<i>Streptococcal </i>proteases

12006530 ยท 2024-06-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to new Streptococcal proteases designated IgdE which display IgG degrading cysteine protease activity. The invention further relates to in vitro methods of cleaving IgG using the described Streptococcal proteases, using the methods to generate Fc and Fab fragments, and using the methods to detect IgG.

Claims

1. An in vitro method for the cleavage of human IgG1, the method comprising contacting human IgG1 with a purified polypeptide in vitro, wherein the purified polypeptide comprises: (a) the amino acid sequence of SEQ ID NO: 3; (b) a variant thereof having at least 95% identity to the amino acid sequence of SEQ ID NO: 3 and having human IgG1 cysteine protease activity; or (c) a fragment thereof of either (a) or (b), having human IgG1 cysteine protease activity.

2. A method according to claim 1, wherein the purified polypeptide comprises the amino acid sequence of SEQ ID NO: 3.

3. A method according to claim 1, wherein the method comprises incubating the purified polypeptide with a sample containing human IgG1 under conditions which permit specific cysteine protease activity to occur.

4. A method according to claim 1, which further comprises identification and/or isolation of the cleavage products.

5. A method according to claim 4, wherein said identification and/or isolation comprises analysis by gel electrophoresis or mass spectrometry.

6. A method according to claim 1, wherein the method is used to generate Fc and Fab fragments.

7. A method according to claim 1, wherein the method is used to detect human IgG1.

8. A method according to claim 7, comprising: (i) contacting a sample with the purified polypeptide under conditions that permit the human IgG1 specific cysteine protease activity of the polypeptide; and (ii) monitoring for the presence of human IgG1 specific cleavage fragments; wherein the presence of the specific cleavage fragments is indicative of human IgG1 in the sample.

9. A method according to claim 1, wherein the purified polypeptide is a purified recombinant polypeptide.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. IgG degradation activity in culture supernatants of S. suis.

(2) (A) Concentrated (20?) culture supernatants of S. suis strains 10 and 10?ide.sub.Ssuis were incubated with 2% porcine plasma for 16 h at 37? C. and analyzed by SDS-PAGE under reducing conditions. A degradation product (*) of approximately 32 kDa was observed. (B) Anti-IgG Western Blot analysis of culture supernatant of S. suis strain 10 fractionated by ammonium sulfate precipitation. IgG degradation products (*) were obtained after incubation of 1% porcine plasma with 20-40% and 40-60% ammonium sulfate saturation fractions for 16 h at 37? C. Lane 1 showing the protein size standard is a photographic image of the membrane before detection of the chemiluminescence signal. (C) Culture supernatants of S. suis strains of all tested serotypes cleaved IgG. Concentrated (10?) culture supernatants were incubated with 1% porcine plasma for 16 h at 37? C. and analyzed by anti-IgG Western blot. IgG cleavage products (*) at approximately 32 kDa of varying intensity were observed in all lanes. Images of different western blots have been assembled into one figure.

(3) FIG. 2. Identification of the active site of S. suis IgdE.

(4) (A) Schematic illustration of IgdE and the different rIgdE constructs with potential active site residues substitutions and the C-terminal truncation variant. The secretion signal peptide (residues 1-37) is marked in light grey, the transglutaminase domain is boxed and the potential active site residues and substitutions are indicated. (B) 3.3 ?M porcine IgG was incubated for 16 h at 37? C. with soluble fractions of E. coli cells expressing different rIgdE constructs. The reaction was analyzed SDS-PAGE under reducing conditions. IgG cleavage (*) occurred upon incubation with rIgdE, rIgdE.sup.D348A and rIgdE.sup.?C but not with rIgdE.sup.C302S or rIgdE.sup.H333A. The weak protein band of 37 kDa is a contaminant present in lysate preparation and not related to IgdE activity.

(5) FIG. 3. Time course and inhibitor profile of recombinant S. suis IgdE.

(6) The time course of cleavage (A) was monitored by continuous sampling prior to Coomassie fluor orange stained SDS-PAGE under reducing conditions followed by densitometric quantification of the cleavage product. 1.67 ?M porcine IgG was incubated with 0.2 ?M purified rIgdE.sup.ac. Overnight cleavage (16 h) was set as 100% relative cleavage. For the inhibitor profile (B) initial cleavage in presence of 250 ?M and 2.5 ?M of each inhibitor was monitored. Initial cleavage activity of the uninhibited control was set as 100% relative activity. The DMSO control correlates to 250 ?M Z-LVG-CHN2. Data are presented as mean?SEM of three experiments. Differences to the uninhibited control (*) or DMSO control (?) were analyzed by Dunnett's Multiple Comparison Test with significance set at P values of <0.05(*), <0.01(**) and <0.001(*** or ???).

(7) FIG. 4. S. suis IgdE cleaves the heavy chain of porcine IgG in the hinge region.

(8) The reaction was analyzed by non-reducing (A) and reducing (B) Coomassie blue stained SDS-PAGE. 3.3 ?M IgG was incubated with (+) or without (?) 10 nM purified rIgdE for 16 h at 37? C. (C) The observed cleavage pattern and cleavage site proposes a model where one IgG heavy chain is first hydrolyzed by IgdE resulting in one free Fab fragment (Fab) and single cleaved IgG (scIgG) and in a second step the other heavy chain is hydrolyzed resulting in one Fc fragment (Fc) and two Fab fragments.

(9) FIG. 5. IgdE is highly specific for porcine IgG.

(10) (A) 2% porcine plasma was incubated with (+) or without (?) 10 nM purified rIgdE.

(11) The reaction was analyzed by anti-porcine IgG, IgM and IgA Western blots under reducing conditions. Only cleavage of IgG was observed (*). (B) 0.5 mg/ml IgG of different species was incubated with (+) or without (?) 10 nM purified rIgdE and analyzed by SDS-PAGE under reducing conditions. No cleavage of IgG derived from any other species than pig (*) was observed. The weak protein band of 37 kDa is a contaminant present in lysate preparation (see lane 2) and not related to IgdE activity. Images of different gels have been assembled into one figure.

(12) FIG. 6. S. suis IgdE degradation of endogenous IgG

(13) S. suis IgdE degrades endogenous IgG in all tested body fluids of healthy pigs and pigs with respective lesions. (size indicated with arrows). No other degradations products could be observed. Body fluids were incubated with (+) or without (?) 10 nM purified rIgdE for 16 h at 37? C. The reactions were analyzed by SDS-PAGE (A) and anti-IgG Western blots (B) under reducing conditions. Lanes showing the protein size standard are a photographic image of the membrane before detection of the chemiluminescence signal. Images of different gels have been assembled into one figure.

(14) FIG. 7. IgdE is necessary for IgG cleavage by S. suis and IgG cleavage is independent of Ide.sub.Ssuis.

(15) Concentrated (10?) supernatants of S. suis strains 10, 10?igdE, 10?ide.sub.Ssuis and 10?ide.sub.Ssuis ?igdE were incubated with 1% porcine plasma for 16 h at 37? C. The reaction was analyzed by anti-IgG Western blot (A) or anti-IgM Western blot (B) under reducing conditions. IgG degradation (*) was only observed when incubated with supernatants of strains 10 and 10?ide.sub.Ssuis, meanwhile IgM degradation (*) only was observed upon incubation with supernatants of strains 10 and 10?igdE.

(16) FIG. 8. Inhibitor profile of IgG degradation activity detected in culture supernatants of S. suis.

(17) Concentrated (10?) culture supernatant of S. suis strain 10 was incubated with porcine plasma in presence of class specific protease inhibitors. The reaction was analyzed by anti-IgG western blot under reducing conditions. A cleavage product of IgG can be observed when incubated with 0.1-1 mM AEBSF, 0.1-5 mM EDTA, 50 ?M E-64, without any inhibitor and 1/200 diluted complete inhibitor cocktail (marked with an asterisk), meanwhile no degradation product was observed when incubated with 5 mM AEBSF, 250 ?M E-64, without concentrated supernatant (-C), 0.1-5 mM Z-LVG-CHN2, 0.1-5 mM iodoacetamide and 1/50 diluted complete inhibitor cocktail.

(18) FIG. 9. Representative Coomassie blue stained SDS-PAGE gel monitoring rIgdE.sup.?C purification.

(19) rIgdE.sup.?C was purified from lysate of IPTG induced E. coli carrying an expression plasmid. The elute of a Ni.sup.2+-affinity chromatography purification containing His-ZZ-tagged rIgdE?C was incubated with Tev-protease to remove the His-ZZ-tag prior to a second round of Ni.sup.2+-affinity chromatography purification. The flow through fractions 2 and 3 of this purification step containing untagged rIgdE.sup.?C were pooled, buffer ex-changed to PBS and used for further experiments. Two major bands around 50 kDa can be observed in these fractions, due to partial degradation of rIgdE.sup.?C.

(20) FIG. 10. rIgdEagalactiae specifically cleaves human IgG1.

(21) (A) rIgdE.sub.agalactiae was incubated with polyclonal IgG of six different species for 18 h at 37? C. and analyzed by SDS-PAGE under reducing conditions. Degradation products are indicated by asterisks (*). Images of different gels have been used to create the figure. (B) rIgdE.sub.agalactiae was incubated with human or bovine serum for 18 h in 37? C. and analyzed by SDS-PAGE under reducing conditions. Degradation products are indicated by asterisks (*). (C) Western Blot with crude extracts of rIgdE.sub.agalactiae incubated with human and porcine serum for 18 h in 37? C. Membrane was treated with antibodies against human and porcine polyclonal IgG respectively. Degradation products are indicated by asterisks (*). (D) rIgdE.sub.agalactiae was incubated with subclasses of human IgG as well as human IgA and IgM for 18 h in 37? C. and analyzed by SDS-PAGE under reducing conditions. Degradation products are indicated by asterisks (*). Images of different gels have been used to create the figure.

(22) FIG. 11. rIgdEagalactiae degrades human serum IgG1 completely to single cleaved IgG1.

(23) Human serum and monoclonal human IgG1 were incubated in presence (+) or absence (?) of rIgdE.sub.agalactiae for 18 h at 37? C. and analyzed by Western blot under non-reducing conditions with a human IgG-specific antibody.

(24) FIG. 12. rIgdEequi cleaves exclusively equine IgG7.

(25) 0.6 ?M recombinant equine IgG subtypes or serum IgG were incubated for 16 h at 37? C. with (+) or without (?) the soluble fraction of E. coli cells expressing rIgdE.sub.equi. Reactions were analyzed by SDS-PAGE under reducing conditions. IgG cleavage (*) occurred upon incubation with IgG7 and serum IgG. SDS-PAGE was either stained with Coomassie Fluor Orange Protein Gel Stain (A) or subjected to Western blot (B) analyses with Rabbit Anti-Horse IgG H&L (HRP) ab6921.

