Messenger RNA nanoparticles and preparation method therefor

10300148 ยท 2019-05-28

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed are nanoparticles that are introduced into cells and express a specific protein and a manufacturing method thereof. More particularly, the present invention relates to mRNA nanoparticles, which increase the expression of a specific protein capable of stimulating the cellular immune system to induce cellular immune responses and are thus applicable to treat a variety of diseases, do not require passage across the nuclear envelope because a desired gene is delivered not as plasmid DNA itself but in the form of mRNA, thus improving the efficiency of protein expression, and the nanoparticles are generated through a one-step process with a relatively small amount of plasmid DNA via rolling circle transcription (RCT), thereby providing a simple and economical process for gene delivery. The present invention is also concerned with such mRNA nanoparticles.

Claims

1. A method of manufacturing an mRNA nanoparticle comprising: preparing a DNA containing a nucleotide sequence encoding a specific protein; transcribing the DNA using an RNA polymerase to generate a single-stranded mRNA containing a repeated nucleotide sequence for expressing the specific protein; and allowing the single-stranded mRNA to self-assemble through entanglement and twisting to form the mRNA nanoparticle, wherein the DNA is a circular double-stranded plasmid DNA is used at a concentration ranging from 1 to 5 nM.

2. The method of claim 1, wherein the DNA further comprises a nucleotide sequence encoding a promoter region for polymerization by an RNA polymerase and a ribosome-binding sequence.

3. The method of claim 1, wherein the single-stranded mRNA is generated via rolling circle transcription.

Description

DESCRIPTION OF DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 is a schematic diagram showing the process of generating mRNA nanoparticles with plasmid DNA;

(3) FIG. 2 is a graph showing the result of dynamic light scattering analysis for mRNA nanoparticles transcribed from various concentrations of plasmid DNA;

(4) FIG. 3 shows SEM images of mRNA nanoparticles transcribed from various concentrations of plasmid DNA;

(5) FIG. 4 shows microscopic images of mRNA nanoparticles according to one embodiment of the present invention;

(6) FIG. 5 shows the result of gel electrophoresis for identifying the component of mRNA nanoparticles;

(7) FIG. 6 shows the result of image cytometry for identifying the component of mRNA nanoparticles;

(8) FIG. 7 shows the result of gel electrophoresis for evaluating nuclease resistance of mRNA nanoparticles;

(9) FIGS. 8 and 9 are fluorescent microscopic images for evaluating protein expression from mRNA nanoparticles; and

(10) FIG. 10 is a graph showing the result of cytometry analysis for detecting protein expression from mRNA nanoparticles.

BEST MODE

(11) Hereinafter, a detailed description will be given of mRNA nanoparticles and a manufacturing method thereof according to the present invention, with reference to the appended drawings. Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. If the meaning of the term used herein conflicts with the general meaning thereof, reference is to be made to the definition used herein. In the following description of the present invention, detailed descriptions of known constructions and functions incorporated herein will be omitted when they may make the gist of the present invention unclear. As used herein, when any part comprises or contains any element, it means that other elements are not precluded but may be further included, unless otherwise mentioned.

(12) The present invention is directed to mRNA nanoparticles that are introduced into cells and overexpress a specific protein. The mRNA nanoparticles comprise a repeated nucleotide sequence for expressing a specific protein. Also, the mRNA nanoparticles have a constant shape and size and preferably have an overall spherical shape and a diameter ranging from 30 to 200 nm. The mRNA nanoparticles are famed with single-stranded mRNA strands that are entangled and twisted with each other. Since the protein which is overexpressed from the mRNA nanoparticles stimulates the cellular immune system and eventually induces cellular immune responses, the mRNA nanoparticles are able to treat a variety of diseases. Further, the mRNA nanoparticles are non-toxic in vivo because they are composed entirely of mRNA, which is a biomolecule. Moreover, since the mRNA nanoparticles can bypass the need for passage across the nuclear envelope for protein expression and are resistant to nuclease RNase, they may improve the efficiency of protein expression.

