Salt-reduced fermentation method for high-salt dilute-state fermented soy sauce

12004543 ยท 2024-06-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure discloses a salt-reduced fermentation method for high-salt dilute-state fermented soy sauce, and belongs to the technical field of fermentation engineering. The present disclosure separates and screens Weissella paramesenteroides JL-5 and Bacillus amyloliquefaciens JDF-2 which inhibit the growth of spoilage bacteria from low-salt soy sauce mash, and by changing the microbial fermentation process of high-salt dilute-state soy sauce, the strains obtained by screening are used for the fermentation of low-salt soy sauce mash. Without changing the flavor and quality of soy sauce, low-salt fermentation of the soy sauce is enabled to proceed normally, and the biogenic amine content is less than 100 mg L.sup.?1, and the number of spoilage bacteria in the soy sauce are reduced. The prepared low-salt soy sauce has an amino acid nitrogen content of greater than 1.2 g.Math.100 mL.sup.?1, contents of various spoilage bacteria of less than 1.0?10.sup.3 CFU.Math.g.sup.?1, a NaCl concentration of no more than 10 g.Math.100 mL.sup.?1, and a sodium content of less than or equal to 420 mg.Math.10 mL.sup.?1. Without the addition of preservatives, the quality stability is the same as that of soy sauce without salt reduction.

Claims

1. A method for producing high-salt dilute-state soy sauce, comprising cooking, koji making, and fermentation; the fermentation comprising: mixing finished koji with brine at a volume ratio of 1:(2-3), so that the final concentration of salt in the system is less than or equal to 12 g.Math.100 mL.sup.?1, adding Weissella paramesenteroides (W. paramesenteroides) JL-5 and Bacillus amyloliquefaciens (B. amyloliquefaciens) JDF-2, or a composition containing the W. paramesenteroides JL-5 and the B. amyloliquefaciens JDF-2, and performing fermentation at 25-30? C. for at least 30 days; wherein the W. paramesenteroides JL-5 is maintained in the China Center for Type Culture Collection, with a preservation number of CCTCC NO: M 2021707; and wherein the B. amyloliquefaciens JDF-2 is maintained in the China Center for Type Culture Collection, with a preservation number of CCTCC NO: M 2021737.

2. The method according to claim 1, wherein the concentration of the W. paramesenteroides JL-5 is greater than or equal to 1.0?10.sup.7 CFU.Math.g.sup.?1, and the concentration of the B. amyloliquefaciens JDF-2 is greater than or equal to 1.0?10.sup.6 CFU.Math.g.sup.?1.

3. The method according to claim 1, wherein the finished koji is prepared by a method comprising: steaming defatted soybeans at 121? C. (0.1 MPa) for 20 min., uniformly mixing cooled soybean with wheat flour at a mass ratio of (4-6):1, adding a soy sauce koji starter accounting for 1-1.5% of the total mass of the mixed raw materials, performing uniform mixing, and performing culturing at 28? C.-30? C., wherein the koji making process takes 40 hours-48 hours.

4. The method according to claim 1, wherein the composition is a starter containing the W. paramesenteroides JL-5 and the B. amyloliquefaciens JDF-2, wheat koji, bran koji or other types of koji for fermentation.

5. The method according to claim 1, comprising the following steps: (1) koji making process: steaming defatted soybeans at 121? C. (0.1 MPa) for 20 min., uniformly mixing the cooled soybean with wheat flour at a mass ratio of (4-6):1, adding a soy sauce koji starter accounting for 1-1.5% of the total mass of the mixed raw materials, performing uniform mixing, and performing culturing at 28? C.-30? C., wherein the koji making process takes 40 hours-48 hour; and (2) fermentation process: mixing the finished koji prepared in step (1) with brine containing NaCl at a volume ratio of 1:(2-3), so that the final concentration of salt in the system is less than or equal to 12 g.Math.100 mL.sup.?1, adding the W. paramesenteroides JL-5 and the B. amyloliquefaciens JDF-2, or adding the starter, wheat koji, bran koji or other types of koji for fermentation, and performing fermentation at 25? C.-30? C. for 40 days; during fermentation, on day 3 to day 5, adding Zygosaccharomyces rouxii ZQ01, and performing stirring during the fermentation.

6. The method according to claim 5, wherein the concentration of the W. paramesenteroides JL-5 in a soy sauce mash containing salt with a concentration of 12 g.Math.100 mL.sup.?1 is at least 1.0?10.sup.7 CFU.Math.g.sup.?1.

7. The method according to claim 5, wherein the number of the W. paramesenteroides JL-5 added and the number of the B. amyloliquefaciens JDF-2 added are in a same order of magnitude.

8. The method according to claim 5, wherein the method makes the produced soy sauce have at least one of the following features (a)-(e): (a) the number of spoilage bacteria in the produced soy sauce is reduced compared to a control soy sauce not made by the method; (b) the salt content in the produced soy sauce is less than or equal to 12 g.Math.100 mL.sup.?1; (c) the biogenic amine content in the produced soy sauce is reduced compared to a control soy sauce not made by the method; (d) the stability during the shelf life of the produced soy sauce is improved compared to a control soy sauce not made by the method; and (e) the formation of volatiles in the produced soy sauce is promoted.

9. The method according to claim 8, wherein the spoilage bacteria comprise at least one of: Bacillus subtilis, Bacillus halodurans, Bacillus megaterium, Staphylococcus saprophytics, Kurthia zopfii, Kurthia gibsonii, and Lactobacillus pobuzihii.

10. A starter containing Weissella paramesenteroides JL-5 and/or Bacillus amyloliquefaciens JDF-2, wheat koji, bran koji or other types of koji for fermentation, wherein the W. paramesenteroides JL-5 is maintained in the China Center for Type Culture Collection, with a preservation number of CCTCC NO: M 2021707; and the B. amyloliquefaciens JDF-2 is maintained in the China Center for Type Culture Collection, with a preservation number of CCTCC NO: M 2021737.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1A shows the changes in the amino acid nitrogen content of soy sauce mash in fermentation processes with different salt concentrations.

(2) FIG. 1B shows the changes in the total acid content of the soy sauce mash in fermentation processes with different salt concentrations.

(3) FIG. 1C shows the changes in pH of the soy sauce mash in fermentation processes with different salt concentrations.