DETAILED DESCRIPTION OF THE INVENTION

Brief Description of the Sequences

(26) SEQ ID NO: 1 is the amino acid sequence of the IgdE isolated from S. suis strain 10. Additional amino acid sequences of IgdEs from S. suis can be found e.g. in GenBank as accession nos WP_012027720.1, WP_044687717.1, WP_045002893.1, WP_044981166.1, WP_044770432.1, WP_043041527.1, WP_014917307.1, WP_044981141.1, WP_044766031.1, WP_044780628.1, WP_044980481.1, WP_044768304.1, WP_043033176.1, WP_044772573.1, ABQ42883.1, ABQ42882.1, ABQ42884.1, ABQ42885.1, WP_024402604.1, WP_044671803.1, WP_014639000.1, WP_014636499.1, WP_044475270.1, WP_044683049.1, WP_044682603.1, WP_044982674.1, WP_024406212.1, WP_024402376.1, WP_024382860.1, WP_044684005.1, WP_044688055.1, WP_044754153.1, WP_024412941.1, WP_029172805.1, AER15932.1, WP_024414493.1, WP_044762560.1, WP_024417771.1, WP_044675281.1, WP_044666819.1, WP_043032980.1, WP_044671755.1, WP_024416363.1, ABL84354.1, ABL84413.1, WP_044758899.1, WP_024393919.1, WP_014736321.1, WP_024383620.1, WP_044475488.1, WP_024386700.1, WP_024381951.1, WP_024390579.1, WP_023371419.1, WP_044772576.1, WP_044766774.1, WP_044672596.1, WP_043028752.1, WP_044771508.1, WP_024383851.1, WP_024388957.1, WP_024394959.1, WP_029174632.1, WP_044752120.1, WP_044678077.1, WP_002938262.1, WP_044769991.1, WP_044770681.1, WP_044749736.1, and WP_044771392.1.

(27) SEQ ID NO: 2 is a nucleic acid sequence encoding IgdE isolated from S. suis strain 10.

(28) SEQ ID NO: 3 is the amino acid sequence of an IgdE isolated from S. agalactiae strain CCUG4208. Additional amino acid sequences of IgdEs from S. agalactiae can be found e.g. in GenBank as accession nos EPU21342.1, EFV98161.1, CAD47554.1, EPU23939.1, EPW71972.1, EPT99261.1, EPV90329.1, EGS26825.1, EPV84888.1, CFQ52811.1, EPT84780.1, EPT99074.1, CCW42936.1, CCW40848.1, EAO70450.1, EPU74838.1, EPT51236.1, EPU77761.1, EPT36280.1, WP_011058381.1, EPT59860.1, EPT39170.1, EPT38734.1, CFQ25568.1, EPU40877.1, WP_025193619.1, WP_000440329.1, WP_000440333.1, WP_000440330.1, WP_000440331.1, WP_047199154.1, WP001901206.1, WP_025193273.1, WP_025194923.1, WP_000440334.1, WP_025195559.1, WP_047200043.1, WP_041165773.1, EPU33307.1, CFW66620.1, WP_041981191.1, WP_000440332.1, WP_047200261.1, WP_029692083.1, WP_017770870.1, WP_025197885.1, EAO75153.1, WP_001884472.1, EAO62452.1, WP_025195776.1, WP_047200280.1, CFW66618.1, and EAO75155.1.

(29) SEQ ID NO: 4 is a nucleic acid sequence encoding IgdE isolated from S. agalactiae strain CCUG4208.

(30) SEQ ID NO: 5 is the amino acid sequence of the IgdE isolated from S. porcinus strain DSM20725. The amino acid sequences of IgdE from S. porcinus can be found e.g. in GenBank as accession no WP_003085269.1

(31) SEQ ID NO: 6 is a nucleic acid sequence encoding IgdE isolated from S. porcinus strain DSM20725.

(32) SEQ ID NO: 7 is the amino acid sequence of the IgdE isolated from S. equi strain ssp zooepidemicus #1. Additional amino acid sequences of IgdEs from S. equi can be found e.g. in GenBank as accession nos. KDE01980.1, KIS07668.1, KIS08707.1, KIS19971.1, WP_043038795.1, WP_043036602.1, WP_037584076.1, KIS20896.1, AIA68804.1, WP_043029522.1, WP_012678259.1, WP_042670323.1, WP_043040324.1, and WP_014622546.1.

(33) SEQ ID NO: 8 is a nucleic acid sequence encoding IgdE isolated from S. equi strain ssp zooepidemicus #1.

(34) SEQ ID NO: 9 is the amino acid sequence of the IgdE isolated from S. pseudoporcinus strain ATCC? BAA-1381. The amino acid sequences of IgdE from S. pseudoporcinus can be found e.g. in GenBank as accession no WP_007895676.1.

(35) SEQ ID NO: 10 is a nucleic acid sequence encoding IgdE isolated from S. pseudoporcinus strain ATCC BAA-1381.

(36) SEQ ID NO: 11 is the amino acid sequence of a C-terminally truncated variant of IgdE isolated from S. suis.

(37) IgdE Polypeptides

(38) The IgdE polypeptide according to the present invention is preferably an IgdE.sub.suis, IgdE.sub.agalactiae, IgdE.sub.porcinus, IgdE.sub.equi, or an IgdE.sub.pseudoporcinus polypeptide, or a variant or fragment of any thereof which retains cysteine protease activity and/or is capable to raise an immune response to a streptococcus in a subject. The variant may be an IgdE polypeptide from another bacterium. The bacterium is preferably a Streptococcus.

(39) The IgdE polypeptide may comprise the amino acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11; or a variant of any one thereof having at least 70% identity to the amino acid sequence of any of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 and having IgG degrading cysteine protease activity; or a fragment of SEQ ID NOs: 1, 3, 5, 7, 9, 11; or a variant of any one thereof having IgG degrading cysteine protease activity.

(40) The IgdE polypeptide may comprise the amino acid sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11; or a variant of any one thereof having at least 70% identity to the amino acid sequence of any of SEQ ID NOs: 1, 3, 5 7, 9, or 11 and being capable to raise an immune response to a streptococcus in a subject; or a fragment of SEQ ID NOs: 1, 3, 5, 7, 9, 11; or a variant of any one thereof being capable to raise an immune response to a streptococcus in a subject.

(41) The streptococcus can be S. suis, S. agalactiae, S. porcinus, S. equi, or S. pseudoporcinus.

(42) Preferably, the polypeptide comprises, or consists of, any of the sequences of SEQ ID NOs: 1, 3, 5, 7, 9, or 11.

(43) The polypeptide may additionally include a signal sequence or a N-terminal methionine.

(44) Variant polypeptides are those for which the amino acid sequence varies from that in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 respectively, but which retain the same essential character or basic functionality as IgdE. The variant polypeptides may therefore display IgG degrading cysteine protease activity, and/or be capable of raising an immune response to a streptococcus in a subject. Preferably the immune response is a protective immune response. Preferably the immune response generates antibodies able to neutralize the IgG degrading cysteine protease activity of the IgdE of an infectious streptococcus in the immunized subject. Notably, an IgdE variant lacking the IgG cysteine protease activity can still be able to raise an immune response generating antibodies being able to neutralize the IgG cysteine protease activity of the IgdE of an infectious streptococcus in the immunized subject. Such IgdE variants are included in the IgdE variants according to the invention.

(45) Typically, polypeptides with more than about 70% identity, preferably at least 80%, at least 90% and particularly preferably at least 95%, at least 97% or at least 99% identity, with the amino acid sequence of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 are considered variants of the protein. Such variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids within the protein sequence, as long as the peptide maintains the basic IgdE functionality. The identity of variants of SEQ ID NOs: 1, 3, 5, 7, 9, or 11 may be measured over a region of at least 50, at least 75, at least 100, at least 150, at least 200, at least 250, at least 275, at least 300 or more contiguous amino acids of the sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11, or more preferably over the full length of SEQ ID NOs: 1, 3, 5, 7, 9, or 11. It will be appreciated that any of the above listed lower limits may be combined with any of the above listed upper limits to provide a range for the length of the polypeptide of the invention. For example, the polypeptide may be 50 to 250 amino acids in length, or 100 to 300 amino acids in length. The polypeptide may be 100 to 586 amino acids in length, 150 to 500 amino acids in length or 100 to 400 amino acids in length.

(46) Amino acid identity may be calculated using any suitable algorithm. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al. (1984) Nucleic Acids Research 12, 387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al. (1990) J Mol Biol 215:403-10.

(47) Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al., supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. ScL USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.

(48) The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two polynucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

(49) The variant sequences typically differ by at least 1, 2, 5, 10, 20, 30, 50 or more amino acids positions (which maybe substitutions, deletions or insertions of amino acids). For example, from 1 to 50, 2 to 30, 3 to 20 or 5 to 10 amino acid substitutions, deletions or insertions may be made. The substitutions are preferably conservative substitutions, for example according to the following Table 1. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

(50) TABLE-US-00001 TABLE1 ALIPHATIC Non-polar GlyAlaPro IleLeuVal Polar-uncharged CysSerThrMet AsnGln Polar-charged AspGlu LysArg AROMATIC HisPheTrpTyr

(51) Unless otherwise specified, the modifications are preferably conservative amino acid substitutions. Conservative substitutions replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side-chain volume. The amino acids introduced may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge to the amino acids they replace. Alternatively, the conservative substitution may introduce another amino acid that is aromatic or aliphatic in the place of a pre-existing aromatic or aliphatic amino acid. Conservative amino acid changes are well-known in the art and may be selected in accordance with the properties of the 20 main amino acids as defined in Table A1 below. Where amino acids have similar polarity, this can be determined by reference to the hydropathy scale for amino acid side chains in Table A2.

