RECOMBINANT POLYNUCLEOTIDE INVOLVED IN LACTONE SYNTHESIS AND PROCESS FOR SYNTHESIS OF LACTONES THEREOF

20190153459 ยท 2019-05-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides the polynucleotide encoding enzyme involved in lactone synthesis and a process for synthesis of lactones using said polynucleotides. The invention also provides recombinant plasmid expression vector comprising said polynucleotide sequence. The recombinant protein encoded by said polynucleotides leads to synthesis of lactones having flavour peculiar to Alphonso mangoes.

    Claims

    1. A recombinant polynucleotide involved in lactone synthesis, wherein the polynucleotide is selected from the group consisting of: (a) a polynucleotide sequence as set forth in SEQ ID No. 1 encoding a recombinant polypeptide epoxide hydrolase 2 of SEQ ID No. 3; and (b) a polynucleotide sequence as set forth in SEQ ID No. 4 encoding a recombinant polypeptide peroxygenase of SEQ ID No. 6.

    2. A process for synthesis of lactones, said process comprising: (a) synthesizing polynucleotide sequence as set forth in SEQ ID No.: 4; (b) expressing a recombinant construct carrying said polynucleotide sequence of SEQ ID No. 4 in a host cell to obtain recombinant polypeptide peroxygenase of SEQ ID No. 6 wherein the host cell is selected from the group consisting of E. coli BL21 or E. coli Rosetta; (c) catalyzing conversion of unsaturated fatty acids to epoxy fatty acids in presence of the recombinant polypeptide peroxygenase of SEQ ID No. 6 of step (b) to obtain epoxy fatty acids; (d) synthesizing polynucleotide sequence as set forth in SEQ ID No.: 1; (e) expressing a recombinant construct carrying said polynucleotide sequence of SEQ ID No. 1 in a host cell to obtain recombinant polypeptide peroxygenase of SEQ ID No. 3; (f) catalyzing conversion of the epoxy fatty acids from step (c) to di-hydroxy fatty acids in presence of the recombinant polypeptide peroxygenase of SEQ ID No. 3 of step (e) to obtain di-hydroxy fatty acids; and (g) subjecting the di-hydroxy fatty acids of step (f) to multiple cycles of to and oxidation to obtain the lactones.

    3. The process as claimed in claim 2, wherein said polynucleotide is a cDNA.

    4. The process as claimed in claim 2, wherein polynucleotide of SEQ ID No. 4 is synthesized by using primer pairs selected from the group consisting of SEQ ID No.: 19-SEQ ID No. 20, SEQ ID No.: 21-SEQ ID No. 22, SEQ ID No.: 23-SEQ ID No. 24, and SEQ ID No.: 25-SEQ ID No. 26.

    5. The process as claimed in claim 2, wherein polynucleotide of SEQ ID No. 1 is synthesized by using primer pairs selected from the group consisting of SEQ ID No.: 7-SEQ ID No. 8, SEQ ID No.: 9-SEQ ID No. 10, SEQ ID No.: 11-SEQ ID No. 12, SEQ ID No.: 13-SEQ ID No. 14, SEQ ID No.: 15-SEQ ID No. 16, and SEQ ID No.: 17-SEQ ID No. 18.

    6. The process as claimed in claim 2, wherein the recombinant construct comprises: (i) an expression vector selected from a plant plasmid expression vector or a bacterial plasmid expression vector; and (ii) polynucleotide sequence selected from the group consisting of SEQ ID No. 1 and SEQ ID No. 4.

    7. The process as claimed in claim 6, wherein the expression vector is selected from the group consisting of pBI121, pET101D, pEXP5-CT/TOPO and pGEMT.

    8. The process as claimed in claim 2, wherein the lactones are selected from the group consisting of -butyrolactone, -valerolactone, -hexalactone, -hexalactone, -octalactone, -octalactone, -decalactone, and -decalactone.

    9. A process of enhancing the synthesis of lactone in fruit of a plant, wherein the method comprises introducing the plasmid expression vector as claimed in claim 2 in fruit of a plant by agroinfiltration.

