Sidt 1 gene controlling determinate growth habit in sesame and SNP molecular marker thereof
10301687 ยท 2019-05-28
Assignee
Inventors
- Haiyang Zhang (Zhengzhou, CN)
- Hongmei Miao (Zhengzhou, CN)
- Chun Li (Zhengzhou, CN)
- Libin Wei (Zhengzhou, CN)
- Yinghui Duan (Zhengzhou, CN)
- Fangfang XU (Zhengzhou, CN)
- Huili WANG (Zhengzhou, CN)
Cpc classification
International classification
A01H1/04
HUMAN NECESSITIES
Abstract
A Sidt1 gene controlling a determinate growth habit of sesame, the gene having a length of 1809 bp and including four exons and three introns. The Sidt1 gene is located on the fourth chromosome of sesame and in an 18.0-19.2 cM interval of the eighth linkage group on an SNP genetic map of sesame. The DNA sequence of the Sidt1 gene is represented by SEQ ID NO. 1. A cDNA sequence of the Sidt1 gene has a length of 531 bp and encodes 176 amino acids, and the cDNA sequence is represented by SEQ ID NO. 2. An SNP molecular marker Sidt27-1 of the Sidt1 gene has a length of 92 bp and is located at a base sequence from 378 to 469 of the Sidt1 gene, and a DNA sequence of the SNP molecular marker Sidt27-1 is represented by SEQ ID NO. 3.
Claims
1. An Sidt1 gene for controlling a determinate growth habit of sesame, the Sidt1 gene consisting of four exons and three introns, wherein a DNA sequence of the Sidt1 gene consists of SEQ ID NO. 1.
2. A cDNA sequence of an Sidt1 gene consisting of a DNA sequence of SEQ ID NO. 1, wherein the cDNA sequence consists of SEQ ID NO. 2.
3. An SNP molecular marker Sidt27-1 being located at a base sequence from 378 to 469 of SEQ ID NO. 1, wherein a DNA sequence of the SNP molecular marker Sidt27-1 consists of TABLE-US-00011 SEQIDNO.3: CCTGATGTTCCTGGTCCTAATGATCCATATCTGAGGGAGCACCTGCACTG GTATGCTTTCATTTTTAACTGCTTAAGACCTGATTGATTTAA.
4. A method for identifying the Sidt1 gene using the SNP molecular marker Sidt27-1 of claim 3, the method comprising: 1) extracting a genome DNA of a germplasm material of sesame to be identified; 2) using an extracted DNA of 1) as a template for PCR amplification by using the following primers: TABLE-US-00012 aforwardprimerHSDt01-1FrepresentedbySEQID NO.4: 5 CCTGATGTTCCTGGTCCGAA3; aforwardprimerHSDt01-2FrepresentedbySEQID NO.5: 5 CTATTCCTGATGTTCCTGGTCCGAG3; and areverseprimerHSDt01-RrepresentedbySEQID NO.6: 5 TAAATCAATCAGGTCTTAAGCAGT3; performing gel electrophoresis on PCR amplified products, and determining whether the genome DNA of the germplasm material of sesame to be identified comprises the SNP molecular marker Sidt27-1 according to the following rules: if the genome DNA only comprises the SNP molecular marker Sidt27-1, when the primer pair HSDt0I-1F and HSDt01-R are adopted for PCR amplification and a product having a band size of 92 bp is amplified, the germplasm material of sesame is determined to belong to a dt1 type having a determinate growth habit and is adapted to cultivate sesame varieties with the determinate growth habit; if the genome DNA is in the absence of the SNP molecular marker Sidt27-1, when the primer pair HSDt01-2F and HSDt01-R are adopted for PCR amplification and a product having a band size of 97 bp is amplified, the germplasm material of the sesame is determined to belong to a dt0 type having an indeterminate growth habit and is adapted to cultivate sesame varieties with the indeterminate growth habit; and if both the product having the band size of 92 bp and the product having the band size of 97 bp are amplified, the germplasm material of the sesame is determined to belong to a hybrid type having the indeterminate growth habit.
