Cherry tree rootstock named ‘Clinton’

Abstract

A new cherry tree variety suitable for use as rootstock.

Claims

1. A new and distinct variety of cherry tree substantially as described and illustrated herein.

Description

BRIEF DESCRIPTION OF PHOTOGRAPHS

(1) The accompanying photographs display flowers, leaves, leaves image 2, and fruits from a self-rooted mother block tree at Clarksville, Mich. planted in 2005.

(2) FIG. 1 is a photograph showing the flowers of CLINTON (May 2014);

(3) FIG. 2 is a photograph of two leaves from CLINTON (July 2016);

(4) FIG. 3 is a photograph of five leaves of CLINTON with a ruler (July 2016);

(5) FIG. 4 is a photograph of cherries from CLINTON (July 2013);

(6) FIG. 5 is a photograph of the young tree of CLINTON (July 2016);

(7) FIG. 6 is a photograph of the flowers on the tree of CLINTON (May 2014);

(8) FIGS. 7A and 7B are photographs of the cherry tree of CLINTON before and after thinning (2012).

DESCRIPTION OF THE NEW VARIETY

(9) The following is a detailed botanical description of the new variety of cherry tree, its flowers, foliage and fruit, as based on observations of various aged specimens grown at Clarksville, Mich. with color in accordance with The Royal Horticultural Society Colour Chart (R.H.S.), 2001 edition. Measurement details: Flowers: Inflorescence height.Measured from where the flower cluster attaches to the branch to the most distal floral part. Flower diameter.Measured across the petals in mm. Flower length.Measured from the bottom of the pedicel to the most distal flower point (mm). Pedicel.The stem of an individual flower. It is measured from the attachment in the bud to the start of the perianth. Peduncle.A stalk supporting an inflorescence. In these selections, the cherry flowers within a flower bud all start at the same base and they the stalk separates into individual pedicels supporting each flower. Anther color.Before the anther's dehisce, when they are still bright yellow and plump. Anther length.Measured for the longest anther measured from the top of the perianth tube. Style.Measured above the swelled ovary. Tree.Height: Approx. 8 ft. Diameter: Approx. 10 ft. Vigor: Weak. Branching habit: Spreading. Branching: Strong. Hardiness: Cold Tolerant. Plant flowers: present. Scion compatibility confirmed: Hedelfingen, Bing, Montmorency. Stem (trunk).Strength: medium. Texture: rough. Color: grey brown (RHS 200A). A comparison of the stems of Clinton and GiSelA 6 (GI 148/1) is provided in Table 1 below:

(10) TABLE-US-00001 TABLE 1 Botanical GiSelA 6 description Clinton (GI 148/1) Stem strength medium medium Stem texture rough rough Stem color grey brown grey brown One year old shoot.Thickness: thin. Length of internode (middle third of shoot mean of 10): 4.0 cm (2.9-5.2). Pubescence (upper third): present. Number of lenticels: 6. Anthocyanin coloration of apex: medium. Position of vegetative bud in relation to shoot: slightly-markedly held out. Shape of apex of vegetative bud: obtuse. Branching: medium. Leaves.Mature leaf arrangement: alternate. Intensity of anthocyanin coloration of young leaf (during rapid growth): medium. Leaf blade shape: ovate. Leaf blade: ratio length to width: 1.6. Leaf length-blade only (cm): 8.1. Leaf width (cm): 4.9. Leaf blade angle of apex (excluding tip): right-angled. Leaf blade shape of base: obtuse. Leaf blade shape of apex (e.g., acute): acute. Leaf blade; incisions of margin: only serrate. Leaf blade: depth of incisions of margin: medium. Leaf blade color of upper side: light green (RHS 137B). Leaf blade: glossiness of upper side: medium. Leaf blade: pubescence of lower side of apex: medium. Petiole: presence of pubescence of upper side: present. Petiole: intensity of pubescence of upper side: medium. Petiole: depth of groove: shallow. Leaf ratio length of leaf blade/length of petiole: 5.1. Leaf: presence of nectaries: present. Varieties with nectaries only: Leaf predominant number of nectaries: two. Leaf: position of nectaries: base of leaf blade. Nectary shape: reniform. Upper surface color (RHS): 137B. Leaf upper surface texture/pubescence: smooth. Leaf upper surface venation color (RHS): 138A. Lower surface color (RHS): 137C. Leaf lower surface texture/pubescence: medium pubescence. Leaf lower surface venation color (RHS): 138C. Leaf stipule frequency: present. Leaf stipule length (mm): 10. Leaf stipule width (mm): 2.5. Leaf stipule shape: pointed. Leaf stipule margin: serrated. Leaf petiole length (mm): 13. Leaf petiole diameter (mm): 1.5. Leaf petiole color (RHS): 138B and 59A. A comparison of the leaves of Clinton and GiSelA 6 (GI 148/1) is provided in Table 2 below:

(11) TABLE-US-00002 TABLE 2 Botanical GiSelA 6 description Clinton (GI 148/1) Mature leaf alternate alternate arrangement Leaf length-blade 8.1 8.7 only (cm) Leaf width (cm) 4.9 5.4 Laminae apex acute acute Leaf upper surface smooth smooth texture/pubescence Leaf upper surface 138A 138A venation color (RHS) Leaf lower surface medium medium texture/pubescence pubescence pubescence Leaf lower surface 138C 138C venation color (RHS) Leaf stipule present present frequency Leaf stipule length 10 6 (mm) Leaf stipule width 2.5 2 (mm) Leaf stipule shape pointed pointed Leaf stipule margin serrated serrated Leaf petiole length 13 11 (mm) Leaf petiole 1.5 1.6 diameter (mm) Leaf petiole color 138B and 138B and 59A (RHS) 59A Flowers.Flowers per cluster: 2 to 3. Fragrance: none. Bloom date (50%): Apr. 29, 2016. Inflorescence height (cm): 4.2. Inflorescence diameter (cm): 4.6. Flower diameter (mm): 32. Flower length (mm): 33. Petal number per flower: 4 or 5. Petal arrangement: flat whorl. Petal length (mm): 11.3. Petal width (mm): 9.5. Petal shape: oval/round. Petal apex: round. Petal margin: smooth. Petal texture: smooth (both upper and lower sides). Petal color when fully opened upper surface (RHS): 155D. Petal color when fully opened lower surface (RHS): 155D. Sepal number: 4 or 5. Sepal length (mm): 4.8. Sepal width (mm): 3. Sepal shape: triangle. Sepal apex: pointed. Sepal margin: serrated. Sepal texture: smooth (on upper side and pubescent on lower side). Sepal color upper (RHS): 138B. Sepal color lower (RHS): 59A with some 138B. Flower pedicel length (mm): 19. Flower pedicel diameter (mm): 1. Flower pedicel angle (degrees): 30. Flower pedicel texture: smooth. Flower pedicel color (RHS): 59A to 138B. Flower peduncle length (mm): 1. Flower peduncle diameter (mm): 2. Flower peduncle texture: smooth. Flower peduncle color (RHS): 138B. Pistils: number per flower: 1. Pistil length (mm): 7.5. Pistil color (RHS): 149B. Style length (mm): 9. Style color (RHS): 138C. Stigma shape: round/indented. Stigma color (RHS): 138B. Stamens: number per flower: 18 to 24. Longest filament length (mm): 8. Filament color (RHS): 155D. Longest anther length (mm): 9. Anther color (RHS): 20B. Pollen color (RHS): 17C. Pollen amount: moderate. A comparison of the flowers of Clinton and GiSelA 6 (GI 148/1) is provided in Table 3 below:

(12) TABLE-US-00003 TABLE 3 Botanical GiSelA 6 description Clinton (GI 148/1) Flower fragrance none none Entire flower bloom period Individual flower bloom period Inflorescence height (cm) 4.2 3.5 Inflorescence diameter (cm) 4.6 3/7 Flower diameter (mm) 32 24 Flower length (mm) 33 31 Petal arrangement flat whorl flat whorl Petal shape oval/round oval/round Petal apex Round Round Petal margin smooth smooth Petal texture smooth smooth Petal color - upper surface 155D 155D Petal color - lower surface 155D 155D Sepal shape triangle triangle Sepal apex pointed pointed Sepal margin serrated serrated Sepal texture smooth smooth Sepal color (upper) 138B 138B Sepal color (lower) 59A with some 59A with some 138B 138B Flower pedicel length (mm) 19 15 Flower pedicel diameter 1 1 (mm) Flower pedicel angle 30 30 (degrees) Flower pedicel texture smooth smooth Flower pedicel color 59A to 138B 59A to 138B Flower peduncle length 1 8 (mm) Flower peduncle diameter 2 2 (mm) Flower peduncle texture smooth smooth Flower peduncle color 138B 138B Number of pistils per flower 1 1 Style length (mm) 9 8 Style color 138C 138C Stigma shape round/indented round/indented Stigma color 138B 138B Stamen filament color 155D 155D (RHS) Anther length (mm) 8 7 Anther color (RHS) 9B 9B Pollen color (RHS) 17C 17C Fruit.Mature fruit shape: flat-round. Mature fruit height (mm): 16.3. Mature fruit width 1 (mm): 17.2. Mature fruit width 2 (mm): 18.8. Mature fruit ratio height/width 2: 0.87. Mature fruit weight (g): 3.6. Mature fruit flesh taste: sour. Mature fruit skin color (RHS): 45A. Mature fruit flesh color (RHS): 31C. Stone color (RHS): 164D. Stone shape: oval. Stone number: 1. Stone height (mm): 8.6. Stone width 1 (mm): 8.4. Stone width 2 (mm): 6.6. Stone ratio height/width 2: 1.31. Stone weight (g): 0.27. Fruit stem length (mm): 32. A comparison of the fruit of Clinton and GiSelA 6 (GI 148/1) is provided in Table 4 below:

