACUG CCUCUAAUAAGAACAGAGGCAUAAUUAAAACCUUUUCAAAUG GCUGUGACUAUGUGUCGAAUAAGGGCGUCGACACGGUCUCAG UAGGGAAUACCCUCUACUACGUUAACAAACAGGAAGGCAAAUC CCUUUAUGUAAAGGGCGAGCCCAUCAUAAAUUUCUACGACCCA CUUGUGUUCCCCAGUGAUGAAUUCGAUGCAUCAAUCUCCCAGG UGAACGAAAAGAUCAAUCAAUCCCUUGCUUUUAUACGAAAGU CAGAUGAACUCCUGCAUAACGUGAAUGCUGGGAAAUCUACAAC CAACAUCAUGAUCACUACCAUCAUUAUUGUGAUUAUCGUAAU UCUGCUAUCCUUGAUUGCUGUCGGGCUGCUUCUGUACUGUAAG GCCAGAUCGACGCCUGUGACCCUUUCAAAAGACCAACUUAGCG GUAUCAAUAAUAUUGCCUUUAGCAAUUGAUAAUAGGCUGGAG CCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCC CCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUA AAGUCUGAGUGGGCGGC Poly(A) Tail 100 ribonucleotides

[0085] While the present invention is described herein with reference to illustrated embodiments, it should be understood that the invention is not limited hereto. Those having ordinary skill in the art and access to the teachings herein will recognize additional modifications and embodiments within the scope thereof. Therefore, the present invention is limited only by the claims attached herein.