(52) TABLE-US-00002 TABLE A1 Chemical properties of amino acids Ala (A) aliphatic, hydrophobic, neutral Cys (C) polar, hydrophobic, neutral Asp (D) polar, hydrophilic, charged (?) Glu (E) polar, hydrophilic, charged (?) Phe (F) aromatic, hydrophobic, neutral Gly (G) aliphatic, neutral His (H) aromatic, polar, hydrophilic, charged (+) Ile (I) aliphatic, hydrophobic, neutral Lys (K) polar, hydrophilic, charged(+) Leu (L) aliphatic, hydrophobic, neutral Met hydrophobic, neutral (M) Asn polar, hydrophilic, neutral (N) Pro (P) hydrophobic, neutral Gln (Q) polar, hydrophilic, neutral Arg (R) polar, hydrophilic, charged (+) Ser (S) polar, hydrophilic, neutral Thr (T) polar, hydrophilic, neutral Val (V) aliphatic, hydrophobic, neutral Trp aromatic, hydrophobic, neutral (W) Tyr (Y) aromatic, polar, hydrophobic

(53) TABLE-US-00003 TABLE A2 Hydropathy scale Side Chain Hydropathy Ile 4.5 Val 4.2 Leu 3.8 Phe 2.8 Cys 2.5 Met 1.9 Ala 1.8 Gly ?0.4 Thr ?0.7 Ser ?0.8 Trp ?0.9 Tyr ?1.3 Pro ?1.6 His ?3.2 Glu ?3.5 Gln ?3.5 Asp ?3.5 Asn ?3.5 Lys ?3.9 Arg ?4.5

(54) Preferably the polypeptides comprise a cysteine residue and a histidine residue at a spacing typically found in cysteine proteases. For example, in SEQ ID NO: 1, these residues are found at position 302 and position 333. An aspartic acid residue completing the catalytic triad is found at position 348.

(55) The fragment of the IgdE polypeptide used in the invention is typically at least 10, for example at least 15, 20, 25, 30, 40, 50 or more amino acids in length, up to 100, 150, 200, 250 or 300 amino acids in length, as long as it retains the IgG degrading cysteine protease activity of IgdE and/or being capable of raising an immune response to a streptococcus in a subject.

(56) The polypeptides used in the invention may be chemically modified, e.g. post-translationally modified. For example, they may be glycosylated, phosphorylated or comprise modified amino acid residues. They may be modified by the addition of histidine residues to assist their purification or by the addition of a signal sequence to promote insertion into the cell membrane. Such modified polypeptides fall within the scope of the term polypeptide used herein.

(57) Typically, polypeptides for use in accordance with the invention display immunoglobulin cysteine protease activity, and in particular IgG degrading cysteine protease activity. Preferably, the polypeptide cleaves IgG in the hinge region and more particularly in the hinge region of the heavy chain. Preferably, cleavage results in production of Fc and Fab fragments of IgG. Preferably the activity is specific for IgG. The IgG degrading cysteine protease activity may be determined by means of a suitable assay. For example, a test polypeptide may be incubated with IgG at a suitable temperature, such as 37? C. The starting materials and the reaction products may then be analysed by SDS PAGE to determine whether the desired IgG cleavage product is present. Typically this cleavage product is a 32 kDa fragment. Typically there is no further degradation of IgG after this first cleavage. The cleavage product may be subjected to N-terminal sequencing to verify that cleavage has occurred in the hinge region of IgG.

(58) The cysteine protease activity of the polypeptides can be further characterised by inhibition studies. Preferably, the activity is inhibited by the peptide derivate Z-LVG-CHN2, and/or by iodoacetic acid which are protease inhibitors.

(59) The IgG degrading cysteine protease activity of the polypeptides is generally IgG-specific in that the polypeptides may not degrade other classes of Ig, namely IgM, and IgA, when incubated with these immunoglobulins under conditions that permit cleavage of IgG. IgdE from S. suis, S. porcinus, and S. pseudoporcinus were found to be specific for porcine IgG. IgdE from S. agalactiae was found to be specific for human IgG, and specifically human IgG1. IgdE from S. equi was found to be specific for equine IgG, and specifically equine IgG7.

(60) Polypeptides for use in the invention may be in a substantially isolated form. It will be understood that the polypeptide may be mixed with carriers or diluents which will not interfere with the intended purpose of the polypeptide and still be regarded as substantially isolated. A polypeptide for use in the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 50%, e.g. more than 80%, 90%, 95% or 99%, by weight of the polypeptide in the preparation is a polypeptide of the invention.

(61) Polypeptides for use in the present invention may be isolated from any suitable organism that expresses an IgdE polypeptide. Typically, the IgdE polypeptide is isolated from suitable IgdE expressing streptococcal strains. Suitable organisms and strains may be identified by a number of techniques. For example, streptococcal strains may initially be tested for the presence an igdE gene. Polynucleotide primers or probes may be designed based on for example, SEQ ID NOs: 2, 4, 6, 8, or 10. Examples of suitable primers are set out in SEQ ID NOs: 12-22. The presence of the igdE gene can then be verified by PCR using the primers or by hybridisation of the probes to genomic DNA of the strain.

(62) Polynucleotides

(63) A polynucleotide according to the invention may comprise or consist of: (a) the coding sequence of SEQ ID NOs: 4, 5, 6, 8, or 10; (b) a sequence which is degenerate as a result of the genetic code to the sequence as defined in (a); (c) a sequence having at least 70% identity to a sequence as defined in (a) or (b) and which encodes a polypeptide having IgG degrading cysteine protease activity and/or be capable of raising an immune response to a streptococcus in a subject; or (d) a fragment of any one of the sequences as defined in (a), (b) or (c) which encodes a polypeptide having IgG degrading cysteine protease activity and/or be capable of raising an immune response to a streptococcus in a subject.

(64) Typically the polynucleotide is DNA. However, the polynucleotide may be a RNA polynucleotide. The polynucleotide may be single or double stranded, and may include within it synthetic or modified nucleotides. A polynucleotide of the invention can typically hybridize to the coding sequence or the complement of the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 at a level significantly above background. Background hybridization may occur, for example, because of other DNAs present in a DNA library. The signal level generated by the interaction between a polynucleotide of the invention and the coding sequence or complement of the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with .sup.32P. Selective hybridisation may typically be achieved using conditions of medium to high stringency. However, such hybridisation may be carried out under any suitable conditions known in the art (see Sambrook et al., Molecular Cloning: A Laboratory Manual, 1989). For example, if high stringency is required suitable conditions include from 0.1 to 0.2?SSC at 60? C. up to 65? C. If lower stringency is required suitable conditions include 2?SSC at 60? C.

(65) The coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 may be modified by nucleotide substitutions, for example from 1, 2 or 3 to 10, 25, 50 or 100 substitutions. The polynucleotide of SEQ ID NO: 2, 4, 6, 8, 10 may alternatively or additionally be modified by one or more insertions and/or deletions and/or by an extension at either or both ends. Additional sequences such as signal sequences may also be included. The modified polynucleotide generally encodes a polypeptide which has IgdE specific cysteine protease activity and/or is capable of raising an immune response to a streptococcus in a subject. Degenerate substitutions may be made and/or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated, for example as shown in the Table 1 above.

(66) A nucleotide sequence which is capable of selectively hybridizing to the complement of the DNA coding sequence of SEQ ID NOs: 2, 4, 6, 8, or 10 will generally have at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the coding sequence of SEQ ID NO: 2, 4, 6, 8, or 10 respectively, over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO: 2, 4, 6, 8, or 10. Sequence identity may be determined by any suitable method, for example as described above.

(67) Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define polynucleotides of the invention, with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred. Thus, for example a polynucleotide which has at least 90% sequence identity over 20, preferably over 30 nucleotides forms one aspect of the invention, as does a polynucleotide which has at least 95% sequence identity over 40 nucleotides. Polynucleotide fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. Fragments can be longer than 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700, 800, 900 or 1000 nucleotides in length, or even up to a few nucleotides, such as five, ten or fifteen nucleotides, short of the coding sequence of SEQ ID NO: 2, 4, 6, 8, or 10 respectively.

(68) Polynucleotides for use in the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. The polynucleotides are typically provided in isolated and/or purified form.

(69) In general, short polynucleotides will be produced by synthetic means, involving a stepwise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.

(70) Longer polynucleotides will generally be produced using recombinant means, for example using PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e.g. of about 15-30 nucleotides) to a region of the igdE gene which it is desired to clone, bringing the primers into contact with DNA obtained from a bacterial cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA. The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector. Suitable primers are for example, those in SEQ ID NOs: 12-22.

(71) Such techniques may be used to obtain all or part of the igdE gene sequence described herein. Although in general the techniques mentioned herein are well known in the art, reference may be made in particular to Sambrook et al. (1989). IgdE polynucleotides as described herein have utility in production of the polypeptides for use in the present invention, which may take place in vitro, in vivo or ex vivo. The polynucleotides may be used as therapeutic agents in their own right or may be involved in recombinant protein synthesis.

(72) The polynucleotides for use in the invention are typically incorporated into a recombinant replicable vector. The vector may be used to replicate the nucleic acid in a compatible host cell. Therefore, polynucleotides for use in the invention may be made by introducing an IgdE polynucleotide into a replicable vector, introducing the vector into a compatible host cell and growing the host cell under conditions which bring about replication of the vector.

(73) Preferably the vector is an expression vector comprising a nucleic acid sequence that encodes an IgdE polypeptide. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals, which may be necessary and which are positioned in the correct orientation in order to allow for protein expression. Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al. (1989).

(74) Preferably, a polynucleotide for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The term operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence, such as a promoter, operably linked to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.

(75) The vectors may be for example, plasmid, virus or phage vectors provided with a origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vector is typically adapted to be used in vivo.

(76) Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed. Mammalian promoters, such as (3-actin promoters, may be used. Tissue-specific promoters are especially preferred. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR). Viral promoters are readily available in the art. The vector may further include sequences flanking the polynucleotide giving rise to polynucleotides which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of eukaryotic cells by homologous recombination. In particular, a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell. Other examples of suitable viral vectors include herpes simplex viral vectors and retroviruses, including lentiviruses, adenoviruses, adeno-associated viruses and HPV viruses. Gene transfer techniques using these viruses are known to those skilled in the art. Retrovirus vectors for example may be used to stably integrate the polynucleotide giving rise to the polynucleotide into the host genome. Replication-defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.

(77) Diseases and Conditions

(78) The IgdE polypeptide, or polynucleotide, may be used to treat or prevent diseases or conditions mediated by pathogenic IgG antibodies. It is well known in the art that pathogenic IgG antibodies are involved in the pathogenesis of a number of different diseases and conditions. Consequently, the effects of pathogenic IgG antibodies in such diseases can be inhibited using an IgdE polypeptide or polynucleotide.