5. The method of claim 4, wherein for further determining whether the germplasm material to be identified comprises the Sidt1 gene, the extracted DNA of 1) is used as the template for PCR amplification using the following primer pair: TABLE-US-00013 aforwardprimerDt1PrimerFrepresentedbySEQ IDNO.7: 5-ATGGCAAAAATGTCATCGGACC-3; and areverseprimerDt1PrimerRrepresentedbySEQ IDNO.8: 5-CTAGCGCCTTCTAGCAGCAGTC-3; the PCR amplified products are sequenced and aligned with the Sidt1 gene, and if the PCR amplified products comprise the Sidt1 gene sequence of SEQ ID NO: 1, the germplasm material to be identified is determined to belong to the determinate florescence phenotype.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The invention is described herein below with reference to the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(12) For further illustrating the invention, experiments detailing an Sidt1 gene, a cDNA of the Sidt1 gene, an SNP molecular marker Sidt27-1, and a method for identifying the Sidt1 gene using the SNP molecular marker Sidt27-1 are described below. It should be noted that the following examples are intended to describe and not to limit the invention.
(13) Primary germplasm materials and varieties of sesame used in the invention are briefly introduced hereinbelow:
(14) In the prior art, Yuzhi 11 is an excellent parent material in sesame breeding. New variety Yuzhi DS899 with the determinate growth habit used in the invention was selected from Yuzhi 11 using EMS mutagenesis by Henan Sesame Research Center, Henan Academy of Agricultural Sciences. This new variety has been applied to national new variety protection (application number: 20150395.2) and passed the evaluation of new sesame variety examination in Henan province in 2015. The main traits of Yuzhi DS899 are as follows: determinate growth habit, average capsule nodes of 15-20, three flowers per leaf axil, single stem, four-edge capsule, and white seed coat color.
(15) The sesame resource JS012 is from the germplasm reservoir of Henan Sesame Research Center, Henan Academy of Agricultural Sciences and has the following traits: indeterminate inflorescence, single flower per leaf axil, branched, four-edge capsule, and black seed coat color.
(16) Other sesame materials including 08TP092, Wuninghei, Zhengzhi 98N09, as wild type involved in examples are all from the germplasm reservoir of Henan Sesame Research Center, Henan Academy of Agricultural Sciences. All above germplasm materials are accessible publicly (or from the germplasm reservoir of Henan Sesame Research Center, Henan Academy of Agricultural Sciences) and planted for application.
(17) It should be noted that a thermal cycler PTC-100 (produced by MJ research company) is adopted for performing PCR amplification. Enzymes, buffer and other reagents involved in the PCR amplification were purchased from Shanghai Sangon Biotech Company. Related primers are provided by the GBI China Corporation. PCR reaction of the plant DNA extraction is referred to modified CTAB method (Wei Libin, et. al., Sesame DNA and RNA synchronous extraction method, 2008, Molecular Plant Breeding). Related gene sequencing experiments are accomplished by Tianjin Gene Chip Biology Company.
Example 1 Selection of the Sidt1 Gene and SNP Molecular Marker Sidt27-1
(18) 1. Genetic Background of the Determinate Growth Habit Trait
(19) To perform the genetic analysis of the determinate growth habit trait, the direct and the reciprocal crosses were carried out between Yuzhi DS899 and Yuzhi 11, JS012, and Wuninghei having the indeterminate growth habit, respectively (specific combinations of the reciprocal cross were as shown in Table 1), and the inflorescence development type of F1 progeny was investigated. Combinations of the direct and the reciprocal crosses of Yuzhi DS899, Yuzhi 11, JS012, and Wuninghei are shown in Table 1:
(20) TABLE-US-00004 TABLE 1 Combinations of the direct and the reciprocal crosses between the determinate and the indeterminate genotypes Parental F.sub.1 F.sub.2 combination generation population BC1 cross Yuzhi DS899 More than Yuzhi DS899 Yuzhi DS899 Yuzhi Yuzhi 11 200 plants Yuzhi 11 11 Yuzhi DS899 Yuzhi DS899 More than Yuzhi DS899 Yuzhi DS899 JS012 JS012 200 plants JS012 Yuzhi DS899 Yuzhi DS899 More than Yuzhi DS899 Yuzhi DS899 Wuninghei 200 plants Wuninghei Wuninghei Yuzhi DS899 Yuzhi 11 More than Yuzhi DS899 200 plants JS012 More than Yuzhi DS899 200 plants Wuninghei More than Yuzhi DS899 200 plants
(21) In which, trait comparison of Yuzhi DS899 (the determinate type) and the indeterminate type parent Yuzhi 11 was shown in
(22) Investigation results of the F.sub.1 generation showed that all the F.sub.1 population presented normal indeterminate growth habit, which indicated that the mutant trait (determinate inflorescence) is controlled by recessive genes. Thereafter, the F.sub.2 progeny of direct crosses of Yuzhi DS899 with Yuzhi 11, JS012, and Wuninghei were cultivated. Each population had exceeding 200 plantlets. Traits were investigated in the filed during the flowering stage, and the results were listed in Table 2.