    10. The process as claimed in claim 9, wherein the plant is mango.

    Description

    BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS

    [0036] FIG. 1 depicts the CBB stained SDS-PAGE gels representing purified recombinant protein MiEH2;

    [0037] FIG. 2 indicates agroinfiltration of empty pBI121 and pBI121 comprising nucleotide sequences selected from SEQ ID No. 1/SEQ ID No. 4 constructs in two different regions of the same mango fruit separated by fruit stone (a). Representative images of Alphonso mango fruit after agroinfiltration and Gus staining (b).

    [0038] FIG. 3 represents extracted ion chromatograms from HRMS analysis for product identification of MiEH2 assay reactions, standards; TSO (a), meso hydrobenzoin (b), CSO (d), R, R (+) hydrobenzoin (e), 12,13 EpOME (g). Chromatogram representing product formation by MiEH2 with substrates TSO (c), CSO (f) and 12,13 EpOME (h). Assay reaction of protein expressed from empty vector with 12,13 EpOME substrate (i). X axes represents retention time (min) and Y axes represents relative intensity;

    [0039] FIG. 4 shows column graphs representing changes in lactone content with respect to control upon transient over expression of MiEH2. Vertical bars represent standard error in the values of lactones from user data set, .star-solid.p0.1; .star-solid..star-solid.p<0.05;

    [0040] FIG. 5 depicts line graphs representing changes in the activity of MiEH2 at different pH (a) and temperatures (b);

    [0041] FIG. 6 depicts transcript profiles of MiPGX1 and MiEH2 from pulp and skin tissues of various fruit development and ripening stages of Alphonso (a), Pairi (b) and Kent (c) mango cultivars. Vertical bars at each data point represent standard error in the relative quantification among the biological replicates. X axes represents fruit development and ripening stages and Y axes represents relative transcript abundance.

    BRIEF DESCRIPTION OF SEQUENCE LISTING

    [0042] SEQ ID No. 1 represents polynucleotide encoding polypeptide epoxide hydrolase 2 (957 bp)

    [0043] SEQ ID No. 2 represents nucleotide sequence encoding epoxide hydrolase 2 (1875 bp)

    [0044] SEQ ID No. 3 represents amino acid sequence of epoxide hydrolase 2 (318 bp)

    [0045] SEQ ID No. 4 represents polynucleotide encoding polypeptide peroxygenase (708 bp)

    [0046] SEQ ID No. 5 represents nucleotide sequence encoding peroxygenase (1515 bp)

    [0047] SEQ ID No. 6 represents amino acid sequence of peroxygenase (235 bp)

    [0048] SEQ ID No. 7 represents forward primer EH DeF1 (17 bp)

    [0049] SEQ ID No. 8 represents reverse primer EH DeR4 (14 bp)

    [0050] SEQ ID No. 9 represents forward primer EHRCF2 (22 bp)

    [0051] SEQ ID No. 10 represents reverse primer EHRCR1 (22 bp)

    [0052] SEQ ID No. 11 represents forward primer EHtrF1 (27 bp)

    [0053] SEQ ID No. 12 represents reverse primer EHtrR1 (28 bp)

    [0054] SEQ ID No. 13 represents forward primer EHTOPO_F1 (24 bp)

    [0055] SEQ ID No. 14 represents reverse primer EHTOPO_R1 (14 bp)

    [0056] SEQ ID No. 15 represents forward primer EHpBI121F1 (39 bp)

    [0057] SEQ ID No. 16 represents reverse primer EHpBI121R1 (43 bp)

    [0058] SEQ ID No. 17 represents forward primer EHRTF4 (25 bp)

    [0059] SEQ ID No. 18 represents reverse primer EHRTR4 (25 bp)

    [0060] SEQ ID No. 19 represents forward primer PGX_De_F (22 bp)

    [0061] SEQ ID No. 20 represents reverse primer PGX_De_R (19 bp)

    [0062] SEQ ID No. 21 represents forward primer PGX_RC_F (23 bp)

    [0063] SEQ ID No. 22 represents reverse primer PGX_RC_R (22 bp)

    [0064] SEQ ID No. 23 represents forward primer MiPGX_Tr_F (24 bp)

    [0065] SEQ ID No. 24 represents reverse primer MiPGX_Tr_R (27 bp)

    [0066] SEQ ID No. 25 represents forward primer MiPGX1_RT_F1 (25 bp)

    [0067] SEQ ID No. 26 represents reverse primer MiPGX1_RT_R1 (25 bp)

    DETAILED DESCRIPTION OF THE INVENTION

    [0068] The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.