(79) The disease or condition can be an autoimmune disease. Such diseases include Addison's disease, alopecia areata, ankylosing spondilitis, antiphospho lipid syndrome, aplastic anaemia, autoimmune gastritis, autoimmune hearing loss, autoimmune haemolytic anaemias, autoimmune hepatitis, autoimmune hypoparathyroidism, autoimmune hypophysitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune polyendocrinopathy, Bechet's disease, bullous pemphigoid, cardiomyopathy, chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, coeliac disease, Crohn's disease, CREST syndrome, Degos disease, epidermolysis bullosa acquisita, essential mixed cryoglobulinaemia, giant cells arteritis, glomerulonephritis, Goodpasture's syndrome, Graves' disease, Guillan-Barre syndrome, Hashimoto's thyroiditis, idiopathic thrombocytopenic purpura, inflammatory bowel disease, Kawasaki's disease, Meniere's syndrome, mixed connective tissue disease, Mooren's ulcer, multiple sclerosis, myasthenia gravis, pemphigus foliaceous, pemphigus vulgaris, pernicious anaemia, polyarteritis nodosa, polyglandular autoimmune syndrome type 1 (PAS-I), polyglandular autoimmune syndrome type 2 (PAS-2), polyglandular autoimmune syndrome type 3 (PAS-3), polymyositis/dermatomyositis, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's syndrome, Reiter's syndrome, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, subacute thyroiditis, sympathetic opthalmia, systemic lupus erythematosus, Takayasu's arteritis, type 1 diabetes mellitus, vitiligo, Vogt-Koyanagi-Harada disease or Wegener's granulomatosis. Preferably the autoimmune disease is rheumatoid arthritis (RA).

(80) The disease or condition can be asthma. The asthma can be acute or chronic asthma.

(81) IgG activates the classical pathway of the complement system. IgdE polypeptides and polynucleotides can therefore be used to treat diseases and conditions where complement activation is detrimental to the patient. For example, the IgdE polypeptides and polynucleotides can be used to treat transplantation-derived disorders, for example transplant rejection (such as allograft and xenograft rejection) and graft-versus-host disease. The transplantation-derived disorder may occur due to the transplantation of a tissue or an organ in a patient.

(82) IgdE polypeptides and polynucleotides are also of use in post-operative treatment, for example in the treatment of patients who have undergone heart by-pass operations.

(83) Further, IgdE polypeptides and polynucleotides can be used for the treatment of acquired haemophilia, i.e to remove IgG in haemophilia patients who have developed autoantibodies against coagulation factors.

(84) The term a subject as used herein includes any mammalian subject such as a human, a pig, a horse, and any cattle.

(85) In Vitro Methods

(86) The invention encompasses in vitro methods for the cleavage of IgG, comprising contacting IgG with a polypeptide comprising: (a) the amino acid sequence of SEQ ID NO: 1, 3, 5, 7, 9 or 11; (b) a variant thereof having at least 70% identity to the amino acid sequence of SEQ ID NO: 1, 3, 5, 7, 9 or 11 and having IgG cysteine protease activity; or (c) a fragment thereof of either (a) or (b), having IgG cysteine protease activity.

(87) In a preferred embodiment, the amino acid sequence is SEQ ID NO: 3. The in vitro method for the cleavage of IgG comprises contacting IgG with a polypeptide comprising:

(88) (a) the amino acid sequence of SEQ ID NO: 3;

(89) (b) a variant of SEQ ID NO: 3 having at least 70% identity to the amino acid sequence of SEQ ID NO: 3 and having IgG cysteine protease activity;

(90) (c) a fragment of SEQ ID NO: 3 or a fragment of a variant of SEQ ID NO: 3, having IgG cysteine protease activity.

(91) In the preferred embodiment, the polypeptide is specific for human IgG, and specifically human IgG1. Furthermore, the polypeptide cleaves IgG1 as shown in FIG. 4, irrespective of whether the light chain is kappa or lambda type.

(92) The polypeptide is an IgG cysteine protease, which may typically comprise a catalytic site including a cysteine residue, a histidine residue and an aspartic acid residue in positions which correspond to positions 265, 296 and 311 of SEQ ID NO: 1. For example, in SEQ ID NO:3 a cysteine residue, histidine residue and an aspartic acid residue are found at positions 262, 293 and 308. The variants and fragments of the polypeptide typically retain these residues.

(93) The method of the present invention comprises incubating the polypeptide with a sample containing IgG under conditions which permit specific cysteine protease activity to occur. The method further comprises identification and/or isolation of the cleavage products. The analysis may be by any suitable method known in the art. In some instances, the analysis is by gel electrophoresis (e.g. SDS-PAGE) or mass spectrometry.

(94) In another embodiment of the present invention, the in vitro method is used to generate Fc or Fab fragments of IgG. The method comprises contacting IgG with a polypeptide of the invention.

(95) In a further embodiment of the invention, the method of the invention is used to detect IgG. This may comprise (i) contacting a sample with a polypeptide under conditions that permit the IgG specific cysteine protease activity of the polypeptide; and (ii) monitoring for the presence of IgG specific cleavage fragments; wherein the presence of the specific cleavage fragments is indicative of IgG in the sample.

EXAMPLES

Example 1. Identification if IgdE from S. suis

(96) Bacterial Strains and Growth Conditions

(97) S. suis strain 10 is a virulent serotype 2 strain that has been used in several studies for mutagenesis and experimental infections of pigs (Smith et al. 1999. Infect. Immun. 67, 1750-1756). Strain 10M7 was kindly provided by Hilde Smith (AWG, Lelystad, Netherlands) (Smith et al. 1996. Infect. Immun. 64, 4409-4412). Streptococci were grown on Columbia agar plates with 6% sheep blood or in Bacto Todd-Hewitt broth (THB) under anaerobic conditions at 37? C. Escherichia coli strains were cultured in Luria Broth (LB). When appropriate, antibiotics were added at 50 ?g/ml for kanamycin and 20 ?g/ml for gentamycin.

(98) Materials from Animals

(99) Samples from experimentally infected piglets were drawn within a previous study. The protocol for this animal experiment was approved by the Committee on Animal Experiments of the Lower Saxonian State Office for Consumer Protection and Food Safety in Germany (permit no. 33.9-42502-04-07/1243). Collection of blood from conventional piglets for bactericidal assays was registered under N19/14 at the regional office in Saxonia, Germany. The animal studies were performed in strict accordance with the principles and recommendations outlined in the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes (European Treaty Series, no. 123: http://www.conventions.coe.int/Treaty/en/Treaties/Html/123.htm) and the German Animal Protection Law.

(100) Identification of the IgG Degrading Activity

(101) S. suis strain 10M7 cultures were harvested at approximately OD.sub.600 of ?0.6 and culture supernatants were sterile-filtrated through a 0.22 ?M Express PLUS membrane filter (Millipore) prior to fractionating the culture supernatant with ammonium sulfate to 30% saturation. The resulting precipitate was discarded and ammonium sulfate was added to the remaining supernatant to a final concentration of 50% saturation. The second precipitate was resuspended in 1/100 of the starting volume with 20 mM Bis-Tris pH 6.8 and buffer exchange against the same buffer was performed by HiPrep 26/10 Desalting column (GE Healthcare). The material was further fractionated by FPLC on a HiTrap Q HP column (GE Healthcare). Proteins were eluted by a linear NaCl gradient, and fractions eluted at ?0.2 M NaCl were found to contain the IgG degrading activity. The active fractions were subjected to size exclusion chromatography (HiPrep 16/60 Sephacryl S-100 HR, GE Healthcare) and there the IgG degrading activity was eluted at ?37 ml elution volume. Active fractions were analyzed by SDS-PAGE and protein bands were subjected to Mass spectrometry analysis.

(102) Mass Spectroscopy

(103) MALDI-TOF mass spectroscopy was performed by Umea Protein Analysis Facility (Umea University). Peptides for MS analysis were prepared by in-gel digestion using trypsin (sequencing grade modified, Promega) and analyzed by ESI LC-MS/MS using an HCT ultra ETD II iontrap instrument (Bruker) linked to an Easy nano LC system (Proxeon). Processing, deconvolution and compound detection for the LC-MS/MS datasets was performed using the DataAnalysis software (4.0 SP4, Bruker). Database searches using the peaklists files of the processed datasets were performed using the Mascot search engine (Matrixscience) in the bacterial sequences of the NCBInr database. The search parameters permitted a mass error of 0.3 Da for both the MS and the MS/MS mode and variable modifications of methionine by oxidation, of cysteine by propionamide derivation and by N-terminal acetylation.

(104) Screening of S. suis Strains for IgG Degrading Capacity

(105) Culture supernatants of 15 different S. suis strains (Table 2) were isolated at OD.sub.600 of ?0.6 and concentrated by addition of saturated ammonium sulfate solution to a final saturation of 50%. The precipitate was re-suspended in 1/20 of the starting volume in PBS following buffer exchange against PBS by Zeba Spin Desalting Columns 7K MWCO (Thermo Scientific). The 50% ammonium sulfate precipitation fraction of S. suis culture supernatants were used for IgG degradation analysis.

(106) TABLE-US-00004 TABLE 2 S. suis strains used in this study Strain Capsule type Source (Reference) 10 cps 2 Smith et al. 1999. Infect. Immun. 67, 1750-1756 A1731/94 cps 1 Allgaier et al. 2001. J Clin Microbiol. 39, 445-453 P1/7 cps 2 Jacobs et al. 1994. Infect. Immun. 62, 1742-1748 T15 cps 2 Smith et al. 1999. Infect. Immun. 67, 1750-1756 19841/1 cps 2 Allgaier ibid 199 cps 2 (human) Baums et al. 2007. Appl. Environ. Microbiol. 73, 711-717 MAC724 cps 2 (human) Baums ibid B2795/96 cps 7 Allgaier ibid B2441/96 cps 2 Allgaier ibid A5505/93 untypeable Allgaier ibid V2569/1 cps 5 Baums, unpublished #451 cps 7 Unterweger et al. 2014. Berl. M?nch Tierarztl. Wochenschr. 127, 194-201 V3667/1 cps 7 Baums, unpublished A5683/94 cps 9 Allgaier ibid A3286/94 cps 9 Allgaier ibid 5223 cps 14 Wisselink et al. 2002. J. Clin. Microbiol. 40, 2922-2929 10M7 cps 2 Smith et al. 1996. Infect. Immun. 64, 4409-4412 10 ?ideSsuis cps 2 Seele et al. 2013 J. Bacteria 195, 930-940 10 ?igdE cps 2 this application 10 ?ideSsuis cps 2 this application ?igdE 5223 cps 14 Wisselink ibid
Generation of a ?igdE Deletion Strain

(107) In frame deletion of igdE was principally conducted as in Seele et al., 2013 (J. Bacteriol. 195, 930-940) with S. suis strain 10. For construction of the thermosensitive vector pSET5_?igdE a 618 bp 5-igdE amplicon was generated with primers preProIgdEPstI (TCACTGCAGTTTTGGGGAGTAGG, SEQ ID NO: 12) and postSSIgdEBamHI (ATGGATCCCAGTTCAGAACCTC, SEQ ID NO: 13) and a 612 bp 3-igdE amplicon was generated with primers preEndIgdEBamHI (CGGGATCCAGAGAAAAAAGAGATCC, SEQ ID NO:14) and postEndIgdEEcoRI (AGGAATTCACCGTTATTGTAGCG, SEQ ID NO:15). These amplicons were cloned into pSET5 (18) with the restriction enzymes indicated in the names of the primers to generate pSET5_?igdE. Deletion clones were confirmed by selective PCR analysis and sequencing of genomic amplicons using primers IgdE-seq_frw (ATTGTATTTGGTGGAGGAG, SEQ ID NO:16) and IgdE-seq_rev (TTTAGCAGCTAAGTTGATACC, SEQ ID NO:17).