(23) TABLE-US-00005 TABLE 2 Segregation results of the determinate growth habit traits in the F.sub.2 generation and its progeny derived from the tested cross F.sub.2 segregation Segregation ratio ratio in test cross (determinate: population (determinate: Hybrid combination indeterminate) indeterminate) Yuzhi DS899 Yuzhi 11 64:215 94:92 Yuzhi DS899 JS012 78:242 108:125 Yuzhi DS899 Wuninghei 71:229 78:84
(24) The above data indicated that the segregation ratios of the determinate phenotype to the wild type were 64:215, 78:242, and 71:229. The fitness test results shown that the segregation results fitted the expected 1:3 segregation ratio, which indicated that the mutant trait is controlled by a recessive gene. Further test was performed using the progeny of top-crosses derived from Yuzhi DS899 and Yuzhi 11, JS012, and Wuninghei, respectively. The progeny segregation ratios of the mutated trait were 94:92, 108:125, and 78:84, respectively. The fitness test results indicated that the determinate growth trait fitted the expected segregation ratio of 1:1, which further demonstrated that the determinate growth trait is controlled by one recessive gene.
(25) 2. Construction of F.sub.2 Genetic Population Derived from Crossing the Determinate Growth Type Parent and the Indeterminate Growth Type Parent
(26) In July, 2013, the new combination between purified Yuzhi DS899 (determinate phenotype) and JS012 (indeterminate phenotype) was performed to acquire an F.sub.1 generation.
(27) In November, seeds from the F.sub.1 generation of the above combination were dibbled in nutrition pots and planted in Sanya base of Henan Sesame Research Center, Henan Academy of Agricultural Sciences. When two pairs of euphylla came out, the plants were timely transplanted, and the number of plantlets were ensured larger than 200.
(28) 3. Construction of the SNP Genetic Map of the F.sub.2 Population and the Location of the Sidt1 Gene
(29) 1) Resequencing of parent of F.sub.2 generation and individual DNAs of 122 F.sub.2 plant
(30) 120 plants were randomly selected from the F.sub.2 population. Young leaves were collected respectively from the 120 F.sub.2 plants and 2 parent plants and DNAs were extracted from each plant. Genomes of the 122 materials were re-sequenced using Illumina sequencing method, and the sequencing coverage was 30.
(31) 2) The Yuzhi 11 genome was used as the reference genome (Zhang et al., Genome sequencing of the important oilseed crop Sesamum indicum L., 2013, Genome Biology; Miao et al., The sesame genome project and genome sequencing. XXII International Plant and Animal Genome Conference (San Diego, USA), 2014 (Conference poster abstract)), and Burrows-Wheeler Aligner (BWA) software was employed to assemble the sequenced data of each plant.