    [0069] Alphonso, Pairi, and Kent varieties of mangoes used in the present invention were obtained from locations in Maharashtra, India. Alphonso and Pairi cultivars were collected from the Mango Research Sub Centre of Dr. Balasaheb Sawant Konkan Agricultural University, Dapoli, Deogad. cv. Kent vrieties were collected from the Regional Fruit Research Station, Dr. Balasaheb Sawant Konkan Agricultural University, Vengurle.

    [0070] Plasmid vectors were commercially obtained/purchased; the cloning vector-pGEMT was procured from Promega, WI, USA; the bacterial expression vector pEXP5-CT/TOPO was procured from Invitrogen, Carlsbad, Calif., USA; and the plant expression vector pBI121 was procured from Clontech, Palo, Alto, Calif. NCBI Accession No. AF485783. The host cell BL21(DE3) pLysS Rosetta cells used for recombinant protein expression were obtained from Novagen, Madison, Wis., USA. E. coli (Top 10) cells were obtained from Novagen, Madison, Wis., USA. Agrobacterium strain GV3101 is employed as referred to by Koncz and Schell, 1986.

    [0071] Epoxide hydrolase (EH) genes are categorized into two classes EH1 and EH2, EH1 catalyzes aromatic epoxide hydrolysis and EH2 catalyzes hydrolysis of fatty acids epoxides and aromatic compounds (Wijekoon et al. 2008; Huang and Schwab 2013). EH2 is known for its activity on epoxy fatty acids formed by peroxygenase to form hydroxy fatty acids. Hydroxy fatty acids formed undergo multiple cycles of and oxidation to obtain lactones such as aromatic alcohols. The lactone biosynthetic pathway is found to be functional in mangoes. Therefore, the polynucleotide sequences encoding epoxide hydrolase 2 and peroxygenase have been synthesized, cloned and expressed for their involvement in lactone synthesis.

    [0072] In a preferred embodiment, the present invention provides a polynucleotide sequence encoding epoxide hydrolase 2 (EH2) represented by SEQ ID No. 1, wherein epoxide hydrolase 2 catalyzes conversion of epoxy fatty acids to di-hydroxy fatty acids.

    [0073] In accordance with this embodiment, the present invention provides SEQ ID No. 1 consisting of a 957 base pair (bp) long nucleotide sequence encoding epoxide hydrolase 2 polypeptide of Mangifera indica as represented in SEQ ID No. 3.

    [0074] The obtained SEQ ID No. 1 upon in silico analysis comprises a complete ORF of EH2 spanning 957 nucleotides with 74 nucleotides long 5 and 241 nucleotides long 3 UTR regions as represented in SEQ ID No. 1. Homology analysis indicate SEQ ID No. 1 encoding EH to have less than 75% sequence identity with other genes encoding plant soluble EH2 (Table 2).

    [0075] In an embodiment, the present invention provides synthesis of SEQ ID No. 1 using primers comprising SEQ ID No. 7 to 12.

    [0076] In another preferred embodiment, the present invention provides a recombinant vector construct comprising nucleotide sequence comprising SEQ ID No. 1 cloned into plasmid vectors selected from the group consisting of pGEMT, a bacterial expression vector (pEXP5-CT/TOPO) and a plant expression vector (pBI121) followed by transformation in host cells for expression.

    [0077] Most preferably, the present invention provides transient expression of recombinant vector construct pBI121 carrying SEQ ID No. 1 to obtain increased lactone production in mangoes. The full length sequence of MiEH2, i.e. SEQ ID No. 1 was cloned in a pBI121 plant expression vector between CaMV 35S promoter and GusA gene. Terminal primers were designed (Table 1A) to clone genes at BamHI restriction site. The resulted correct oriented construct pBI121+SEQ ID No. 1 was transformed in the Agrobacterium GV3101 strain for transient expression. Over expression of EH2 was carried out by Agrobacterium mediated infiltration in ethylene treated mango fruits at 3DAH stage by using hypodermic syringe. Equal volumes of the said constructs i.e. pBI121+ MiEH2 and pBI121 empty vector construct were used for infiltration in two different halves of same mango fruit separated by fruit stone.