(108) Sequence Analysis

(109) Sequence analyses were performed using the SIB Bioinformatics Resource Portal Expasy (www.expasy.ch). SignalP 4.0 was run to identify a putative signal peptide and the respective cleavage sites (www.cbs.dtu.dk/services/SignalP/). In silico modelling of S. suis IgdE to identify the potential active site residues was performed using SWISS-MODEL (http://swissmodel.expasy.org/). A putative transmembrane region was identified using the consensus prediction web server TOPCONS (htp://topcons.cbr.su.se/) last accession 2015-11-06.

(110) DNA Techniques and Primer Sequences

(111) Primers were designed based on gene SSU_RS08150 in the genome S. suis P1/7. All PCRs were conducted with Phusion Master Mix HF (Thermo Scientific). All obtained plasmids were checked by restriction analyses, PCR and sequencing.

(112) Cloning of S. suis igdE and Generation of IgdE Mutants

(113) The S. suis igdE gene lacking the signal peptide coding sequences (encoding amino acid 38-1121) was amplified from chromosomal DNA of S. suis strain 10 as template using primers IgdE-frw_NcoI (GTTTCCATGGATGAAAACTCACATTTACAATCG, SEQ ID NO:18) and IgdE-rev_NotI (ACGTGCGGCCGCATAAGCTTCGTAC, SEQ ID NO:19) and cloned into pET_ZZ_1a after digestion with NcoI and NotI (Thermo Scientific). The entire insert was sequenced to verify the cloning and the sequence of S. suis igdE. The obtained sequence of S. suis strain 10 igdE was identical to the one of S. suis 05ZYH33 and contained an insertion of 32 amino acids compared to SSU_RS08150 of S. suis P1/7.

(114) Directed mutagenesis of the putative active site residues C302 to S, H333 to A, and D348 to A were performed with QuickChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies) and primers IgdE-C302S (AACGTCAGAAAGCGATGAGTGTAGGTTTCAGCACT, SEQ ID NO:20), IgdE-H333A (CAGAAGGTGTCCCGGCTGCTACAGCGCGTG, SEQ ID NO:21) and IgdE-D348A (TAAAAAGTGGCACACCATTGCCGGTACAGGTTTTATTACAG, SEQ ID NO:22) according to the manufacturer's instructions.

(115) IgdE.sup.?C, consisting of the N-terminal 470 amino acids of S. suis IgdE was created by digesting full-length igdE in pZZ1a with restriction endonucleases XhoI (Thermo Scientific). The digested plasmids were purified, re-ligated and transformed into E. coli.

(116) Expression and Purification of Recombinant S. suis IgdE

(117) E. coli ArcticExpress (DE3)_RIL (Agilent Technologies) isolates carrying pET_ZZ_1a igdE, igdE.sup.C302S, igdEH.sup.302A, igdE.sup.D302A or igdE.sup.?C were grown to OD.sub.600 0.6 at 30? C. Protein expression was induced with 1 mM IPTG at 12? C. and incubation was continued for an additional 22 h.

(118) Cells were lysed for crude extracts by BugBuster HT Protein Extraction Reagent (Novagen) or for purification by Stansted high pressure cell disrupter (Stansted Fluid Power) in 50 mM Bis-Tris pH 7, 0.5 M NaCl, 5% glycerol, 40 ?M imidazole. The His-ZZ-tagged protein was purified on HisTrap FF (GE healthcare) using standard protocols. The tag was removed by enzymatic cleavage by Tev-protease for 20 h at 5? C. followed by a second round of purification on HisTrap FT. The flow through, containing untagged rIgdE, was collected. Recombinant IgdE.sup.?C was purified as described above with higher yields and purity compared to full-length rIgdE.

(119) Qualitative IgG Degradation Analyses

(120) To monitor IgG cleavage activity in concentrated and fractionated culture supernatants, samples were incubated with 1% porcine plasma in PBS for 16 h at 37? C. prior to Western blot analyses.

(121) To identify the catalytic type of the IgG protease, the IgG degradation reaction was performed in the presence of 0.1-5 mM AEBSF (Sigma), 0.1-5 mM EDTA, 50-250 ?M E-64 (Sigma), 0.1-5 mM Z-LVG-CHN.sub.2 (Bachem), 0.1-5 mM Iodoacetamide (Sigma) or 1/200 to 1/50 dilution of complete protease inhibitor cocktail (Roche).

(122) 0.5 mg/ml of porcine IgG (Sigma) in PBS or of other species (human, goat, cow, horse and mouse; all Sigma) were incubated with either crude extracts of induced E. coli carrying S. suis IgdE constructs mentioned above or 10 nM purified rIgdE for 16 h at 37? C. prior subjection to SDS-PAGE under either reducing or non-reducing conditions.

(123) To analyze degradation of endogenous IgG in porcine body fluids following dilutions were used: 1/10 for heart sac fluid, abdominal cavity fluid and joint fluid; 1/50 for serum; undiluted for cerebrospinal fluid. Cerebrospinal and joint fluids were either from piglets with fibrino-suppurative meningitis and synovialitis caused by S. suis infection or from piglets with no lesions. Otherwise IgG degradation analyses were conducted as mentioned above with purified rIgdE and analyzed by both SDS-PAGE and western blot analyses. Experiments were repeated at least three times and representative analyses are shown.

(124) Quantitative IgG Degradation Analyses

(125) For time course analyses and inhibitor profiles the IgG degradation reaction was performed with 0.25 mg/ml porcine IgG and 2 ?M purified IgdE.sup.?C at 37? C. in PBS uninhibited or in the presence of 2.5 ?M or 250 aM AEBSF (Sigma), EDTA, E-64 (Sigma), lodoacetamide (Sigma), or Z-LVG-CHN.sub.2 (Bachem). DMSO (Sigma) at 0.275%, corresponding to the DMSO content in 250 lM Z-LVG-CHN.sub.2, was used as a solvent control. The reactions were continuously sampled and subjected to SDS-PAGE under reducing conditions. Protein bands were detected by staining with Coomassie Fluor? Orange Protein Gel Stain (Invitrogen). The IgG degradation product was densitometrical quantified by imaging with LAS4000 imaging system (Fujifilm) and analyzed with Image Studio Version 3.1 (LI-COR Biosciences) software. Uninhibited over-night cleavage was set as 100% relative cleavage for the time course experiment. For the inhibitor profile the initial cleavage rate was calculated from the initial increase of cleavage product (0-25% relative cleavage) and the initial cleavage rate of the uninhibited reaction was set as 100% relative activity. Experiments were at least performed in triplicates. Statistical analyses were performed using GraphPad Prism Version 5.0.

(126) SDS-PAGE and Western Blot Analyses

(127) Samples for SDS-PAGE were prepared with either reducing or non-reducing sample buffer and heated to 95? C. for 5 min. 12% SDS-PAGE was either stained with Coomassie blue (Sigma), Coomassie Fluor? Orange Protein Gel Stain (Invitrogen) or blotted to Hybond-P PVDF membrane (GE Healthcare) for western blot analyses. Membranes were blocked with 5% dry milk powder in 0.1% PBS-Tween, followed by incubation with horse-radish peroxidase conjugated antibodies. Goat anti-pig IgG-HRP (Thermo Scientific) and goat anti-porcine IgM-HRP (Thermo Scientific) was diluted 1:25000 and goat anti-porcine IgA-HRP (Thermo Scientific) was diluted 1:12500. Membranes were thoroughly washed with 0.1% PBS-Tween prior to development with Amersham ECL Select Western blotting detection reagent (GE Healthcare) according to manufactures instruction and pictured by LAS4000 imaging system (Fujifilm).

(128) N-Terminal Edman Sequencing

(129) S. suis IgdE processed porcine IgG was separated by SDS-PAGE as previously explained and transferred by semi-dry blotting on Hybond-P PVDF membrane (GE Healthcare) with 50 mM sodium-borate/20% MetOH as blotting buffer. The membrane was stained with Ponceau S (Sigma) and after drying the ?32 kDa degradation product was tightly cut out. N-terminal Edman sequencing of the degradation product was performed by Proteome Factory (Berlin, Germany) and the sequence W/C PICPACE was obtained. The first position sequence determination was complicated due to a likely contamination yielding a strong tryptophan peak and only a minor peak at the cysteine position. However, in BLAST homology searches the sequence indubitable scored porcine IgG hinge region sequences containing a cysteine residue in the corresponding position. Cysteines were identified by signals of propionamide modified cysteine, nevertheless cysteine is not part of the calibration standard.

(130) ELISA

(131) For detection of IgG titers against S. suis IgdE Maxisorb? plates (Nunc) were coated with 0.6 ?g rIgdE protein using carbonate buffer. After coating the plates were washed three times with PBS plus 0.1% Tween 20 (PBST) and blocked with 5% milk powder in PBS for 2 h at 37? C. Every sample and the controls were measured in a duplicate series of four (positive reference serum: six) twofold dilutions in PBST starting with a dilution of 1:100. For the detection of S. suis IgdE specific IgG antibodies the plates were incubated with goat anti-pig IgG-HRP (1 mg/ml, Bethyl, A100-105P) at a dilution of 1:10000 for 1 h at 37? C. All incubation steps at 37? C. were performed on a shaker and after each incubation step the plates were washed with PBST. The plates were developed with 2,2-azino-di-[3-ethylbenzithiazo line sulphonate] (ABTS) and 0.003% H.sub.2O.sub.2 as substrate. Absorbance was measured at 405 nm in a microplate reader (Synergy H1, BioTek Instruments GmbH). Optical densities were converted to antibody concentrations through log linear regression analysis after background subtraction. The ELISA units for each sample were defined as the mean of the calculated units for each of the four dilutions of the two series. ELISA values obtained from a serum sample drawn 20 days after experimental infection with S. suis strain 10 was arbitrary set to 100 ELISA units, while ELISA values from serum samples derived from colostrum deprived piglets were used as negative control.