(32) 3) The ultra-dense SNP genetic map of the F.sub.2 population of sesame was constructed using the Joinmap_linkage map software. As shown in
(33) 4) During the early flowering stagethe final flowering stage, the inflorescence type of 120 plants of the F.sub.2 population and two parent plants of the F.sub.2 generation was investigated. The phenotype investigation was performed for three times. Combined with the above ultra-dense SNP genetic map, the WinQTL cart software was employed to determine one interval coherently linked to the determinate growth habit of sesame, as shown in
(34) Subsequently, the 15 candidate SNP/InDel polymorphic loci were converted into molecular markers (in another word, primers were designed and amplified according to the known sequences in order to acquire the corresponding sequences). The molecular markers of the specific 15 candidate SNP/InDel polymorphic loci were listed as follows in Table 3:
(35) TABLE-US-00006 TABLE3 Molecularmarkersofthespecific15candidateSNP/InDelpolymorphicloci Sizeof amplified Candidate Primer Tm product SNP/InDel name PrimerDNAsequence(5-3) ( C.) (bp) Sidt27-1 HSDt01-1F CCTGATGTTCCTGGTCCGAA(SEQID 60.4 92 NO.4) HSDt01-2F CTATTCCTGATGTTCCTGGTCCGAG(SEQ 61.9 IDNO.5) HSDt01-R CTATTCCTGATGTTCCTGGTCCGAG(SEQ 55.5 IDNO.6) Sidt27-2 HSDt02-F TTGGGGTTTGGAGTCTTGG(SEQIDNO. 57.9 77 12) HSDt02-1R AATGATTGATGTCTGTGTGTGTCTA(SEQ 57.3 IDNO.13) HSDt02-2R TATTAAATGATTGATGTCTGTGTGTGTCT 58.9 T(SEQIDNO.14) Sidt27-3 HSDt03-F ATTACTCCATAGTCGAGGAAGAAAC 57.8 96 (SEQIDNO.15) HSDt03-1R ACACCTTAATAGAAAAACAAAATCA 57.5 (SEQIDNO.16) HSDt03-2R TATATACACCTTAATAGAAAAACAAAATC 58.9 G(SEQIDNO.17) Sidt27-4 HSDt04-1F ACAATTAATACATGTATATGTGCCC(SEQ 55.7 112 IDNO.18) HSDt04-2F TATATACAATTAATACATGTATATGTGGCG 59.1 (SEQIDNO.19) HSDt04-R CTCTCTCCCTCTCTCATACACAAAT(SEQ 58.2 IDNO.20) Sidt27-5 HSDt05-F AAGTTTTGAACCAACGTAAACA(SEQID 56.8 74 NO.21) HSDt05-1R ATTGATCAGTAAAGATTATCATGGT(SEQ 52.4 IDNO.22) HSDt05-2R ATATAATTGATCAGTAAAGATTATCATGG 53.8 C(SEQIDNO.23) Sidt27-6 HSDt06-1F TGCTCAACCTCCATTTGGCG(SEQID 59.2 103 NO.24) HSDt06-2F TATATTGCTCAACCTCCATTTGGCA(SEQ 62 IDNO.25) HSDt06-R CAACACGTGCTATCATCTGAATC(SEQID 57.6 NO.26) Sidt27-7 HSDt07-1F CGCAGGTTTTATTCTGATATACTG(SEQ 59.9 103 IDNO.27) HSDt07-2F ATATACGCAGGTTTTATTCTGATATACTA 61.5 (SEQIDNO.28) HSDt07-R ACTCTCGTACTTCTCTCTTGAACCC(SEQ 59.7 IDNO.29) Sidt27-8 HSDt08-1F AAATAACAAAGGTGTAAATCATTCC 59.3 114 (SEQIDNO.30) HSDt08-2F AATATAAATAACAAAGGTGTAAATCATTC 60.8 T(SEQIDNO.31) HSDt08-R AGTAGTCGCCATAAACTATAACTCA(SEQ 55.3 IDNO.32) Sidt27-9 HSDt09-F CACAATTTTCTCATTTCACTCGGAA(SEQ 62.7 87 IDNO.33) HSDt09-1R TAGGATGTGGGTTTGTTCTATACAT(SEQ 55 IDNO.34) HSDt09-2R TATATTAGGATGTGGGTTTGTTCTATACA 56.4 G(SEQIDNO.35) Sidt27-10 HSDt10-F AATCAATTGGTAAGGATGGTATCA(SEQ 57.7 193 IDNO.36) HSDt10-R TTATTCGTCACTTACAGATTATCCA(SEQ 56.2 IDNO.37) Sidt27-11 HSDt11-F GCATTTAGAATTACGTTTTAATCTCC 58.3 130 (SEQIDNO.38) HSDt11-R AACCGTTATTGAAATAGTCTATTGG(SEQ 56.9 IDNO.39) Sidt27-12 HSDt12-F TATTATTGCCGTTCTTATTGTTTTT(SEQ 57.7 99 IDNO.40) HSDt12-R CGTCATTTTTTTGGTTATATTTCTA(SEQ 56 IDNO.41) Sidt27-13 HSDt13-F TGGATAAGCATACACACACCAACAT 61.3 129 (SEQIDNO.42) HSDt13-R AACTTGCTGCAGAGGGACTCG(SEQID 60.4 NO.43) Sidt27-14 HSDt14-F GCCGCAATTTAATTTCTTTCA(SEQID 57.9 166 NO.44) HSDt14-R GACTAGAGACTCCCCACACTTAGAT 57.4 (SEQIDNO.45) Sidt27-15 HSDt15-F TTTTTAGCCGTATTCCGAGACTAT(SEQ 59.3 187 IDNO.46) HSDt15-R ATGGCTCTATCTACCAAAATCTAAT(SEQ 55.8 IDNO.47)
(36) 50 plants were randomly selected from the parent plants and the F.sub.2 population to extract DNAs therefrom, and the 15 primer pairs of molecular markers were utilized to evaluate the association relationship. The results demonstrated that only Sidt27-1 locus was tightly associated with the determinate growth habit trait (as shown in
Example 2 Gene Cloning and Gene Sequence Analysis of the Sidt1 Gene
(37) On the basis of Example 1, PCR amplification was applied to obtain the related sequences, and the amplification product was sequenced to obtain the specific sequence of the Sidt1 gene. The processes were introduced as follows:
(38) 1) According to the SNP locus acquired in Example 1 and the genome data of Yuzhi 11, the gene sequence containing the Sidt27-1 locus was determined. The gene sequence was denominated as Sidt1. The sequence analysis of Sidt1 showed that the gene was annotated as TEL gene (SiDt) in the genome of sesame (Yuzhi 11).
(39) Thereafter, software Primer premier 5.0 was utilized to design the primer pair for amplifying the Sidt1 gene according to the genome data, which were specifically as follows:
(40) TABLE-US-00007 SequenceofforwardprimerDt1PrimerF(SEQID NO.7): 5-ATGGCAAAAATGTCATCGGACC-3; and SequenceofreverseprimerDt1PrimerR(SEQID NO.8): 5-CTAGCGCCTTCTAGCAGCAGTC-3.
(41) PCR amplification was then performed using DNA of Yuzhi DS899 as a template.
(42) PCR procedure was as follows: 94 C. for 3 min, 30 cycles of 30 s at 94 C., 30 s at 55 C., 1 min at 72 C., and a final 5 min extension at 72 C. PCR amplification products were preserved at 4 C., or the amplification bands were directly recovered and sequenced.
(43) The results indicated that the DNA sequence of the gene had a length of 1809 bp, including 4 exons and 3 introns (as shown in
(44) In the meanwhile, the above primer pair was adopted to amplify the DNA of Yuzhi 11 and the amplified products were sequenced.
(45) The Sidt1 gene was aligned with SiDt allele of wild type (Yuzhi), results of which were shown in
(46) 2) According to the DNA extraction method as described in the above, RNA was extracted from young plants of Yuzhi DS899 and TaKaRa RNA reverse transcription kit (purchased from TaKaRa company) was utilized to perform the reverse transcription to acquire total cDNA. PCR amplification was performed according to the instruction for use of the reverse transcription kit.
(47) It should be noted that during the reverse transcription process, the primer pairs utilized in the PCR reactions were designed as follows:
(48) TABLE-US-00008 TFL1CDs-F(SEQIDNO.7): 5-ATGGCAAAAATGTCATCGGACC-3; TFL1CDs-R(SEQIDNO.8): 5-CTAGCGCCTTCTAGCAGCAGTC-3.
(49) The PCR reaction was performed to amplify a sequence of the coding region of the cDNA of Sidt. PCR products were then sequenced to yield the cDNA sequence of the Sidt1 gene, which had a length of 531 bp, encoding 176 amino acids, and having a sequence presented by SEQ ID NO. 2.
(50) 3) For demonstrating the SNP locus of the Sidt1 gene, the SNP primer pairs of the Sidt1 gene were designed according to Wei et. al., (Development of SNP and InDel markers via de novo transcriptome assembly in Sesamum indicum L., 2014, Molecular Breeding). It should be explained that in order to distinguish different SNP alleles in the genome, two aspects must be noted as follows:
(51) First, the SNP primer pair was designed to be three primers, and mismatching was required to be introduced into a third base at a 3 end of the specific primer to enhance the specificity of the amplicons. The principle for introducing the mismatching was as follows: the third mismatching base at the 3 end of the primer was able to form stable complementary mismatch structure with the SNP mismatching base at the 3 end, that was, strong dismatching type (C/T or G/A) and weak dismatching type (C/A or G/T) were coordinated, and medium dismatching type (A/A, C/C, G/G, or T/T) and medium dismatching type were coordinated.