(4) FIG. 2 shows the changes in the biogenic amine content in the soy sauce produced by fermentation with different salt concentrations.

(5) FIG. 3 shows the content and composition of volatiles in the soy sauce produced by fermentation with different salt concentrations.

(6) FIG. 4A shows the changes in the number of B. megaterium in the soy sauce mash in fermentation processes with different salt concentrations.

(7) FIG. 4B shows the changes in the number of B. subtilis in the soy sauce mash in fermentation processes with different salt concentrations.

(8) FIG. 4C shows the changes in the number of B. halodurans in the soy sauce mash in fermentation processes with different salt concentrations.

(9) FIG. 4D shows the changes in the number of L. pobuzihii in the soy sauce mash in fermentation processes with different salt concentrations.

(10) FIG. 4E shows the changes in the number of S. saprophytics in the soy sauce mash in fermentation processes with different salt concentrations.

(11) FIG. 4F shows the changes in the number of Kurthia in the soy sauce mash in fermentation processes with different salt concentrations.

(12) FIG. 5A shows the effects of different fermentation methods on the number of B. subtilis in a simulated soy sauce fermentation system.

(13) FIG. 5B shows the effects of different fermentation methods on the number of B. megaterium in a simulated soy sauce fermentation system.

(14) FIG. 5C shows the effects of different fermentation methods on the number of B. halodurans in a simulated soy sauce fermentation system.

(15) FIG. 5D shows the effects of different fermentation methods on the number of S. saprophytics in a simulated soy sauce fermentation system.

(16) FIG. 5E shows the effects of different fermentation methods on the number of L. pobuzihii in a simulated soy sauce fermentation system.

(17) FIG. 5F shows the effects of different fermentation methods on the number of K. zopfii in a simulated soy sauce fermentation system.

(18) FIG. 6A shows the effects of different fermentation methods on the amino acid nitrogen content of soy sauce.

(19) FIG. 6B shows the effects of different fermentation methods on the pH of soy sauce.

(20) FIG. 6C shows the effects of different fermentation methods on the reducing sugar content of soy sauce.

(21) FIG. 6D shows the effects of different fermentation methods on the total acid content of soy sauce.

(22) FIG. 7 shows the biogenic amine content of soy sauce produced by different fermentation methods.

(23) FIG. 8 shows the content of volatiles in the soy sauce produced by different fermentation methods.

DETAILED DESCRIPTION

Strains and Materials

(24) Z. rouxii ZQ01: Disclosed in Study on the Production Mechanism and Elimination Strategies of Ethyl Carbamate in Soy Sauce, the applicant promised to release the biological material to the public within 20 years from the filing date.

(25) Soy sauce koji starter: A soy sauce koji starter is prepared by drying and separating to extract effective spores from Aspergillus oryzae and Aspergillus niger with high protease activity and glucoamylase activity, and the spore content is greater than or equal to 10,000.Math.g.sup.?1.

Media

(26) MRS medium: 10 g.Math.L.sup.?1 peptone, 8 g.Math.L.sup.?1 beef extract powder, 4 g.Math.L.sup.?1 yeast extract powder, 20 g.Math.L.sup.?1 glucose, 2 g.Math.L.sup.?1 dipotassium hydrogen phosphate, 2 g.Math.L.sup.?1 diammonium hydrogen citrate, 5 g.Math.L.sup.?1 sodium acetate, 0.2 g.Math.L.sup.?1 magnesium sulfate, 0.04 g.Math.L.sup.?1 manganese sulfate, and 1 gL.sup.?1 Tween 80.

(27) Rose bengal medium: 5 g.Math.L.sup.?1 peptone, 10 g.Math.L.sup.?1 glucose, 1 g.Math.L.sup.?1 dipotassium hydrogen phosphate, 0.5 g.Math.L.sup.?1 magnesium sulfate, 20 g.Math.L.sup.?1 agar, and 100 mL.Math.L.sup.?1 1/3000 rose bengal solution.

(28) YPD medium: 10 g.Math.L.sup.?1 yeast extract, 20 g.Math.L.sup.?1 peptone, and 20 g.Math.L.sup.?1 glucose.

(29) LB medium: 5 g.Math.L.sup.?1 yeast extract, 10 g.Math.L.sup.?1 peptone, and 10 g.Math.L.sup.?1 sodium chloride.

(30) Soy sauce mash fermentation medium: Raw materials for producing soy sauce, namely defat soybean and wheat flour are mixed at a ratio of 1:1, 4 times of water (w/v) and thermostable amylase (50 U.Math.kg.sup.?1) are added for cooking and gelatinizing for 1 h, glucoamylase (120 U.Math.kg.sup.?1) is added for saccharifying at 60? C. for 2 h , and sterilizing is carried out at 121? C. for 20 min to obtain a simulated fermentation medium.

Detection Methods

(31) The total acid concentration is measured by a sodium hydroxide titration method. The pH of a soy sauce mash sample is measured using a pH meter. The amino acid nitrogen concentration is measured by a formol titration method (for the determination method, refer to the method in the reference Effect of Tetragenococcus halophilus on Soy Sauce Quality Prepared by Fermentation). The reducing sugar content is determined by the 3,5-dinitrosalicylic acid method (DNS). The salt content is determined using a silver nitrate titration method (refer to GB 5009.44-2016 National Food Safety Standard Determination of Chloride in Food), and the sodium content is determined by an atomic absorption method (refer to GB 5009.91-2017 National Food Safety Standard Determination of Potassium and Sodium in Food).

(32) Detection of biogenic amine content:

(33) (1) Preparation of biogenic amine (mixed standard) standard solutions: 1 mL is pipetted from each of 8 kinds of biogenic amine solutions (with a mass concentration of 1,000 mg.Math.L.sup.?1): putrescine, cadaverine, spermine, spermidine, tryptamine, histamine, tyramine and phenethylamine, and added to a 10 mL volumetric flask, the solutions are diluted to a volume of 10 mL with a 0.1 mol.Math.L.sup.?1 hydrochloric acid solution, the mixtures are uniformly mixed, and a biogenic amine standard (100 mg.Math.L.sup.?1) is prepared. Biogenic amine standard series solution: The biogenic amine standard mixed solution is diluted with 0.1 mol.Math.L.sup.?1 hydrochloric acid into biogenic amine standard series solutions with a mass concentration of 5 mg.Math.L.sup.?1, 10.0 mg.Math.L.sup.?1, 25.0 mg.Math.L.sup.?1, 50.0 mg.Math.L.sup.?1 and 100.0 mg.Math.L.sup.?1, and the solutions are prepared just before use. Standard solutions as internal standards: An appropriate amount of 1,7-diaminoheptane is weighed and prepared with a 0.1 mol.Math.L.sup.?1 HCl solution to a mass concentration of 100 mg.Math.L.sup.?1. Dansyl chloride derivatizing agent: An appropriate amount of dansyl chloride is weighed and dissolved with acetone. The prepared solution has a mass concentration of 10 mg.Math.mL.sup.?1, and is prepared just before use.