(132) Results

(133) S. suis Secretes an IgG-Cleaving Enzyme

(134) Proteolytic activities of extracellular enzymes of S. suis were analyzed by incubating concentrated supernatants of S. suis strain 10 and the isogenic IgM protease mutant 10?ide.sub.Ssuis with 2% porcine plasma as putative substrate. After 3 hours of incubation, the reaction was analyzed by reducing SDS-PAGE. Interestingly, the plasma protein band patterns obtained from bacterial culture supernatants of both wild type strain 10 and the isogenic IgM protease mutant 10?ide.sub.Ssuis contained an additional protein band of approximately 32 kDa, which was absent in the porcine plasma control (FIG. 1A). The 32 kDa band was excised, subjected to MALDI-TOF mass spectroscopy and identified as an IgG degradation product showing the presence of an IgG proteolytic activity in S. suis. To confirm this finding and to sustain that the proteolytic activity is due to a secreted enzyme of S. suis, growth supernatant of bacterial cultures was fractionated by adding increasing amounts of ammonium sulfate (0 to 80% saturation). Fractions were tested for IgG cleaving activity with porcine plasma and IgG degradation fragments were detected by Western blot using specific polyclonal anti-porcine IgG antibodies. Precipitates of 20 to 60% ammonium sulfate saturation clearly exhibited IgG-cleaving activity, demonstrating that the observed IgG proteolytic activity is distinct from the recently described IgM protease IdeS.sub.suis(Seele supra) and due to a secreted protein in the culture supernatant of S. suis (FIG. 1B).

(135) Culture supernatant of 15 different S. suis strains, including several strains of the clinical relevant serotype 2; two human isolates of serotype 2, and a set of strains representing additional serotypes (Table 2) were analyzed by Western blot as described above. For all strains an IgG cleavage product of approximately 32 kDa could be detected by Western blot analysis (FIG. 1C), indicating that IgG degradation activity is conserved among different S. suis strains.

(136) Purification and Sequence Characteristics of IgdE, a Novel Protease of S. suis

(137) Prior to a purification trial, protease enriched ammonium sulfate precipitates were tested for IgG cleaving activity in the presence of class specific protease inhibitors to preliminary classify the putative IgG protease. Metallo protease inhibitor EDTA did not affect IgG cleavage, while serine protease inhibitor AEBSF interfered moderately with IgG cleavage. Cysteine protease inhibitors E-64, Z-LVG-CHN.sub.2 and iodoacetamide, however, all appeared to inhibit IgG degrading activity (FIG. 8). Thus, since active site cysteine residues can be inhibited by AEBSF (24, 25), the overall inhibitor profile is most consistent with the assumption that the IgG cleaving protease belongs to the class of cysteine proteases. For purification, strain S. suis 10M7, an isogenic mutant of strain 10, was used to avoid masking of low expressed proteins by the in culture supernatants highly abundant muraminidase-released protein (MRP). Bacterial culture supernatant was fractionated by ammonium sulfate precipitation and precipitates were subjected to anion-exchange chromatography and size exclusion chromatography (SEC). Samples showing IgG cleaving activity were separated by reducing SDS-PAGE. Protein bands were identified by MALDI-TOF mass spectrometry and similarity searches against NCBI databases using a pBLAST algorithm. Since the initial characterization of the IgG proteolytic enzyme indicated that the protease is most likely a secreted cysteine protease, sequences of identified proteins were screened for i) the presence of a cysteine residue within the core of the protein and ii) the presence of a secretion signal peptide. Beside Ide.sub.Ssuis that previously has been shown to be IgM specific two (out often) identified proteins contained a putative catalytic cysteine residue, but only one contained both a signal peptide sequence predicted by the SignalP algorithm and a core cysteine residue. This protein is annotated as a putative exported protein in the genomic sequences database of S. suis serotype 2 strains (www.sanger.ac.uk) and designated SSU_RS08150 in strain P1/7. SSU_RS08150 encodes a 1121 amino acid protein (GenBank accession no WP_012027720) with a putative transglutaminase core sequence motif located in the N-terminal half of the protein within amino acids 188 to 265. The TOPCONS consensus prediction of membrane protein topology identified a putative transmembrane helix in the C-terminal approximately between amino acids 1059-1080. The predicted size of 118 kDa (without signal sequence) is somewhat less than the estimated size of the initially purified protein band after SDS-PAGE (data not shown), which is due to the slightly slower migration of proteins with low pI (pI 4.66) on SDS-PAGE. The full-length putative protein sequence was used in similarity searches against NCBI databases using a pBLAST algorithm. This search revealed no similarities of the full-length protein to any known protease of the MEROPS peptidase database (Rawlings et al. 2014. Nucleic Acids Res. 42, 503-509); no similarities to any eukaryotic protein, but some similarity of the N-terminal half of the protease, containing the transglutaminase core motif, to hypothetical proteins of Streptococcus porcinus and Streptococcus pseudoporcinus (54% identity in a region of 480-492 amino acid residues) and a hypothetical protein of Streptococcus equi (up to 40% identity in a region of 264 to 406 amino acid residues). The N-terminal part of the protease shows also some similarity to hypothetical proteins of Streptococcus agalactiae and Streptococcus merionis (approximately 32% identity). The putative protein is in some databases denoted as ribonuclease or ribonucleases G and E, but due to the absence of an experimentally confirmed function and based on the enzymatic activity against porcine IgG, the protein was denoted IgdE for Immunoglobulin G degrading enzyme of Streptococcus suis.

(138) IgdE is a Novel Cysteine Protease

(139) The S. suis IgdE sequence reveals the presence of a single cysteine residue in position 302 that, due to the inhibitor profile, is assumed to represent the catalytic site cysteine. In silico 3D-modelling (http://swissmodel.expasy.org) of S. suis IgdE, using known transglutaminase domain structures as template, revealed a putative active site cleft in the N-terminal part of the protein containing a potential catalytic triad consisting of cysteine 302, histidine 333 and aspartic acid 348.

(140) For identification of the putative protease domain and catalytic site residues of S. suis IgdE several recombinant IgdE constructs were created (FIG. 2A). All three putative catalytic site residues were replaced by site directed mutagenesis generating mutant proteins, IgdEC.sup.302S, IgdE.sup.H333A and IgdE.sup.D348A respectively. In addition, a construct lacking the C-terminal part of S. suis IgdE was created by an XhoI restriction enzyme cut-back. Crude soluble fractions of E. coli expressing these constructs were incubated with porcine IgG and analyzed by SDS-PAGE. In the presence of recombinant S. suis IgdE, the 32 kDa IgG-derived band appeared, demonstrating that the recombinant protein contains IgG proteolytic activity (FIG. 2B, lane 3). The IgG cleaving activity could be assigned to the N-terminal part of the protein, as a recombinant protein lacking amino acids 471 to 1121 is sufficient for IgG cleaving activity (FIG. 2B, lane 7). SDS-PAGE analysis of porcine IgG incubated with the mutant proteins (FIG. 2B, lane 4-6), revealed that neither rIgdE.sup.C302S nor rIgdE.sup.H333A exhibited IgG cleaving activity, while rIgdE.sup.D348A showed somewhat reduced IgG cleaving activity. Altogether, these data strongly indicate that these three residues are part of the catalytic site of S. suis IgdE.

(141) The inhibitor screen was repeated with purified recombinant IgdEAC and class specific protease inhibitors. In contrast to classical transglutaminase enzymes, IgdE is not calcium dependent, as the protease is fully active in the presence of EDTA, while cysteine class specific inhibitors iodoacetamide and Z-LVG-CHN2 efficiently interfered with IgG proteolytic activity as no cleavage product at all could be detected at 125fold molar excess of inhibitor even after 18 h incubation (FIG. 3). The serine protease inhibitor AEBSF inhibited the IgdEAC moderately at 125 fold molar excess. Interestingly, E-64 did not inhibit purified IgdEAC in this experimental setting, which might be due to a narrow active site similar as described for other streptococcal Ig-proteases, like IdeS and Ide.sub.Ssuis. However, at very high concentrations, E-64 interfered with IgG cleavage activity of S. suis culture supernatants (FIG. 8). Z-LVG-CHN2 a cysteine protease specific inhibitor structurally based on the inhibitory reactive site of cystatin C (Green and Shaw. 1981. J. Biol. Chem. 256, 1923-1928) completely inhibited IgdEAC at 125 fold molar excess. The inhibition of enzymatic activity with iodoacetamide and Z-LVG-CHN2 as well as the lack of enzymatic activity of the IgdEC302S and IgdEH333A mutant suggest that IgdE is a novel and so far unique member of the cysteine protease family.

(142) S. suis IgdE Cleaves Porcine IgG with High Specificity in the Hinge Region

(143) Porcine IgG degradation products were analyzed by reducing and non-reducing SDS-PAGE. The observed band pattern under non-reducing conditions is consistent with a cleavage site located in the hinge region of the heavy chain just N-terminal of the interconnecting disulfide bonds (FIG. 4A). IgG degradation products obtained under reducing conditions (FIG. 4B) were subjected to N-terminal Edman sequencing and the obtained sequence C*PICPACE was found in the hinge region sequences of porcine IgG2ab, IgG4ab, and IgG6ab subtypes. Similar sequences with CPICPGCE as common motif are present in the hinge region of IgGlab and IgGSab subtypes, while IgG3 exhibited a CPxxxxC sequence in the hinge region (Table3).

(144) TABLE-US-00005 TABLE3 N-terminalEdmansequencingofporcineIgGdegra- dationproducts Sub- Hinge(correspondingtoaa99-121 types ofIgGla IgG1a GTKTKPP? CPICPGCEVAG IgG1b GIHQPQT? CPICPGCEVAG IgG2a GTKTKPP? CPICPACESPG IgG2b GTKTKPP? CPICPACEAPG IgG3 DIEPPTPI? CPEICSCPAA EVLGA IgG4a GTKTKPP? CPICPACEGPG IgG4b GIHQPQT? CPICPACEGPA IgG5a GRP? CPICPGCEVAG IgG5b GKKTKPR? CPICPGCEVAG IgG6a GRP? CPICPACEGPG IgG6b GRP? CPICPACEGNG Hinge region sequences of all porcine IgG sub-types. Cysteine residues believed to be involved in S-S covalent bonds (underlined) and the potential cleavage site (?) are marked in the table.

(145) The observed cleavage patterns on reducing and non-reducing SDS-PAGE; in addition to the identified cleavage site, are consistent with a cleavage reaction in which one IgG heavy chain is hydrolyzed just N-terminal of the homo-dimer disulfide bonds, before a second step hydrolysis cleaves the second heavy chain (FIG. 4C). Interestingly, sequences similar to the IgG hinge region could not be found in the heavy chain sequences of porcine IgA and IgM. Therefore S. suis IgdE specificity was further investigated employing specific antibodies against porcine IgG, IgM and IgA. Porcine plasma incubated with recombinant S. suis IgdE was analyzed by Western blot demonstrating that the protease targets IgG in porcine plasma, but does not cleave IgA or IgM (FIG. 5A).

(146) The host specificity of the protease was investigated by incubation of purified S. suis IgdE with IgG preparations of humans, goat, bovine, horse and mouse (FIG. 5B). Interestingly, only pig IgG was found to be a substrate for this novel IgG protease. Thus, IgdE shows a pronounced species specificity and targets only porcine IgG.

(147) To further evaluate the specificity ofS. suis IgdE ex vivo, body fluids of healthy or diseased piglets were used. Fluids from heart sac, abdominal cavity, and joint, as well as cerebrospinal fluid and serum were treated with recombinant S. suis IgdE and analyzed by SDS-PAGE (FIG. 6A) and by Western blot using porcine IgG specific antibodies (FIG. 6B). No apparent change in the protein band pattern, except for the appearance of the diagnostic IgG cleavage product could be observed in the presence of rIgdE in heart sac, abdominal cavity and serum samples. Also no IgG, i.e. no cleavage products, were present in joint fluid and cerebrospinal fluids of healthy pigs. In contrast, all body fluids obtained from piglets with clinical signs, e.g. suffering from meningitis and synovialitis, contained IgG as consequence of an inflammatory response and again a single diagnostic 32 kDa band could be observed in all samples treated with rIgdE (FIG. 6). The specificity ofS. suis IgdE is emphasized by the observation that no additional degradation products could be identified on SDS-PAGE following incubation of porcine body fluids with the protease. Thus, although it cannot be excluded that additional substrates exist, these results indicate that S. suis IgdE is a highly specific IgG protease, complementing the previously described IgA and IgM degrading proteases of S. suis (Seele supra; Zhang et al. 2010. Vet. Microbiol. 140, 171-175).

(148) IgdE is the Sole IgG Cleaving Enzyme Expressed by S. suis

(149) Strain 10 and strain 10?ide.sub.Ssuis, the latter lacking IgM cleaving activity, were used to generate S. suis igdE in-frame deletion mutants. IgG and IgM cleaving activities in growth supernatant from wild type strain 10 were determined by Western blot using specific polyclonal anti-porcine IgG or IgM antibodies (FIG. 7). As expected, wild type strain 10 exhibited IgG and IgM cleaving activity (FIGS. 7A and B, lane 3), while supernatant of the isogenic mutant strain 10?igdE only contained IgM cleaving activity and neither IgG or IgM degradation was detectable in supernatant of double mutant strain 10?ide.sub.Ssuis ?igdE (FIGS. 7A and B, lane 5) Thus, it appears that S. suis IgdE is required and sufficient to cleave porcine IgG and that no other IgG cleaving activity is released under these experimental conditions.

(150) In Vivo Expression of S. suis IgdE

(151) Weaning piglets are initially protected from bacterial infection through colostrum derived maternal antibodies. Levels of maternal antibodies decrease over time and active IgG mediated immunity develops at earliest after two weeks. Accordingly, levels of IgG antibodies in serum of colostrum-deprived piglets (SCDP) do not exceed background values in ELISA measurements. An ELISA was conducted with rIgdE as antigen to investigate different serum samples from piglets for the presence of antibodies directed against this IgG protease. A serum sample drawn 20 days after experimental infection with S. suis strain 10 contained very high titers against rIgdE (defined as 100 ELISA units, see Material and Methods). In contrast to SCDP that was used as negative control, significant amounts of specific antibodies against S. suis IgdE were detectable in seven out of nine 5-6 weeks old conventional weaning piglets (ELISA units ranging from 36 and 92). These results demonstrated that S. suis IgdE is an immunogenic antigen expressed by S. suis in vivo.

Example 2. Identification IgdE from Other Streptococcus Species

(152) The coding sequences of all available Streptococcus genomes were downloaded from NCBI [ftp://ftp.ncbi.nlm.nih.gov/genomes/Bacteria/ on Aug. 21, 2015] and from PATRIC [ftp://ftp.patricbrc.org/patric2/ on Aug. 25, 2015].

(153) As reference sequence for IgdE we used the RefSeq sequence WP_014636499.1. The N-terminal signal peptide and the C-terminal region only present in sequences from S. suis were removed, leaving amino acids 38-520, hereafter called IgdE_domain.

(154) IgdE_domain was used as query sequence in blastp searches (E-value cutoff 1 to keep all possible proteases) against the NCBI sequences as well as the PATRIC sequences. The obtained hits were in turn used as query sequences against the same databases, using the same parameters. From the list of matched sequences we chose those that in the second round had a match that overlap with the region matched in the first round, when IgdE was used as query. Sequences not containing the C in the catalytic site were removed from further consideration, and in case of identical sequences only one copy was kept.

(155) Many of the sequences found are annotated as S-layer proteins or as containing an S-layer homology domain W. These are often present in two or more copies in the same genome, and have a SxC or GxC motif in the catalytic site instead the AxC motif found in the original IgdE sequences. When searching all the sequences against Pfam, these sequences fit well to the Pfam model Transglut_core. In order to remove these sequences, that are not members of the IgdE family, all sequences matching to the Transglut_core model with an E-value of at most 1e-6 were removed, as well as sequences lacking the AxC motif. The remaining sequences were cut at both ends to contain only the parts matching the IgdE_domain sequence. In cases this resulted in identical domain sequences only one copy was kept.

(156) Proteases belonging to the IgdE family were identified in S. porcinus, S. agalactiae, S. equi, and S. pseudoporcinus. The protease were cloned, expressed and characterized.

Example 3. Properties of IgdE Isolated from S. porcinus

(157) Recombinant IgdE.sub.porcinus cleaved purified polyclonal porcine IgG resulting in a 32 kDa degradation product detected by reducing SDS-PAGE. No degradation product was observed when recombinant IgdE.sub.porcinus was incubated with purified polyclonal IgG from cow, horse, human, goat or mouse. Recombinant IgdE.sub.porcinus cleaved IgG in porcine serum, but not IgM or IgA detected by anti-IgG, IgM and IgA Western blot analyses. The N-terminal sequence of the 32 kDa degradation product of porcine IgG is CPICPACE as shown by N-terminal Edman sequencing indicating that that this protein has the same cleavage site as IgdE from S. suis within porcine IgG. The recombinant IgdE.sub.porcinus was easily over-expressed and purified to great purity. All tested S. porcinus strains showed the same porcine IgG cleaving phenotype in their growth culture supernatants as the recombinant protein.

Example 4. Properties IgdE Isolated from S. agalactiae

(158) Recombinant IgdE.sub.agalactiae cleaved purified polyclonal human IgG resulting in a 32 kDa degradation product detected by reducing SDS-PAGE (FIG. 10). Recombinant IgdE.sub.agalactiae cleaved purified monoclonal human IgG1 kappa and IgG1 lambda resulting in a 32 kDa degradation product detected by reducing SDS-PAGE (FIG. 10D). No degradation product was observed when recombinant IgdE.sub.agalactiae was incubated with monoclonal human IgG2, IgG3 or IgG4 (FIG. 10D). No degradation product was observed when recombinant IgdE.sub.agalactiae was incubated with purified polyclonal IgG from cow, horse, pig, goat and mouse (FIG. 10A). Recombinant IgdE.sub.agalactiae cleaved IgG in human serum, but not IgM or IgA detected by anti-IgG, IgM and IgA Western blot analyses Recombinant IgdE.sub.agalactiae degrades human serum IgG1 completely to single cleaved IgG1 (FIG. 11). The N-terminal sequence of the 32 kDa degradation product of human IgG is H (or G or S)TCPPCPAPE as shown by N-terminal Edman sequencing indicating that that this protein has the same cleavage site as papain in IgG1 in the hinge region N-terminal of the cysteine residues believed to be involved in HH covalent bonds between the heavy chains. Recombinant IgdE.sub.agalactiae was easily over-expressed and purified.

Example 5. Properties of IgdE Isolated from S. equi

(159) Lysate of E. coli expressing recombinant IgdE.sub.equi cleaved purified polyclonal horse IgG resulting in a 32 kDa degradation product detected by reducing SDS-PAGE. No degradation product was observed when recombinant IgdE.sub.equi was incubated with purified polyclonal IgG from cow, human, pig, goat, rat, rabbit and mouse. Recombinant IgdE.sub.equi cleaved IgG in equine serum, but not IgM or IgA detected by anti-IgG, IgM and IgA Western blot analyses Recombinant IgdE.sub.equi cleaved purified monoclonal recombinant equine IgG7 resulting in a 32 kDa degradation product detected by reducing SDS-PAGE (FIG. 12). No degradation product was observed when recombinant IgdE.sub.equi was incubated with recombinant monoclonal equine IgG1, IgG2, IgG3, IgG4, IgG5 or IgG6. The N-terminal sequence of the 32 kDa degradation product of equine IgG as shown by N-terminal Edman sequencing is (G)PTCPECXGV. This sequence is found in the hinge region of equine IgG7.