(13) A method of manufacturing the above-described mRNA nanoparticles will be described in more detail below, and manufacturing is preferably conducted according to the method described below, without limitation thereto.

(14) The method of manufacturing mRNA nanoparticles comprises the step of preparing a DNA that is a circular double-stranded plasmid DNA, which comprises, in sequence, a promoter to which an RNA polymerase binds to initiate transcription, a ribosome binding site (RBS) that allows ribosomes to bind onto the resulting mRNA transcript and a nucleotide sequence encoding a specific protein; the step of transcribing the plasmid DNA using an RNA polymerase to generate a long single-stranded mRNA containing a repeated nucleotide sequence for expressing the specific protein; and the step of allowing the single-stranded mRNA to self-assemble through entanglement and twisting to form the mRNA nanoparticles.

(15) The DNA-preparing step serves to prepare a DNA containing a nucleotide sequence encoding a protein that is intended to be expressed. At this step, a circular double-stranded plasmid DNA is generated comprising a promoter region for polymerization by an RNA polymerase, a ribosome-binding sequence, and a nucleotide sequence encoding a specific protein (e.g. green fluorescent protein (GFP)). The plasmid DNA for expressing a specific protein is transcribed, and the resulting transcripts self-assemble into nanostructures, thus forming mRNA nanoparticles, which may be introduced into human cells to express the specific protein.

(16) At the transcription step, a long single-stranded mRNA strand is generated from the plasmid DNA generated at the DNA-generating step via rolling circle transcription (RCT) using an RNA polymerase, the mRNA strand comprising a repeated nucleotide sequence for expressing a specific protein.

(17) At the self-assembly step, the single-stranded mRNA strands self-assemble while being entangled and twisted with each other to form mRNA nanoparticles. At this step, the resulting nanoparticles become resistant to the nuclease RNase through the self-assembly process during which mRNA strands are entangled and twisted with each other. The mRNA nanoparticles containing genetic information for a desired protein have a diameter that may be controlled by changing the amount of plasmid DNA during the process of manufacturing mRNA nanoparticles. As described in detail below, when the plasmid DNA is mixed with an RNA polymerase and allowed to react at a predetermined temperature for a desired period of time, through the RCT reaction by the RNA polymerase are generated long single-stranded mRNA strands (see, FIG. 1), which self-assemble while being entangled and twisted with each other, thus producing mRNA nanoparticles. This one-step process via RCT provides a simple process for producing mRNA nanoparticles with a small amount of plasmid DNA.

MODE FOR INVENTION

(18) A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are not to be construed to limit the present invention.

Example 1: Preparation of Plasmid DNA

(19) A plasmid DNA as a template for RCT was designed so as to contain a nucleotide sequence (SEQ ID NO: 1) carrying genetic information for expressing a green fluorescent protein, a eukaryotic ribosomal binding sequence (RBS) (SEQ ID NO: 2), known as the Kozak sequence, and a nucleotide sequence (SEQ ID NO: 3) of a promoter region for T7 RNA polymerase, as follows.

