Method for enhancing vanillin resistance of <i>Saccharomyces cerevisiae </i>by knocking out SNG1 gene

Abstract

A method of enhancing vanillin resistance of Saccharomyces cerevisiae, including: knocking out SNG1 gene from a genome of Saccharomyces cerevisiae. This application further provides a mutant of SNG1 gene of Saccharomyces cerevisiae including the nucleotide sequence shown in SEQ ID NO: 1, where the sequence shown in SEQ ID NO: 1, from left to right, consists of a ?18?+203 bp fragment of SNG1 gene of Saccharomyces cerevisiae, a nucleotide fragment of loxp-KanMX4-loxp and a +1446?+1644 bp fragment of the SNG1 gene of Saccharomyces cerevisiae.

Claims

1. A mutant SNG1 gene, comprising the nucleotide sequence of SEQ ID NO: 1.

2. A Saccharomyces cerevisiae cell with vanillin resistance, the Saccharomyces cerevisiae cell comprising a mutant SNG1 gene comprising the nucleotide sequence of SEQ ID NO: 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a gel electrophoresis image showing nucleotide fragments involved in the construction of a sng1? mutant, where M: marker; 1: the nucleotide fragment shown in SEQ ID NO: 2; 2: the nucleotide fragment shown in SEQ ID NO: 3; 3: loxp-KanMX4-loxp; 4: the nucleotide fragment shown in SEQ ID NO: 1; 5: amplified product using genome of the sng1? mutant as template (the absence of the target sequence indicates that the SNG1 has been successfully knocked out; and 6: amplified product using genome of the wild-type strain (positive control).

(2) FIG. 2 illustrates growth statuses of the sng1? mutant and the wild-type strain on YEPD plate.

(3) FIG. 3 shows growth statuses of the sng1? mutant and the wild-type strain under vanillin stress during the shake-flask fermentation.

(4) FIG. 4 shows the ability of the sng1? mutant and the wild-type strain to metabolize vanillin.

(5) FIG. 5 illustrates the growth statuses of the sng1? mutant and the wild-type strain under normal conditions during the shake-flask fermentation.

DETAILED DESCRIPTION OF EMBODIMENTS

(6) The disclosure will be described in detail below with reference to the embodiments and accompanying drawings. Provided below are merely preferred embodiments of the disclosure, and it should be noted that these embodiments are merely illustrative of the disclosure, and are not intended to limit the disclosure. Any modification, change and replacement made by those skilled in the art without departing from the spirit of the disclosure should fall within the scope of the disclosure.

(7) Experimental Materials

(8) (1) Liquid YEPD (Yeast extract Peptone Dextrose) medium for Saccharomyces cerevisiae: 20 g/L of peptone, 10 g/L of yeast extract and 20 g/L of glucose. 20 g/L of agar was required to prepare a solid YEPD medium. The medium was sterilized at 115? C. for 30 min immediately after the preparation. G418 with a final concentration of 800 ?g/mL may be introduced for the purpose of screening.

(9) Synthetic complete (SC) medium for yeast: 6.7 g/L of yeast nitrogen base, 5 g/L of ammonium sulfate, 0.77 g/L of CSM-URA, supplemented with uracil to a final concentration of 20 mg/L. After sterilized at 115? C. for 30 min, the medium was further supplemented with a pre-sterilized 400 g/L glucose mother liquor to a final concentration of 20 g/L.

(10) (2) Enzymes and reagents

(11) The DNA polymerase used in PCR was Phata Max Super Fidelity DNA Polymerase P505-d2, which was purchased from Nanjing Vazyme Biotech Co., Ltd.

(12) (3) Strain and plasmid

(13) Saccharomyces cerevisiae BY4741 was purchased from a website platform (http://www.miaolingbio.com). The pUG6 plasmid was constructed according to the method mentioned in a literature (A new efficient gene disruption cassette for repeated use in budding yeast[J]. Nucleic Acids Res, 1996, 24(13): 2519-2524).

(14) Unless otherwise specified, other materials and reagents are commercially available.

Example 1 Construction of Sng1? Mutant

(15) (1) Extraction of Genome of Saccharomyces cerevisiae BY4741

(16) Saccharomyces cerevisiae BY4741 was inoculated to 5 mL of a YEPD medium and cultured at 30? C. and 200 rpm overnight. The suspension was centrifuged to collect Saccharomyces cerevisiae cells, which were washed with 1 mL of sterile water and then suspended with 200 ?L of lysis buffer, where the lysis buffer contained 2% Triton X-100, 1% SDS, 100 mmol/L of NaCl, 10 mmol/L of Tris-HCl and 1 mmol/L of EDTA, and was adjusted to pH 8.0. The cells suspension was transferred to a screw-capped tube containing 0.4 g of glass beads, to which 200 ?L of a mixture of phenol, chloroform and isoamyl alcohol (25:24:1) was added. After vortexed for 3 min, the reaction mixture was added with 200 ?L of TE solution, mixed uniformly and centrifuged at 4? C. and 13,000 rpm for 10 min. The supernatant was transferred to a new Eppendorf tube, to which 1 mL of absolute ethanol (?20? C.) was added to precipitate the DNA. The Eppendorf tube was centrifuged at 4? C. and 13,000 rpm for 10 min, and the supernatant was discarded. The DNA precipitate was dried under vacuum, dissolved with 400 ?L of TE solution and added with 10 ?L of RNase A (10 mg/mL). The reaction mixture was incubated at 37? C. for 15 min, added with 10 ?L of ammonium acetate (4 mol/L) and 1 mL of absolute ethanol, mixed uniformly and centrifuged at 13,000 rpm for 10 min. The supernatant was discarded, and the precipitate was dried and dissolved with 50 ?L of ddH.sub.2O to obtain the genome of Saccharomyces cerevisiae BY4741.

(17) (2) Amplification of the Fragment Shown in SEQ ID NO: 2

(18) The fragment shown in SEQ ID NO: 2 was amplified by PCR using the genome of Saccharomyces cerevisiae BY4741 as template and a first primer pair, where the first primer pair consisted of a

(19) TABLE-US-00003 forwardprimerF1f: GCCGTACAGAGAACAAATATGACTAAATCGG; anda reverseprimerF1r: ATTAAGGGTTGTCGACCTGCAGCGTACGAAGCTTCAGCTGACAGATGACA ATGAGGACGGC.
The underlined fragment was homologous to a left end sequence of the loxp-KanMX4-loxp fragment, for fusion PCR with loxp-KanMX4-loxp. The PCR system consisted of 0.5 ?L of template, 0.5 ?L of the forward primer F1f, 0.5 ?L of the reverse primer F1r, 2 ?L of dNTPs, 0.5 ?L of DNA Polymerase, 25 ?L of 2?buffer and 21 ?L of ddH.sub.2O, and the PCR amplification was programmed as follows: pre-denaturation at 95? C. for 3 min; 30 cycles: denaturation at 95? C. for 15 s, annealing at 55? C. for 15 s and extension at 72? C. for 10 s; and final extension at 72? C. for 5 min.

(20) (3) Amplification of the Fragment Shown in SEQ ID NO: 3

(21) The fragment shown in SEQ ID NO: 3 was amplified by PCR using the genome of Saccharomyces cerevisiae BY4741 as template and a second primer pair, where the second primer pair consisted of a

(22) TABLE-US-00004 forwardprimerF2f: GAAGTTATTAGGTGATATCAGATCCACTAGTGGCCTATGGGGAAGAAATT ACGGTATTCTCGTGGC; anda reverseprimerF2r: TTAATTTCCGGGCGGGTTGTTATTTTTATCAG.
The underlined fragment was homologous to a right end sequence of the loxp-KanMX4-loxp fragment, for fusion PCR with loxp-KanMX4-loxp. The PCR system consisted of 0.5 ?L of template, 0.5 ?L of the forward primer F2f, 0.5 ?L of the reverse primer F2r, 2 ?L of dNTPs, 0.5 ?L of DNA Polymerase, 25 ?L of 2?buffer and 21 ?L of ddH.sub.2O, and the PCR amplification was programmed as follows: pre-denaturation at 95? C. for 3 min; 30 cycles: denaturation at 95? C. for 15 s, annealing at 55? C. for 15 s and extension at 72? C. for 10 s; and final extension at 72? C. for 5 min.