(34) (2) Sample pretreatment: 10 mL of a soy sauce sample is accurately measured and put in a 50 mL centrifuge tube, 20 mL of a 5% (w/v) trichloroacetic acid solution is added and uniformly mixed, vibrating extraction is performed for 60 min, the extract is centrifuged at 8,000 r.Math.min.sup.?1 for 10 min to take the supernatant, extraction is performed twice, and the supernatants are combined, diluted to 25 mL and filtered with filter paper. 2 mL of the soy sauce sample extract is accurately pipetted into a 15 mL centrifuge tube, 3 mL of n-hexane is added, and the mixture is shaken for 2 min, allowed to stand for layering, and centrifuged at 8,000 r.Math.min.sup.?1 for 10 min to obtain the supernatant.

(35) (3) Sample derivatization: 500 ?L of the sample pretreatment solution and the biogenic amine standard series solutions are pipetted respectively, 50 ?L of internal standard (100 mg.Math.L.sup.?1), 100 ?L of a NaOH solution (2 mol.Math.L.sup.?1) and 150 ?L of a saturated NaHCO.sub.3 buffer are added respectively, and then 75 ?L of a dansyl chloride derivatizing solution is added. The mixture is placed in a 45? C. water bath after uniform mixing to react in the dark for 50 min, and then 50 ?L of ammonia is added to stop the reaction. After standing in the dark for 30 min, the volume is adjusted to 2.5 mL with acetonitrile, the mixture is centrifuged at 8,000 r.Math.min.sup.?1 for 10 min, and the supernatant is filtered with a 0.22 ?m pore filter membrane for determination.

(36) (4) Quantitative determination of biogenic amine adopts high performance liquid chromatography (HPLC), wherein the mobile phase A is acetonitrile, the mobile phase B is ultrapure water, the column temperature is 30? C., the flow rate is 0.8 mL.Math.min.sup.?1, the injection volume is 10 ?L, and the UV detection wavelength is 254 nm. In an elution procedure, within 0-7 min, the mobile phase A is kept at 55%; within 7-14 min, the mobile phase A is kept at 65%, and then kept at 70% for 6 min; and the mobile phase A is restored from 70% to 55% within the last 1 min.

(37) Volatiles are determined by solid-phase micro-extraction combined with gas chromatography-mass spectrometry (SPME-GC-MS), and for the specific method, refer to patent application CN112852667A Effect of Enrichment of Tetragenococcus Halophilus on Simulated Fermentation of Low-Salt Soy Sauce published in 2021.

Example 1

Preparation of High-Salt Dilute-State Soy Sauce Fermentation with Reduced Salt Content

(38) (1) Koji making:

(39) The raw materials for koji making include defatted soybeans and wheat flour at a mass ratio of 6:4.

(40) The specific steps are as follows: Defat soybeans were steamed at 121? C. (0.1 MPa) for 20 min., uniformly mixing the cooled soybean with wheat flour at a mass ratio of (4-6): 1 and then a soy sauce koji starter accounting for 1.5% of the total mass of the mixed raw materials was added. After uniform mixing, the mixed raw materials were cultured in a biochemical incubator at 28? C.-30? C., the koji was turned at the right time, and the finished koji was prepared after 40 h-48 h when the surface of the koji material was covered with yellow-green hyphae.

(41) (2) Fermentation: The finished koji prepared in step (1) was mixed with brine containing 200 g.Math.L.sup.?1 NaCl at a volume ratio of 1:(2-3). The uniformly mixed soy sauce mash was put into a 5 L beaker to make the final concentration of salt in the system reach 12 g.Math.100 mL.sup.?1, then Z. rouxii ZQ01 with a final concentration of 10.sup.7 CFU.Math.g.sup.?1 was added in day 3-day 5, and the soy sauce mash was fermented at 30? C. for 40 days and stirred once a day during fermentation.

(42) Following the steps (1)-(2), the concentrations of brine added were adjusted respectively, thus the initial salt concentrations of the systems for fermentation were 18 g.Math.100 mL.sup.?1, 15 g.Math.100 mL.sup.?1, 12 g.Math.100 mL.sup.?1 and 9 g.Math.100 mL.sup.?1 respectively, and samples were taken on day 0, day 5, day 10, day 15, day 20, day 25, day 30, day 35 and day 40 respectively.

(43) (a) Physicochemical indexes in a salt-reduced fermentation process of high-salt dilute -state soy sauce:

(44) 5 g of soy sauce mash samples with different salt concentrations were collected, ground and dissolved in 100 mL of normal saline to detect the physicochemical indexes. As shown in FIG. 1, after 40 days of fermentation, the amino acid nitrogen content of the fermented soy sauce mash under the salt concentrations of 12 g.Math.100 mL.sup.?1 and 9 g.Math.100 mL.sup.?1 significantly was decreased to 0.31 g.Math.100 mL.sup.?1 and 0.22 g.Math.100 mL.sup.?1, which are not in line with the Chinese Hygienic Standard for Soy Sauce GB2717-2018 (0.4 g.Math.100 mL.sup.?1) and the Japanese Quality Standard for Soy Sauce G/TBT/N/JPN/297. The total acid content was increased significantly to 10.5 g.Math.L.sup.?1 and 10.1 g.Math.L.sup.?1, and the pH value was decreased significantly. Under the salt concentrations of 18 g.Math.100 mL.sup.?1 and 15 g.Math.100 mL.sup.?1, the amino acid nitrogen contents of the soy sauce after 40 days of fermentation were 1.18 g.Math.100 mL.sup.?1 and 1.08 g.Math.100 mL.sup.?1, which are all in line with Chinese Standard for Special Grade Soy Sauce GB2717-2018 (1 g.Math.100 mL.sup.?1) and Japanese Quality Standard for Soy Sauce G/TBT/N/JPN/297, and the total acid contents were 5.9 g.Math.L.sup.?1 and 5.5 g.Math.L.sup.?1.