(20) TABLE-US-00001 <ThenucleotidesequenceofplasmidDNA> CCCGTGTAAAACGACGGCCAGTTTATCTAGTCAGCTTGATTCTAGCTGA TCGTGGACCGGAAGGTGAGCCAGTGAGTTGATTGCAGTCCAGTTACGCT GGAGTCTGAGGCTCGTCCTGAATGATATGCGACCGCCGGAGGGTTGCGT TTGAGACGGGCGACAGATCCAGTCGCGCTGCTCTCGTCGATCC- CTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCTGTTACA AACTCAAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAA GGGCAGATTGTGTGGACAGGTAATGGTTGTCTGGTAAAAGGACAGGGCC ATCGCCAATTGGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGCTT CCATCTTCAATGTTGTGTCTAATTTTGAAGTTAACTTTGATTCCATTCT TTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTATTC CAATTTGTGTCCAAGAATGTTTCCATCTTCTTTAAAATCAATACCTTTT AACTCGATTCTATTAACAAGGGTATCACCTTCAAACTTGACTTCAGCAC GTGTCTTGTAGTTCCCGTCATCTTTGAAAAATATAGTTCTTTCCTGTAC ATAACCTTCGGGCATGGCACTCTTGAAAAAGTCATGCCGTTTCATATG ATCTGGGTATCTTGAAAAGCATTGAACACCATAAGAGAAAGTAGTGACA AGTGTTGGCCATGGAACAGGTAGTTTTCCAGTAGTGCAAATAAATTTAA GGGTAAGTTTTCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGA AAATTTGTGCCCATTAACATCACCATCTAATTCAACAAGAATTGGGACA ACTCCAGTGAAAAGTTCTTCTCCTTTACTCAT(SEQIDNO:1)- CCATGGTGGC(SEQIDNO:2)- ATCCCTATAGTGAGTCGTATTA(SEQIDNO:3)- GGTGCGAGCGGATCGAGCAGTGTCGATCAGTTCTGGACGAGCGAGCTGT CGTCCGACCCGTGATCTTACGGCATTATACGTATGATCGGTCCACGATC AGCTAGATTATCTAGTCAGCTTGATGTCATAGCTGTTTCCTGAGGCTCA ATACTGACCATTTAAATCATACCTGACCTCCATAGCAGAAAGTCAAAAG CCTCCGACCGGAGGCTTTTGACTTGATCGGCACGTAAGAGGTTCCAACT TTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATC GAGATTITCAGGAGCTAAGGAAGCTAAAATGAGTATTCAACATTTCCGT GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGC ACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAG AGTTTACGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTC TGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACT CGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCA GTCACAGAAAAGCATCTCACGGATGGCATGACAGTAAGAGAATTATGCA GTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGGC AACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGG GATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCA TACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAAC GTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAA CAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGATCACTTCTGC GCTCGGCCCTCCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGG TGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAG CCCTCCCGCATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGG ATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCA TTGGTAATGAGGGCCCAAATGTAATCACCTGGCTCACCTTCGGGTGGGC CTTTCTTGAGGACCTAAATGTAATCACCTGGCTCACCTTCGGGTGGGCC TTTCTGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCA TCACAAAAATCGATGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTA TAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTG TTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGT AAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGC AGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA ACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAA GCCAGTTACCTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAA CCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCG CAGGATCTCAAGAAGATCCTTTGATTTTCTACCGAAGAAAGGCCCA

Example 2: Preparation of mRNA Nanoparticles

(21) 1 nM of the plasmid DNA prepared in Example 1 was mixed in a tube with 4 mM of Ribonucleotide Solution Mix (Bioline), Reaction buffer (8 mM Tris-HCl, 0.4 mM spermidine, 1.2 mM MgCl.sub.2 and 2 mM dithiothreitol), and 50 units/ml of T7 RNA polymerase (New England Biolabs). The mixture was then incubated at 37 C. for 20 hrs to generate transcripts from the plasmid DNA via rolling circle transcription (RCT), thus yielding mRNA nanoparticles (hereinafter, referred to as mRNA-NPs).

Example 3: Evaluation for Size Distribution of mRNA Nanoparticles Transcribed from Various Concentrations of Plasmid DNA

(22) 1) mRNA nanoparticles were prepared according to the same procedure as in Example 2 with various concentrations (0.05 nM, 0.11 nM, 0.57 nM, 5.00 nM and 25.00 nM) of plasmid DNA.

(23) 2) The mRNA nanoparticles prepared in Examples 2 and 3-1) were analyzed by dynamic light scattering analysis (Particle Size Analyzer WI30i), and the results are given in FIG. 2. Nanoparticles generated with 1 nM, 5 nM and 25 nM of plasmid DNA were also observed by scanning electron microscopy (SEM), and SEM images are given in FIG. 3.