    [0078] The present invention provides transient expression of SEQ ID No. 1 in a plant expression vector carrying the said SEQ ID No. 1 which transformed in an Agrobacterium strain and introduced in mangoes via agroinfiltration resulting in a significant overexpression of lactones selected from the group consisting of 6-valerolactone, -hexalactone and 6-hexalactone. A corresponding increase of 1.46, 1.96 and 1.98 fold more of 6-valerolactone, -hexalactone and 6-hexalactone was observed, respectively compared to control tissue.

    [0079] In another preferred embodiment, the present invention provides a nucleotide sequence encoding peroxygenase of SEQ ID No. 4, wherein peroxygenase (upstream enzyme to epoxide hydrolase) catalyzes conversion of unsaturated fatty acids to epoxy fatty acids.

    [0080] Accordingly, SEQ ID No. 4 comprises a nucleotide sequence spanning 708 bp encoding a peroxygenase polypeptide of Mangifera indica as represented in SEQ ID No. 6.

    [0081] In a further embodiment, the present invention provides the synthesis of SEQ ID No. 4 using primers comprising SEQ ID No. 19 to 24.

    [0082] In one more embodiment, the present invention provides transient expression of a plant expression vector carrying SEQ ID No. 4 which when transformed in an Agrobacterium strain and introduced in mangoes via agroinfiltration results in overexpression of transcripts encoding peroxygenase.

    [0083] In one more preferred embodiment, the present invention provides a process for synthesis of lactones having flavour peculiar to Alphonso mangoes, said process comprising: [0084] (a) synthesizing polynucleotide sequence as set forth in SEQ ID No.: 4; [0085] (b) expressing a recombinant construct carrying said polynucleotide sequence of SEQ ID No. 4 in a host cell to obtain recombinant polypeptide peroxygenase of SEQ ID No. 6; [0086] (c) catalyzing conversion of unsaturated fatty acids to epoxy fatty acids in presence of the recombinant polypeptide peroxygenase of SEQ ID No. 6 of step (b) to obtain epoxy fatty acids; [0087] (d) synthesizing polynucleotide sequence as set forth in SEQ ID No.: 1; [0088] (e) expressing a recombinant construct carrying said polynucleotide sequence of SEQ ID No. 1 in a host cell to obtain recombinant polypeptide peroxygenase of SEQ ID No. 3; [0089] (f) catalyzing conversion of the epoxy fatty acids from step (c) to di-hydroxy fatty acids in presence of the recombinant polypeptide peroxygenase of SEQ ID No. 3 of step (e) to obtain di-hydroxy fatty acids; and [0090] (g) subjecting the di-hydroxy fatty acids of step (f) to multiple cycles of and oxidation to obtain the lactones.

    [0091] In yet another embodiment of the present invention, the polynucleotide of SEQ ID No. 4 is synthesized by using primer pairs selected from the group consisting of SEQ ID No.: 19-SEQ ID No. 20, SEQ ID No.: 21-SEQ ID No. 22, SEQ ID No.: 23-SEQ ID No. 24, and SEQ ID No.: 25-SEQ ID No. 26.

    [0092] A further embodiment of the present invention provides that the polynucleotide of SEQ ID No. 1 is synthesized by using primer pairs selected from the group consisting of SEQ ID No.: 7-SEQ ID No. 8, SEQ ID No.: 9-SEQ ID No. 10, SEQ ID No.: 11-SEQ ID No. 12, SEQ ID No.: 13-SEQ ID No. 14, SEQ ID No.: 15-SEQ ID No. 16, and SEQ ID No.: 17-SEQ ID No. 18.

    [0093] Yet another embodiment of the present invention provides a method of enhancing the synthesis of lactone in fruit of a plant, wherein the method comprises introducing the plasmid expression vector comprising SEQ ID No. 1 or SEQ ID No. 4 in fruit of a plant by agroinfiltration,

    [0094] In a further embodiment of the present invention the plant in the process of agroinfiltration is mango.