(13) TABLE-US-00004 TABLE 4 GiSelA 6 Botanical description Clinton (GI 148/1) Mature fruit shape flat-round round Mature fruit flesh taste sour sweet-sour Mature fruit flesh color 31C 23C (RHS) Mature fruit skin color 45A 45A Stone color (RHS) 164D 164D Stone shape oval oval Stone number 1 1
Simple Sequence Repeat (SSR) Materials and Methods

(14) The use of clonally propagated Prunus sp. rootstocks in cherry production is increasing as these rootstocks provide reduced tree size and precocity. DNA markers that differentiate rootstocks are an important tool to verify identity among these rootstocks during the vegetative propagation stage. The simple sequence repeat (SSR) marker PceGA59 was previously determined to uniquely distinguish the commercially available GiSelA (GI 148/2 and GI 148/1) rootstocks (Struss et al. 2002).

(15) A targeted approach was used to develop a second SSR that was capable of providing differentiation of the rootstock selections of the invention and others by the inventors. The approach used was based on the ability to obtain genome-wide SNP (Single Nucleotide Polymorphism) data using the Illumina Infinium cherry SNP array (Peace et al. 2012). An analysis of genome-wide SNP data for the rootstocks resulted in the identification of a genomic region on linkage group 4 that was likely to differ among the MSU rootstocks.

(16) Using the peach genome sequence, an SSR marker was designed to target this region. This SSR marker, termed PruG4RS, successfully differentiated the MSU rootstocks. The development of PruG4RS and its combined use with PceGA59 has successfully circumvented the limitations of each individual marker and proven effective for use as a quality control DNA diagnostic tool for the commercial GiSelA (GI 148/2 and GI 148/1) rootstocks as well as the MSU breeding program rootstock selections.

(17) SSR Markers Used

(18) Fingerprinting was performed using two simple sequence repeat (SSR) markers: PceGA59 and PruG4RS. The forward and reverse primers sequences for these two SSR markers are as follows:

(19) TABLE-US-00005 TABLE5 Primername Primersequence5 .fwdarw. 3 PceGA59_redesigned_F TGAACCCCTCTACAAATTTTCC PceGA59_redesigned_R GACTGTAGAACCCAAAAGAACG PruG4RS-F TCAGAAAAGAAATTGCAACGGG PruG4RS-R CTTAGTGGTCTAGTC TGCATGC

(20) The first primer pair, PceGA59, was published in Struss et al. (2002). However, the primer sequence reflects the addition of GC clamps. Based on genetic data for the MSU cherry rootstocks we designed a second primer, PruG4RS (Andersen et al. 2015)

(21) Plant Material Used and DNA Extraction

(22) Cherry DNA was extracted from young unfolded leaf blades using the procedure of Edge-Garza et al. (2014).

(23) Polymerase Chain Reaction (PCR)

(24) PCR amplification was performed for the two SSRs using the following conditions: 94 C. for 5 min followed by 9 cycles of 94 C. for 30 s, 60 C. for 45 s (1 C. per cycle), 72 C. for 1 min and then 24 cycles of 94 C. for 30 s, 55 C. for 45 s, 72 C. for 1 min with an elongation step of 72 C. for 5 min.

(25) Gel Electrophoresis and Fragment Visualization

(26) The PCR products were visualized by electrophoresis on a 6% denaturing polyacrylamide gel in a 50 cm Sequi-Gen GT vertical sequencing apparatus (Bio-Rad Laboratories, Hercules, Calif.) for 2.5 hours at 70 watts with 1 TBE buffer. Following electrophoresis, the gels were stained with the Silver Sequence DNA Sequencing System (Promega Corporation, Madison, Wis.) and dried for 24 hours. DNA fragment sizes were scored visually using 10 and 50 base pair ladders (Invitrogen Corporation, Carlsbad, Calif.).

(27) TABLE-US-00006 TABLE 6 DNA Fingerprint Data PceGA59 Allele (bp) 182 186 189 194 226 Clinton + + + + GiSelA 5 + + + (GI 148/2) GiSelA 6 + + + (GI 148/1) PruG4RS Allele (bp) 172 182 190 192 196 198 200 Clinton + + + + GiSelA 5 + + (GI 148/2) GiSelA 6 + + (GI 148/1)

(28) All references cited herein, are hereby incorporated in their entirety by reference, including but not limited to the following which relate to determination of various alleles.

(29) Struss D, Boritzki M, Karle R, and Iezzoni A F. 2002. Microsatellite markers differentiate eight Giessen cherry rootstocks. Hort Science 37: 191-193.

(30) Andersen K, Sebolt A, Stegmeir T, Iezzoni A. 2015. Development of the Simple Sequence Repeat marker PruG4RS for the differentiation of cherry rootstocks. American Society for Horticultural Sciences Annual Conference, New Orleans, La., August 4-7, Poster #023.

(31) Edge-Garza, D., Rowland, T., Haendiges, S. and Peace, C. 2014. A high-throughput and cost-efficient DNA extraction protocol for the tree fruit crops apple, sweet cherry, and peach relying on silica beads during tissue sampling. Molecular Breeding 34:2225-2228.