(24) 3) As shown in FIGS. 2 and 3, nanoparticles were not famed when the plasmid DNA was used at a concentration of 0.05 nM or less. Nanoparticles famed with 0.11 nM or more of plasmid DNA were found to have a diameter ranging from 30 to 200 nm while the diameter increased with increasing concentrations of plasmid DNA, but with plasmid DNA of higher than 5 nM, the diameter and particle number were not increased much further. It is an object of the present invention to produce nanoparticles with a minimal amount of plasmid DNA, and nanoparticles having a diameter of around 100 nm are preferable for cellular entry and pharmaceutical efficacy. For these reasons, the plasmid DNA may be preferably used at a concentration ranging from 1 to 5 nM.

Example 4: Evaluation for the Size and Shape of mRNA Nanoparticles

(25) The mRNA nanoparticles prepared with 5.00 nM of plasmid DNA in Example 3-1) were analyzed by scanning electron microscopy (SEM, XL30-FEG (ELI)) and atomic force microscopy (AFM, Park NX10 (Park Systems)). SEM and AFM images are given in FIGS. 4a and 4b, respectively. The SEM image (scale bar, 100 nm) showed that the mRNA-NPs had a spherical shape with a diameter ranging from 100 to 200 nm. Also, the spherical structure of the particles in the AFM image was correlated with the SEM result.

Example 5: Evaluation for the Component of mRNA Nanoparticles

(26) 1) Nanoparticles were prepared under the same conditions as in Example 2 except for the use of ribonucleotide solution mix containing Cyanine 3-labelled UTP (Enzo). Cyanine 3-UTP was used at concentrations of 5, 20 and 100 M.

(27) 2) The nanoparticles prepared in Example 5-1) were run on a 1.2 wt % agarose gel at 100V at room temperature in Tris-acetate-EDTA (TAE) buffer (40 mM Tris-acetate and 1 mM EDTA, pH 8.0, Biosesang), and the result is given in FIG. 5a. Also, the nanoparticles prepared in Example 5-1) were run after stained with Gelred on a 1.2 wt % agarose gel at 100V at room temperature in Tris-acetate-EDTA (TAE) buffer (40 mM Tris-acetate and 1 mM EDTA, pH 8.0, Biosesang). and the result is given in FIG. 5b. Lanes 1 and 2 indicate 1 kb DNA ladder marker and plasmid DNA, respectively. Lanes 3, 5 and 7 indicate samples not containing nanoparticles, and lanes 4, 6 and 8 indicate nanoparticle samples labeled with 100, 20 and 5 M of Cyanine 3-UTP, respectively, which were prepared in Example 5-1).

(28) 3) Image cytometry was also carried out for nanoparticles prepared according to the same procedure as in Example 5-1), and the result is given in FIG. 6. Cyanine 3-UTP (Cy3-UPT) was used at concentrations of 0 (control), 5 and 20 M.

(29) 4) The nanoparticles could be labeled with Cy3-UTP, which emits orange fluorescence via the rolling circle transcription (RCT) reaction involving Cy3-UTP, and thus is readily visible under ultraviolet light. As shown in FIGS. 5a and 5b, the nanoparticles transcribed with Cy3-UTP were visible (see, lanes 4, 6 and 8), indicating that the nanoparticles were composed of RNA strands. Also, the image cytometry resulted in the finding that the nanoparticles showed strong fluorescence intensity and the intensity increased with increasing concentrations of Cy3-UTP (FIG. 6), indicating that the nanoparticles were composed of RNA strands.

Example 6: Evaluation for the Nuclease Resistance of mRNA Nanoparticles

(30) 50 ng of capped mRNA (1800 bp; hereinafter, referred to as Naked) containing a nucleotide sequence for expressing Xef-1 protein and 0.54 amole (12 g) of mRNA nanoparticles (mRNA-NPs) were incubated with 2% and 10% fetal bovine serum (FBS, nuclease-containing) for 5 min and 1 hr at 37 C. Then, gel electrophoresis was performed on a 1% agarose gel, and the result is given in FIG. 7 (Control (cntl) not treated with FBS (lane 1); samples incubated with 2% FBS for 5 min (lane 2), 10% FBS for 5 min (lane 3), 2% FBS for 1 hr (lane 4) and 10% FBS for 1 hr (lane 5)).