(23) (4) Amplification of the Loxp-KanMX4-Loxp Fragment Shown in SEQ ID NO: 4

(24) The loxp-KanMX4-loxp fragment was amplified by PCR using a pUG6 plasmid as template and a third primer pair, where the third primer pair consisted of a forward primer F3f: CAGCTGAAGCTTCGTACGCTG; and a reverse primer F3r: GCATAGGCCACTAGTGGATCTG. The PCR system consisted of 0.5 ?L of template, 0.5 ?L of the forward primer F3f, 0.5 ?L of the reverse primer F3r, 2 ?L of dNTPs, 0.5 ?L of DNA Polymerase, 25 ?L of 2?buffer and 21 ?L of ddH.sub.2O, and the PCR amplification was programmed as follows: pre-denaturation at 95? C. for 3 min; 30 cycles: denaturation at 95? C. for 15 s, annealing at 55? C. for 15 s and extension at 72? C. for 45 s; and final extension at 72? C. for 5 min.

(25) (5) Amplification of the Gene Sequence Shown in SEQ ID NO: 1

(26) The gene sequence shown in SEQ ID NO: 1 was amplified by fusion PCR using SEQ ID NO: 2, loxp-KanMX4-loxp and SEQ ID NO: 3 as templates and the second primer pair, where the fusion PCR system consisted of 0.5 ?L of SEQ ID NO: 2, 0.5 ?L of loxp-KanMX4-loxp, 0.5 ?L of SEQ ID NO: 3, 0.5 ?L of the forward primer F2f, 0.5 of the reverse primer F2r, 2 ?L of dNTPs, 0.5 ?L of DNA Polymerase, 25 ?L of 2?buffer and 20 ?L of ddH.sub.2O, and the PCR amplification was programmed as follows: pre-denaturation at 95? C. for 3 min; 30 cycles: denaturation at 95? C. for 15 s, annealing at 55? C. for 15 s and extension at 72? C. for 1 min; and final extension at 72? C. for 5 min.

(27) (6) Transformation of SEQ ID NO: 1 into Wild-Type Saccharomyces cerevisiae Strain

(28) The nucleotide fragment shown in SEQ ID NO: 1 was subjected to gel purification, and the specific process was described as follows. The PCR products were subjected to agarose gel electrophoresis, and the resulting gel was collected and placed under ultraviolet light. The gel slice with target DNA was carefully excised, placed in an Eppendorf tube and weighed. The recovery and purification of DNA fragments in the agarose gel were carried out as instructed by E.Z.N.A Gel Extraction kit (Omega Bio-tek, Co., Ltd, USA).

(29) The purified nucleotide fragment shown in SEQ ID NO: 1 was transformed into wild-type Saccharomyces cerevisiae cells by lithium acetate protocol. Specifically, a single colony was picked and cultured in 1-2 mL of YEPD medium overnight, and then the cells were transferred to 40 mL of YEPD medium at an initial OD.sub.600 of 0.2 and cultured at 30? C. under shaking to OD.sub.600 of 0.6-1.0. The cell suspension was centrifuged to collect the cells, which were then washed with sterile water, resuspended with 1 mL of 0.1 mol/L LiAc and transferred to a new sterile Eppendorf tube. The resuspension was centrifuged, and the supernatant was discarded. The cells were collected and resuspended with 400 ?L of 0.1 mol/L LiAc, and the resulting suspension was divided into multiple 50 ?L aliquots, which were respectively transferred to multiple sterile Eppendorf tubes, respectively. After centrifugation, the supernatant was discarded, and each Eppendorf tube was sequentially added with 240 ?L of 50% (w/v) PEG-3350, 36 ?L of 1 mol/L LiAc and 10 ?L of 10 mg/mL single-stranded salmon sperm DNA (boil for 5 min before use, then quickly place on ice; use within half an hour) and a total of 70 ?L of sterile re-distilled water and a plasmid (or DNA fragment), shaken, incubated at 30? C. for 30 min and subjected to heat shock in a 42? C. water bath for 25 min. Then the Eppendorf tube was centrifuged, and the supernatant was discarded. The cells were resuspended with YEPD medium and incubated for 2-4 h. The resuspension was centrifuged again, and the cells were suspended with sterile water and spread onto a YEPD plate supplemented with 800 ?g/mL of G418 for screening to preliminarily obtain a SNG1-deletion S. cerevisiae mutant, which was named as sng1.4 mutant.