(45) (b) The biogenic amine content of the reduced-salt fermented crude soy sauce of high-salt dilute-state soy sauce:

(46) The biogenic amine contents of soy sauce with different salt concentrations were detected by high performance liquid chromatography. The results are shown in FIG. 2. The contents and types of biogenic amines in soy sauce fermented under salt concentrations of 12 g.Math.100 mL.sup.?1 and 9 g.Math.100 mL.sup.?1 were significantly higher than those fermented under salt concentrations of 18 g.Math.100 mL.sup.?1and 15 g.Math.100 mL.sup.?1, and the total biogenic amine contents after 40 days of fermentation were 612.423 mg.Math.L.sup.?1 and 904.49 mg.Math.L.sup.?1, respectively. Under the salt concentrations of 18 g.Math.100 mL.sup.?1 and 15 g.Math.100 mL.sup.?1, the biogenic amine contents were 18.99 mg.Math.L.sup.?1 and 39.79 mg.Math.L.sup.?1.

(47) (c) Volatiles changes of salt-reduced fermented soy sauce:

(48) At the end of fermentation (day 40), three parallel samples were taken from each sample. After filtering and mixing, 5 mL of soy sauce samples were accurately measured and put in 20 mL headspace sample bottles, 83.36 ?g.Math.L.sup.?1 2-octanol was added as an internal standard, the bottles were sealed immediately after mixing, and determination was performed. After the determination, the sample mass spectrum was compared with the NIST 2.0 standard library for identification. volatiles were qualitatively analyzed based on the retention index (RI). According to the area of the internal standard 2-octanol, the volatiles were quantitatively analyzed.

(49) The results are shown in FIG. 3. The total volatiles content of the low-salt soy sauce prepared under a salt concentration of 12 g.Math.100 mL.sup.?1 was increased compared with that in the one prepared in the presence of 18 g.Math.100 mL.sup.?1 salt. The content of alcohols and esters in the main volatiles of the soy sauce was decreased significantly, the content of 4-ethylguaiacol was decreased by 32.3%; the content of furanone (HEMF) was decreased by 25.4%; the content of 1-octene-3-ol was decreased by 18.4%; the content of alcohols was decreased by 39.2% to 732.15 ?g.Math.L.sup.?1; and the content of esters was decreased by 44.59% to 92.33 ?g.Math.L.sup.?1.

(50) (d) Changes in spoilage microorganisms in the salt-reduced fermentation process of high-salt dilute-state soy sauce

(51) Metagenomic preparation: An appropriate amount of soy sauce mash sample was weighed into a beaker, and washed twice with a sterile saline solution. The washed soy sauce mash was transferred to a mortar, liquid nitrogen was added, and the mixture was ground thoroughly to break cells. Then a microbial genome was extracted by a Power Max? Soil DNA Isolation Kit according to instructions. The concentration of microbial genomic DNA was determined by a Nano Drop2000 ultra-micro spectrophotometer and the purity was evaluated. Specific primers were designed with 16S rDNA sequences of B. megaterium, B. halodurans, B. subtilis, Kurthia, S. saparophytics, and L. pobuzihii for RT-qPCR amplification. The quantification of microorganisms adopted an absolute quantification method, that is, a standard curve was prepared with a standard substance of known concentration, and the copy number of the sample of unknown concentration was determined. 10-fold gradient dilution was performed on the standard substance, and then the standard substance was used as a template for performing the RT-qPCR reaction. When the reaction was complete, a standard curve was drawn with a cycle threshold Ct as an abscissa and the logarithm of the standard concentration as an ordinate.

(52) TABLE-US-00001 TABLE1 Primersusedinthispatent Target Amplification sequences Primers Primersequences(5-3) length(bp) Kurthia KurR CTGGATCACGGTTTACTTCAC(SEQIDNO:3) 182 KurF CCATTACCATCAATACCTGCA(SEQIDNO:4) L.pobuzihii PoF ACTTACTTTCCAAATGTCGA(SEQIDNO:5) 212 PoR TCGTTCTAAGTATGGTGCGA(SEQIDNO:6) S.saprophytics StaF CAATTATAATTAACTAAGGT(SEQIDNO:7) 190 StaR TTACAAGGGAATCATTAACT(SEQIDNO:8) Bacillus BacF TCATTACAAATATAACAAG(SEQIDNO:9) 167 BacR AGCTTGTTCTACTGTATCC(SEQIDNO:10) B.megaterium MegF TCAGAACTCAGCGAAATCGAGA(SEQIDNO:11) 205 MegR CTATATAAGGAGAGGAATGGT(SEQIDNO:12) B.halodurans HalF TTTGGTGGCGATAGCGAAGAG(SEQIDNO:13) 198 HalR GAGTAGGACGCTGCCAAGC(SEQIDNO:14) B.subtilis SubF ACCGCGTTCGCCTCATTGAACA(SEQIDNO:15) 211 SubR AGCGCTCCAAGCGCTAGCACG(SEQIDNO:16)