    [0095] The unsaturated fatty acids are selected from the group consisting of Linoleic acid (LA), -linolenic acid (ALA). The epoxide of linoleic acid is 12,13-cis epoxide of linoleic acid (12,13 EpOME). The process of the present invention yields 8 lactones selected from the group consisting of -butyrolactone, -valerolactone, -hexalactone, -hexalactone, -octalactone, -octalactone, -decalactone and -decalactone. The different lactones were detected from all the tissues by GC-MS analysis as showed in FIG. 4. The recombinant vector and the host cell employed in the present process have been referred to in the description herein above. In case of transient expression of SEQ ID No. 1, over expression significantly increased contents of -valerolactone, -hexalactone and -hexalactone, this increase was 1.46, 1.96 and 1.98 folds more, respectively.

    EXAMPLES

    [0096] Following examples are given by way of illustration therefore should not be construed to limit the scope of the invention.

    Example 1: Plant Sources

    [0097] Plant material employed in the present invention was based on plant varieties. These varieties included cv. Alphonso and cv. Pairi which were collected from the Mango Research Sub Centre of Dr. Balasaheb Sawant Konkan Agricultural University, Dapoli, Deogad (Maharashtra, India, 16 31 N, 73 20 E). Fruits of cv. Kent were collected from the Regional Fruit Research Station, Dr. Balasaheb Sawant Konkan Agricultural University, Vengurle (Maharashtra, India, 15 51 N, 73 39 E). Four developing and four ripening stages of all three mango cultivars were collected. Developing stages were collected at 15 Days after Pollination (DAP), 30 DAP, 60 DAP and Mature raw stage (90DAP for cv. Alphonso and Pairi, 110DAP for cv. Kent). Fruits at these developing stages were harvested pulp(mesocarp) and skin(exocarp) were separated immediately. The tissues were snap frozen in liquid nitrogen and stored at 80 C. till further use.

    Example 2: Pre-Treatment of Mangoes

    [0098] A set of 12 fruits each for all the three cultivars, i.e. Alphonso, Pairi and Kent were harvested at their respective mature raw stage and stored in the hay containing boxes at ambient temperature for ripening. Since the three cultivars showed variation in the ripening duration, tissue for ripening stages were collected at Table Green, Mid Ripe, Ripe and Over Ripe stage (each stage is represented by days after harvest for cv. Alphonso as 5, 10, 15 and 20 days; for cv. Pairi as 4, 6, 8 and 10 days and for cv. Kent as 5, 8, 10 and 13 days respectively) based on the skin colour, aroma and fruit softness. At each ripening stage, fruits for each cultivar were removed from the storage boxes, followed by pulp and skin separation. The pulp and skin removed were frozen in liquid nitrogen and stored at 80 C. till further use. For transient expression studies ethylene treated fruits were collected as described by Chidley et al. (2013).

    Example 3: RNA Isolation and cDNA Synthesis

    [0099] Total RNA isolation was carried out for all the tissues sampled for current study using RNeasy Plus mini kit (Quiagen, Venlo, Netherlands). Two microgram of total RNA was used to carry out reverse transcription for synthesis of cDNA using High Capacity cDNA reverse transcription kit (Applied Biosystem, CA, USA).

    Example 4: Isolation of Epoxide Hydrolase 2 cDNA

    [0100] Isolation of partial gene sequence of EH2 from Alphonso mango was initiated by designing degenerate primers by the homology based approach. Nucleotide sequences of EH2 from other plant species retrieved from NCBI were aligned and degenerate primers EH DeF1, EH DeR4 (Table 1A) were designed. Amplification was carried out using cDNA prepared from ripe fruit as the template. The resultant amplicon with expected size was purified from agarose gel, followed by cloning in pGEM-T easy vector (Promega, WI, USA), and was sequenced to confirm the partial cDNA sequence of EH2. Gene specific primers EHRCF2, EHRCR1 (Table 1A) were designed from obtained sequence and used for rapid amplification of cDNA ends (RACE) to acquire 5 and 3 ends. The obtained amplicons were cloned and sequenced to design terminal gene specific primers EHtrF1, i.e. SEQ ID No. 11 and EHtrR1, i.e. SEQ ID No. 12 (Table 1A) for isolation of complete ORF of EH2. Amplification using ripe mango cDNA as template and the above mentioned terminal primers for

    [0101] EH2 was carried out with using Advantage2 polymerase mix (Clonetech, USA) and cloned into pGEM-T easy vector, transformed into E. coli (Top 10) cells. Finally, presence of the complete ORF of the gene encoding epoxide hydrolase 2 enzyme was confirmed by sequencing.