(31) 2) As shown in FIG. 7, the long Naked strand was rapidly degraded according to nuclease concentration and reaction time. In contrast, the mRNA-NPs, in which RNA strands were entangled and twisted with each other to form nanoparticles, were degraded to some extent but relatively large amounts thereof remained intact. These results indicate that the mRNA-NPs are resistant to nuclease degradation.

Example 7: Evaluation for Protein Expression from mRNA Nanoparticles

(32) 1) PC-3 cells were grown in RPMI 1640 (Welgene) supplemented with 10% fetal bovine serum (Gibco), 100 units/ml of penicillin, 100 g/ml of streptomycin, and 1% antibiotic-antimycotic (Gibco) at 37 C. in a humidified atmosphere of 5% CO.sub.2. 24 hrs before transfection, the cells were trypsinized, diluted with fresh medium (310.sup.5 cells/ml) and transferred to 24-well plates (500 l per well).

(33) 2) The mRNA-NPs prepared in Example 2 were diluted with OPTI-MEMI (Gibco) and mixed with the transfection reagent TransIT-X2 (Mirus). The mixtures were then incubated at room temperature for 15 min to form a complex of mRNA-NPs with TransIT-X2.

(34) 3) Each concentration of mRNA-NPs after complexation was diluted and added to each well of cells, and the cells were then incubated at 37 C. for 3 to 48 hrs in a humidified atmosphere with 5% CO.sub.2.

(35) 4) To image GFP-expressing PC-3 cells, the cells were grown on 8-well cell culture chamber slides (SPL Life Science). All the cells were fixed with 4% paraformaldehyde (MBiotech) and stained with DAPI at a concentration of 5 g/ml to locate the cell nucleus. Fluorescent microscopy (Eclipse Ti (Nikon)) was carried out to image the transfected cells, and the results are given in FIGS. 8 and 9. FIG. 8 shows fluorescent microscopic images of the transfected PC-3 cells with different filters, where DAPI (blue) identifies the nuclear location (a) and the green signal indicates the expression of GFP protein (b). The cells were transfected with 0.6 fM of mRNA-NPs (top) transcribed from 1 nM of plasmid DNA, plasmid DNA (middle) of the same concentration as in the top, and neither mRNA-NPs nor plasmid DNA (control, bottom). FIG. 9 shows a merged DAPI and GFP image of the cells transfected with 0.1 fM of the mRNA-NPs generated with 5 nM of plasmid DNA.

(36) 5) As shown in FIG. 8, the mRNA-NPs-transfected PC-3 cells exhibited strong green fluorescence, indicating that GFP protein was produced in a large amount (top, mRNA-NPs). When cells were transfected with plasmid DNA, there was only relatively low green fluorescence, indicating that the GFP protein was produced in a small amount (middle, plasmid). As shown in FIG. 9, in mRNA-NPs-transfected PC-3 cells, the GFP protein (green) was found to be distributed around the nuclei (blue).

(37) 6) FIG. 10 is a graph showing the result of cytometry analysis. PC-3 cells were transfected with 0.6 fM (red) and 0.1 fM (orange) of mRNA-NPs. As controls, cells were transfected with 12 pM (navy) and 2 pM (green) of plasmid DNA. GFP fluorescence intensity and GFP expression duration varied with the samples. As shown in FIG. 10, the strongest GFP fluorescent intensity was observed 24 hrs post-transfection with 0.6 fM of mRNA-NPs, and the intensity was higher even after 40 hrs relative to the controls (see, red line). Taken together, as compared to the controls transfected with plasmid DNA, the mRNA-NPs gave stronger fluorescent intensities for a longer period of time.

(38) Although the preferred embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims.