N-(2-AMINOETHYL)MORPHOLINE-BASED RNA ANALOGS, METHOD FOR THE PREPARATION AND USE THEREOF
20240182512 ยท 2024-06-06
Assignee
Inventors
- Adam MAMOT (Warszawa, PL)
- Pawel SIKORSKI (Warszawa, PL)
- Joanna KOWALSKA (Warszawa, PL)
- Jacek JEMIELITY (Warszawa, PL)
Cpc classification
C07D311/90
CHEMISTRY; METALLURGY
C07H1/00
CHEMISTRY; METALLURGY
C09B11/245
CHEMISTRY; METALLURGY
International classification
Abstract
The subject of the invention is RNA analogs, their preparation and application, inter alia, in microscopic observations, study of the gene expression process and monitoring of enzyme activity.
Claims
1. An RNA analog of formula 1: ##STR00053## where: R.sub.1 is: RNA chain of formula 2a: ##STR00054## wherein: n is a natural number in the range from 1 to 10,000, m is a natural number in the range from 0 to 3, X.sub.1 is independently: OH or OCH.sub.3, or RNA chain of formula 2b: ##STR00055## wherein: n is a natural number in the range from 1 to 10,000, X.sub.1 is independently: OH or OCH.sub.3, X.sub.2 is N.sub.3 or ##STR00056## group, or an RNA chain of formula 2c: ##STR00057## wherein: n is a natural number in the range from 1 to 10,000, m is a natural number in the range from 1 to 4, X.sub.1 is independently: OH or OCH.sub.3 X.sub.2 and X.sub.3 are independently: OH, OCH.sub.3, or ##STR00058## R.sub.2 is a natural or modified purine or pyrimidine nitrogenous base, preferably selected from: ##STR00059## R.sub.3 is a functional substituent such as: a substituent containing a bioorthogonal group of formula 3a: ##STR00060## wherein Y is NH.sub.2, N.sub.3 or ##STR00061## group or a substituent having the structure of a fluorophore from the cyanine group of formula 3b: ##STR00062## wherein: Y.sub.1 and Y.sub.2 are independently: CH.sub.3, (CH.sub.2).sub.3SO.sub.3H or (CH.sub.2).sub.4SO.sub.3H, Z.sub.1 and Z.sub.2 are independently: SO.sub.3H or H, or a substituent having the structure of a fluorophore from the rhodamine or fluorescein group of formula 3c: ##STR00063## wherein: Y.sub.1 and Y.sub.2 are independently: SO.sub.3, OCH.sub.3, OH, COOH or H, Z.sub.1 and Z.sub.2 are independently: NH or O, Z.sub.3 is NH.sub.2 or OH group, or a substituent having the structure of a fluorophore from the rhodamine group of formula 3d: ##STR00064## wherein: Y.sub.1 and Y.sub.2 are independently: SO.sub.3H, OCH.sub.3, OH, COOH or H, Y.sub.3 is CH.sub.2CH.sub.3, CH.sub.3 or H group, Z.sub.1 and Z.sub.2 are independently: NH or O, Z.sub.3 is NH.sub.2 or OH group, or a substituent having an affinity tag structure of formula 3e: ##STR00065## or a substituent having a nucleic acid structure of formula 3f: ##STR00066## wherein: Y is independently: OCH.sub.3, OH or H, n is a natural number in the range from 1 to 30, R.sub.2 is nitrogenous base as above, or a substituent having a nucleic acid structure of formula 3g: ##STR00067## wherein: Y is independently OCH.sub.3, OH or H group, m is a natural number in the range from 1 to 4, n is a natural number in the range from 1 to 30, R.sub.2 is nitrogenous base as above, or a substituent having a nucleic acid structure of formula 3h: ##STR00068## wherein: Y is independently OCH.sub.3, OH or H group, m is a natural number in the range from 1 to 4, n is a natural number in the range from 1 to 30, R.sub.2 is nitrogenous base as above, wherein in the above formulas (3a to 3h) X is a linker of formula being any group or a serial combination of many of the following groups: ##STR00069## wherein m is a natural number ranging from 1 to 10.
2. A method for the preparation of an RNA analog of formula 1, as defined in claim 1, characterized in that the solution of RNA of formula 4: ##STR00070## is subjected to successive: (i) incubation with metaperiodic acid (HIO.sub.4), with its salt, a solution of metaperiodic acid (HIO.sub.4) or its salt, to provide a compound of formula 5: ##STR00071## (ii) incubation in a reducing medium with an ethylenediamine analog of formula 6: ##STR00072## to give an RNA analog of formula 1: ##STR00073## wherein the meaning of the groups R.sub.1, R.sub.2 and R.sub.3 in the above formulas is defined in claim 1.
3. The method according to claim 2, characterized in that steps (i) and (ii) are carried out in one reactor.
4. The method according to claim 2, characterized in that the RNA is: compound of formula 4a: ##STR00074## wherein: n is a natural number in the range from 1 to 10,000, m is a natural number in the range from 0 to 3, X1 is independently: OCH3 or OH, or compound of formula 4b. ##STR00075## wherein: n is a natural number in the range from 1 to 10,000, X1 is independently: OH or CH3 group, X.sub.2 is N.sub.3 or ##STR00076## group, or a compound of formula 4c: ##STR00077## wherein: n is a natural number in the range from 1 to 10,000, m is a natural number in the range from 1 to 4, X.sub.1 is independently: OH or OCH.sub.3 X.sub.2 and X.sub.3 are independently: OH, OCH.sub.3, ##STR00078##
5. The method according to claim 2, characterized in that step (i) is carried out in the presence of NaIO.sub.4, preferably at a concentration of 1.0 to 1.5 mM, at a temperature below 40? C., and at the RNA concentration of 1 to 100 ?M.
6. The method according to claim 2, characterized in that step (ii) is carried out in the presence of a KH.sub.2PO.sub.4 buffer, preferably at pH 5.5-7.5, a NaBH.sub.3CN reducing agent at a concentration not exceeding 100 mM, preferably at a concentration of 20 mM, and an ethylenediamine analog at a concentration of 1-10 mM.
7. The method according to claim 2, characterized in that the obtained RNA analog is isolated from the reaction mixture by a known method of RNA isolation, preferably by alcohol precipitation of the RNA salt or by means of high-performance liquid chromatography (HPLC).
8. Ethylenediamine analog of formula 7: ##STR00079## wherein R is: a substituent having the structure of a fluorophore from the cyanine group of the formula 7a: ##STR00080## wherein: Y.sub.1 and Y.sub.2 are independently: CH.sub.3, (CH.sub.2).sub.3SO.sub.3H or (CH.sub.2).sub.4SO.sub.3H, Z.sub.1 and Z.sub.2 are independently: SO.sub.3H or H, or a substituent having the structure of a fluorophore from the rhodamine or fluorescein group of formula 7b: ##STR00081## wherein: Y.sub.1 and Y.sub.2 are independently: SO.sub.3H, OCH.sub.3, OH, COOH or H, Z.sub.1 and Z.sub.2 are independently: NH or O, Z.sub.3 is NH.sub.2 or OH group, or a substituent having the structure of a fluorophore from the rhodamine group of formula 7c: ##STR00082## wherein: Y.sub.1 and Y.sub.2 are independently: SO.sub.3H, OCH.sub.3, OH, COOH or H, Y.sub.3 is CH.sub.2CH.sub.3, CH.sub.3 or H group, Z.sub.1 and Z.sub.2 are independently: NH or O, Z.sub.3 is NH.sub.2 or OH group, or a substituent having an affinity tag structure of formula 7d: ##STR00083## or a substituent having a nucleic acid structure of formula 7e: ##STR00084## wherein: Y is independently OCH.sub.3, OH or H group, n is a natural number in the range from 1 to 30, R.sub.2 is nitrogenous base as above, or a substituent having a nucleic acid structure of formula 7f: ##STR00085## wherein: Y is independently OCH.sub.3, OH or H group, m is a natural number in the range from 1 to 4, n is a natural number in the range from 1 to 30, R.sub.2 is nitrogenous base as above, or a substituent having a nucleic acid structure of formula 7g: ##STR00086## wherein: Y is independently OCH.sub.3, OH or H group, m is a natural number in the range from 1 to 4, n is a natural number in the range from 1 to 30, R2 is nitrogenous base as above, wherein in the above formulas (7a to 7g) X is a linker of formula being any group or a serial combination of many of the following groups: ##STR00087## wherein m is a natural number ranging from 1 to 10.
9. The ethylenediamine analog according to claim 8, characterized in that it is selected from the compounds of the formulas: ##STR00088## ##STR00089##
10. The method according to claim 3, characterized in that the RNA is: compound of formula 4a: ##STR00090## wherein: n is a natural number in the range from 1 to 10,000, m is a natural number in the range from 0 to 3, X1 is independently: OCH3 or OH, or compound of formula 4b: ##STR00091## wherein: n is a natural number in the range from 1 to 10,000, X1 is independently: OH or CH3 group, X.sub.2 is N.sub.3 or ##STR00092## group, or a compound of formula 4c: ##STR00093## wherein: n is a natural number in the range from 1 to 10,000, m is a natural number in the range from 1 to 4, X.sub.1 is independently: OH or OCH.sub.3 X.sub.2 and X.sub.3 are independently: OH, OCH.sub.3, ##STR00094##
11. The method according to claim 3, characterized in that step (i) is carried out in the presence of NaIO.sub.4, preferably at a concentration of 1.0 to 1.5 mM, at a temperature below 40? C., and at the RNA concentration of 1 to 100 ?M.
12. The method according to claim 4, characterized in that step (i) is carried out in the presence of NaIO.sub.4, preferably at a concentration of 1.0 to 1.5 mM, at a temperature below 40? C., and at the RNA concentration of 1 to 100 ?M.
13. The method according to claim 3, characterized in that step (ii) is carried out in the presence of a KH.sub.2PO.sub.4 buffer, preferably at pH 5.5-7.5, a NaBH.sub.3CN reducing agent at a concentration not exceeding 100 mM, preferably at a concentration of 20 mM, and an ethylenediamine analog at a concentration of 1-10 mM.
14. The method according to claim 4, characterized in that step (ii) is carried out in the presence of a KH.sub.2PO.sub.4 buffer, preferably at pH 5.5-7.5, a NaBH.sub.3CN reducing agent at a concentration not exceeding 100 mM, preferably at a concentration of 20 mM, and an ethylenediamine analog at a concentration of 1-10 mM.
15. The method according to claim 5, characterized in that step (ii) is carried out in the presence of a KH.sub.2PO.sub.4 buffer, preferably at pH 5.5-7.5, a NaBH.sub.3CN reducing agent at a concentration not exceeding 100 mM, preferably at a concentration of 20 mM, and an ethylenediamine analog at a concentration of 1-10 mM.
16. The method according to claim 3, characterized in that the obtained RNA analog is isolated from the reaction mixture by a known method of RNA isolation, preferably by alcohol precipitation of the RNA salt or by means of high-performance liquid chromatography (HPLC).
17. The method according to claim 4, characterized in that the obtained RNA analog is isolated from the reaction mixture by a known method of RNA isolation, preferably by alcohol precipitation of the RNA salt or by means of high-performance liquid chromatography (HPLC).
18. The method according to claim 5, characterized in that the obtained RNA analog is isolated from the reaction mixture by a known method of RNA isolation, preferably by alcohol precipitation of the RNA salt or by means of high-performance liquid chromatography (HPLC).
19. The method according to claim 6, characterized in that the obtained RNA analog is isolated from the reaction mixture by a known method of RNA isolation, preferably by alcohol precipitation of the RNA salt or by means of high-performance liquid chromatography (HPLC).
Description
SHORT DESCRIPTION OF THE FIGURES
[0108] For a better understanding of the invention, it has been illustrated in the embodiments and in the attached tables and figures, in which:
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118] Table 1 shows the names of the obtained RNAs and type and modification methods thereof: 5 IVT is a nucleotide or its analog introduced at the 5 end of RNA during the transcription reaction; 3 labeling: means that RNA of interest was subjected to a 3 end labeling reaction with Cy3 according to the invention; 5 labeling: means that the RNA of interest was subjected to a 5 end labeling reaction with Cy5. Double labeling products (with 3 Cy3 and 5 Cy5 simultaneously) contain both Cy3 and Cy5;
[0119] Table 2 shows the RNA nucleotide sequences of Table 1.
[0120] Table 3 shows the DNA sequences used during the chemical ligation of RNA6 (
EXAMPLES
[0121] The following examples are provided only to illustrate the invention and to explain its particular aspects, not to limit it, and should not be construed as falling within its entire scope as defined in the appended claims. The following examples used standard materials and methods employed in the art or followed manufacturers' recommendations for specific materials and methods unless otherwise indicated.
Synthesis of tert-butyl (2-bromoethyl)carbamate
[0122] ##STR00038##
[0123] The synthesis was carried out based on the published protocol [23]. Triethylamine (1.38 mL, 9.92 mmol) was added to a solution of 2-bomoethylamine hydrobromide (1.02 g, 4.96 mmol) in methanol (70 mL) at 0/4? C. Then, a solution of di-tert-butyl dicarbonate (1.09 g, 4.99 mmol) in methanol (20 mL) was added. After stirring for 15 min at 0/4? C., the cooling bath was removed and the solution was stirred for 2 h at room temperature. The solution was diluted with water/dichloromethane (65 mL/65 mL), transferred to a separatory funnel and washed with dichloromethane (65 mL). The combined organic fractions were dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The product was obtained in the form of a colorless oil (1.11 g, 4.95 mmol, ?100%). .sup.1H NMR (500 MHz, CDCl.sub.3) ? [ppm]: 4.94 (br s, 1H, CONH), 3.54 (t, J=5.8 Hz, 2H, CH.sub.2CH.sub.2), 3.45 (t, J=5.8 Hz, 2H, CH.sub.2CH.sub.2), 1.45 (s, 9H, tBu).
Synthesis of tert-butyl (N-propargylaminoethyl)carbamate
[0124] ##STR00039##
[0125] Sodium bicarbonate (200 mg, 2.38 mmol), DMF (2.0 mL), and propargylamine (849 ?L, 13.25 mmol) were added to tert-butyl (2-bromoethyl)carbamate (495 mg, 2.21 mmol). The suspension was refluxed at 60? C. for 4.5 h. The course of the reaction was monitored on TLC (n-hexane/2-propanol 1:1, ninhydrin staining, RF?0.4). The suspension was diluted with a mixture of saturated sodium carbonate and dichloromethane (20 mL/30 mL), transferred to a separatory funnel and washed with dichloromethane (2?20 mL). The combined organic phases were dried with Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The obtained ginger oil was separated by FLASH chromatography (dryload, 12 g silicagel cartridge) with a step gradient of 2-propanol in n-hexane. The fractions containing the desired product were combined and concentrated under reduced pressure. The product was obtained in the form of a yellow oil (374 mg, 1.88 mmol, 86%). .sup.1H NMR (500 MHz, CDCl.sub.3) ? [ppm]: 3.42 (d, J=2.4 Hz, 2H, CH.sub.2CCH), 3.24 (q, J=5.7 Hz, 2H, CH.sub.2CH.sub.2), 2.81 (t, J=5.7 Hz, 2H, CH.sub.2CH.sub.2), 2.22 (t, J=2.4 Hz, 1H, CCH), 1.44 (s, 9H, tBu).
Synthesis of N-Propargylethylenediamine (PEDA) Dihydrochloride
[0126] ##STR00040##
[0127] Hydrochloric acid (4 mL, ?37 wt %) was added dropwise to a solution of tert-butyl (N-propargylaminoethyl)carbamate (374 mg, 1.88 mmol) in methanol (20 mL). After 30 min of incubation at room temperature, ethanol was added and the solution was evaporated under reduced pressure. Anhydrous ethanol was then added portionwise until precipitation occurred. Then the mixture was cooled, the precipitate was filtered and washed with a minimum volume of cold anhydrous ethanol (a total of 100 mL of anhydrous ethanol was consumed). The precipitate was dissolved in water and lyophilized to obtain the product as a light-brown powder (156 mg, 0.912 mmol, 48%). .sup.1H NMR (500 MHz, D.sub.2O) ? [ppm]: 4.08 (d, J=2.6 Hz, 2H, CH.sub.2CCH), 3.58 (td, J=7.0, 1.8 Hz, 2H, CH.sub.2CH.sub.2), 3.46 (td, J=7.0, 1.9 Hz, 2H, CH.sub.2CH.sub.2), 3.10 (t, J=2.6 Hz, 1H, CCH). .sup.13NMR (126 MHz, D.sub.2O) ? [ppm]: 79.01 (CCH), 43.11 (CH.sub.2CH.sub.2), 36.98 (CH.sub.2CCH), 35.37 (CH.sub.2CH.sub.2).
Synthesis of 2-azidoethylamine
[0128] ##STR00041##
[0129] The synthesis was carried out based on the published protocol [8]. 2-Bromoethylamine hydrobromide (10.09 g, 49.3 mmol) was added to a solution of sodium azide (8.14 g, 148 mmol) in water (40 mL) and refluxed at 70? C. for 16 h. The mixture was cooled and a solution of potassium hydroxide (14 g) in water (10 mL) was added, followed by dichloromethane (50 mL). After stirring at room temperature for 30 min, the suspension was transferred to a separatory funnel and washed with dichloromethane (5?50 mL). The combined organic phases were dried with Na.sub.2SO.sub.4, filtered and carefully concentrated under reduced pressure (in the pressure range of 600-50 mbar at 30? C., until the weight of the product was stabilized). The product was obtained in the form of a colorless oil (3.78 g, 43.9 mmol, d=1.04 g/ml, 89%).
Synthesis of tert-butyl [N-(2-azidoethyl)aminoethyl]carbamate
[0130] ##STR00042##
[0131] A solution of tert-butyl (2-bromoethyl)carbamate (1.47 g, 6.58 mmol) in DMF (2 mL) was added dropwise to a suspension consisting of 2-azidomethylamine (1.63 mL, 19.73 mmol), sodium bicarbonate (0.91 g, 6.58 mmol) and DMF (8 mL) for 1 h at 70? C. The course of the reaction was monitored by TLC (n-hexane/2-propanol 1:1, ninhydrin staining, RF?0.4). The suspension was diluted with a mixture of saturated sodium carbonate and dichloromethane (40 mL/50 mL), transferred to a separatory funnel and washed with dichloromethane (3?50 mL). The combined organic phases were dried with Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The resulting colorless oil was separated by FLASH chromatography (dryload, 12 g silicagel cartridge) with step gradient of 2-propanol in n-hexane. The fractions containing the desired product were combined and concentrated under reduced pressure. The product was obtained in the form of a colorless oil (940 mg, 4.14 mmol, 63%).
Synthesis of N-(2-azidoethyl)ethylenediamine (AEEDA) dihydrochloride
[0132] ##STR00043##
[0133] Dilute hydrochloric acid (5 mL, ?10 wt %) was added dropwise to tert-butyl [N-(2-azidoethyl)aminoethyl]carbamate (374 mg, 1.88 mmol). After 1 h incubation at room temperature, the mixture was diluted with water (20 mL), transferred to a separatory funnel and washed with dichloromethane (3?25 mL). Ethanol was added to the aqueous phase and the solution was evaporated under reduced pressure. Anhydrous acetonitrile was then added portionwise until precipitation occurred. Then the mixture was cooled, the precipitate was filtered and washed with a minimum volume of cold anhydrous ethanol. The precipitate was dried under reduced pressure to obtain the product as a white powder (70 mg, 0.53 mmol, 13%). .sup.1H NMR (500 MHz, D.sub.2O) ? [ppm]: 3.82 (t, J=5.5 Hz, 2H), 3.49 (m, 2H), 3.43 (m, 2H), 3.35 (t, J=5.5 Hz, 2H). .sup.13C NMR (126 MHz, D.sub.2O) ? [ppm]: 49.61, 49.48, 46.84, 38.01.
Synthesis of Biot-EDA
[0134] ##STR00044##
[0135] The synthesis of Biot-N.sub.3 was carried out according to the known method [24]. A mixture of 50% DMSO (1.26 mL) and a solution of the CuSO4-TBTA complex (340 ?L, 9.4/10 mM in 50% DMSO) was added to the weighed reagents Biot-N.sub.3 (9.81 mg, 31.4 ?mol), PEDA?2HCl (8.27 mg, 48.4 ?mol) and sodium ascorbate (146 mg, 234 ?mol). After being stirred for 105 min at room temperature, EDTA (400 ?L of 0.5 M) and water (6 mL) were added to the solution. After filtration with a syringe filter, HPLC separation was carried out: SUPELCOSIL? LC-18-T column, 250?4.6 mm, 5 ?m, A50 mM NH.sub.4OAc pH 5.9, B50 mM NH.sub.4OAc pH 5.9/MeOH 1:1, 1.3 mL/min @22? C., programs: 0-100% B in 30 min (RT=15 min). After combining the fractions and freeze-drying three times, the Biot-EDA product was obtained in the form of the acetate salt (4.5 mg, 8.48 ?mol, M=530.7 g/mol) with a yield of 29%. MS ESI(+): 411.4 (Calc. [M+H].sup.+: 411.2).
Synthesis of Cy3-EDA
[0136] ##STR00045##
[0137] Sodium ascorbate (5.19 mg, 26.2 ?mol) and PEDA?2HCl (1.13 mg, 6.63 ?mol) were added to sulfo-Cy3-N.sub.3 (2.22 mg, 3.01 ?mol, Lumiprobe) and dissolved in 50% DMSO (270 ?L). Then a solution of the CuSO.sub.4-TBTA complex (32 ?L, 9.4/10 mM in 50% DMSO) was added and incubated for 60 min at room temperature (22? C.). Then water (2.7 mL) and EDTA solution (6 ?L, 0.5 M, pH 8.0) were added and HPLC separation was performed on a Gemini? NX-C18 column, 5 ?m, 110 ?, 250?10 mm; system A: 100 mM TEAA pH 7.0 B: 75% MeCN, program: 0-27% B in 40 min, 100% B for 10 min, 5 mL/min @25? C. (RT=35 min). After combining the fractions and freeze-drying three times, and dissolving in 50% DMSO (180 ?L), the product was obtained in the form of a triethylamine acetate salt solution (1.66 ?mol, 9.2 mM, A.sub.550=1492, ?.sub.548=162 mM.sup.?1cm.sup.?1) with a 55% yield. MS ESI(?): 795.6 (Calc. [M?H].sup.?: 796.3) ESI(+): 797.4 (Calc. [M?H].sup.?: 797.3).
Synthesis of Cy5-EDA
[0138] ##STR00046##
The synthesis was carried out according to a protocol analogous to the synthesis of Cy3-EDA, starting from sulfo-Cy5-N.sub.3 (4.7 mg, 6.01 ?mol, Lumiprobe). After combining the HPLC fractions, freeze-drying three times and dissolving in water (360 ?l), the product was obtained in the form of a triethylamine acetate salt solution (3.58 ?mol, 9.8 mM, A.sub.654=2450, ?.sub.645=250 mM.sup.?1cm.sup.?1) with a yield of 59%. MS ESI(?): 821.8 (Calc. [M?H].sup.?: 821.4) ESI(+): 823.5 (Calc. [M?H].sup.?: 823.4).
Synthesis of FAM-EDA
[0139] ##STR00047##
[0140] Triethylamine (10 ?L, bioultra) and diethylenetriamine (30 ?L) were added to a solution of NHS 6-carboxyfluorescein (4.5 mg, 9.5 ?mol, ChemGenes) in DMSO (200 ?L) and incubated at 22? C. for 60 min. Then an ethanol solution (1 mL, 80%) was added and evaporated under reduced pressure. This operation was repeated twice. Ammonium acetate solution (1.8 mL, 0.5 M, pH 5.9) was added and separation was performed by HPLC: Gemini? 5 ?m NX-C18 column, 110 ?, 250?10 mm; system A: 50 mM NH.sub.4OAc pH 5.9, B: MeOH; 0-50% B in 30 min, 5.0 mL/min @22? C. (RT=27 min). After freeze-drying three times, the product in the form of the ammonium acetate salt (2.8 ?mol, ?.sub.490=83 mM.sup.?1cm.sup.?1, 30%) was dissolved in 60% DMSO to give a 10 mM solution. MS ESI(?): 460.5 (Calc. [M?H].sup.?: 460.2).
Synthesis of pHrodo-EDA
[0141] ##STR00048##
[0142] Triethylamine (10 ?L, bioultra) and diethylenetriamine (20 ?L) were added to a solution of pHrodo RED NHS ester (1 mg, 2.0 ?mol, Thermo) in DMSO (200 ?L) and incubated at 22? C. for 60 min in the dark. Then an ethanol solution (1 mL, 80%) was added and evaporated under reduced pressure. This operation was performed twice. A solution of triethylamine acetate (1.8 mL, 0.1 M, pH 7.0) was added and separation was performed by HPLC: Gemini? 5 ?m NX-C18 column, 110 ?, 250?10 mm; system A: 50 mM AA pH 5.9, B: MeCN; 0-100% B in 60 min, 5.0 mL/min @22? C. (RT=26 min, MS). After double lyophilization and dissolving in water (100 ?L), a product solution (2.8 ?mol, ?.sub.560=65.0 mM.sup.?1cm.sup.?1) was obtained, with a concentration of 12.6 mM (A.sub.560=82, A.sub.260=30, 1 mm, pH 7.0) with a yield of 63%. MS ESI(+): 630.4 (Calc. [M?H].sup.?: 630.4).
Synthesis of EDA-m.SUP.7.Gp.SUB.3.G
[0143] ##STR00049##
[0144] Sodium ascorbate (10.3 mg, 52 ?mol) and PEDA?2HCl (3.4 mg, 20 ?mol) were added to N.sub.3-m.sup.7Gp.sub.3G [8] (10 mg, 8.4 ?mol) and dissolved in a degassed triethylamine acetate solution (2.0 mL, 45 mM, pH 7). Then a solution of the CuSO.sub.4-THPTA complex (10 ?L, 100/500 mM in water) was added and incubated for 2 h at room temperature. Then, an EDTA solution (20 ?L, 100 mM, pH 7.0) was added and HPLC separation was performed on a C18 column; system A: 100 mM NH.sub.4OAc pH 5.9, B: 30% MeCN, program: 0-25% B in 40 min, 4.5 mL/min @22? C. After combining the fractions and freeze-drying three times, the product was obtained in the form of the ammonium acetate salt (1.6 mg, 1.75 ?mol, ?.sub.260=20.0 mM.sup.?1cm.sup.?1) with a yield of 21%. MS ESI(?): 505.4 (Calc. [M?2H].sup.2?: 505.1), ESI(+): 507.4 (Calc. [M+2H].sup.2+: 507.1).
Synthesis of pU.SUB.3
[0145] ##STR00050##
[0146] The synthesis was carried out on the basis of the known method using the AKTA Oligopilot plus 10 synthesizer on 5-O-DMT-2-O-TBDMS-rU 3-|caa Primer Support 5G ribo U 300 (170 mg, 50.7 ?mol, 298 ?mol/g, GE Healthcare) solid support. During the coupling, the column solid support was washed with a solution of 5-O-DMT-2-O-TBDMS uridine phosphoramidite (ChemGenes) or biscyanoethyl phosphoramidite (ChemGenes) in acetonitrile (0.6 mL, 0.2 M, 2.4 eq) along with a solution of 5-(benzylthio)-1H-tetrazole in acetonitrile (0.30 M) for 15 min. A solution of dichloroacetic acid in toluene (3% v/v) was used as a detritilation reagent, an iodine solution in pyridine (0.05 M) was used as an oxidant, N-methylimidazole in acetonitrile (20% v/v) was used as Cap A and a mixture of acetic anhydride (40% v/v) and pyridine (40% v/v) in acetonitrile was used as Cap B. After the final synthetic cycle, the RNA product on the solid support was incubated in a solution of diethylamine in acetonitrile to remove 2-cyanoethyl groups. The solid support was washed with acetonitrile and dried with argon. For cleavage and deprotection of the product, the resin was incubated in AMA (3 mL of 40 wt % methylamine and 3 ml of 30 wt % ammonia water) for one hour at 40? C. The resulting solution was evaporated and the product was dissolved in DMAO (0.220 mL). TBDMS groups were removed with triethylamine trihydrofluoride (250 ?L, 65? C., 3 h). After cooling, the solution was diluted with sodium bicarbonate solution (20 mL, 0.25 M). The product was isolated by ion exchange chromatography on DEAE Sephadex (0-1.2 M TEAB gradient). After evaporation of the fractions, the product was obtained in the form of the triethylammonium salt (29 mg, 21.0 ?mol, 630 mOD.sub.260, HPLC.sub.260=99%, 57% yield). ESI(+): 467.1, 935.5 (Calc. [M+2H].sup.2+: 469.1, [M+H].sup.+: 937.1).
Synthesis of N.SUB.3.-AG
[0147] ##STR00051##
The synthesis was carried out on the basis of the known method using the AKTA Oligopilot plus 10 synthesizer on 5-O-DMT-2-O-TBDMS-rG.sup.iBu 3-Icaa Primer Support 5G ribo G 300 (163 mg, 49.0 ?mol, 300 ?mol/g, GE Healthcare) solid support. During the coupling, the column solid support was washed with a solution of 5-O-DMT-2-O-TBDMS rA.sup.Pac in acetonitrile (0.6 mL, 0.2 M, 2.4 eq) along with a solution of 5-(benzylthio)-1H-tetrazole in acetonitrile (0.30 M) for 15 min. A solution of dichloroacetic acid in toluene (3% v/v) was used as a detritilation reagent, an iodine solution in pyridine (0.05 M) was used as an oxidant, N-methylimidazole in acetonitrile (20% v/v) was used as Cap A and a mixture of acetic anhydride (40% v/v) and pyridine (40% v/v) in acetonitrile was used as Cap B. After the final synthetic cycle, the RNA product on the solid support was incubated in a solution of diethylamine in acetonitrile to remove 2-cyanoethyl groups. The solid support was washed with acetonitrile and dried with argon. The solid support was washed in a closed circuit with a solution of triphenoxymethylphosphine iodide ((PhO).sub.3PCH.sub.3.sup.+I.sup.?) in DMF (1.0 mL, 0.6 M) for 15 min. The solid support was washed successively with DMF, acetonitrile, dried with argon and transferred to a test tube. A saturated solution of sodium azide in DMF (1 mL) was then added and vigorously stirred for one hour at 60? C. The solid support was washed successively with water, ethanol, acetonitrile, and dried with argon. For cleavage and deprotection of the product, the solid support was incubated in AMA (3 mL of 40 wt % methylamine and 3 mL of 30 wt % ammonia water) for one hour at 50? C. The resulting solution was evaporated and the product was dissolved in water. The product was isolated by ion exchange chromatography on DEAE Sephadex (gradient elution 0-0.6 M TEAB). After evaporation of the fractions, the product was obtained in the form of the triethylammonium salt (21 mg, 20.8 ?mol, 550 mOD.sub.260, E.sub.260=24.3 mM.sup.?1cm.sup.?1 HPLC.sub.260=92%, 42% yield).
[0148] For in vitro transcription, a portion of the product (11 mg, 11.1 ?mol) was further purified by HPLC: Vydac Denali HiChrom C18 column, 150?10 mm, 5 ?m, 120 ?; solvents A50 mM NH.sub.4OAc pH 5.9, B50 mM NH.sub.4OAc pH 5.9/MeCN 7:3 v/v, program: 0-25% B in 40 min, flow 4.5 mL/min at 25? C. (RT=25 min). After combining the fractions and freeze-drying three times, the product was obtained in the form of the ammonium salt (5.5 mg, 9.0 ?mol, 220 mOD.sub.260, E.sub.260=24.3 mM.sup.?1cm.sup.?1, HPLC.sub.260?100%, 81% yield). MS ESI(?): 636.3 (Calc. [M?H].sup.?1: 636.1).
Synthpgig of FnA-An
[0149] ##STR00052##
[0150] Sodium ascorbate (10.3 mg, 52 ?mol) and PEDA?2HCl (3.4 mg, 20 ?mol) were added to N.sub.3-AG (7.4 mg, 11.5 ?mol) and dissolved in degassed triethylamine acetate solution (2.0 mL, 45 mM, pH 7). Then a solution of the CuSO4-THPTA complex (10 ?L, 100/500 mM in water) was added and incubated for 2 h at room temperature. Then an EDTA solution (20 ?L, 100 mM, pH 7.0) was added and HPLC separation was performed on a C18 column; system A: 100 mM NH.sub.4OAc pH 5.9 B: 30% MeCN, program: 0-25% B in 40 min, 4.5 mL/min @22? C. After combining the fractions and freeze-drying three times, the product was obtained in the form of the ammonium acetate salt (2.8 mg, 3.50 ?mol, E.sub.260=24.3 mM.sup.?1cm.sup.?1) with a yield of 30%. MS ESI(?): 734.4 (Calc. [M?H].sup.?: 734.2).
Preparation of Template DNA for In Vitro Transcription Reaction of RNA Having A35 and SP6 Sequences
[0151] RNA transcription template having A35 sequence (RNA1-6) was prepared as follows: solutions of two DNA oligonucleotides (Genomed) having sequences:
TABLE-US-00001 CAGTAATACGACTCACTATTAGGGAAGC GGGCATGCGGCCAGCCATAGCCGATCA (codingstrandA35); TGATCGGCTATGGCTGGCCGCATGCCCG CTTCCCTAATAGTGAGTCGTATTACTG (templatestrandA35);
were mixed 1:1 in hybridization buffer (4 mM Tris-HCl pH 7.5, 15 mM NaCl, 0.1 mM EDTA, final 45 ?M of each DNA strand). Then the solution was warmed up and cooled slowly (from 95 to 25? C. in 1 h, step gradient ?5? C./?4 min).
[0152] The template for the transcription of RNA having SP6 sequence (RNA7-9) was prepared according to the known procedure [8]
Preparation of Template DNA for In Vitro Transcription of RNA Having V5x3, G276, Gluc, Egfp and Fluc Sequences
[0153] Template DNA for transcription of the RNA having 3xV5 sequence was prepared by digesting the 3xV5_ pUC57 plasmid with Aarl (Thermo) restriction enzyme. The plasmid 3xV5_pUC57 was made by GeniScript by cloning the gene of the following sequence into the pUC57 vector using the EcoRV strategy:
TABLE-US-00002 CACGCTGTGTAATACGACTCACTATAGGGGTAC GCCACCATGGAAGGTAAGCCTATCCCTAACCCT CTCCTCGGTCTCGATTCTACGGGCAGCAGCGGC GGCAAACCGATTCCGAACCCGCTGCTGGGCCTG GATAGCACCGGTAGCAGCGGCGGTAAGCCTATC CCTAACCCTCTCCTCGGTCTCGATTCTACGGTT TAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG CAGGTGTCTAGA
[0154] Template DNA for RNA transcription of the G276 sequence was prepared by digesting the hRLuc-pRNA2(A)128 plasmid with Adel restriction enzyme (Thermo). The hRLuc-pRNA2(A)128 plasmid was made according to a known procedure [26].
[0155] Template DNA for RNA transcription of the gluc sequence was prepared by digesting the pJET1.2_T7_Gluc_3utr-beta-globin_A128 plasmid with Aarl restriction enzyme (Thermo). The pJET1.2_T7_Gluc_3utr-beta-globin_A128 was made according to the known procedure [11].
[0156] Template DNA for RNA transcription of the egfp sequence was prepared by digesting the pJET1.2_T7_Egfp_3utr-beta-globin_A128 plasmid with Aarl restriction enzyme (Thermo). pJET1.2_T7_Egfp_3utr-beta-globin_A128 was made in the same way as the pJET1.2_T7_Gluc_3utr-beta-globin_A128 plasmid, by cloning the eGFP gene into the pJET1.2 vector [11].
[0157] Template DNA for RNA transcription of the fluc sequence was prepared by digesting the pJET1.2_T7_Fluc3utr-beta-globin_A128 plasmid with Aarl restriction enzyme (Thermo). pJET1.2_T7_Fluc_3utr-beta-globin_A128 was made according to the known procedure [8].
In Vitro Transcription and Isolation of the RNA Encoding the A35 Sequence (RNA1, RNA3, RNA6)
[0158] RNA3: Reagents were added to the template DNA solution (45 ?M, 11 ?L) to obtain a reaction mixture (250 ?L) with the following composition: Transcription buffer (x1, Thermo), GTP (5.0 mM), UTP (5.0 mM), CTP (5.0 mM), ATP (3.0 mM), N.sub.3-AG (6.0 mM), MgCl.sub.2 (20 mM), Ribolock (1 U/?L, Thermo), T7 RNAP (0.125 mg/mL). After incubation for 2 h at 37? C., DNase I (2 ?L, 30 min, Thermo) was added and the incubation continued for another 30 min. Then an EDTA solution (250 ?L, 30 mM) was added and deproteinization (washing of the reaction mixture with PhOH/CHCl.sub.3 system, followed by CHCl.sub.3, 1:1 v/v) and precipitation (50 ?L of 3M NaOAc, pH 5.2/1.1 mL 99% EtOH, ?20? C., ON) were performed. After centrifugation (>10 g, 20 min @4? C.), washing (80% EtOH) and drying in vacuo, the RNA pellet was dissolved in water (200 ?L). Separation of the products by HPLC was performed: Phenomenex Clarity 3 ?m Oligo RP C18 column, 50?4.6 mm. Buffers A: 50 mM TEAA, B: MeCN. Program: 5% B for 5 min, 5-10% B in 15 min, 10-50% B in 1 min, 50% for 4 min, flow 1.0 mL/min, @50? C. (RT?16 min). The collected fractions were lyophilized, dissolved in water and separated on a PAA gel (15% PAA, 8M urea, 1?TBE) in order to analyze their composition. Fractions containing the desired RNA product were combined, lyophilized and dissolved in water. The RNA in the solution was precipitated in ethanol (as the sodium salt as before) and redissolved in water (160 ?L). The concentration of the RNA product was measured with a nanodrop (A.sub.260=2.48, 1.0 mm optical path). The product RNA3 (159 ?g, 9.1 nmol, 3.98 mOD.sub.260, E.sub.260=437 mM.sup.?1cm.sup.?1) was obtained as a mixture of n-mers (?35-36 nt).
[0159] RNA1: RNA1 transcription and isolation were performed as described for RNA3, except that the reaction mixture contained the following concentrations of selected reagents: ATP (5.0 mM), N.sub.3-AG (0 mM).
[0160] RNA6: RNA6 transcription and isolation were performed as described for RNA3, except that the reaction mixture contained the following concentrations of selected reagents: EDA-AG (46.0 mM), N.sub.3-AG (0 mM).
In Vitro Transcription and Isolation of the RNA Encoding the SP6 Sequence (RNA7, RNA9)
[0161] RNA7: RNA7 transcription and isolation were performed according to a known procedure [8]
[0162] RNA9: RNA9 transcription and isolation were performed as described for RNA7, except that the reaction mixture contained the following concentrations of selected reagents: EDA-m.sup.7Gp.sub.3G (1.0 mM), N.sub.3-m.sup.7Gp.sub.3G (0 mM).
In Vitro Transcription and Isolation of RNA Encoding the V5x3, G276, Gluc, Egfp and Fluc Sequences (RNA10, RNA15, RNA16, RNA20, RNA24)
[0163] RNA20: Reagents were added to the template DNA solution (13 ?g, 20 ?L) to form a reaction mixture (130 ?L) with the following composition: Transcription buffer (x1, Thermo), ATP (5.0 mM), UTP (5.0 mM), CTP (5.0 mM), GTP (1.0 mM), N.sub.3-m.sup.7Gp.sub.3G (6.0 mM), MgCl.sub.2 (20 mM), Ribolock (1 U/?L, Thermo), T7 RNAP (0.125 mg/mL). After incubation for 135 min at 37? C., DNase I (2 ?L, 30 min, Thermo) was added and incubations continued for another 30 min. Then EDTA solution (8 ?L, 0.5 M) and water (420 ?L) were added. Reaction products were purified with NucleoSpin? RNA (MACHEREY-NAGEL): 1 prep, loading in three portions, elution 2?60 ?L. An RNA20 solution was obtained (152 ?g/115 ?L, 1.32 ?g/?L, 2.31 ?M). For further purification, portion of the obtained RNA was separated by HPLC chromatography: RNASept? Prep C18 column, 50?7.8 mm, 2 ?m, A100 mM TEAOAc pH 7.0, B200 mM TEAOAc pH 7.0/MeCN 1:1, 0.9 mL/min @55? C. Program: 18-30% B in 40 minutes The collected fractions were divided into ?700 ?L aliquots, NaOAc (70 ?L, 3 M), glycogen (1 ?L, 5 mg/mL) and iPrOH (800 ?L) were added and incubated at ?80? C. for 30 min. The pellets were centrifuged (30 min, 4? C., 15,000 g), supernatants were carefully removed, EtOH (80%, 0.5 mL) was added, the pellets were centrifuged again (10 min, 4? C., 14,000 g), dried under vacuum and dissolved in water (20 ?L per sample). Product samples (60 ng) were separated on an agarose gel (1%, 1?TBE, 80 V 60 min). After combining the fractions containing the desired product, high-quality RNA20 was obtained (4.76 ?g, 53%).
[0164] RNA10: Transcription on the appropriate DNA template (V5X3) and RNA10 isolation were performed as described for RNA20, except that the reaction mixture contained the following concentrations of selected reagents: GTP (5.0 mM), N.sub.3-m.sup.7Gp.sub.3G (0 mM). Different HPLC chromatography conditions were also used: SecurityGuard? Cartridge Gemini?-NX C18 pre-column, 4?3.00 mm, +Phenomenex Clarity 3 ?m Oligo RP C18 column, 150?4.6 mm, A100 mM TEAOAc pH 7. RNA10: Transcription on the appropriate DNA template (V5X3) and RNA10 isolation were performed as described for RNA200, B200 mM TEAOAc pH 7.0/MeCN 1:1, 1 mL/min @50? C. Program: 10-60% B in 60 min.
[0165] RNA12: transcription on the appropriate DNA template (G276) and RNA12 isolation were performed as described for RNA20, except that different HPLC chromatography conditions were used: SecurityGuard? Cartridge Gemini?-NX C18 pre-column, 4?3.00 mm, +Phenomenex Clarity 3 ?m Oligo RP C18 column, 150?4.6 mm, A100 mM TEAOAc pH 7.0, B200 mM TEAOAc pH 7.0/MeCN 1:1, 1 mL/min @50? C. Program: 10-60% B in 60 min.
[0166] RNA15: transcription on the appropriate DNA template (gluc) and RNA15 isolation were performed as described for RNA20, except that the reaction mixture contained the following concentrations of selected reagents: GTP (5.0 mM), N.sub.3-m.sup.7Gp.sub.3G (0 mM).
[0167] RNA16: transcription on the appropriate DNA template (gluc) and RNA16 isolation were performed as described for RNA20.
[0168] RNA24: transcription on an appropriate DNA template (fluc) and RNA24 isolation were performed as described for RNA20, except that the reaction mixture contained the following concentrations of selected reagents: GTP (1.0 mM), m.sub.2.sup.3-O,7Gp.sub.3G (6.0 mM) [27].
Preparation and Isolation of RNA Labeled According to the Invention at the 3 End of Cy3 (RNA2, RNA4, RNA11, RNA13, RNA17, RNA21, RNA25)
[0169] RNA21: Fresh NaIO.sub.4 solution (2 ?L, 10 mM) was added to the RNA20 solution (11.43 ?g/12 ?L) and incubated for 30 min at 25? C. Then KH.sub.2PO.sub.4 buffer (2 ?L, 1M, pH 6.0), fresh NaBH.sub.3CN solution (2 ?L, 200 mM) and Cy3-EDA (2 ?L, 10 mM, 50% DMSO) were added. After incubation for 120 min at 25? C., water (160 ?L), NaOAc (20 ?L, 3M, pH 5.9), glycogen (1 ?L, 5 mg/mL) and EtOH (100%, 600 ?L) were added and incubated at ?80? C. for 30 minutes. The pellet was centrifuged (30 min, 4? C., 15,000 g), the supernatant was carefully removed, EtOH (80%, 800 ?L) was added, the pellet was centrifuged again (10 min, 25? C., 14,000 g), dried under vacuum and dissolved in water (100 ?L). RNA21 solution (101.1 ng/?L, 10.1 ?g, 88%) was obtained. For further purification, a portion of the obtained RNA was separated by HPLC chromatography, as described for RNA20. After combining the fractions containing the desired product, high-quality RNA21 (3.30 ?g, 37%) was obtained.
[0170] RNA2: The labeling reaction and RNA2 isolation were performed as described for RNA21, using RNA1 as substrate. HPLC chromatography conditions: Phenomenex Clarity 3 ?m Oligo RP C18 column, 50?4.6 mm, A50 mM TEAOAc pH 7.0, B MeCN, 1 mL/min @50? C. Program: 5-75% B in 10 min.
[0171] RNA4: The labeling reaction and RNA4 isolation were performed as described for RNA21, using RNA3 as substrate. HPLC chromatography conditions: as described for RNA2.
[0172] RNA11: The labeling reaction and RNA11 isolation were performed as described for RNA21, using RNA10 as substrate. HPLC conditions: as described for RNA10.
[0173] RNA17: The labeling reaction and RNA17 isolation were performed as described for RNA21, using RNA16 as substrate.
[0174] RNA25: The labeling reaction and RNA25 isolation were performed as described for RNA21, using RNA24 as substrate.
Preparation and Isolation of RNA Labeled at the 5 End of Cy5 (RNA18, RNA22)
[0175] RNA22: Buffer KH.sub.2PO.sub.4 (2 ?L, 1M, pH 6.0) and DIBAC-sCy5 (2 ?L, 20 mM, 50% DMSO, Lumiprobe) were added to the RNA20 solution (11.43 ?g/16 ?L). After incubation for 120 min at 25? C., water (160 ?L), NaOAc (20 ?L, 3M, pH 5.9), glycogen (1 ?L, 5 mg/mL) and EtOH (100% 600 ?L) were added and incubated at ?80 ? C. for 30 minutes. The pellet was centrifuged (30 min, 4? C., 15,000 g), the supernatant was carefully removed, EtOH (80%, 800 ?L) was added, the pellet was centrifuged again (10 min, 25? C., 14,000 g), dried under vacuum and dissolved in water (100 ?L). RNA22 solution (94.3 ng/?L, 9.43 ?g, 83%) was obtained. For further purification, a portion of the obtained RNA was separated by HPLC chromatography, as described for RNA20. After combining the fractions containing the desired product, high-quality RNA22 (4.78 ?g, 53%) was obtained.
[0176] RNA18: The labeling reaction and RNA18 isolation were performed as described for RNA22, using RNA16 as substrate.
Preparation and Isolation of RNA Labeled According to the Invention at the 3 End of Cy3 and the 5 End of Cy5 (RNA5, RNA8, RNA14, RNA19, RNA23)
[0177] RNA23: Fresh NaIO4 solution (2 ?L, 10 mM) was added to the RNA20 solution (11.43 ?g/10 ?L) and incubated for 30 min at 25? C. Then KH.sub.2PO.sub.4 buffer (2 ?L, 1M, pH 6.0), fresh NaBH.sub.3CN solution (2 ?L, 200 mM), DIBAC-sCy5 (2 ?L, 20 mM, 50% DMSO, Lumiprobe) and Cy3-EDA (2 ?L, 10 mM, 50% DMSO) were added. After incubation for 120 min at 25? C., water (160 ?L), NaOAc (20 ?L, 3M, pH 5.9), glycogen (1 ?L, 5 mg/mL) and EtOH (100%, 600 ?L) were added and incubated at ?80? C. for 30 minutes. The pellet was centrifuged (30 min, 4? C., 15,000 g), the supernatant was carefully removed, EtOH (80%, 800 ?L) was added, the pellet was centrifuged again (10 min, 25? C., 14,000 g), dried under vacuum and dissolved in water (100 ?L). The RNA23 solution (94.6 ng/?L, 9.46 ?g, 83%) was obtained. For further purification, a portion of the obtained RNA was separated by HPLC chromatography, as described for RNA20. After combining the fractions containing the desired product, high-quality RNA23 (2.66 ?g, 37%) was obtained.
[0178] RNA5: The labeling reaction and RNA5 isolation were performed as described for RNA23, using RNA3 as substrate. HPLC chromatography conditions: Phenomenex Clarity 3 ?m Oligo RP C18 column, 50?4.6 mm, A50 mM TEAOAc pH 7.0, B MeCN, 1 mL/min @50? C. Program: 5-30% B in 20 min.
[0179] RNA8: The labeling reaction and RNA8 isolation were performed as described for RNA23, using RNA7 as substrate. HPLC conditions: as described for RNA5.
[0180] RNA14: The labeling reaction and RNA14 isolation were performed as described for RNA23, using RNA12 as substrate. HPLC conditions: as described for RNA10.
[0181] RNA19: The labeling reaction and RNA19 isolation were performed as described for RNA23, using RNA16 as substrate.
Monitoring the Activity of RNase A, RNase T1 and RNAse R
[0182] The reaction buffer (4 mM Tris-HCl pH 7.5, 15 mM NaCl, 0.1 mM EDTA) was degassed under reduced pressure. A concentrated labeled RNA solution (RNA5) was then mixed with the buffer to obtain an RNA concentration suitable for fluorescence measurements (?100 nM). RNA solution (50 ?L) was warmed and slowly cooled down (from 95 to 25? C. in 1 h, step gradient ?5? C./?4 min) then incubated on ice in the dark. After dilution with degassed buffer (150 ?L) or RiboLock RNase inhibitor buffer (Thermo, 10 ?L+140 ?L), the solution was placed in a quartz cuvette (1?1?350 mm) and the fluorescence spectrum was recorded (excitation 500 nm, range 510-850 nm, averaged over three spectra, 10 nm slit). The changes in the emission spectrum were measured at 5? C. After the system stabilized (5-15 min), the enzyme was added in the appropriate concentration:
[0183] RNase A (Thermo): 10 mg/mL stock solution, 1 ?L of the million-fold diluted (?10 ng/ml, H.sub.2O) enzyme was added to the cuvette
[0184] RNase T1 (Thermo): 1000 U/?L stock solution, 1 ?L of the 100-fold diluted (10 U/?L, H.sub.2O) enzyme was added to the cuvette
[0185] RNase R (ABM): 10 U/?L stock solution, 1 ?L of an enzyme was added to the cuvette The changes in the emission spectrum were then measured at 5? C. as the reaction progressed.
Monitoring of Dcp1/2 Enzyme Activity
[0186] The reaction buffer (4 mM Tris-HCl pH 7.5, 15 mM NaCl, 0.1 mM EDTA) was degassed under reduced pressure. The concentrated RNA solution (RNA8) was then mixed with the buffer to obtain a probe solution (?100 nM) for fluorescence measurements. The FRET probe solution (40 ?L) was warmed and cooled slowly (from 95 to 25? C. in 1 h, step gradient ?5? C./?4 min) and then incubated on ice in the dark. After dilution with degassed buffer (150 ?L), MgCl.sub.2 (1 ?L, 1M) was added, transferred to a quartz cuvette (1?1?350 mm) and the fluorescence spectrum was recorded (excitation 500 nm, range 510-850 nm, averaged over three spectra, slit 10 nm). The changes in the emission spectrum were measured at 5? C. After the system stabilized (5-15 min), Dcp1/2 complex with Schizosaccharomyces pombe (10 ?L, 7 ?M) was added. The changes in the emission spectrum were then measured at 5? C. as the reaction progressed.
Monitoring of RNase H Activity
[0187] DNA solution (6.00 ?L, 1 ?M, 1.2 eq) was added to the FRET probe solution (RNAS, ?100 nM, 50 ?L) in buffer (412 ?L; 4 mM Tris-HCl pH 7.5, 15 mM NaCl, 0.1 mM EDTA) or water (6.00 ?L), warmed up and slowly cooled (from 95 to 25? C. in 1 h, step gradient ?5? C./?4 min). Then degassed water (160 ?L) and Rnase H Buffer?10 (24 ?L, 200 mM Tris-HCl pH 7.5, 500 mM NaCl, 100 mM MgCl.sub.2, 10 mM DTT) were added and placed in a quartz cuvette (240 ?L, 1?1?350 mm). The changes of the emission spectrum were measured at 35? C. (excitation 500 nm, range 510-850 nm, averaged over three spectra, slit 10 nm). After the system stabilized (2-5 min), RNase H (2.00 ?L, 0.1 mg/mL) was added and the changes in the emission spectrum were measured at temperature as the reaction progressed.
BIBLIOGRAPHY
[0188] [1] D. A. Baum, S. K. Silverman Angewandte Chemie International Edition 2007, 46, 3502 [0189] [2] L. B?ttner, F. Javadi-Zarnaghi, C. H?bartner Journal of the American Chemical Society 2014, 136, 8131 [0190] [3] M. G. Maghami, C. P. M. Scheitl, C. H?bartner Journal of the American Chemical Society 2019, 141, 19546 [0191] [4] M. G. Maghami, S. Dey, A. Lenz, C. H?bartner Angewandte Chemie International Edition 2020, 59, 9335 [0192] [5] B. Samanta, D. P. Horning, G. F. Joyce Nucleic Acid Research 2018, 46, e103 [0193] [6] T. E. England, O. E. Uhlenbeck Nature 1978, 275, 560 [0194] [7] W. C. Lai, M. Kayedkhordeh, E. V. Cornell, E. Farah, S. Bellaousov, R. Rietmeijer, E. Salsi, D. H. Mathews, D. N. Ermolenko Nature Communications 2018, 9, 4328 [0195] [8] A. Mamot, P. J. Sikorski, M. Warminski, J. Kowalska, J. Jemielity Angewandte Chemie International Edition 2017, 56, 15628 [0196] [9] S. Croce, S. Serdjukow, T. Carell, T. Frischmuth ChemBioChem 2019, 21, 1641 [0197] [10] L. Anh?user, S. H?wel, T. Zobel, A. Rentmeister Nucleic Acid Research 2019, 47, e42 [0198] [11] P. S. Sikorski, M. Warminski, D. Kubacka, T. Ratajczak, D. Nowis, J. Kowalska, J. Jemielity Nucleic Acid Research 2020, 48, 1607 [0199] [12] D. Strzelecka, M. Smietanski, P. J. Sikorski, M. Warminski, J. Kowalska, J. Jemielity RNA 2020, 26, 1815 [0200] [13] M. Tomkuvien?, M. Mickut?, G. Vilkaitis, S. Klima?auskas Current Opinion in Biotechnology 2019, 55, 114 [0201] [14] L. Bellon, C. Workman, J. Scherrer, N. Usman, F. Wincott Journal of the American Chemical Society 1994, 118, 3771 [0202] [15] N. Rublack, S. M?ller Beilstein Journal of Organic Chemistry 2014, 10, 1906 [0203] [16] G. Lentzen, B. Dobberstein, W. Wintermeyer FEBS Letters 1994, 348, 233 [0204] [17] E. Griffin, Z. Qin, W. J. Michels, A. M. Pyle Chemistry & Biology 1995, 2, 761 [0205] [18] S. Busch, L. A. Kirsebom, H. Notbohm, R. K. Hartmann Journal of Molecular Biology 2000, 299, 941 [0206] [19] O. Rossbach, L. H. Hung, S. Schreiner, I. Grishina, M. Heiner, J. Hui, A. Bindereif Molecular and Cellular Biology 2009, 29, 1442 [0207] [20] D. Li, M. H. F. Meyer, D. K. Willkomm, M. Keusgen, R. K. Hartmann Biochemie 2010, 92, 772 [0208] [21] M. Zhao, F. D Steffen, R. B?rner, M. F. Schaffer, R. K. O. Sigel, E. Freisinger Nucleic Acids Research 2018, 46, e13 [0209] [22] U. Ragnarson Chemical Society Reviews 2001, 30, 205 [0210] [23] M. R. Johnson, W. R. Thelin PCT/US2016/029729 WO 2016/176423 [0211] [24] P. Wanat, S. Walczak, B. A. Wojtczak, M. Nowakowska, J. Kowalska, J. Jemielity Organic Letters 2015, 17, 3062 [0212] [25] M. Warminski, J. Kowalska, J. Jemielity Organic Letters 2017, 19, 3624 [0213] [26] M. Warminski, P. J. Sikorski, Z. Warminska, M. Lukaszewicz, A. Kropiwnicka, J. Zuberek, E. Darzynkiewicz, J. Kowalska, J. Jemielity Biocojnugate Chemistry 2017, 28 1978 [0214] [27] J. Jemielity, T. Fowler, J. Zuberek, J. Stepinski, M. Lewdorowicz, A. Niedzwiecka, R. Stolarski, E. Darzynkiewicz, R. E. Rhoads RNA 2003, 9, 1108