(53) Taking B. subtilis, B. halodurans, B. megaterium, S. saprophytics, K. zopfii and L. pobuzihii as the representative microorganisms of spoilage bacteria, the results are shown in FIG. 4. At the beginning of fermentation, the total number of the spoilage bacteria in the soy sauce fermentation system with different salt concentrations was less than or equal to 50 CFU.Math.g.sup.?1. In the soy sauce mash sample with a salt concentration of 12 g.Math.100 mL.sup.?1, the contents of B. subtilis, B. halodurans, B. megaterium, S. saprophytics, K. zopfii and L. pobuzihii at the end of fermentation were 5.3?10.sup.4 CFU.Math.g.sup.?1, 1.1?10.sup.4 CFU.Math.g.sup.?1, 8.3?10.sup.5 CFU.Math.g.sup.?1, 3.4?10.sup.4 CFU.Math.g.sup.?1, 1.4?10.sup.5 CFU.Math.g.sup.?1, and 2.5?10.sup.4 CFU.Math.g.sup.?1, respectively. At the end of fermentation (40 days) under a salt concentration of 9 g.Math.100 mL.sup.?1, the contents of B. subtilis, B. halodurans, B. megaterium, S. saprophytics, K. zopfii and L. pobuzihii were 9.5?10.sup.4 CFU.Math.g.sup.?1, 2.1?10.sup.4 CFU.Math.g.sup.?1, 1.1?10.sup.6 CFU.Math.g.sup.?1, 4.4?10.sup.5 CFU.Math.g.sup.?1, 2.5?10.sup.5 CFU.Math.g.sup.?1, and 3.6?10.sup.4 CFU g.sup.?1, respectively. The contents of B. subtilis, B. halodurans, B. megaterium, S. saprophytics, K. zopfii and L. pobuzihii at the end of fermentation under a salt concentration of 18 g.Math.100 mL.sup.?1 were 2.8?10.sup.2 CFU.Math.g.sup.?1, 1.3?10.sup.2 CFU.Math.g.sup.?1, 1.6?10.sup.3 CFU.Math.g.sup.?1, 1.5?10.sup.2 CFU.Math.g.sup.?1, 6.1?10.sup.2 CFU.Math.g.sup.?1, and 1.1?10.sup.2 CFU.Math.g.sup.?1, respectively. The contents of B. subtilis, B. halodurans, B. megaterium, S. saprophytics, Kurthia and L. pobuzihii at the end of fermentation under a salt concentration of 15 g.Math.100 mL.sup.?1 were 4.1?10.sup.2 CFU.Math.g.sup.?1, 1.4?10.sup.2 CFU.Math.g.sup.?1, 1.8?10.sup.2 CFU.Math.g.sup.?1, 1.7?10.sup.2 CFU.Math.g.sup.?1, 6.3?10.sup.2 CFU.Math.g.sup.?1, and 2.4?10.sup.2 CFU.Math.g.sup.?1, respectively. The above results show that the contents of spoilage bacteria in the soy sauce prepared by fermentation after reducing the salt concentration of the high-salt dilute-state soy sauce significantly increase.

Example 2

Screening of Strains for Inhibition of Spoilage Bacteria and Identification of their Antibacterial Spectrum

(54) (1) Screening of Weissella

(55) Weissella was isolated by plating serial dilutions of soy sauce mash on a MRS medium containing vancomycin (0.2 g.Math.L.sup.?1) and natamycin (0.1 g.Math.L.sup.?1). Soy sauce mash samples were selected on the day 5, day 20 and day 35 of fermentation, 15 g of soy sauce mash was taken and put in a beaker, and 135 mL of sterile normal saline and an appropriate amount of glass beads were added and shaken at 100 r.Math.min.sup.?1 for 5 min. After standing at room temperature for 5 min, 1 mL of the bacterial suspension was taken, spread after gradient dilution on the MRS medium containing vancomycin (0.2 g.Math.L.sup.?1) and natamycin (0.1 g.Math.L.sup.?1), and cultured at 37? C. for 1-3 d, and a single colony was picked for streaking to obtain a pure strain.

(56) (2) Screening of B. amyloliquefaciens

(57) 5 g of soy sauce mash was taken and put in 100 mL beef extract peptone liquid medium with glass beads and cultured statically at 37? C. for 1-3 d; the upper-layer bacterial solution was subjected to gradient dilution and spread in a beef extract peptone medium, and cultured at 37? C. for 1-3 d; and single colonies were picked for streaking on a beef extract peptone solid medium to obtain single colonies.

(58) (3) Identification of strains

(59) Genomic DNA was extracted from the culture broth of the above strains using a bacterial genomic DNA extraction kit of Tiangen Biotech Co., LTD. The general primers 27F and 1492R of the bacterial 16S rRNA gene were used for PCR amplification, and the PCR products were sent to Talen-Bio Scientific (Wuxi) Co., Ltd. for sequencing. The 16S rRNA gene sequence obtained by sequencing was submitted to GenBank for BLAST comparison and identification of bacterial species.

(60) TABLE-US-00002 27F(5-AGAGTTTGATCCTGGCTCAG-3,SEQIDNO:17) and 1492R(5-GGTTACCTTGTTACGACTT-3,SEQIDNO:18)

(61) A PCR reaction system (50 ?L): 2 ?L of template (50 mg.Math.L.sup.?1), 1 ?L of forward and reverse primers (10 ?mol.Math.L.sup.?1) each, 25 ?L of PCR Master Mix, and 21 ?L of double distilled water. Reaction conditions: 94? C. for 3 min; 94? C. for 1 min; 55? C. for 1 min; 72? C. for 2 min, 30 cycles; and 72? C. for 10 min. The PCR products were sent to Talen-Bio Scientific (Wuxi) Co., Ltd. for sequencing, and the sequencing results were compared in the NCBI Genbank database. The results showed that Weissella was identified as W. paramesenteroides, named JL-5; and Bacillus was identified as B. amyloliquefaciens, named JDF-2.

(62) TABLE-US-00003 TABLE 2 Identification of screened strains by BLAST 16S rDNA sequences Strains NCBI comparison results Similarity of strains JDF-2 B. amyloliquefaciens 99% SEQ ID NO: 1 JL-5 W. paramesenteroides 99% SEQ ID NO: 2

(63) (4) Verification of the antibacterial activity of isolated strains

(64) Cultivation of strains:

(65) B. subtilis, B. megaterium, B. halodurans, B. amyloliquefaciens, K. zopfii and K. gibosonii were cultured statically at 37? C. in LB medium; W. paramesenteroides, Weissella confusa, Weissella cibaria, T. halophilus and L. pobuzihii were cultured statically at 37? C. in MRS medium; S. saprophytics was cultured statically at 37? C. in nutrient broth medium; and each strain was cultured for 1-2 d.

(66) (1) Preparation of strain fermentation supernatants: B. amyloliquefaciens JDF-2 was inoculated in the LB medium, Weissella and T. halophilus were inoculated in the MRS media, and the strains were cultured at 37? C. and 30? C. respectively to 10.sup.7 CFU.Math.mL.sup.?1. An appropriate amount of fermentation broth was taken and centrifuged at 12,000 r.Math.min.sup.?1 and 4? C. for 5 min, and the supernatants were collected and filtered through a 0.22 ?m filter membrane for later use.

(67) (2) Screening of antibacterial microorganisms by an oxford cup method: The indicator bacteria cultured to the logarithmic phase (the bacterial concentration was 10.sup.7 CFU.Math.mL.sup.?1) were mixed with soft agar media at 1:50 (v:v), and then the mixtures were poured onto lower-layer media in which oxford cups were placed. After the soft agar were solidified, the oxford cups were taken out, 100 ?L of the supernatants of B. amyloliquefaciens JDF-2, W. paramesenteroides JL-5, W. confusa 20, W. cibaria 35, W. paramesenteroides LCW-28 and T. halophilus R44 prepared in step (1) were added to the corresponding wells, and sterile water was added as a control. Then plates were placed in an incubator for culture for 20 h to investigate whether the fermentation of the strains has inhibitory effects on the indicator bacteria. 3 parallels were made for each indicator bacterium. The indicator bacteria were various bacteria derived from soy sauce.

(68) The results are shown in Table 3. W. paramesenteroides JL-5 has a significant inhibitory effect on Bacillus (B. subtilis, B. megaterium and B. halodurans) and S. saprophytic. Among them, the inhibitory effect on B. halodurans was the most obvious, and the diameter of the inhibition zone reached 1.77 cm. B. amyloliquefaciens JDF-2 has the most obvious inhibitory effects on K. zopfii, K. gibsonii and L. pobuzihii.

(69) TABLE-US-00004 TABLE 3 Comparison of the inhibition of common spoilages in soy sauce by soy sauce moromi mash isolates B. B. B. S. K. K. L. subtilis megaterium halodurans saprophytics zopfii gibsonii pobuzihii W. paramesenteroides JL-5 1.44* 1.56 1.77 0.23 0.18 0.09 0 W. confusa 20 0.84 0.45 1.02 0 0 0 0 W. cibaria 35 0.55 1.21 0 0.33 0 0 0 W. paramesenteroides LCW-28 0.62 1.4 1.52 0 0 0 0 T. halophilus R44 0.32 0.14 0 0 0 0 0 B. amyloliquefaciens JDF-2 0 0 0 0.22 0.54 0.42 0.25 *the data in the table is the diameter of an inhibition zone (cm).

Example 3

Cooperative Fermentation with Weissella and B. amyloliquefaciens to Prepare High-Salt Dilute-State Salt-Reduced Soy Sauce

(70) Cultivation of W. paramesenteroides: Single colonies of W. paramesenteroides JL-5 screened in Example 2 were picked and inoculated into a MRS medium, cultured statically at 37? C. for 24 h, transferred to a fresh MRS medium at a ratio of 1% (v/v), and cultured at 37? C. until the OD.sub.600 reached 3.0.

(71) Culture of B. amyloliquefaciens: Single colonies of B. amyloliquefaciens JDF-2 were picked and inoculated into a liquid LB medium, cultured statically at 37? C. for 24 h, transferred to a fresh LB medium at a ratio of 1% (v/v), and cultured at 37? C. until the OD.sub.600 reached 3.0.

(72) Culture of Z. rouxii: Single colonies of Z. rouxii were picked and inoculated into a liquid YPD media, cultured at 30? C. and 220 r.Math.min.sup.?1 for 30 h, inoculated into a fresh YPD medium at a ratio of 1% (v/v), and cultured until the OD.sub.600 reached 4.0.

(73) Low-salt dilute-state soy sauce fermentation process:

(74) (1) Koji making process: Defat soybeans were steamed at 121? C. (0.1 MPa) for 20 min, uniformly mixing the cooled soybean with wheat flour at a mass ratio of (4-6):1, a soy sauce koji starter accounting for 1.5% of the total mass of the mixed raw materials was added and uniformly mixed, the mixture was cultured at 30? C., the koji was turned at the right time, and the finished koji was prepared after 48 h when the surface of the koji is covered with yellow-green hyphae.

(75) (2) Fermentation process: The finished koji prepared in step (1) was mixed with NaCl brine at a volume ratio of 1:2.5, Z. rouxii ZQ01 (10.sup.7 CFU.Math.g.sup.?1) was added on day 3-day 5, and the mixture was fermented at 30? C. for 40 days while being stirred once a day during fermentation.

(76) A total of 6 groups of soy sauce mash were set up for fermentation, as follows:

(77) (a) Group A: the salt concentration of the soy sauce mash mixed with the brine in step (2) was controlled at 18 g.Math.100 mL.sup.?1;

(78) (b) Group B: the salt concentration of the soy sauce mash mixed with the brine in step (2) was controlled at 12 g.Math.100 mL.sup.?1;

(79) (c) Group C: the salt concentration of the soy sauce mash mixed with the brine in step (2) was controlled at 12 g.Math.100 mL.sup.?1, and W. paramesenteroides JL-5 with a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 was added to the soy sauce mash system;

(80) (d) Group D: the salt concentration of the soy sauce mash mixed with the brine in step (2) was controlled at 12 g.Math.100 mL.sup.?1, and B. amyloliquefaciens JDF-2 with a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 was added to the soy sauce mash system;

(81) (e) Group E: the salt concentration of the soy sauce mash mixed with the brine in step (2) was controlled at 12 g.Math.100 mL.sup.?1, and W. paramesenteroides JL-5 with a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 and B. amyloliquefaciens JDF-2 with a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 were added to the soy sauce mash system; and

(82) (f) Group F: the salt concentration of the soy sauce mash mixed with the brine in step (2) was controlled at 12 g.Math.100 mL.sup.?1, the addition of Z. rouxii was omitted, and W. paramesenteroides JL-5 with a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 and B. amyloliquefaciens JDF-2 with a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 were added to the soy sauce mash system.

(83) The physicochemical indexes of the soy sauce samples in the groups A-F were detected. The results show that: Groups A and E can make the amino acid nitrogen content reach 1.2 g.Math.100 mL.sup.?1 and 1.16 g.Math.100 mL.sup.?1, and the total acid content reach 8.1 g.Math.L.sup.?1 and 7.5 g.Math.L.sup.?1. The amino acid nitrogen contents of Groups C and F can reach 1.08 g.Math.100 mL.sup.?1 and 1.04 g.Math.100 mL.sup.?1 respectively, and the amino acid nitrogen content of Group D is relatively low, only 0.85 g.Math.100 mL.sup.?1. However, the fermented soy sauces of the above groups all meet the Chinese Hygienic Standard for Soy Sauce GB2717-2018 and the Japanese Quality Standard for Soy Sauce G/TBT/N/JPN/297. The amino acid nitrogen content of Group B is 0.38 g.Math.100 mL.sup.?1, which does not meet the Chinese Hygienic Standard for Soy Sauce GB2717-2018 and the Japanese Quality Standard for Soy Sauce G/TBT/N/JPN/297.

(84) The contents of volatiles in soy sauce samples with different strain addition methods were detected, and the results are shown in FIG. 8: the total content of flavor substances in Group E was 2674.39 ?g.Math.L.sup.?1, which was increased by 20.64% compared with that in Group B; the content of esters was 437.72 ?g.Math.L.sup.?1, which was 3.74 times higher than that in Group B; and the content of alcohols was 1181.66 ?g.Math.L.sup.?1, which was 70.72% higher than that in Group B. This indicates that the W. paramesenteroides JL-5 and the B. amyloliquefaciens JDF-2 can jointly promote the formation of volatiles in soy sauce. The contents of volatiles of Group C with the W. paramesenteroides JL-5 added alone and Group D with the B. amyloliquefaciens JDF-2 added alone were 2283.84 ?g.Math.L.sup.?1 and 2252.86 ?g.Math.L.sup.?1 respectively, and compared with group B, the contents of esters were increased by 2.9 times and 2.7 times respectively, but the contents of alcohols were reduced by 26% and 14.4% respectively. In the soy sauce fermented in Group F, the total content of volatiles was increased to 2430.7 ?g.Math.L.sup.?1, the content of esters was increased by 3.3 times, and the content of alcohols was decreased by 9.7%.

(85) The biogenic amine contents in soy sauce samples with different addition methods were detected, and the results showed that compared with Group B, the total biogenic amine content in Group E was 93.365 mg.Math.L.sup.?1, which was decreased by 84.65%, wherein the contents of histamine and tyramine were 21.21 mg.Math.L.sup.?1 and 12.332 mg.Math.L.sup.?1, which were decreased by 90.06% and 92.53% respectively. The total biogenic amine contents in Group C and Group F were 179.8 mg.Math.L.sup.?1 and 216.1 mg.Math.L.sup.?1 respectively, which were reduced by 70.6% and 64.7% respectively compared with Group B.

Example 4

Application of W. paramesenteroides to Inhibit Spoilage Bacteria in a Simulated Soy Sauce Fermentation System

(86) Miscellaneous bacteria and spoilage bacteria (B. subtilis, B. megaterium, B. halodurans, S. saprophytics, L. pobuzihii and K. zopfii) were combined with equal amount and added in the soy sauce mash fermentation medium (supplemented with salt 10-12 g.Math.100 mL.sup.?1) with a total concentration of 1.0?10.sup.6 CFU.Math.mL.sup.?1, for simulated soy sauce fermentation. Then, the strains capable of inhibiting the growth of the spoilage bacteria were inoculated into the simulated fermentation systems by the following methods to verify the conditions that the strains inhibit the growth of the spoilage bacteria in the systems.

(87) Strain addition methods:

(88) (1) W. paramesenteroides JL-5 and B. amyloliquefaciens JDF-2 were added at a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1 at a ratio of bacterial cell numbers of 1:1.

(89) (2) T. halophilus R44 was added separately at a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1; and the T. halophilus R44 was disclosed in the paper Effect of Enrichment Tetragenococcus halophilus on Simulated Fermentation of Low-Salt Soy Sauce published in 2020.

(90) (3) W. paramesenteroides LCW-28 was added separately at a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1; and the W. paramesenteroides LCW-28 was disclosed in the patent Method for Increasing Content of Flavor Substances in Soy Sauce published in 2020.

(91) (4) W. cibaria 35 and W. confusa 20 were added separately at a final concentration of 1.0?10.sup.7 CFU.Math.g.sup.?1; and the W. cibaria 35 and W. confusa 20 were disclosed in the paper Detection of Characteristics of Weissella Strains and Their Contents in Soy Sauce Moromi Mash during Soy Sauce Fermentation published in 2018.

(92) The results are shown in FIG. 5. When W. paramesenteroides JL-5 was added alone, on day 20 of fermentation, the number of B. megaterium, B. subtilis, B. halodurans and S. saprophytics in simulated fermentation mash were 1.2?10.sup.3 CFU.Math.g.sup.?1, 6.3?10.sup.3 CFU.Math.g.sup.?1, 1.1?10.sup.4 CFU.Math.g.sup.?1 and 1.3?10.sup.3 CFU.Math.g.sup.?1, respectively. And compared with the control group, the above spoilage bacteria were significantly inhibited, but the numbers of K. zopfii and L. pobuzihii were not significantly reduced.

(93) When the B. amyloliquefaciens JDF-2 was added alone, L. pobuzihii and K. zopfii in the fermentation system can be significantly inhibited, and the bacterial cell concentrations were reduced to 1.0?10.sup.4 CFU.Math.g.sup.?1 and 2.3?10.sup.5 CFU.Math.g.sup.?1 on day 20 of fermentation, respectively. The B. amyloliquefaciens JDF-2 has no significant inhibitory effect on other spoilage bacteria and miscellaneous bacteria.

(94) Co-inoculation of the W. paramesenteroides JL-5 and the B. amyloliquefaciens JDF-2 could significantly inhibit the growth of 6 types of spoilage bacteria, and on day 20 of fermentation, the contents of B. megaterium, B. subtilis, B. halodurans, S. saprophytics, K. zopfii and L. pobuzihii were reduced to 1.0?10.sup.3 CFU.Math.g.sup.?1, 6.1?10.sup.3 CFU.Math.g.sup.?1, 6.7?10.sup.3 CFU.Math.g.sup.?1, 1.0?10.sup.3 CFU.Math.g.sup.?1, 8.2?10.sup.3 CFU.Math.g.sup.?1 and 5.3?10.sup.3 CFU g.sup.?1, respectively.

Example 5

Preparation of High-Salt Dilute-State Soy Sauce Fermentation with Reduced-Salt Content by using Weissella and/or B. amyloliquefaciens

(95) Koji making process: Defat soybeans were steamed at 121? C. (0.1 MPa) for 20 min., uniformly mixing the cooled soybean with wheat flour at a mass ratio of (4-6):1, a soy sauce koji starter accounting for 1.5% of the total mass of the raw materials was added and mixed, the mixture was cultured at 30? C. for 40-48 h until the surface of the koji was covered with yellow-green hyphae.

(96) Fermentation process: The finished koji was mixed with brine containing 150-250 g.Math.L.sup.?1 NaCl at a volume ratio of 1:(2-3). The mixed soy sauce mash was fermented, wherein the final salt concentration in the system reached 10-12 g.Math.100 mL.sup.?1, and fermenting was performed at 30? C. for 40 -60 days. The soy sauce mash was stirred once a day in the early stage of fermentation and twice a week in the later stage of fermentation.

(97) Addition of strains: W. paramesenteroides JL-5 and B. amyloliquefaciens JDF-2 were added to the soy sauce mash with an inoculation size of 3%-5%, so that the bacterial cell number after inoculation was greater than 1?10.sup.7 CFU.Math.g.sup.?1. When the pH of the soy sauce mash was 5.0-5.5, Z. rouxii was added with an inoculation size of 3%, so that the yeast cell number was greater than 1?10.sup.8 CFU.Math.g.sup.?1.

(98) Criteria for physiochemical properties of soy sauce mash and bacteria population: The number of spoilage bacteria (B. subtilis, B. megaterium, B. halodurans, K. zopfii, L. pobuzihii and S. saprophytics) should be less than or equal to 1.0?10.sup.4 CFU.Math.g.sup.?1, the amino acid nitrogen content was controlled to be greater than or equal to 1 g.Math.100 mL.sup.?1, the total acid content was less than or equal to 12 g.Math.L.sup.?1, and the pH was controlled at 5-5.5.

(99) The finished product after fermentation had an amino acid nitrogen content of greater than or equal to 1.2 g.Math.100 mL.sup.?1, contents of various spoilage bacteria of less than 1.0?10.sup.3 CFU.Math.g.sup.?1, a NaCl concentration of 10 g-12 g.Math.100 mL.sup.?1, and a sodium content of 380 mg -420 mg.Math.10 mL.sup.?1.

Example 6

Application of W. paramesenteroides and B. amyloliquefaciens to Improve the Quality Stability in the Shelf Life of Low-Salt Soy Sauce

(100) Soy sauce were prepared according to the methods of Example 3, and the soy sauce were divided into 4 groups according to the following methods, namely:

(101) Group a: a soy sauce with an initial fermentation salt concentration of 12 g.Math.100 mL.sup.?1 was prepared according to the method of Group B in Example 3;

(102) Group b: potassium sorbate with a final concentration of 1 g.Math.L.sup.?1 was added on the basis of the soy sauce prepared in Group a;

(103) Group c: a soy sauce with an initial fermentation salt concentration of 18 g.Math.100 mL.sup.?1 was prepared according to the method of Group A in Example 3; and

(104) Group d: a soy sauce was prepared according to the method of Group E in Example 3.

(105) After the fermentation, the soy sauce mash was squeezed and filtered with gauze to obtain crude soy sauce. The crude soy sauce samples were sterilized at 121? C. for 20 min, and aseptically transferred into 1 L sterile glass bottles, and the bottles were sealed and placed at room temperature for 0-60 d. Samples were taken on day 0, day 10, day 30, and day 60.

(106) According to the Chinese Hygienic Standard for Soy Sauce (GB2717-2018), the total number of bacteria in soy sauce shall be less than 5?10.sup.3 CFU.Math.mL.sup.?1, and the coliform group shall be less than 10 CFU.Math.mL.sup.?1. The results showed that: on day 10 of storage, the total number of bacteria in Group a was 3.2?10.sup.4 CFU.Math.mL.sup.?1, which did not meet the hygienic standards for soy sauce. On day 30 of storage, the total number of bacteria in Group a reached 6.8?10.sup.7 CFU.Math.mL.sup.?1, which exceeded the hygienic standards for soy sauce by 4 orders of magnitude; Group b reached 4.1?10.sup.4 CFU.Math.mL.sup.?1, which did not meet the hygienic standards for soy sauce; and both Group c and d met the hygienic standards for soy sauce. On day 60 of storage, the total numbers of bacteria in Groups c and d were both lower than 5?10.sup.3 CFU.Math.mL.sup.?1, which met the hygienic standards for soy sauce; and the total number of colonies in Group a was 6.2?10.sup.9 CFU.Math.mL.sup.?1, and Group b reached 3.5?10.sup.5 CFU.Math.mL.sup.?1, both of which exceeded the hygienic standards for soy sauce. The above results confirm that the low-salt soy sauce produced by synergistic fermentation with the W. paramesenteroides JL-5 and the B. amyloliquefaciens JDF -2 maintains good and stable quality in the shelf life without adding any preservatives, which is of great significance to prolong the shelf life of low-salt soy sauce without preservatives. When the soy sauce prepared by this method was stored for 60 days, the total number of microorganisms was not significantly different from that of a high-salt dilute-state soy sauce, which met the hygienic standards for soy sauce. The low-salt soy sauce with W. paramesenteroides JL-5 and B. amyloliquefaciens JDF-2 added for cooperative fermentation in this patent has better quality stability in the shelf life than the low-salt soy sauce with preservatives.

(107) TABLE-US-00005 TABLE 4 Microbial changes in low-salt soy sauce at different storage times 0 d 10 d 30 d 60 d Total Total Total Total number number number number of bacteria Coliform of bacteria Coliform of bacteria Coliform of bacteria Coliform Storage (CFU .Math. (CFU .Math. (CFU .Math. (CFU .Math. (CFU .Math. (CFU .Math. (CFU .Math. (CFU .Math. Group mL.sup.?1) mL.sup.?1) mL.sup.?1) mL.sup.?1) mL.sup.?1) mL.sup.?1) mL.sup.?1) mL.sup.?1) a 0 0 6.1 ? 10.sup.4 1.1 ? 10.sup.2 6.8 ? 10.sup.7 2.2 ? 10.sup.2 6.2 ? 10.sup.9 1.8 ? 10.sup.3 b 0 0 1.3 ? 10.sup.2 9 4.1 ? 10.sup.4 13 3.5 ? 10.sup.5 28 c 0 0 23 8 95 11 2.8 ? 10.sup.2 18 d 0 0 18 5 65 8 2.3 ? 10.sup.2 20

(108) Although the present disclosure has been disclosed as above in preferred examples, it is not intended to limit the present disclosure. Anyone skilled in the art can make various changes and modifications without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure should be defined by the claims.