Example 6. Properties of IgdE isolated from S. pseudoporcinus

(160) S. pseudoporcinus culture supernatant possessed porcine IgG cleaving phenotype, but not human IgG cleaving phenotype. Recombinant IgdE.sub.pseudoporcinus cleaved purified polyclonal human and porcine IgG resulting in a 32 kDa degradation product as detected by reducing SDS-PAGE. No degradation product was observed when recombinant IgdE.sub.pseudoporcinus was incubated with purified polyclonal IgG from cow, horse, goat, mouse, or rat. Recombinant IgdE.sub.pseudoporcinus cleaved IgG in human and porcine serum, but not IgM or IgA in porcine serum as detected by anti-IgG, IgM and IgA Western blot analyses. The N-terminal sequence of the 32 kDa degradation product of porcine IgG is CPICPACE as shown by N-terminal Edman sequencing indicating that that this protein has the same cleavage site as IgdE within porcine IgG. The recombinant IgdE.sub.pseudoporcinus was easily over-expressed in E. coli BL21 pLysS.
The invention described herein also relates to the following aspects:
1. A polypeptide for use in generating an immune response in a subject comprising:

(161) (a) the amino acid sequence of SEQ ID NO: 1;

(162) (b) a variant of SEQ ID NO: 1 having at least 70% identity to the amino acid sequence of SEQ ID NO: 1 and having IgG degrading cysteine protease activity;

(163) (c) a fragment of SEQ ID NO: 1, a variant of SEQ ID NO:1, or a fragment of a variant of SEQ ID NO: 1 which is capable of generating an immune response to a streptococcus, preferably a S. suis in a subject;

(164) (d) the amino acid sequence of SEQ ID NO: 3;

(165) (e) a variant of SEQ ID NO: 3 having at least 70% identity to the amino acid sequence of SEQ ID NO: 3 and having IgG degrading cysteine protease activity;

(166) (f) a fragment of SEQ ID NO: 3, a variant of SEQ ID NO:3, or a fragment of a variant of SEQ ID NO: 3 which is capable of generating an immune response to a streptococcus, preferably a S. agalactiae in a subject;

(167) (g) the amino acid sequence of SEQ ID NO: 5;

(168) (h) a variant of SEQ ID NO: 5 having at least 70% identity to the amino acid sequence of SEQ ID NO: 5 and having IgG degrading cysteine protease activity;

(169) (i) a fragment of SEQ ID NO: 5, a variant of SEQ ID NO:5, or a fragment of a variant of SEQ ID NO: 5 which is capable of generating an immune response to a streptococcus, preferably a S. porcinus in a subject;

(170) (j) the amino acid sequence of SEQ ID NO: 7;

(171) (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;

(172) (l) a fragment of SEQ ID NO: 7, a variant of SEQ ID NO:7, or a fragment of a variant of SEQ ID NO: 7 which is capable of generating an immune response to a streptococcus, preferably a S. equi in a subject;

(173) (m) the amino acid sequence of SEQ ID NO: 9;

(174) (n) a variant of SEQ ID NO: 9 having at least 70% identity to the amino acid sequence of SEQ ID NO: 9 and having IgG degrading cysteine protease activity;

(175) (o) a fragment of SEQ ID NO: 9, a variant of SEQ ID NO:9, or a fragment of a variant of SEQ ID NO: 9 which is capable of generating an immune response to a streptococcus, preferably a S. pseudoporcinus in a subject;

(176) 2. A polynucleotide encoding a polypeptide according to aspect 1 for use in generating an immune response in a subject.

(177) 3. A polynucleotide for use in generating an immune response in a subject comprising:

(178) (a) SEQ ID NO: 2 or a complementary sequence thereto;

(179) (b) a sequence which is degenerate as a result of the genetic code to a sequence as defined in (a);

(180) (c) a sequence which hybridises under stringent conditions to the sequence defined in (a) or (b);

(181) (d) a sequence having at least 70% identity to a sequence as defined in (a) or (b);

(182) (e) a fragments of any of the sequences (a), (b), (c) or (d), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably a S. suis in a subject.

(183) (f) SEQ ID NO: 4 or a complementary sequence thereto;

(184) (g) a sequence which is degenerate as a result of the genetic code to a sequence as defined in (f);

(185) (h) a sequence which hybridises under stringent conditions to the sequence defined in (f) or (g);

(186) (i) a sequence having at least 70% identity to a sequence as defined in (f) or (g);

(187) (j) a fragments of any of the sequences (f), (g), (h) or (i), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably a S. agalactiae in a subject;

(188) (k) SEQ ID NO: 6 or a complementary sequence thereto;

(189) (l) a sequence which is degenerate as a result of the genetic code to a sequence as defined in (k);

(190) (m) a sequence which hybridises under stringent conditions to the sequence defined in (k) or (l);

(191) (n) a sequence having at least 70% identity to a sequence as defined in (k) or (l);

(192) (o) a fragments of any of the sequences (k), (l), (m) or (n), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably a S. porcinus in a subject;

(193) (p) SEQ ID NO: 8 or a complementary sequence thereto;

(194) (q) a sequence which is degenerate as a result of the genetic code to a sequence as defined in (a);

(195) (r) a sequence which hybridises under stringent conditions to the sequence defined in (p) or (q);

(196) (s) a sequence having at least 70% identity to a sequence as defined in (p) or (q);

(197) (t) a fragments of any of the sequences (p), (q), (r) or (s), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably a S. equi in a subject;

(198) (u) SEQ ID NO: 10 or a complementary sequence thereto;

(199) (v) a sequence which is degenerate as a result of the genetic code to a sequence as defined in (u);

(200) (w) a sequence which hybridises under stringent conditions to the sequence defined in (u) or (v);

(201) (x) a sequence having at least 70% identity to a sequence as defined in (u) or (v); or

(202) (y) a fragments of any of the sequences (u), (v), (w) or (x), and which encodes a polypeptide having IgG degrading cysteine protease activity and/or is capable of generating an immune response against a streptococcus, preferably S. pseudoporcinus in a subject.

(203) 4. A polypeptide for use in treatment or prevention of a disease or condition mediated by IgG antibodies comprising:

(204) (a) the amino acid sequence of SEQ ID NO: 1;

(205) (b) a variant of SEQ ID NO: 1 having at least 70% identity to the amino acid sequence of SEQ ID NO: 1 and having IgG degrading cysteine protease activity;

(206) (c) a fragment of SEQ ID NO: 1 or a fragment of a variant of SEQ ID NO: 1 having IgG degrading cysteine protease activity.

(207) (d) the amino acid sequence of SEQ ID NO: 3;

(208) (e) a variant of SEQ ID NO: 3 having at least 70% identity to the amino acid sequence of SEQ ID NO: 3 and having IgG degrading cysteine protease activity;

(209) (f) a fragment of SEQ ID NO: 3 or a fragment of a variant of SEQ ID NO: 3 having IgG degrading cysteine protease activity;

(210) (g) the amino acid sequence of SEQ ID NO: 5;

(211) (h) a variant of SEQ ID NO: 5 having at least 70% identity to the amino acid sequence of SEQ ID NO: 5 and having IgG degrading cysteine protease activity;

(212) (i) a fragment of SEQ ID NO: 5 or a fragment of a variant of SEQ ID NO: 5 having IgG degrading cysteine protease activity;

(213) (j) the amino acid sequence of SEQ ID NO: 7;

(214) (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity; or

(215) (l) a fragment of SEQ ID NO: 7 or a fragment of a variant of SEQ ID NO: 7 having IgG degrading cysteine protease activity; or

(216) (m) the amino acid sequence of SEQ ID NO: 9;

(217) (n) a variant of SEQ ID NO: 9 having at least 70% identity to the amino acid sequence of SEQ ID NO: 9 and having IgG degrading cysteine protease activity;

(218) (o) a fragment of SEQ ID NO: 9 or a fragment of a variant of SEQ ID NO: 9 having IgG degrading cysteine protease activity;

(219) (p) the amino acid sequence of SEQ ID NO: 11;

(220) (q) a variant of SEQ ID NO: 11 having at least 70% identity to the amino acid sequence of SEQ ID NO: 11 and having IgG degrading cysteine protease activity; or

(221) (r) a fragment of SEQ ID NO: 11 or a fragment of a variant of SEQ ID NO: 11 having IgG degrading cysteine protease activity.

(222) 5. A polynucleotide encoding a polypeptide according to aspect 4 for use in treatment or prevention of a disease or condition mediated by IgG antibodies.

(223) 6. An in vitro method for the cleavage of IgG, comprising contacting IgG with a polypeptide comprising:

(224) (a) the amino acid sequence of SEQ ID NO: 1;

(225) (b) a variant of SEQ ID NO: 1 having at least 70% identity to the amino acid sequence of SEQ ID NO: 1 and having IgG degrading cysteine protease activity;

(226) (c) a fragment of SEQ ID NO: 1 or a fragment of a variant of SEQ ID NO: 1 having IgG degrading cysteine protease activity.

(227) (d) the amino acid sequence of SEQ ID NO: 3;

(228) (e) a variant of SEQ ID NO: 3 having at least 70% identity to the amino acid sequence of SEQ ID NO: 3 and having IgG degrading cysteine protease activity;

(229) (f) a fragment of SEQ ID NO: 3 or a fragment of a variant of SEQ ID NO: 3 having IgG degrading cysteine protease activity;

(230) (g) the amino acid sequence of SEQ ID NO: 5;

(231) (h) a variant of SEQ ID NO: 5 having at least 70% identity to the amino acid sequence of SEQ ID NO: 5 and having IgG degrading cysteine protease activity;

(232) (i) a fragment of SEQ ID NO: 5 or a fragment of a variant of SEQ ID NO: 5 having IgG degrading cysteine protease activity;

(233) (j) the amino acid sequence of SEQ ID NO: 7;

(234) (k) a variant of SEQ ID NO: 7 having at least 70% identity to the amino acid sequence of SEQ ID NO: 7 and having IgG degrading cysteine protease activity;

(235) (l) a fragment of SEQ ID NO: 7 or a fragment of a variant of SEQ ID NO: 7 having IgG degrading cysteine protease activity;

(236) (m) the amino acid sequence of SEQ ID NO: 9;

(237) (n) a variant of SEQ ID NO: 9 having at least 70% identity to the amino acid sequence of SEQ ID NO: 9 and having IgG degrading cysteine protease activity;

(238) (o) a fragment of SEQ ID NO: 9 or a fragment of a variant of SEQ ID NO: 9 having IgG degrading cysteine protease activity;

(239) (p) the amino acid sequence of SEQ ID NO: 11;

(240) (q) a variant of SEQ ID NO: 11 having at least 70% identity to the amino acid sequence of SEQ ID NO: 11 and having IgG degrading cysteine protease activity; or

(241) (r) a fragment of SEQ ID NO: 11 or a fragment of a variant of SEQ ID NO: 11 having IgG degrading cysteine protease activity.

(242) 7. A method for identifying a substance that activates or inhibits the IgG cysteine activity of an IgdE polypeptide comprising the steps;

(243) a) contacting the IgdE polypeptide and IgG with a candidate substance under conditions permitting IgG cysteine activity in the absence of the substance,

(244) b) determining the amount of IgG digested in the presence of the candidate substance compared to in the absence of said substance,

(245) c) based on the results obtain in b) determining whether the substance activates or inhibits the IgG cysteine activity of the IgdE polypeptide.