Brown adipocyte progenitors in human skeletal muscle
12025612 ยท 2024-07-02
Assignee
Inventors
Cpc classification
C12N2501/999
CHEMISTRY; METALLURGY
C12N2501/385
CHEMISTRY; METALLURGY
C12N5/0667
CHEMISTRY; METALLURGY
C12N2506/13
CHEMISTRY; METALLURGY
G01N2800/042
PHYSICS
A61K31/4439
HUMAN NECESSITIES
C12N2501/01
CHEMISTRY; METALLURGY
International classification
G01N33/53
PHYSICS
A61K31/4439
HUMAN NECESSITIES
Abstract
Brown adipose tissue (BAT) progenitor cells and methods for identifying BAT progenitor cells in a population of cells are provided. Methods are also provided for inducing differentiation of BAT progenitor cells into differentiated brown adipocytes, inducing expression or increased activity levels of BAT uncoupling protein-1 (UCP1), and for identifying agents capable of inducing differentiation of BAT progenitor cells into brown adipocytes and/or inducing expression or increased activity levels of UCP1. Differentiated brown adipocytes and agents and methods for inducing differentiation of BAT progenitor cells can be used for treatment of or the making of medicaments for the treatment of metabolic diseases or conditions in a patient such as obesity, overweight, impaired glucose tolerance, insulin-resistance, type 2 diabetes, dyslipidemia, hypertension, cardiovascular diseases, metabolic syndrome, and the like. Differentiated brown adipocytes and agents and methods for inducing differentiation of BAT progenitor cells can be used for prevention of hypothermia.
Claims
1. A method for inducing differentiation of brown adipose tissue (BAT) progenitor cells into brown adipocytes comprising: providing a BAT progenitor cell isolated from skeletal muscle; and exposing the BAT progenitor cell to a differentiation agent in vitro, said differentiation agent comprising one or more of the following: a peroxisome-proliferator-activated receptor ? (PPAR?) activator, a peroxisome-proliferator-activated receptor ? (PPAR?) activator, a peroxisome-proliferator-activated receptor ? (PPAR?) activator, a dual PPAR? and PPAR? activator, or a pan-PPAR (?, ?, ?) activator; wherein the differentiation agent induces the BAT progenitor cell to differentiate into a brown adipocyte.
2. The method of claim 1, wherein the differentiation agent comprises a peroxisome-proliferator-activated receptor ? (PPAR?) activator.
3. The method of claim 1, wherein the differentiation agent comprises rosiglitazone.
4. The method of claim 1, wherein the brown adipocyte is characterized by one or more of the following: expression of uncoupling protein-1 (UCP1) or mRNA, expression of mitochondrial transcription factor A (mtTFA) protein or mRNA, expression of PGC-1? protein or mRNA, uncoupled respiration, metabolic rate, glucose utilization rate, fatty acid oxidation rate, and a combination of any of the foregoing.
5. The method of claim 4, wherein the brown adipocyte contains UCP1 mRNA at a level higher than that of in vivo brown adipocytes in human skeletal muscle.
6. The method of claim 1, wherein the BAT progenitor cell is CD34 positive.
7. The method of claim 6, wherein the BAT progenitor cell is CD45 negative.
8. The method of claim 6, wherein the BAT progenitor cell is CD56 negative.
9. The method of claim 6, wherein the BAT progenitor cell is CD146 negative.
10. The method of claim 6, wherein the BAT progenitor cell is in primary culture.
11. The method of claim 6, wherein the BAT progenitor cell is expanded in culture for one or more passages.
12. The method of claim 1, wherein the differentiation agent comprises a peroxisome-proliferator-activated receptor ? (PPAR?) activator.
13. The method of claim 1, wherein the differentiation agent comprises a peroxisome-proliferator-activated receptor ? (PPAR?) activator.
14. The method of claim 1, wherein the differentiation agent comprises a dual PPAR? and PPAR? activator.
15. The method of claim 1, wherein the differentiation agent comprises a pan-PPAR (?, ?, ?) activator.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
DESCRIPTION OF VARIOUS EMBODIMENTS
(6) The present disclosure provides methods for identifying and isolating BAT progenitor cells in and from various tissues, including, in some embodiments, the identification of common brown adipocyte progenitor cells in human skeletal muscle and isolation of such cells from human skeletal muscle samples. In some embodiments, the cell sorting can be done by immunohistochemical analysis of cell surface markers such as cluster of differentiation/designation (CD) molecules CD34, CD45, CD56, and CD146. Hematopoetic cells and myogenic progenitors can be sorted based on identification of CD45 and CD56, respectively, on their cell surfaces. CD34 and CD146 can be used to identify endothelial cells and pericytes, respectively. In one aspect, expression of CD34 identifies a cell as a progenitor of a brown adipocyte.
(7) Flow cytometry, fluorescent-activated cell sorting (FACS), and other cell sorting techniques known in the art can be used for sorting cells obtained from various tissues and for separating BAT progenitor cells from other cells. Among other techniques known in the art, multi-color FACS can be used to identify CD34+ endothelial cells and CD146+ pericytes and separate them from each other and from CD45+ hematopoietic cells and CD56+ myogenic progenitors. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis can be used to confirm the absence of hematopoietic cells and myogenic progenitors from the populations of CD34+ and CD146+ cells.
(8) Applicants have found that a population of progenitors is present in skeletal muscle, and that this population is, in some embodiments, found in skeletal muscle but not in white adipose tissue and, in some embodiments, exclusively found in skeletal muscle (i.e., not in other tissues). The skeletal muscle may be that of a human or of any animal, and populations of progenitor cells may be diffuse in the skeletal muscle or concentrated in discrete regions. BAT progenitor cells may, in some embodiments, be found between myofibers. Skeletal muscle BAT progenitor cells may be a stationary population or may be mobile both within skeletal muscle or other tissue and between and among different tissues. Further, BAT progenitor cells can be found in fetal, juvenile, and adult skeletal muscle.
(9) The present teachings provide BAT progenitor cells isolated from various tissues. For example, BAT progenitor cells isolated from human skeletal muscle are provided. In some embodiments, the BAT progenitor cells are found in skeletal muscle but not in white adipose tissue, and/or are exclusively found in skeletal muscle. Some BAT progenitor cells may express UCP1, mitochondrial transcription factor A (mtTFA), and/or PPAR? coactivator-1? (PGC-1?) as well as one or more of the corresponding mRNAs. The present disclosure provides methods for detection of BAT progenitor cells and/or UCP1 mRNA in the skeletal muscle of adult humans. Although prior studies concerning UCP1 expression in adult humans have focused on white adipose tissue, applicants disclose the existence in, and isolation from, human skeletal muscle of brown adipose progenitor cells with a high potential for UCP1 expression. In some embodiments, a reservoir of BAT progenitor cells in skeletal muscle provides a mechanism for modulating energy dissipation for treatment of metabolic diseases such as obesity, diabetes, and the like.
(10) At least a portion of the population of progenitor cells present in skeletal muscle is capable of differentiating into genuine brown adipocytes, and, in some embodiments, a portion of the population of progenitor cells present in skeletal muscle are capable of being differentiated in vitro into genuine brown adipocytes. The present disclosure provides methods for expanding BAT progenitor cell cultures and methods for differentiating BAT progenitor cells into genuine BAT cells, including methods for differentiating previously sorted cells in an adipogenic medium. In some embodiments, differentiation of sorted progenitor cells into brown adipocytes can be performed using conditions that sustain white adipocyte differentiation or by use of agents determined to promote differentiation of progenitors into brown adipocytes.
(11) Some embodiments utilize the presence of UCP1, mitochondrial transcription factor A (mtTFA), and/or PPAR? coactivator-1? (PGC-1?) as well as one or more of the corresponding mRNAs, to identify BAT progenitor cells that have begun to at least partially differentiate. High metabolic rate or high levels of uncoupled respiration, glucose utilization, fatty acid oxidation, or combinations of the foregoing characteristics with each other or other characteristics, can be used to identify BAT progenitor cells that have begun to at least partially differentiate. For purposes of this disclosure, BAT progenitor cells that have begun to at least partially differentiate into brown adipocytes are referred to as differentiated brown adipocytes.
(12) As an example, cells determined to express the CD34 marker (i.e., CD34+ cells) can be differentiated into brown adipocytes by culturing in DMEM-Ham's F-12 medium containing 0.86 ?M insulin, 10 ?g/ml transferrin, 0.2 nM triiodothyronine, 1 ?M rosiglitazone, 100 ?M 3-isobutyl-1-methylxanthine, 1 ?M dexamethasone and 1% penicillin-streptomycin. Other agents may also be used to promote differentiation of progenitor cells into brown adipocytes. In some embodiments, agents identified according to the teachings of this disclosure are used to promote differentiation of progenitor cells into brown adipocytes. In some embodiments, differentiated brown adipocytes exhibit high levels of UCP1 expression, high levels of uncoupled respiration, and/or high metabolic rate.
(13) The present disclosure provides methods for increasing UCP1 mRNA expression in BAT progenitor cells, differentiated brown adipocytes, or both. For example, agents such as cell-permeating cAMP derivatives and peroxisome-proliferator-activated receptor-? (PPAR-?) agonists can be used to increase UCP1 mRNA expression in BAT progenitor cells, differentiated brown adipocytes, or both. Enhanced UCP1 expression can be determined by methods known in the art, including measurement of UCP1 mRNA by quantitative RT-PCR. Exemplary primers for use in RT-PCR analysis of UCP1 mRNA are provided as SEQ ID NOS: 1-4 and 11-12.
(14) BAT progenitor cells exposed to adipogenic media can contain higher levels of UCP1 mRNA than BAT progenitor cells that are not exposed to adipogenic media. Cyclophilin mRNA levels can serve as a normalizing value (reflecting the number of cells or the total amount of RNA) for evaluating the abundance of UCP1 mRNA in a cell. In some embodiments, UCP1 mRNA levels in BAT progenitor cells not exposed to adipogenic media are not detectable using RT-PCR while UCP1 mRNA levels in differentiated brown adipocytes is detectable and can be normalized to cyclophilin mRNA levels. As a comparative measure of UCP1 expression, UCP1 mRNA levels in differentiated brown adipocytes can be compared to UCP1 mRNA levels in cultured mouse brown adipocytes. The present disclosure provides UCP1 mRNA levels in differentiated brown adipocytes of about 25% of the UCP1 mRNA levels in cultured mouse brown adipocytes, while in other embodiments the UCP1 mRNA level is about 25?10% or from about 15% to about 30% of the UCP1 mRNA levels in cultured mouse brown adipocytes. The present disclosure contemplates UCP1 mRNA levels in differentiated brown adipocytes in a range of from about 5% to about 100% of the UCP1 mRNA levels in cultured mouse brown adipocytes. In some embodiments, the UCP1 mRNA levels can be in excess of 100% of the UCP1 mRNA levels in cultured mouse brown adipocytes.
(15) Differentiated brown adipocytes can contain significantly higher levels of UCP1 mRNA than cells in same-species or same-individual adult skeletal muscle biopsies. In addition, the quantity of UCP1 protein in a differentiated brown adipocyte can be approximately equal to the quantity of UCP1 protein in same-species or same-individual fetal BAT. The present disclosure contemplates UCP1 mRNA levels in human differentiated brown adipocytes being approximately equivalent to UCP1 mRNA levels in human brown adipocytes in vivo. In some embodiments the UCP1 mRNA level in a human differentiated brown adipocyte can be in a range from about 1% to many times greater than UCP1 mRNA levels in human brown adipocytes in vivo.
(16) The present disclosure provides methods for increasing UCP1 mRNA levels in BAT progenitor cells, differentiated brown adipocytes, or both. In some embodiments, the methods provide for selectively increasing UCP1 mRNA levels in BAT progenitor cells, differentiated brown adipocytes, or both. PPAR? agonists can stimulate UCP1 mRNA production in both skeletal muscle and differentiated brown adipocytes. For example, in some embodiments, the PPAR? agonist rosiglitazone selectively stimulates UCP1 mRNA production in skeletal muscle or in differentiated brown adipocytes. Cell-permeating cAMP derivatives can stimulate UCP1 mRNA production in both skeletal muscle and in differentiated brown adipocytes. For example, in some embodiments the cell-permeating cAMP derivative 8-bromo-cAMP selectively stimulates UCP1 mRNA production in skeletal muscle or in differentiated brown adipocytes while in some embodiments the cell-permeating cAMP derivative (4-chlorophenylthio)-cAMP selectively stimulates UCP1 mRNA production in skeletal muscle or in differentiated brown adipocytes.
(17) Mitochondrial transcription factor A (mtTFA) and peroxisome-proliferator-activated receptor-? coactivator-1? (PGC-1?) are involved in the control of mitochondriogenesis. Differentiated brown adipocytes can contain large amounts of mtTFA, PGC-1?, or both. The present disclosure provides differentiated brown adipocytes having significantly increased levels of mtTFA mRNA, PGC-1? mRNA, or both, as compared to undifferentiated BAT progenitor cells. Mitochondrial marker cytochrome oxidase IV (COX IV) is involved with the mitochondrial respiratory chain. The present disclosure provides differentiated brown adipocytes having significantly increased levels of COX IV mRNA as compared to undifferentiated BAT progenitor cells.
(18) Differentiated brown adipocytes according to some embodiments have high levels of uncoupled respiration and/or high metabolic rate. Uncoupled respiration can occur when protons leak across the inner mitochondrial membrane rather than passing through the adenosine triphosphate synthase (ATP Synthase) enzyme to drive production of adenosine triphosphate (ATP). The energy released by the proton movement in the electrochemical proton gradient across the membrane is dissipated as heat, rather than in the process of making ATP. Uncoupled respiration can be measured as a function of the portion of cellular respiration (e.g., oxygen consumption) that occurs independently of ATP formation by ATP Synthase. For example, oxygen consumption in the electron transport chain of oxidative phosphorylation in the presence of oligomycin, which blocks the function of ATP Synthase, provides a measure of uncoupled respiration.
(19) The present disclosure provides differentiated brown adipocytes having significantly increased levels of uncoupled respiration as compared to undifferentiated BAT progenitor cells. In some embodiments, the present disclosure provides differentiated brown adipocytes having levels of uncoupled respiration of about 50% of total respiration. Some embodiments exhibit uncoupled respiration at levels in a range of from about 20% to about 50% of total respiration. Using the level of uncoupled respiration in adult white adipocytes as a standard for comparison, some embodiments exhibit uncoupled respiration in a range of from about 1.5 to about 3.5 times greater than in adult white adipocytes. In some embodiments, the level of uncoupled respiration is about 2.5 times greater than in adult white adipocytes. The present disclosure provides, among other things, differentiated brown adipocytes that are equipped to metabolize glucose, oxidize fatty acids, and dissipate energy as heat via uncoupling of oxidative phosphorylation.
(20) The present disclosure provides conditions and agents (e.g., compounds, proteins, biologicals, and the like) that promote the differentiation of BAT progenitor cells to brown adipocytes, both in vitro and in vivo. In some embodiments, the differentiation-promoting agent is: a PPAR? activator, modulator, or inhibitor (e.g., rosiglitazone), a PPAR? activator or modulator (e.g., GW9578), a PPAR? activator or modulator (e.g., GW501516 or GW0742), a dual PPAR? and PPAR? activator or modulator, a pan-PPAR (?, ?, ?) activator or modulator (e.g., GW4148), a phosphodiesterase 4 (PDE4) inhibitor (e.g., rolipram or IBMX), a PDE7 phosphodiesterase 7 (PDE7) inhibitor (e.g., BMS 586353 or BRE 50481 or IBMX), a nuclear receptor interacting protein 1 (NRIP1) inhibitor, a phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase (PTEN) inhibitor (e.g., potassium bisperoxo (bipyridine) oxovanadate or dipotassium bisperoxo (5-hydroxypyridine-2-carboxyl) oxovanadate), an ?.sub.1-adrenergic full or partial agonist (e.g., phenylephrine or cirazoline), a retinoid X receptor ? (RXR?) activator or modulator (e.g., LGD1069 (Targretin) or 9-cis retinoic acid), a PGC-1? activator, a PGC-1? inhibitor or activator, adiponectin or an activator of adiponectin receptor AdipoR1 and/or AdipoR2, a nitric oxide synthase (NOS) inhibitor or activator (e.g., 2-Ethyl-2-thiopseudourea or NG-nitro-L-arginine methyl ester (L-NAME) or adenosine), a Rho kinase-ROCK inhibitor (e.g., fasudil), brain derived neurotrophic factor (BDNF), a monoamine oxidase (MAO) A inhibitor and/or a MAO B inhibitor (e.g., isocarboxazid, moclobemide, selegiline), an activator of Proto-oncogene tyrosine-protein kinase Src (SRC), an inhibitor of an epidermal growth factor receptor (EGFR) (e.g., erlotinib or ZD1839-gefinitib or Argos protein), an inhibitor of fatty acid amide hydrolase (FAAH) (e.g., URB597), an inhibitor of mitogen-activated protein kinase (MAPK) 1 (e.g., PD98059) or 2 (e.g., PD98059) or 4 or 5 or 7 or 8 (e.g., PD98059), an inhibitor of CDK9 (e.g., 1,5,6,7-Tetrahydro-2-(4-pyridinyl)-4H-pyrrolo[3,2-c]pyridin-4-one hydrochloride), a TGR5 agonist (e.g., oleanolic acid), a 5 AMP-activated protein kinase (AMPK) activator (e.g., AICAR), bone morphogenetic protein 7 (BMP-7), a mammalian target of rapamycin (mTOR) inhibitor (e.g., rapamycin), an adenylate cyclase activator (e.g., forskolin), combinations of any of the foregoing.
(21) In some embodiments, treatment of a subject, including a human subject, with rosiglitazone results in an increase in the production of UCP1 mRNA in the subject's skeletal muscle. Treatment of subjects with rosiglitazone can, in some embodiments, induce the appearance or differentiation of brown adipocytes in skeletal muscle, enhance expression of the UCP1 gene in existing brown adipocytes in skeletal muscle, or both. For example, in some embodiments the appearance or differentiation of brown adipocytes in skeletal muscle can be induced in a subject suffering from a metabolic disease. The brown adipocytes can provide a glucose sink with high mitochondrial and cellular respiration and fatty acid oxidation rates, dissipating energy as heat (uncoupled oxidative phosphorylation). The subject metabolic rate can be enhanced, and a decrease in body weight can be induced. Induction of the appearance or differentiation of brown adipocytes can also yield improvements in insulin sensitivity, blood glucose homeostasis and cardiovascular disease risk factors.
(22) The present disclosure also provides assays that allow the identification of agents (e.g., compounds, proteins, biologicals, and the like) that promote the differentiation of BAT progenitor cells into brown adipocytes and/or induce the expression of the UCP1 gene in vitro, in vivo, or both. Such agents can be identified by screening compounds, proteins, biologicals, and the like. For example, in some embodiments isolated CD34+ cells can be used to screen agents for the ability to induce expression of the UCP1 gene and/or differentiation of the CD34+ cells into brown adipocytes. Agents identified in this manner can be used for a variety of research, diagnostic and therapeutic purposes, including, for example, treatment of metabolic diseases such as obesity, type 2 diabetes, insulin-resistance, dyslipidemia, and the like. In some embodiments, an agent identified by an assay according to the present disclosure is optimized for improvement of its physico-chemical and/or pharmacokinetics properties.
(23) Expression of UCP1, mtTFA, PGC-1?, and/or COX IV in BAT progenitor cells in vitro and in vivo can be enhanced according to methods provided in the present disclosure. In some embodiments, exposure to adipogenic media can be used to stimulate increased expression of UCP1, mtTFA, PGC-1?, and/or COX IV in BAT progenitor cells. Agents such as a PPAR? activator, modulator or inhibitor (e.g., rosiglitazone), a PPAR? activator or modulator (e.g., GW9578), a PPAR? activator or modulator (e.g., GW501516 or GW0742), a dual PPAR? and PPAR? activator or modulator, a pan-PPAR (?, ?, ?) activator or modulator (e.g., GW4148), a PDE4 inhibitor (e.g., rolipram or IBMX), a PDE7 inhibitor (e.g., BMS 586353 or BRL 50481 or IBMX), a NRIP1 (RIP140) inhibitor, a PTEN inhibitor (e.g., potassium bisperoxo (bipyridine) oxovanadate or dipotassium bisperoxo (5-hydroxypyridine-2-carboxyl) oxovanadate), an al-adrenergic full or partial agonist (e.g., phenylephrine or cirazoline), an RXR? activator or modulator (e.g., LGD1069 (Targretin) or 9-cis retinoic acid), a PGC-1? activator, a PGC-1? inhibitor or activator, adiponectin or an activator of adiponectin receptor AdipoR1 and/or AdipoR2, an NOS inhibitor or activator (e.g., 2-Ethyl-2-thiopseudourea or NG-nitro-L-arginine methyl ester (L-NAME) or adenosine), a Rho kinase-ROCK inhibitor (e.g., fasudil), BDNF, a monoamine oxidase (MAO) A inhibitor and/or a MAO B inhibitor (e.g., isocarboxazid, moclobemide, selegiline), an activator of SRC, an inhibitor of EGFR (e.g., erlotinib or ZD1839-gefinitib or Argos protein), an inhibitor of FAAH (e.g., URB597), an inhibitor of MAPK 1 (e.g., PD98059), or 2 (e.g., PD98059) or 4 or 5 or 7 or 8 (e.g., PD98059), an inhibitor of CDK9 (e.g., 1,5,6,7-Tetrahydro-2-(4-pyridinyl)-4H-pyrrolo[3,2-c]pyridin-4-one hydrochloride), a TGR5 agonist (e.g., oleanolic acid), an AMPK activator (e.g., AICAR), BMP-7, an mTOR inhibitor (e.g., rapamycin), an adenylate cyclase activator (e.g., forskolin) or combinations thereof can also be used to stimulate increased expression of UCP1, mtTFA, PGC-1?, and/or COX IV in BAT progenitor cells.
EXAMPLES
(24) Aspects of the present teachings may be further understood in light of the following examples, which should not be construed as limiting the scope of the present teachings in any way.
Example 1: Sorting and Differentiation of Muscle Vascular Cells
(25) In fetal skeletal muscle, CD34 and CD146 were found, by immunohistochemistry, to be expressed at the surface of endothelial cells and pericytes, respectively, although CD34 was also expressed by cells scattered in the inter-myofibrillar space.
(26) Vascular cells from seven independent fetal muscles (16-24 weeks of gestation) were sorted using multi-color fluorescence-activated cell sorting (FACS). Hematopoietic (CD45+) cells were first gated out, as were myogenic progenitors (CD56+). Then, endothelial cells (CD34+/CD146?) and pericytes (CD34?/CD146+) were sorted. The CD34+/CD146?/CD45?/CD56? are designated thereafter as CD34+ cells and the CD34?/CD146+/CD45?/CD56? as CD146+ cells.
(27)
(28) Sorted cells were grown 4-6 days in EGM2 medium and 8-12 days in the adipogenic medium described under Materials and Methods. These conditions sustain white adipocyte differentiation in WAT primary cultures.
Example 2: UCP1 Expression in Cultivated CD34+ Cells
(29) The remarkable adipocyte-like differentiation of fetal muscle CD34+ cells was an incentive for further characterization. Strikingly, quantitative RT-PCR revealed a high level of UCP1 mRNA in these cells.
(30) For comparison, the mean UCP1 mRNA level normalized to cyclophilin A in mouse brown adipocytes differentiated in culture was 7715?2649 (n=10) arbitrary units. Therefore, the level of UCP1 mRNA in human CD34+ cells amounted to almost one fourth of that in mouse brown adipocytes in culture. Human fetus BAT was not be used as a positive control for quantitative RT-PCR analysis because the risk of RNA degradation was high due to the time elapsed after the termination of the pregnancy. The amplicon was cloned and sequenced and found to be 100% identical to human UCP1. In fetal muscle CD34+ cells expanded up to passage 3 a high UCP1 mRNA expression, amounting to 43% of that detected in primary cultured cells, was still observed. UCP1 mRNA expression was not detected in non-differentiated fetal muscle CD34+ cells or in CD146+ cells in primary culture. The level of leptin mRNA was 9.95.5 and 71?52 arbitrary units in primary cultured and expanded cells, respectively (
Example 3: Additional Phenotyping of the CD34+ Cells
(31) To better characterize the gene expression pattern of the fetal muscle CD34+ cells expanded in culture a gene chip analysis was performed. The levels of expression of several representative gene mRNAs with significant Detection P-Values (p<0.01) are shown in Table 1 and compared with those in human muscle biopsies. The following protein mRNAs were chosen: UCP1 as a reference gene, mitochondrial transcription factor A (mtTFA) and peroxisome-proliferator-activated receptor (PPAR?) and PPAR? coactivator-1? (PGC-1?), which are involved in the control of thermogenesis and mitochondriogenesis, enzymes of the mitochondrial respiratory chain succinate dehydrogenase (SDH) and cytochrome oxidase IV (COX IV), enzymes of the fatty acid degradation pathway, carnitine palmitoyltransferase 1B (CPT1B), acyl-CoenzymeA dehydrogenases long chain (ACAD) and C4 to C-12 straight chain (ACADM), and the skeletal muscle markers myogenin, myogenic factor 5 (Myf5) and myogenic differentiation1 (MyoD1). Cidea, which is highly expressed in BAT and may act as a suppressor of UCP1 activity [16], was chosen as a BAT marker. The Genbank accession numbers of these genes are shown in the supplemental data.
(32) TABLE-US-00001 TABLE 1 Human Accession CD34 + muscle mRNA No. cells biopsies UCP1 NM_021833 94 n.s. mTFA NM_003201.1 413 205 PPAR? NM_138712.2 3326 84 PGC-1? NM_013261.2 137 619 COX IV NM_001861.2 13082 13407 SDH NM_003000.1 2390 5187 CPT1B NM_004377.2 99 639 ACAD NM_032169.3 1037 141 ACADM NM_000016.2 599 1640 Myogenin NM_002479.3 n.s. 267 Myf5 NM_05593 n.s. 21 MyoD1 NM_002478 n.s. 12 Cidea NM_198289.1 337 n.s.
(33) The data in Table 1 are expressed as the average Illumina signal. The Detection P-Values are <0.01. The following abbreviations are used: n.s., not significant; mtTFA, mitochondrial transcription factor A; PPAR?, peroxisome-proliferator-activated receptor-?; PGC-1?, PPAR? coactivator-1?; COX IV, cytochrome oxidase IV; SDH, succinate dehydrogenase; CPT1B, carnitine palmitoyltransferase 1B; ACAD, acyl-CoenzymeA dehydrogenases long chain; ACADM, C-4 to C-12 straight chain; Myf5, myogenic factor 5; MyoD1, myogenic differentiation 1.
(34) UCP1 was significantly expressed in fetal muscle-expanded CD34+ cells but not in adult muscle biopsies (for which p=0.12). The levels of mRNA expression of the selected genes in expanded CD34+ cells from fetal muscle were comparable with those of the adult muscle biopsies with the exceptions of PGC-1? and CPT1B mRNAs (which were about 5-fold less expressed in the cells) and of the PPAR? and ACAD mRNAs (which were 40- and 7-fold less expressed, respectively in the muscle biopsies). The muscle markers myogenin, Myf5 and MyoD1 mRNA were significantly expressed in the muscle but not in the cells whereas the BAT marker Cidea mRNA was expressed in the cells but not in the muscle. No $3-adrenoceptor mRNA could be detected in the gene chip analysis. It is noteworthy, however, that ?.sub.3-adrenoceptor mRNA was detected by quantitative RT-PCR (arbitrary value 0.084?0.044 with cyclophilin A as a reference; n=4) in fetal muscle CD34+ cells in primary culture. Measurements of mtTFA, PGC1-? and COX IV were also performed by quantitative RT-PCR to confirm the gene chip data with a different technique. The results were confirmatory, showing that fetal muscle CD34+ cells in primary culture express high levels of mtTFA, PGC1-? and COX IV mRNA [amounting to 306?117, 385?294, and 23,400?10,300 arbitrary units (n=3-4), respectively], using cyclophilin A as a reference.
(35) The UCP1 protein, as assessed by Western blotting with an anti-mouse antibody cross-reacting with human UCP1 (80% identity), was as abundant in primary cultured fetal muscle CD34+ cells as in fetal BAT.
Example 4: Uncoupling of Oxidative Phosphorylation
(36) To get insight into the possible function of UCP in muscle-derived cells, mitochondrial respiration of isolated cultured human fetal muscle CD34+ cells and human adult white adipocytes was compared. Basal respiration was defined as the antimycin A-sensitive oxygen consumption. Uncoupled respiration (proton leak) was defined as the percentage of basal respiration insensitive to the ATP synthase blocker oligomycin.
(37)
Example 5: Modulation of UCP1 Expression in Cultured CD34+ Cells
(38) UCP1 mRNA expression in fetal muscle CD34+ cells could be modulated by drug treatment. Cell-permeating cAMP derivatives strongly stimulated (7 to 8-fold) UCP1 mRNA expression in both primary cultured and expanded cells. The effects of cAMP derivatives, 8-bromo-cAMP, 0.25 mM or (4-chlorophenylthio)-cAMP, 0.25 mM (cAMP) on UCP1 mRNA expression in CD34+ cells in primary culture (PC) or expanded up to passage 3 (P3) are shown in
(39) Rosiglitazone, a PPAR? agonist, had no effect in primary culture cells but strongly stimulated (8-fold) UCP1 mRNA expression in expanded cells. The effects of rosiglitazone (Rosi) 1 ?M on UCP1 mRNA expression in CD34+ cell PC or P3 are shown in
Example 6: Muscle Specificity and Persistence Throughout Life of Human Brown Adipocyte Progenitors
(40) The derivation of UCP1-expressing cells from human fetal muscle raised the question of the restriction of brown adipocyte progenitors to this tissue and to the fetal stage. To address this issue, CD34+ cells purified by FACS from human fetal pancreas, lung and liver were cultured under the same adipogenic conditions as fetal muscle CD34+ cells. The sorted cells grew slowly and only a small proportion of them became multilocular. UCP1 mRNA was not expressed in pancreas or lung cells; however, a minor expression was measured in liver cells, which amounted to 2% of that detected in fetal muscle CD34+ cells (not shown).
(41) CD34+ cells sorted from 4 adult (50-78 years) human skeletal muscle samples, grown in primary culture (PC) under adipogenic conditions, also differentiated into multilocular cells. These cells were interspersed with other types of cells, some of them containing small lipid droplets (
Example 7: Detection of UCP1 mRNA Expression in Human Muscle and Effect of Rosiglitazone In Vivo
(42) Brown adipocyte progenitors of adult human skeletal muscle can differentiate in vivo and give rise to UCP1 expressing cells. The presence of UCP1 mRNA in the adult human skeletal muscle was tracked using a high sensitivity RT-PCR technique and, in fact, low levels of UCP1 mRNA were detected in the rectus abdominus muscle of 10 lean subjects (UCP1/cyclophilinA ratio: 24?9). The PCR-amplified fragment was sequenced and found to be 100% identical to human UCP1. The UCP1 mRNA level in adult human muscle was 75-fold lower than that in fetal muscle CD34+ cells in culture.
(43) Since the PPAR? agonist rosiglitazone was a strong inducer of UCP1 mRNA expression in muscle CD34+ cells in culture, the effect of this compound in vivo in humans was investigated. Vastus lateralis muscle biopsies from 7 obese patients with type 2 diabetes mellitus treated for the management of their metabolic syndrome with rosiglitazone were used. The biopsies were obtained before and after 8 weeks of treatment with rosiglitazone (2?4 mg per day). The treatment with rosiglitazone resulted in a significant improvement of the patients' insulin resistance and diabetes. In that study rosiglitazone, concomitantly with the improvement in insulin sensitivity, increased the level of expression of UCP1 in muscle by about 1.6-fold.
(44) In
(45) Strong effects of rosiglitazone, varying between 1.5- and 4.1-fold, were observed in 4 out 7 patients. This result suggests that rosiglitazone induced the appearance of brown adipocytes and/or enhanced the expression of the UCP1 gene in existing brown adipocytes in the skeletal muscle of the patients. This effect of the PPAR? agonist may play a key role in the therapeutic effect of this agent as an insulin-sensitizer.
Example 8: Screening of Potential Modulators of the Human UCP1 Promoter/Enhancer Region
(46) The identified and isolated CD34+ cells can be used as a tool to identify agents (compounds, proteins, biologicals, and the like) that induce the differentiation of these cells into brown adipocytes or modulate the expression of UCP.
(47) For this purpose a large region (6 kb) of DNA upstream (in 5) of the transcription start site of the human UCP1 gene (containing the promoter/enhancer region) has been cloned into a reporter/MAR GFP (Green Fluorescent Protein) or luciferase. This construct has been used to transfect CD34+ cells, and the cells grown in multiwell plates and screened for agents that increase the fluorescence (GFP) or luminescence (luciferase) of the cells, reflecting induction of gene expression (and thus increased UCP1 expression). This allows the identification of agents that can enhance the differentiation of CD34+ cells into brown adipocytes and/or the expression of UCP1 by enhancing the transcription of the UCP1 gene and/or by enhancing the translation of the UCP1 transcript, and/or by stabilizing the UCP1 transcript or protein.
(48) For example, a PPAR? modulator or activator like rosiglitazone can be used to promote the differentiation of CD34+ progenitor cells into brown adipocytes (
Example 9: Gene Chip Studies
(49) Gene chip studies were performed to identify molecular pathways that play a role in the differentiation of CD34+ progenitor cells into brown adipocytes and/or the induction of the expression of UCP1. CD34+ cells were isolated from human skeletal muscle biopsies, and were used in two studies: (1) cAMP study: CD34+ cells were differentiated as described in Materials (Control) plus addition of vehicle (Control 1 sample) or cAMP (cAMP sample); and (2) Rosiglitazone study: CD34+ cells were differentiated as described in Materials except that rosiglitazone was omitted from the adipogenic medium (Control 2 sample). Rosiglitazone was added only to the second sample (Rosiglitazone sample) in this study.
(50) We have found that these compounds promote the differentiation of CD34+ cells into brown adipocytes and the expression of UCP1 (see
(51) Total RNA was purified from these cells, and transcriptional profiles were assessed with Illumina Human WG-6 BeadChip (Expression Analysis, Inc., Durham, N.C.). Results were analyzed with Ingenuity Pathway Analysis 7.0 (trial version). These results were used to determine what molecular pathways are involved in the differentiation of CD34+ cells into brown adipocytes, and, more importantly, what molecular targets can be used for the development of agents that promote the appearance of brown adipocytes and the expression of UCP1.
(52) This work showed that the following actions/agents should promote brown adipocyte development: a PPAR? activator, modulator or inhibitor (e.g., rosiglitazone), a PPAR? activator or modulator (e.g., GW9578), a PPAR? activator or modulator (e.g., GW501516 or GW0742), a dual PPAR? and PPAR? activator or modulator, a pan-PPAR (?, ?, ?) activator or modulator (e.g., GW4148), a PDE4 inhibitor (e.g., rolipram or IBMX), a PDE7 inhibitor (e.g., BMS 586353 or BRL 50481 or IBMX), a NRIP1 (RIP140) inhibitor, a PTEN inhibitor (e.g., potassium bisperoxo (bipyridine) oxovanadate or dipotassium bisperoxo (5-hydroxypyridine-2-carboxyl) oxovanadate), an al-adrenergic full or partial agonist (e.g., phenylephrine or cirazoline), an RXR? activator or modulator (e.g., LGD1069 (Targretin) or 9-cis retinoic acid), a PGC-1? activator, a PGC-1p inhibitor or activator, adiponectin or an activator of adiponectin receptor AdipoR1 and/or AdipoR2, an NOS inhibitor or activator (e.g., 2-Ethyl-2-thiopseudourea or NG-nitro-L-arginine methyl ester (L-NAME) or adenosine), a Rho kinase-ROCK inhibitor (e.g., fasudil), BDNF, a monoamine oxidase (MAO) A inhibitor and/or a MAO B inhibitor (e.g., isocarboxazid, moclobemide, selegiline), an activator of SRC, an inhibitor of EGFR (e.g., erlotinib or ZD1839-gefinitib or Argos protein), an inhibitor of FAAH (e.g., URB597), an inhibitor of MAPK 1 (e.g., PD98059), or 2 (e.g., PD98059) or 4 or 5 or 7 or 8 (e.g., PD98059), an inhibitor of CDK9 (e.g., 1,5,6,7-Tetrahydro-2-(4-pyridinyl)-4H-pyrrolo[3,2-c]pyridin-4-one hydrochloride), a TGR5 agonist (e.g., oleanolic acid), an AMPK activator (e.g., AICAR), BMP-7, an mTOR inhibitor (e.g., rapamycin), and adenylate cyclase activator (e.g., forskolin), or combinations of any of the foregoing.
(53) Materials & Methods
(54) All organic and inorganic chemicals of analytical or molecular biology grade were purchased from Sigma Chemical Co. (St Louis, Mich.) and Gibco BRL (New York, N.Y.).
(55) Human Tissues
(56) Human fetal tissues were obtained anonymously, following spontaneous, voluntary or therapeutic terminations of pregnancy, from Magee Women Hospital, University of Pittsburgh, in compliance with the Institutional Review Board protocol. Developmental age (16 to 24 weeks of gestation) was estimated by measuring foot length. Informed consent to the use of fetal tissues was obtained from the patients in all instances. Adult human discarded abdominal subcutaneous WAT, originating from 45-55 year old patients undergoing plastic surgery performed one year after gastric bypass, was kindly provided by Dr Peter Rubin (Division of Plastic Surgery, University of Pittsburgh). The adult skeletal muscle tissue used for cell sorting was obtained post mortem from 50-78 year-old donors. The adult skeletal muscle used for the first group of RT-PCR studies was obtained from the rectus abdominus during surgery for either lap banding, inguinal hernia or hysterectomy of 10 lean male and female subjects. All subjects agreed to donate muscle samples during their operations and the protocol was approved by the Medical Ethical Review Committee of Deakin University. The average ages were 45?3 years and the average body mass index was 22.2?0.8. The adult skeletal muscle used for the second group of RT-PCR studies was obtained from the vastus lateralis of 7 obese type 2 diabetic male and female patients before and after 8 weeks of treatment with rosiglitazone (2?4 mg per day). The average age was 63?4 years and the average body mass index was 29.93.8. The complete clinical profile of the patients has been described in a previous publication [18]. All subjects agreed to donate muscle samples, and the protocol was approved by the Medical Ethical Review Committee of Maastricht University.
(57) Mice
(58) Animals were treated in accordance with the Centre M?dical Universitaire (Gen?ve) institutional guidelines. They were housed individually and kept on a 12 h light-dark cycle in a temperature-controlled room at 24? C. They were allowed ad libitum access to water and a standard laboratory chow. The interscapular BAT of 4- to 6-week-old male 129 Sv/ev mice were excised and their precursor cells isolated and cultured as previously described [19].
(59) Immunohistochemistry
(60) Fresh fetal and adult tissues were gradually frozen by immersion in isopentane cooled in liquid nitrogen. Five- to 7-?m sections were cut on a cryostat (Microm HM 505 E), fixed with 50% acetone and 50% methanol, dried for 5 min at room temperature (RT), and then washed 3 times for 5 min in phosphate-buffered saline. Non-specific binding sites were blocked with 5% goat serum for 1 hour at RT. Sections were incubated overnight at 4? C. with a CD34 mouse anti-human antibody (Serotech, 1:50), then, after rinsing, for 1 hour at RT with a secondary goat anti-mouse biotinylated antibody (DAKO, 1:1000) and for 30 min at RT with streptavidin-Cy3 (Sigma, 1:1000) or for 2 hours at RT with a conjugated CD146-Alexa 488 mouse anti-human antibody (Chemicon, 1:200). Nuclei were stained with 4,6-diamino-2-phenylindole dihydrochloride (Molecular Probes, 1:2000) for 5 min at RT. An isotype-matched negative control was performed with each immunostaining.
(61) Flow Cytometry
(62) The vascular cells of fetal skeletal muscle, pancreas, lung and liver as well as of adult muscle and WAT were analysed by flow cytometry. Fresh fetal or adult muscle as well as fetal pancreas, lung and liver tissues were cut into small pieces with a scalpel in Dulbecco's Modified Eagle Medium high glucose (DMEM) containing 20% fetal bovine serum (FBS), 1% penicillin-streptomycin (PS) and collagenases IA-S, II-S and IV-S (1 mg/mL), then incubated at 37? C. for 75 min (fetal tissues) or 90 min (adult tissues) with constant stirring. Final cell dissociation was achieved between ground glass slides. Cells were washed with phosphate-buffered saline and centrifuged for 5 min at 350 g. They were resuspended in DMEM, 20% FBS, filtered at 100 ?m, stained with Trypan blue and counted after dead cell exclusion. The WAT stroma vascular fraction was prepared by collagenase digestion according to Champigny et al. [20]. Cells (10.sup.5 for analysis and around 30.Math.106 for sorting) were incubated with one of the following directly coupled mouse anti-human antibodies: CD45-APC Cy7 (Santa Cruz Biotechnologies, 1:200), CD56-PE Cy7 (BD Pharmigen 1:100), CD34-PE (DAKO, 1:100) and CD146-FITC (Serotec, 1:100) in 1 ml DMEM, 20% FBS, 1% penicillin-streptomycin, at 4? C. for 15 min. After washing and centrifugation cells were incubated 30 min with 7-amino-actinomycin D (7-AAD, BD Pharmigen, 1:100) for dead cell exclusion, filtered at 70 ?m and run on a FACS Aria flow cytometer (Becton Dickinson). As negative controls, cell aliquots were incubated with isotype-matched mouse IgGs conjugated to APC Cy7 (BD Pharmigen, 1:100), PE Cy7 (BD Pharmigen, 1:100), PE (Chemicon, 1:100) and FITC (US Biological, 1:100) under the same conditions.
(63) Cell Culture
(64) Cells were seeded at 2-10.sup.4 per cm.sup.2 in 0.2% gelatin coated plates, cultured until confluency (4-6 days) at 37? C. in EGM2 medium (Cambrex Bio Science, Walkersville, Md.) and until differentiation (8-12 more days) in a modification of the adipogenic medium described by Rodriguez et al. [21] consisting in DMEM-Ham's F-12 medium containing 0.86 ?M insulin, 10 ?g/ml transferrin, 0.2 nM triiodothyronine, 1 ?M rosiglitazone (GlaxoSmithKline, Research Triangle Park, N.C.), 100 ?M 3-isobutyl-1-methylxanthine (IBMX), 1 ?M dexamethasone and 1% penicillin-streptomycin. For cell expansion studies, confluent cells grown in EGM2 medium only were detached by treatment with trypsin-EDTA for 3-5 min at 37? C., and then split 1:3 and cultured as described above. Human white adipocytes in primary culture used in the oxymetry studies were obtained as previously described [22].
(65) RT-PCR
(66) Total cell RNA was prepared using the kit NucleoSpin? RNAII (Clontech, Palo Alto, Calif.) or Extract-all solution (Eurobio, Courtaboeuf, France) and quantified by Biophotometry (Biophotometer, Eppendor). Oligo-dT primed First strand cDNA were synthesized using the Superscript? II RNase H Reverse Transcription kit (Invitrogen, Carlsbad, Calif.) and oligo-dT primers or the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, Calif.) and random primers. Quantitative real-time PCR was performed using ABI rapid thermal cycler system, and a SYBR Green PCR master mix (Applied Biosystems, Foster City, Calif.). Cyclophilin A was used as a control to account for any variations due to the efficiency of the reverse transcription. The upstream and downstream oligonucleotide primers were chosen on both sides of an intron to prevent amplification of contaminating genomic DNA.
(67) The primers used for real time quantitative PCR in human cells and in mouse brown adipocytes are as follows:
(68) TABLE-US-00002 hUCP1 Senseprimer: (SEQIDNO:1) 5-CCTCACCGCAGGGAAAGAA-3 Antisenseprimer: (SEQIDNO:2) 5-CTAACGACTGGAGGAGTGGCA-3 Ampliconposition:429-504. AccessionNo.:NM_021833. mUCP1 Senseprimer: (SEQIDNO:3) 5-CGATGTCCATGTACACCAAGGA-3 Antisenseprimer: (SEQIDNO:4) 5-TTGTGGCTTCTITTCTGCGA-3 Ampliconposition:996-1063. AccessionNo.:NM_009463.2. hleptin Senseprimer: (SEQIDNO:5) 5-CCAAAACCCTCATCAAGACAATT-3 Antisenseprimer: (SEQIDNO:6) 5-AAGTCCACCGGTTTGGACTTCA-3 Ampliconposition:143-238. AccessionNo.:BC069323. hcyclophilinA Senseprimer: (SEQIDNO:7) 5-CATCTGCACTGCCAAGACTGA-3 Antisenseprimer: (SEQIDNO:8) 5-GCAAAGTGAAAGAAGGCATGAA-3 Ampliconposition:466-537. AccessionNo.:NM_203431. mcyclophilinA Senseprimer: (SEQIDNO:9) 5-CAAATGCTGGACCAAACACAA-3 Antisenseprimer: (SEQIDNO:10) 5-CCATCCAGCCATTCAGTCTTG-3 Ampliconposition:343-412. AccessionNo.:NM_008907. PrimerusedforrealtimequantitativePCRin humanskeletamuscleareasfollows: hUCP1 Senseprimer: (SEQIDNO:11) 5-TCCGGCTCCAGGTCCAA-3 Antisenseprimer: (SEQIDNO:12) 5-TGATTGTTCCCAGGACACCTTT-3 Ampliconposition:240-311. AccessionNo.:NM_021833. hcyclophilinA Senseprimer: (SEQIDNO:7) 5-CATCTGCACTGCCAAGACTGA-3 Antisenseprimer: (SEQIDNO:8) 5-GCAAAGTGAAAGAAGGCATGAA-3 Ampliconposition:466-537. AccessionNo.:NM_203431. PrimersusedforanalyticalPCRareasfollows: CD34 Senseprimer: (SEQIDNO:13) 5-CATCACTGGCTATTTCCTGATG-3 Antisenseprimer: (SEQIDNO:14) 5-AGCCGAATGTGTAAAGGACAG-3 Ampliconposition:1172-1591. AccessionNo.:M81104. CD56 Senseprimer: (SEQIDNO:15) 5-GTATTTGCCTATCCCAGTGCC-3 Antisenseprimer: (SEQIDNO:16) 5-CATACTTCTTCACCCACTGCTC-3 Ampliconposition:542-873. AccessionNo.:BC014205. CD45 Senseprimer: (SEQIDNO:17) 5-CATGTACTGCTCCTGATAAGAC-3 Antisenseprimer: (SEQIDNO:18) 5-GCCTACACTTGACATGCATAC-3 Ampliconposition:940-1579. AccessionNo.:Y00638. CD146 Senseprimer: (SEQIDNO:19) 5-AAGGCAACCTCAGCCATGTCG-3 Antisenseprimer: (SEQIDNO:20) 5-CTCGACTCCACAGTCTGGGAC-3 Ampliconposition:168-603. AccessionNo.:M28882. ?-actin Senseprimer: (SEQIDNO:21) 5-CCTCGCCTTTGCCGATCC-3 Antisenseprimer: (SEQIDNO:22) 5-GGAATCCTTCTGACCCATGC-3 Ampliconposition:25-229. AccessionNo.:NM_001101.
(69) Arbitrary units were determined by normalizing target mRNA levels to cyclophilin mRNA levels (based on Cts), wherein the cyclophilin levels were first divided by 100,000 for ease of reference. For example, a ratio of target mRNA to cyclophilin mRNA of 0.01797 is expressed as 1797.
(70) Validation of the Human UCP1 Amplicon
(71) The PCR-amplified fragment was cloned into the pCR2.1-TOPO vector through the TOPO-TA cloning system (Invitrogen, Carlsbad, Calif.) and purification of color-selected colonies was performed using the Qiaprep Spin Miniprep (Qiagen, Hilden, Germany). Sequences were determined with oligonucleotide M13 Reverse on the pCR2.1-TOPO vector using the Applied Biosystem Big Dye sequencing kit on an ABI 3700 automated sequencer (Applied Biosystems, Foster City, Calif.).
(72) Western Blots
(73) Cultured cells were collected with a rubber policeman in 200 ?l of RIPA buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% Na deoxycholate, 0.1% SDS, 1:200 protease inhibitor cocktail (Sigma Chemical Co, St Louis, Mich.) and 50 mM Tris/HCl pH 8.0). Human BAT and skeletal muscle were homogenized in the above RIPA buffer. The protein content was determined according to the technique of Lowry [23]. Western blots were performed as previously described [24]. The UCP1 protein was detected using a 1/500 diluted rabbit anti-mouse UCP1 polyclonal primary antibody generously provided by Dr B. Cannon (Stockholm, Sweden). This antibody had been raised against the C-terminal decapeptide of mouse UCP1, that shares 80% identity with human UCP1 and 0 and 10% identities with human UCP2 and UCP3, respectively. Glyceraldehyde phosphate dehydrogenase (GAPDH) protein was detected using a 1/5000 diluted mouse anti-mouse GAPDH monoclonal primary antibody (Chemicon International, Inc, Temecula, Calif.). 1/5000 diluted goat anti-rabbit or anti-mouse peroxidase-labelled secondary antibodies (Sigma-Aldrich, St. Louis, Mo. or Bio-Rad, Hercules, Calif.) were used. A SeeBlue? Plus 2 Pre-stained Standard Ladder (Invitrogen, Carlsbad, Calif.) was used. Protein signals were detected by chemiluminescence using a standard ECL kit and developed on a Hyperfilm ECL film.
(74) High-Resolution O.sub.2 Consumption Measurement
(75) Oxygen consumption was measured using a 2-injection chambers respirometer equipped with a Peltier thermostat, Clark-type electrodes, and integrated electromagnetic stirrers (Oroboros? Oxygraph, Oroboros, Innsbruck, Austria). Measurements were performed at 37? C. with continuous stirring in 2 ml of DMEM F12, 10% new born calf serum. Under these conditions, the serum provided the fatty acids necessary to sustain UCP1 uncoupling activity. Before each 02 consumption measurement, the medium in the chambers was equilibrated with air for 30 min, and freshly trypsinized cells were transferred into the respirometer glass chambers. After observing steady-state respiratory flux, ATP synthase was inhibited with oligomycin (0.25-0.5 mg/I) and cells were titrated with the uncoupler carbonyl cyanide 3-chloro-phenylhydrazone up to optimum concentrations in the range of 1-2 ?M. The respiratory chain was inhibited by antimycin A (1 ?g/ml). Oxygen consumption was calculated using DataGraph software (Oroboros software).
(76) Gene Chip Analysis
(77) The total RNA of fetal muscle CD34+ cells expanded in culture for up to 3 passages (4 weeks) and of human muscle biopsies were prepared as described above. The quality assurance measurements, the preparation of the cRNA targets and the gene chip analyses using Illumina Human WG-6 BeadChip were performed by Expression Analysis, Inc. (Durham, N.C.). BeadStudio nonparametric methods were used for the computation of Detection P-Values.
(78) Statistical Analysis
(79) Data are expressed as means?s.e.m. Significances were evaluated using the unpaired Student's t-test. A paired Student's t-test was used to determine the effects of rosiglitazone on human skeletal muscle UCP1 mRNA levels. Significances were set at p<0.05.
(80) Cloning of the Human UCP1 Promoter/Enhancer Region:
(81) To develop our screening strategy, the human UCP1 promoter/enhancer was subcloned as follow:
(82) A human BAC (bacterial artificial chromosome) clone #RP11-5K16, (AC 108019) containing the human UCP1 (uncoupling protein-1) promoter/enhancer region, was obtained from the CHORI (Children's Hospital Oakland Research Institute) BAC-PAC resources service. The selected promoter/enhancer region starts at position ?25 upstream of the 5UTR (UnTranslated Region) of the human UCP1 gene (accession number: NM_021833). Based on the human UCP1 gene initiation codon, the full cloned promoter/enhancer sequence locates between position ?149 and ?6269.
(83) Primer sets were designed to amplify either: i) the full targeted promoter/enhancer region (6120 bp starting at position ?25 upstream of the UCP1 5UTR),
(84) TABLE-US-00003 Leftprimer: (SEQIDNO:23) 5-TCGTAAGCTTAGAGGCGGCGGCTGCAGACGGAGCGCGGTGTT-3 Rightprimer: (SEQIDNO:24) 5-ACGAAGATCTCATTACCCCAAATAGCATCACA-3 ii) the proximal targeted promoter/enhancer region (3685 bp upstream of the ?25 nucleotide of the UCP1 5UTR)
(85) TABLE-US-00004 Leftprimer: (SEQIDNO:25) 5-TCGTAAGCTTAGAGGCGGCGGCTGCAGACGGAGCGCGGTGTT-3 Rightprimer: (SEQIDNO:26) 5-ACGAACCGGTCAGAAGTGGTGAAGCCAGCCTGC-3 iii) the distal targeted promoter/enhancer region (2435 bp upstream of the proximal targeted promoter/enhancer region) as indicated:
(86) TABLE-US-00005 Leftprimer: (SEQIDNO:27) 5-TCGTACCGGTACAGGCTCTGGGAAGTAGGAGAAAGT-3 Rightprimer: (SEQIDNO:28) 5-ACGAAGATCTCATTACCCCAAATAGCATCACA-3
(87) Each primer contains a restriction site to facilitate subsequent cloning in mammalian expression vector (see below).
(88) Cloning of the promoter/enhancer in PCR reaction was performed with 500 ng of BAC #RP11-5K16 as template, using Takara Ex Taq DNA Polymerase kit (Clontech) for amplification. PCR program steps were as follow: Initialization step, 92? C. for 2, followed by 28 cycles: denaturation: 92? C.-30 seconds/annealing: 59? C.-40 seconds/extension: 68? C.-5 minutes 30 second, with a final elongation step 68? C.-8 minutes.
(89) The full promoter/enhancer, proximal or distal promoter/enhancer were subsequently subcloned in the reporter/MAR element-containing vector p1-68_GFP at the BlgII/HindIII sites, replacing the SV40 promoter cassette [25]. Alternatively, the luciferase-based pGL3 Basic vector (Promega) was also used as another reporter type, using the same BgIII/NcoI sites for subcloning purpose.
(90) The human UCP1 promoter sequence cloned was confirmed by state-of-the-art sequencing, performed at biotechnology company, Fasteris SA, Switzerland. The sequence of the human UCP1 promoter sequence is provided as follows (SEQ ID NO. 29):
(91) TABLE-US-00006 5-CATTACCCCAAATAGCATCACATTCTATCTCTGGATCACCATTTT TACACTTATCTAGAATTTGCCCACCTGTAGTTTCCACTCTTCGGCACT AATTATTTTGCTTAATTGCGTACAGAACAAATCTACCCCGTCCACTGT CTATGCCTTCAAGTATCTGAGAACAGTAATGTCCTGTTCGGTAAGTCA TTTTCTCCTTTTCACTCTCTGGTCCTTCCATGGGGCTTCAATCCCCAT ACACCTCTTTTTTCTAAATTTCATAGGTCAGTTTTCCTGTCTCTTCTA CCAGGTTCTACTGAAGATGAAAAAAAGTGCTTTTTTAAACCAAAAGTA TTGCAATGTTTATTTTATCTTTGTAAGTTCCTTAGTAATATATACAAA TCAAGTAAAAGATATATGTTGCATGTGATATTTTAACTTTTGATATGA CTTATTGAAAAAATATATAAGGATACATAGCCATTGTGTGTCTTCAAA TCATAGGAAAGTATCATGTCGCGAATGTATTGGGAAGGCAGTTGGGGT ATCACGTAGTAGTTGAGAGTTAGGGGGTCAGGCAGATCCTCAGTGTAC CATTTACTGGTTCCGTGACCTAGGAGAAGTTATTTAACTTCTCTGAGC TCTCTGAGTTTCCTCATCAGTGAAGGGGAATAACAATAATATATGCCT CCAAAGGCCGCAATGAGGACTAACTGTGTTAAGTTTTGTAAAATGCCT AAAATATTATAGTGTCTGGCACTTGTTCAATGCTATGTATTTGTTAAA TACATGACATGAATAAATCTTTCATTGAGTTATGAGGATTAGGTACAT CAGGTGCTTAGCATAAAGAGTGATTTATTAATAAGAATAGGCTCATGA TGCAGGAATATTCATCACATATGTAAATAATCTGAAGCTCAGAGAAGT TAAGTAATTTGGCCATGCTTACCCAGTCAGTTATTATCTTAGTGAGAA TTTGAACATGGGCCTCCTGGTCTCTTAATCACCATGCTATACCACTTA TATCAGCATAGAAATGGAATATTTTCTCCTTAACGCAGAGTTTGATAG TCTTTGTCTCTTTGTATTGGGCTGGACTAAGAAAACCCAATCCTGTCC TCTTTCTACTTTTTCTCTGTTCCTAAGAGCACTCCCCTTTCTCTGTTG TATATCAGTTCCTAATGGTAGACACTTGAGCACCACTATTCTGTACAG CTCTCCGACAATCCCACATCTAGATGCCAAGCTGAGGTTGGCATTCTC ACTAATTTGCTGTTATAAATATTAAGCTATCATAAGCGTTAGCCTACA TATGACTCTTTCATATGTTAGTTAATTATTTTAGGGTAGAAATCCAAA AGTGGAGTTACCAGAAGTGGATATAGACATTCTGGCTGGGTGTGATGG TTCATGCCTGTAATCCCAGCACTTTGGGAGGCAGAGGCAGGCGGATCA CTTGAGGCCAGGAGTTTGAGATCAGCCTGGGCCAACACAGCGAAACCC CATCTCTACTAAAAATTCCAAAACTAGCCAGGCATAGTGGCACATGCC TGTACTCCCAGCTACTTGGGAGGCTAAGACACAAGAATCGCTTGAACC CGGGAGGGAGGTGGAGGTTGCGGTGAGCTGAGATTGTGCCACCGTACT CCAGCCTGGGTGACACAGCTAGACTCTGTTTCAAAAAAAAAAAGAAAA AGAAAAGAAAAAAATAGACTTTCTCTTGGCTCAGTGTATACTGCCAAA TTGTTTTCCAAAAAAATTGTGTCAATGTATAACACCATCACTAATATA GTATTGATATTATGGTTATTACATTTTAAAATTCATAATTTGTAATTA TAACATTCATAATTTATTACTATTTATAATATTAATGTAAATGTATAT TATATATAAATGTTATAGTAATTATAACTTTGGTAGTGACAAAGTATT AATTTATTAGGTGAAGTATATGCTTTTTTATTAGTGATAATAAATATA TCCTCTCTCCCATTATAAAAGTTTGTATTTCTTCTTTTAGAAATTGAT TCTTCTGTCATTTGCACATTTATCTGTATAATTATAACAGGGTATTTC CCAGTGGTGGCTAATGAGAGAATTATGGGAAAGTATAGAACACTATTC AAATGCAAAGCACTGTATGATTTTTATTTAATAGGAAGACATTTTGTG CAGCGATTTCTGATTGACCACAGTTTGATCAAGTGCATTTGTTAATGT GTTCTACATTTTCAAAAAGGAAAGGAGAATTTGTTACATTCAGAACTT GCTGCCACTCCTTTGCTACGTCATAAAGGGTCAGTTGCCCTTGCTCAT ACTGACCTATTCTTTACCTCTCTGCTTCTTCTTTGTGCCAGAAGAGTA GAAATCTGACCCTTTGGGGATACCACCCTCTCCCCTACTGCTCTCTCC AACCTGAGGCAAACTTTCTCCTACTTCCCAGAGCCTGTCAGAAGTGGT GAAGCCAGCCTGCTCCTTGGAATCCAGAACTACTTTCAGAATCTTGAA CTTCTGTGACCTCTCAGGGTCCCCTTGTGTGAAGTTTTTGACGTCAGC TTCTCCTGTGACCCTTAGAAGTCACTCTTGTGTCTAGCACATCCCAGG TGCTCAGTCACCATTGAACTACAGTCATACTATCTCCTGGCAAAGGCT CTTAACTGTCCATGTTAGCCTGATATTAATATCCTGGAAGCTTATACT GTCGTTCTTCCTTCCAGGTTTAAATAAGGCAGCCCCTTTATCCTGTCA CAGGTCCTCTCTCCCTACCTATCCTTACCTGTTTTGGATAACAACCTT TCTTCATTTCTAATAGATTTATTTATTTCTCACATTTCCTTCCCTTAT CATAGTTTTCCTCTCACTTTCTCCTCTAGTTTGTCATACTCTGGCTTT AAAACATGCAAACATGTGCCTTATGGGGAAAAAAAGACAATTTTAATT TACCTTGCTTCTTTACAAATGTATTGTGGCTTCTTCTTATAGTCCAAA TCTAAAACTCTTTACCCACCCACTGCCTTGAACTCCTTCCTCGTTGTG AAAGTAGGATGGGGCAAAGAGAGAATGCATGCCCCTCCCAACTGCTCA AACAAGTAAAGGTGCTGTTACAGTTATCTTTTGCTACCTTAATACAAT AATTATTTTATTATATCTCACAATTTTATGGATCAGGAATTTAGACTG GGCTCAGCTAGGCGATTCTTCTGCTTTACTGACATCATAGGAGATCAC TTGGTGGTATTCAACTGTCAGGTAGGCTTATCTGGAGGGTCCAAGATA GCTGTACTCTGGTGCCTGGTGCCTTGGTAAAGAGGGATGATGATGTGG GGCCTCTCCAGCATGAACAGCCTCAGAGAAGTTTGCTTTCTTACATGC TGGCCCAGGGCTCCAAGAGCAAATGTTGCAGTGAGTAAAGCAGAAGAT ACAAGGACTTTTATAATCTGGTCTCAGAAGCCACATGGCATCAGTTCT GTATTATTCTATTGGTCAAAACATTCATAAGCCTGCCAGATGCAAGGG GAAGGCATATGTACCCTCATCTTTTGATGGGAGGAATGTGATGGATTT GCAATTATGTTTTAAAACTACTACAGACAGAACCACTGAGAAAGATTC ATGGGTAGCTTTGGGGTGAGGACTGGGAATTAACCTGTTGATAGCAGA GGTTCACTAGAGTCAACAAGGAATAAGGTCTCCTCTTGTACACTTTAG TCATACTATACCAACATTCTTAACCACTGCTTAGCCATCAGCCTCACA ACATAACAACTCCATCATAGTTGTACTCCCTAAGATCACCAACAATGT TAGAGTCAAATCCGGTAGGTTTTTCTTTGTTTTTGTCCTCCTGACATT TTTTCTAAACTTGACACTGGTCAGACCCAATCTTTCTTTAATCATATT CTTAAATACCAGTTCTATCACTGGATATGTTACTGTTTCTTGTTCTCA CTCTACCTTTGACAAAGCCATTCTTTCCAGACTATAACTCTGGGTCTG GGTCCCCCTATGGTTTGGCCCTTGAATTCTTTTCCTAGTCCTATTTGA CTAGCCCCATTTTCCCGTGAAAAGCATGCCCCTTTCATTGCATCCATA TCATGACTACCAAATACCTCCTCTATTTCTTCCTCTTTTAGCATGTTA AATGCAGCTTCCTAAGCTCTCTATCTGGATATCAACAGTATTCTCTCC AAATAATTCTAAGACTTTAAAAATTGGTTTAATCTTCTTACCCCTAAA ATCACCCCCCTTACCAACTGCCTCATGACAATCATTGGTACTGTCACT GAGCTTGCAACCCATGTTCTTAAACATAGAGTAATCTTTGACTCCACA TCTAATCATTCATAAAGCTGTATTGTCTATCAAATTAAATCTGACATT TATGTGAGAGCACTTCATAGTCTGTAAAGCACTACACAGGTGATAACA TGAAGCTACACTCATAATGGATTTGCAGGCTCTGCTTCTCATTTGGCT TCTACAGCCTCATCCCTCACCAACTTCTTGCCCTACCTCTCTCTTTCT TCCCCATCACCCAATTTCCCAGTCAGTCAGGCCAACAGAATGCATTCT ATATACGCGACTTGCTTTCCCCAACATCTTTGCCTGTATGCATGCCAC TTATTTGCCTCAGTTGATCTTTATTTCAACAAGTGTTTGCAGAGGAGA AACCTCGCTGGCTCCTTCTCCTTTCTATTTTTTTTCAGAGGCTACCCG TCAGGTCAACATTGCCTTTTTCAGGGAAGCTCTGCAAGCCTGACCTCC CTTGGAAGTGCCTTAGGACTGGCTTCTTGCACAGTACACAACCTTTAC TTATAGAGGGTTTGGAGATTATTCTTTATTCATGTCTTATTTCTCCTG CTCCTGGAGGAGATGACTCTGACTTCCACTGACTCTTTTGGGGGGCTT AAGTCAGGGTTGAGTACCAGAGGCCCTAAATAGCTGGACGTGGATTCT GGTAATATCAAATCCATCTTTGGCTTAACTGAGAGGTTCTGAAAGCTG GGACCTGACCTTGTCCATTTCCCTCTTTCTCCAGTTTCCTATTATTTC CCACTGTTTTTTTTAAAAGTTTTTTGTTTTCTTAAGTTTTCACAAGAA TAAACATTGAAAATAAAATTTGCACAAAGATCGAACTAGGAAAGGCCA CACAACCAACACATATTACATCATTATAGGTAAGTTAGCAGGGAGATT TCAGACCTGGGCTAGCTCTGGAACCACATTTTACACTGTTGAAAATAA AAGCTGGAGTACAGATGAGTTTCCCAGGTTCACAGAGTTGGTAAGCTG GAGAGCTGCACCTGGAGCCAAGCAACCTGCCCTGTCCTTTCCACTGCA CCCTCTAAGAAATCTAATTAGAAGGAACAGGTGGTATCTCATTTTGTA CGGTGCTTTAGCAATGTACTATTTGCTTTCTAGTGTGTCTATTGTCTC GTTTGACATCTTCTCTGAAAAAGTGATGAAACGAAACGCTCTTTTTGA CAAGTTCAGAGTGCTCTTGGTTCCTGTGTGGGATTCTTCCAAGTCTGA ATTTGGTAGTGGGAAGAGAAGGAATCCGGAGGAAGGAGGATGAGAAGT TTAAAGGAGAGGAAAGGGAAGCAGAGAAGGCCGCAAGGTGCCTGCAAG ATGTCTGGGGAGTTGGAGGAATGGAAGAGTGCCCCGCTCTTCCTTCTG GGAGAGCTCCAGCTAGGCAGAACCTTTCACCAAGGCTCTGATATCGTG CTGGTTTCCGAAAGCCCCAGCCGAAGGTGTGCAGCCAAAGGGTGACAG AAGGTGAGGCACGTGCGGGGGCGCGGGTGCTGACCGCCGCGGTGCGCC CTCCCTCCGACGTGCGGTGTGCGGGGCGCAGACAACCAGCGGCCGGCC CAGGGCTTTCGGGGAGCGAAGCAGGGCTCCCGAGGCACCGAGCGAGAA TGGGAATGGGAGGGACCCGGTGCTCCCGGACACGCCCCCGGCAGGTCC CACGCCCGGGTCTTCTGAGACCTCGCGCGGCCCAGCCCGGGAGCGGCC CAGCTATATAAGTCCCAGCGGAAGACCGGAACGCAGAGGGTCCTGCTG GCGCGAGGGTGGGTAGGAGGGGACGCGGGGACTCGGCCCCCAACACCG CGCTCCGTCTGCAGCCGCCGCCTCT-3
(92) The section headings and subheadings used in this specification are for organizational purposes only and are not to be construed as limiting the subject matter described in any way. Further, while the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents as will be appreciated by those of skill in the art.
REFERENCES
(93) [1] M. Klingenspor, Cold-induced recruitment of brown adipose tissue thermogenesis, Exp Physiol. 88 (2003) 141-148. [2] B. Cannon, J. Nedergaard, The biochemistry of an inefficient tissue: brown adipose tissue, Essays Biochem. 20 (1985) 110-164. [3] N. J. Rothwell, M. J. Stock, A role for brown adipose tissue in diet-induced thermogenesis, Nature. 281 (1979) 31-35. [4] B. B. Lowell, V. S-Susulic, A. Hamann, J. A. Lawitts, J. Himms-Hagen, B. B. Boyer, L. P. Kozak, J. S. Flier, Development of obesity in transgenic mice after genetic ablation of brown adipose tissue, Nature 366 (1993) 740-742. [5] H. M. Feldmann, V. Golozoubova, B. C. M. Cannon, J. Nedergaard, UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality, Cell Metab. 9 (2009) 203-209. [6] J. Kopecky, G. Clarke, S. Enerb?ck, B. Spiegelman, L. P. Kozak, Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity, J Clin Invest. 96 (1995). [7] K. Tsukiyama-Kohara, F. Poulin, M. Kohara, C. T. DeMaria, A. Cheng, Z. Wu, A. C. Gingras, A. Katsume, M. Elchebly, B. M. Spiegelman, M. E. Harper, M. L. Tremblay, N. Sonenberg, Adipose tissue reduction in mice lacking the translational inhibitor 4E-BP1, Nature Medicine 7 (2001) 1128-1132. [8] K. Almind, M. Manieri, W. I. Sivitz, S. Cinti, C. R. Kahn, Ectopic brown adipose tissue in muscle provides a mechanism for differences in risk of metabolic syndrome in mice, Proc Natl Acad Sci USA. (2007). [9] M. Del Mar Gonzalez-Barroso, D. Ricquier, A. M. Cassard-Doulcier, The human uncoupling protein-1 gene (UCP1): present status and perspectives in obesity research, Obes Rev. 1 (2000) 61-72. [10] B. Cannon, J. Nedergaard, Brown adipose tissue: function and physiological significance, Physiol Rev. 84 (2004) 277-359. [11] W. D. van Marken Lichtenbelt, J. W. Vanhommerig, N. M. Smulders, J. M. Drossaerts, G. J. Kemerink, N. D. Bouvy, P. Schrauwen, G. J. Teule, Cold-activated brown adipose tissue in healthy men, N Engl J. Med. 360 (2009) 1500-1508. [12] A. M. Cypess, S. Lehman, G. Williams, I. Tal, D. Rodman, A. B. Goldfine, F. C. Kuo, E. L. Palmer, Y. H. Tseng, A. Doria, G. M. Kolodny, C. R. Kahn, Identification and importance of brown adipose tissue in adult humans, N Engl J. Med. 360 (2009) 1509-1517. [13] K. A. Virtanen, M. E., J. Orava, M. Heglind, R. Westergren, T. Niemi, M. Taittonen, J. Laine, N. J. Savisto, S. Enerb?ck, P. Nuutila, Functional brown adipose tissue in healthy adults, N Engl J. Med. 360 (2009) 1518-1525. [14] H. L. Garstka, W. E. Schmitt, J. Schultz, B. Sogl, B. Silakowski, A. Perez-Martos, J. Montoya, R. J. Wiesner, Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA, Nucleic Acids Res. 31 (2003) 5039-5047. [15] Z. Wu, P. Puigserver, B. M. Spiegelman, Transcriptional activation of adipogenesis, Curr Opin Cell Biol. 11 (1999) 689-694. [16] Z. Zhou, T. S. Yon, Z. Chen, K. Guo, C. P. Ng, S. Ponniah, S. C. Lin, W. Hong, P. Li, Cidea-deficient mice have lean phenotype and are resistant to obesity, Nat. Genet. 35 (2003) 49-56. [17] L. A. Foellmi-Adams, B. M. Wyse, D. Herron, J. Nedergaard, R. F. Kletzien, Induction of uncoupling protein in brown adipose tissue. Synergy between norepinephrine and pioglitazone, an insulin-sensitizing agent, Biochem Pharmacol. 52 (1996) 693-701. [18] M. Mensink, M. K. Hesselink, A. P. Russell, G. Schaart, J. P. Sels, P. Schrauwen, Improved skeletal muscle oxidative enzyme activity and restoration of PGC-1 alpha and PPAR beta/delta gene expression upon rosiglitazone treatment in obese patients with type 2 diabetes mellitus, Int J Obes (Lond). 31 (2007) 1302-1310. [19] L. Lehr, K. Canola, C. Asensio, M. Jimenez, F. Kuehne, J. P. Giacobino, P. Muzzin, The control of UCP1 is dissociated from that of PGC-1 alpha or of mitochondriogenesis as revealed by a study using beta-less mouse brown adipocytes in culture, FEBS Lett. 580 (2006) 4661-4666. [20] O. Champigny, B. R. Holloway, D. Ricquier, Regulation of UCP gene expression in brown adipocytes differentiated in primary culture. Effects of a new beta-adrenoceptor agonist, Mol Cell Endocrinol. 86 (1992) 73-82. [21] A. M. Rodriguez, C. Elabd, F. Delteil, J. Astier, C. Vernochet, P. Saint-Marc, J. Guesnet, A. Guezennec, E. Z. Amri, C. Dani, G. Ailhaud, Adipocyte differentiation of multipotent cells established from human adipose tissue, Biochem Biophys Res Commun. 315 (2004) 255-263. [22] J. Corre, V. Planat-Benard, J. X. Corberand, L. Penicaud, L. Casteilla, P. Laharrague, Human bone marrow adipocytes support complete myeloid and lymphoid differentiation from human CD34 cells, Br J. Haematol. 227 (2004) 344-347. [23] O. H. Lowry, N. J. Rosebrough, A. L. Farr, R. J. Randall, Protein measurement with the Folin phenol reagent, J Biol. Chem. 193 (1951) 265-275. [24] M. Jimenez, C. Yvon, L. Lehr, B. Leger, P. Keller, A. Russell, F. Kuhne, P. Flandin, J. P. Giacobino, P. Muzzin, Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting, Eur J. Biochem. 269 (2002) 2878-2884. [25] P. A. Girod, D. Q. Nguyen, D. Calabrese, S. Puttini, M. Grandjean, D. Martinet, A. Regamey, D. Saugy, J. S. Beckmann, P. Bucher, N. Mermod, Genome-wide prediction of matrix attachment regions that increase gene expression in mammalian cells, Nat. Methods. 4 (2007) 747-773.