(52) Second, to one of two forward or reverse primers containing the SNP locus, five bases were randomly added to the 5 end of the primer sequence, primarily for the purpose of distinguishing the PCR products of different loci much easier in subsequent gel electrophorogram.
(53) Primer pairs of SNP loci designed by software Primer premier 5.0 were as follows:
(54) TABLE-US-00009 aforwardprimerHSDt01-1FrepresentedbySEQID NO.4: 5 CCTGATGTTCCTGGTCCGAA3; aforwardprimerHSDt01-2FrepresentedbySEQID NO.5: 5 CTATTCCTGATGTTCCTGGTCCGAG3; areverseprimerHSDt01-RrepresentedbySEQID NO.6: 5 TAAATCAATCAGGTCTTAAGCAGT3;
(55) It should be noted that when the forward primer HSDt01-1F matched with the reverse primer HSDt01-R, the amplified product had a band size of 92 bp (dt1 type); when the forward primer HSDt01-2F matched with the reverse primer HSDt01-R, the amplified product had a band size of 96 bp (dt2 type).
(56) To identify the Sidt1 gene to be the gene controlling the inflorescence development type in sesame, F.sub.2 populations of three combinations were constructed for validation. These F.sub.2 populations were specifically as follows: F.sub.2 progeny derived from three combinations of Yuzhi DS899Yuzhi 11, Yuzhi DS899JS012, and Yuzhi DS899Wuninghei, respectively were constructed, and 50 lines were randomly selected from the F.sub.2 progeny, and in the meanwhile, the inflorescence phenotype of each line were investigated in the field.
(57) 50 plantlets were randomly selected from the 50 lines, and young leaves were collected from the 50 plantlets and 4 parent plantlets. DNAs were extracted from each plant and used as templates for performing PCR amplification, respectively.
(58) PCR reaction adopted a 10 L reaction system, which was as follows:
(59) Template DNA (50 ng/L), 1.0 L;
(60) 10PCR Buffer (Mg.sup.2+), 1.0 L;
(61) Taqase (5 U/L), 0.2 L;
(62) dNTP (10 mmol/L), 0.2 L;
(63) Forward Primer 1 (10 M), 0.5 L;
(64) Forward specific Primer 2 (10 M), 0.5 L;
(65) Reverse Primer (10 M), 1.0 L; and
(66) Added with ultrapure water 5.6 L.
(67) The PCR procedure was as follows: 94 C. for 3 min, 30 cycles of 30 s at 94 C., 30 s at 55 C., 30 s at 72 C., and a final 5 min extension at 72 C. PCR products were preserved at 4 C.
(68) PCR products were conducted with non-denaturing polyacrylamide gel electrophoresis analysis, in which, a gel concentration was between 8 and 10 wt. %, a gel size was 180 mm120 mm2 mm, an electrophoresis buffer was 0.5TBE, and the electrophoresis was performed at 150V AC voltage for 1.5 to 2 hours. After the electrophoresis, 0.1% silver nitrate solution was added to the gel and a resulting mixture was placed on a horizontal shaker for 10 minutes. Then 2% sodium hydroxide and 0.4% formaldehyde mixed solution were added for appropriateness color developing in horizontal shaker. Finally, the gel was rinsed with water and data was read and recorded.
(69) A part of an electrophoresis photograph was shown in
(70) The results indicated that plants with determinate phenotype had the amplicon with a band size of 92 bp, parent plants with indeterminate phenotype had the amplicon with a band size of 97 bp, and hybrid plants had amplicons with band sizes of 92 bp and 97 bp and the phenotype was indeterminate.
(71) Thus, Sidt1 was considered as the gene causing the mutation of the determinate growth habit in sesame and was adaptable to the study of the inflorescence development in crops.
Example 3 Sequence Analysis of Sidt1 Gene
(72) To further identify the characteristics of the Sidt1 gene and in the meanwhile identify the copy number thereof in the genome of sesame, Southern hybrid blotting was performed.
(73) 1) Design and preparation of Southern hybridization probe of the Sidt1 gene
(74) Software Primer Premier 5.0 was utilized to design the primer pair according to genome DNA and SiDt sequence of Yuzhi 11, and the primer pair was specially as follows:
(75) TABLE-US-00010 ForwardprimerofDt-Gs(SEQIDNO.48): 5-GAGCCCTCTTTCAAAAACACC-3; and ReverseprimerofDt-Gs(SEQIDNO.49): 5-AGCAGCAACAGGGAGACCTA-3.
(76) Genome DNA of Yuzhi 11 as the template and the primer pairs Dt-Gs was adopted for PCR amplification, and PCR products had a band size of 459 bp.
(77) Ingredients and volumes for the PCR reaction were as follows:
(78) Template DNA (50 ng/L), 2.0 L;
(79) 10PCR Buffer (Mg.sup.2+), 5.0 L;
(80) Taqase (5 U/L), 0.5 L;
(81) dNTP (10 mmol/L), 1.0 L;
(82) Forward primer Dt-Gs (10 M), 1.0 L;
(83) Reverse primer (10 L), 1.0 L;
(84) Added with ultrapure water to a total volume of 50 L;
(85) The PCR reactions were carried out under the following conditions: 94 C. for 3 min, 30 cycles of 30 s at 94 C., 30 s at 55 C., 30 s at 72 C., and a final 5 min extension at 72 C. PCR amplified products were preserved at 4 C.
(86) The PCR products were detected by 1% agarose gel electrophoresis and sequenced for identification.
(87) The PCR products were used as the Southern hybridization probes, and DIG-High Prime DNA Labeling & Detection Starter Kit I (Roche company) was utilized for performing probes labeling and detection. Specific processes were performed following the instruction of DIG-High Prime DNA Labeling & Detection Starter Kit I.
(88) 2) Construction of recombinant standard plasmid
(89) The probe fragments obtained in the above step 1) were inserted into a vector pGEM-T Easy to construct a pGEM-T Easy plasmid carried with the probe fragments, which was used as a positive control of the Southern hybridization.
(90) Processes including ligation, recovery, and purification of the plasmid were accomplished using ligation and recovery kits (related regents and kits were all purchased from Promega corporation), and the quality of the plasmid was detected by 0.8% agarose gel electrophoresis.
(91) The pGEM-T Easy plasmids carried with the probe sequence was extracted using DNA extraction kit (TaKaRa company), and diluted to a concentration of between 1 and 5 g/L for subsequent Southern blotting. Specific processes were performed according to the instructions of DNA extraction kit.
(92) 3) Southern blotting of the Sidt1 gene
(93) 200 g of young leaves of three sesame varieties of Yuzhi 11, Yuzhi Ds899, and S. raditum (wild species) were respectively collected and DNAs of each plant were extracted.
(94) 10 g of the genome DNAs of the three varieties were respectively collected and digested by two restriction endonuclease enzymes of HindIII and EcoRI for 16 h, and the digested products were recovered and purified using the recovery kit (related enzyme reagents and recovery kits were all purchased from TaKaRa company, and specific processes thereof were carried out according to the instructions of the kits).
(95) The digested products were properly concentrated, labeled by digoxin, and applied for Southern hybridization. Specific hybridization process was as follows:
(96) The electrophoresis of the digested DNA products was performed with 0.7% gel at a constant voltage of 25 V, 4 C. for overnight. Then the DNA products were transferred to hybridization membrane, and hybridized with probes, and the membrane was then washed. Southern hybridization results were recorded, as shown in
(97) Specific processes and operations of Southern hybridization were carried out according to the instructions of digoxin labeled Southern blotting kit (Roche company).
(98) It was known from the results of Southern hybridization that in the determinate (dt1 type) and the indeterminate (dt0 type) sesame germplasm, the Sidt1 and the SiDt allele were all hybridized. The hybridized band was sole and the size thereof was approximately the same. This result indicated that the Sidt1 and the allele all existed with single copy in the genomes of the cultivated or the wild type germplasm with the two inflorescence growth phenotypes. The difference existed in the gene sequences of the Sidt1 and the allele thereof is very slight.
Example 4 Development of SNP Molecular Marker Sidt27-1 of Sidt1 Gene
(99) As exhibiting the selection process of breeding materials with high yield, high quality, and the determinate growth habit, the example introduced the specific application of the SNP molecular marker Sidt27-1 of the Sidt1 gene.
(100) 1) In order to breed materials with high yield, high quality, and the determinate growth habit, Zhengzhi 98N09 was selected from the sesame germplasm reservoir as a female parent, and Yuzhi DS899 was selected as a male parent and the two parents were planted in Yuanyang experimental base of Henan Sesame Research Center, Henan Academy of Agricultural Sciences in June 2014. Cross combination was performed to get F.sub.1 population in July, 2014. Seeds of the F.sub.1 population were sowed in Sanya base in November, 2014, and plants were self-pollinated in inbred net, then seeds of the F.sub.2 generation were obtained, and the F.sub.2 population has larger than 200 plantlets. In February, 2015, healthy seeds were randomly selected from 50 plantlets of F.sub.2 generation and planed in Sanya base of Hainan. The inflorescence development type of the F.sub.2 progeny was investigated. Each line was planted with three repeats, and 10 plantlets per each repeat were investigated.
(101) 2) Reliability of SNP markers was evaluated using the three primers (forward primer HSDt01-1F, forward primer HSDt01-2F, reverse primer HSDt01-R) of Example 2.
(102) 50 plantlets were randomly selected from the F.sub.2 population and two parent plantlets were selected. DNAs were extracted from each plant and used as templates for PCR amplification.
(103) PCR reaction adopted a 10 L reaction system, which was as follows:
(104) Template DNA (50 ng/L), 1.0 L;
(105) 10PCR Buffer (Mg.sup.2+), 1.0 L;
(106) Taqase (5 U/L), 0.2 L;
(107) dNTP (10 mmol/L), 0.2 L;
(108) Forward Primer 1 (10 M), 0.5 L;
(109) Forward specific Primer 2 (10 M), 0.5 L;
(110) Reverse Primer (10 M), 1.0 L;
(111) Added with ultrapure water 5.6 L.
(112) The PCR procedure was as follows: 94 C. for 3 min, 30 cycles of 30 s at 94 C., 30 s at 55 C., 30 s at 72 C., and a final 5 min extension at 72 C. PCR amplified products were preserved at 4 C.
(113) 3) Non-denaturing polyacrylamide gel electrophoresis analysis for separating amplified products
(114) PCR products yielded from 2) were analyzed with non-denaturing polyacrylamide gel electrophoresis, in which, the gel concentration was between 8 and 10 wt. %, the gel size was 180 mm120 mm2 mm, the electrophoresis buffer was 0.5TBE, and treatment was electrophoresis at 150V AC voltage for 1.5 to 2 h. After the electrophoresis, 0.1% silver nitrate solution was added to the gel and a resulting mixture was silver-dyed on a horizontal shaker for 10 min. Then 2% sodium hydroxide and 0.4% formaldehyde mixed solution were added for appropriate color developing on horizontal shaker. Finally, the gel was rinsed with water and the band data was read and recorded.
(115) A part of an electrophoresis photograph was shown in
(116) 4) Consistence of the detection results of the SNP molecular marker with the phenotypes of the test samples
(117) It was known from the screening process of the Sidt27-1 that theoretically, plants containing the allele 1 of Sidt27-1 (a band size of 92 bp, i. e., Sidt27-1 locus) present determinate; plants containing the allele 2 of Sidt27-1 (a band size of 97 bp, i. e., when a G base in the Sidt27-1 locus is mutated into an A base) present indeterminate; and plants containing the allele 1 and allele 2 of Sidt27-1 (band sizes of 92 bp and 97 bp) are hybrid plants and present the indeterminate inflorescence.
(118) The phenotype investigation results indicated that all the 20 plants containing the allele 1 of Sidt27-1 (the band size of 92 bp) presented determinate, and the reliability was 100%. All the 15 plants containing the allele 2 of Sidt27-1 (the band size of 97 bp) presented indeterminate, and the reliability was 100%. All the 15 plants containing the allele 1 and allele 2 of Sidt27-1 (band sizes of 92 bp and 97 bp) were hybrid plants and presented indeterminate inflorescence, and the reliability was 100%.
(119) PCR amplification results of a part of the plants were shown in
(120) In summary, the SNP marker was demonstrated to be the SNP molecular marker for the Sidt1 gene, which was adapted to predicting the inflorescent development type of the sesame varieties, to molecular marker-assisted breeding and the breeding of the new sesame varieties having the determinate growth habit.
(121) Unless otherwise indicated, the numerical ranges involved in the invention include the end values. While particular embodiments of the invention have been shown and described, it will be obvious to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects, and therefore, the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of the invention.