(30) (7) PCR Identification

(31) A single colony was picked from the plate and cultured in a YEPD liquid medium containing 200 ?g/mL of G418 at 30? C. and 200 rpm for 24 h. Then the genome was extracted according to the procedure of extraction of BY4741 genome and was identified by PCR, where the obtained genome was used as template. The forward primer was Fy (CGGGGTTTCGTACAGTAATCAGCG), which was designed according to the +87?+110 region of the SNG1 gene; and the reverse primer was F2r (TTAATTTCCGGGCGGGTTGTTATTTTTATCAG).

(32) The electrophoresis (FIG. 1) results confirmed that a 1558 bp fragment can be amplified when using the genome of the wild-type BY4741 (positive control) as template, so the absence of the 1558 bp fragment in the amplified product indicated that the SNG1 gene had been successfully knocked out, that was, the 1558 bp fragment was absent in the amplified product when using the genome of the sng1.4 mutant as template.

(33) The PCR system consisted of 0.5 ?L of template, 0.5 ?L of forward primer Fy, 0.5 ?L of reverse primer F2r, 2 ?L of dNTPs, 0.5 ?L of DNA Polymerase, 25 ?L of 2?buffer and 21 ?L of ddH.sub.2O, and the PCR was programmed as follows: pre-denaturation at 95? C. for 3 min; 30 cycles: denaturation at 95? C. for 15 s, annealing at 55? C. for 15 s and extension at 72? C. for 15 s; and final extension at 72? C. for 5 min.

Example 2 Verification of Vanillin Resistance (Tolerance) of sng1? Mutant

(34) (1) Test on Vanillin Resistance of Sng1? Mutant

(35) The sng1? mutant obtained above was cultured on a YEPD plate containing 6 mmol/L of vanillin to observe its growth status. Specifically, the sng1? mutant was inoculated to 1-2 mL of a liquid YEPD medium and cultured at 30? C. overnight to logarithmic growth phase. Then the mutant cells were transferred to 5 mL of fresh medium at an initial OD.sub.600 of 0.2, cultured overnight and centrifuged. The cells were collected, washed with 1 mL of sterile water three times and centrifuged at 8,000 r/min. The cells were again suspended with sterile water and placed at 30? C. for 9 h to prepare resting cells, and during the preparation, the medium was prepared, poured to a plate and naturally dried. The cell suspension was adjusted to OD.sub.600 of 1.0 and subjected to 10-fold serial dilution, and 4 ?L of the suspension at each dilution was dropped on the plate, cultured at 30? C. for 1-3 days and photographed to observe the colony growth. The control strain was tested in the same way for the vanillin resistance.

(36) The results were presented in FIG. 2, in which it can be obviously seen that the sng1? mutant displayed a superior growth status to the control strain under vanillin stress.

(37) (2) Shake-Flask Fermentation

(38) A single colony of the sng1? mutant was picked, transferred to 1-2 mL of a SC medium and cultured at 30? C. and 200 rpm for about 24 h. The cell suspension was transferred to 20 mL of fresh medium at an initial OD.sub.600 of 0.2 and cultured at 30? C. and 200 rpm overnight to the mid log phase for secondary activation. Then the cell culture, at an initial OD.sub.600 of 0.2, was transferred to 40 mL of a SC medium containing 6 mmol/L of vanillin and cultured at 30? C. and 200 rpm under shaking, where the OD.sub.600 was regularly measured.

(39) The maximum specific growth rate was obtained by calculating a near regression slope of ln(OD.sub.600) versus time in the logarithmic growth phase. As shown in FIG. 3, the sng1? mutant showed a maximum specific growth rate of 0.225/h under vanillin stress.

(40) After measured for OD.sub.600, the cell culture was centrifuged, and the supernatant was collected and analyzed by HPLC to determine the extracellular vanillin content.

(41) The HPLC method for the determination of vanillin was described as follows.

(42) The fermentation liquid was centrifuged at 13,000 r/min for 10 min, and the supernatant was collected, filtered with a 0.45 ?m microporous membrane and then analyzed by HPLC for extracellular metabolites, where HPLC conditions were listed as follows: photodiode array detector (SPD-M20A); BioSil-C18 column (Bio-Rad, USA); mobile phase: 40% methanol; flow rate: 0.6 mL/min; temperature: room temperature; and detection wavelength: 210 nm.

(43) The specific consumption rate of vanillin was calculated based on the cell dry weight, which was determined as follows. 10 mL, 20 mL, 30 mL, 40 mL and 50 mL of the culture medium were taken, measured for OD 600 and filtered with a 0.45 ?m nitrocellulose filter membrane (weighed in advance), respectively. Then the filter membrane was washed twice with deionized water, dried in a microwave oven at 360 W for 20 min and weighed, and the cell dry weight can be obtained according to the weight difference of the filter membrane. The OD.sub.600 of cells in the culture medium was a product of one unit of OD.sub.600 and the volume. A curve of OD.sub.600 versus cell dry weight was plotted, and the cell dry weight during the fermentation process can be calculated according to this curve. For the BY4741 strains, one unit of OD.sub.600 corresponded to a cell dry weight of 0.18 g/L. The specific consumption rate of vanillin was calculated according to the following equation:

(44) $r=\frac{A_n-A_m}{\frac{1}{2}{.Math.}_{i=m+1}^n\left(B_1+B_{i-1}\right)?\left(t_i-t_{i-1}\right)};$ where, r: specific consumption/production rate of a certain substance during the period from sampling point m to n; A: metabolite concentration at sampling points n, i and m; B: biomass concentration at sampling points n, i and m; t: time at sampling points n, i and m; and specific consumption/production rate: g g.sup.?1 h.sup.?1.

(45) The specific consumption rate of vanillin in the sng1? mutant was 0.052 g g.sup.?1 h.sup.?1 (FIG. 4).

(46) The wild-type BY4741 strain was also subjected to shake flask fermentation according to the above operation, and its maximum specific growth rate was calculated to be 0.132 h.sup.?1 using the method by which the maximum specific growth rate of the sng1? mutant was calculated (FIG. 3). Similarly, the specific consumption rate of vanillin in the wild-type BY4741 strain was calculated to be 0.035 g g.sup.?1 h.sup.?1 according to the above method (FIG. 4).

(47) The sng1? mutant was subjected to shake flask fermentation in a SC medium without vanillin stress, and the operation process was the same as above. In this case, the sng1? mutant had a maximum specific growth rate of 0.293 h.sup.?1 (FIG. 5).

(48) The wild-type BY4741 strain was also subjected to stress-free shake flask fermentation according to the above process, and showed a maximum specific growth rate of 0.304 h.sup.?1 (FIG. 5).

(49) It can be seen from the above that in the absence of vanillin, there was no significant difference between the sng1? mutant and the wild-type BY4741 strain in the growth; while under vanillin stress, compared to the control strain, the sng1? mutant was improved by 70% and 52% respectively in the maximum specific growth rate and the specific consumption rate of vanillin.