    TABLE-US-00001 TABLE1A TerminalPrimersforsynthesisoffulllength nucleotidesequence, SEQIDNo.1encodingEpoxidehydrolase2 Primer Class PrimerSequence MiEH2 EHDeF1 A CTYTGGTAYTCVTGGCG SEQIDNo.7 EHDeR4 A CCHRYCCATGGHSC SEQIDNo.8 EHRCF2 B GTGGCTTCGGTGATACTGACGC SEQIDNo.9 EHRCR1 B CCTGATCAGAGGCAACGACGTC SEQIDNo.10 EHtrF1 C ATGGAAGATATACAGCACAGAATTGTG SEQIDNo.11 EHtrR1 C TCAGAACTTCTGAAAAAAGTTGTATATG SEQIDNo.12 EHTOPO_Fl D ATGGAAGATATACAGCACAGAATT SEQIDNo.13 EHTOPO_R1 D GAACTTCTGAAAAAAGTTGTATATG SEQIDNo.14 EHpBI121F1 E AAAAAAGGATCCATGGAAGATATACAGCACAGAAT SEQIDNo.15 TGTG EHpBI121R1 E AAAAAAGGATCCTCAGAACTTCTGAAAAAAGTTGT SEQIDNo.16 ATATGTGC EHRTF4 F CCTTGGGCCGGGAGTCAAATAAAGG SEQIDNo.17 EHRTR4 F AATGGCACATCTCGCTTGAACCCAC SEQIDNo.18

    [0102] The obtained sequence upon in silico analysis showed presence of the complete ORF of EH spanning 957 nucleotides with 74 nucleotides long 5 and 241 nucleotides long 3 UTR regions. Homology analysis indicated SEQ ID No. 1 encoding EH had sequence identity with other genes encoding plant soluble EH2 (Tablet).

    TABLE-US-00002 TABLE 2 Homology analysis of SEQ ID No. 1 and SEQ ID No. 3 MiEH2 ORF length (nucleotides) 957 3 UTR length (nucleotides) 241 5 UTR length (nucleotides) 74 Nucleotide sequence similarity Prunus persica EH2 (75%) Arabidopsis thaliana EH2 (71%) Brassica napus EH2 (74%) Insilico translated protein Protein length (amino acids) 318 Calculated molecular weight (kDa) 35.9

    Example 5: Isolation of Peroxygenase cDNA

    [0103] Isolation of partial gene sequence of peroxygenase from Alphonso mango was initiated by designing degenerate primers by homology based approach. Nucleotide sequences of PGX from other plant species retrieved from NCBI were aligned and degenerate primers PGX_DeF, PGX_DeR (Table 1B) were designed. Amplification was carried out using ripe cDNA as the template. The resultant amplicon with expected size was purified from agarose gel, followed by cloning in pGEM-T easy vector (Promega, WI, USA), and was sequenced to confirm partial cDNA sequence of PGX. Gene specific primers PGX_RCF, PGX_RCR (Table 1B) were designed from obtained sequence and used for rapid amplification of cDNA ends (RACE) to acquire 5 and 3 ends. The obtained amplicons were cloned and sequenced to design terminal gene specific primers PGX_Tr_F, i.e. SEQ ID No. 23 and PGX_Tr_R, i.e. SEQ ID No. 24 (Table 1B) for isolation of complete ORF of peroxygenase. Amplification using ripe mango cDNA as template and above mentioned terminal primers for peroxygenase was carried out using Advantage2 polymerase mix (Clonetech, USA) and cloned into pGEM-T easy vector, transformed into E. coli (Top 10) cells. Finally, the presence of the complete ORF of the gene encoding peroxygenase enzyme was confirmed by sequencing.

    TABLE-US-00003 TABLE1B TerminalPrimersforsynthesisoffulllength nucleotidesequence, SEQIDNo.4encodingPeroxygenase Primer Class PrimerSequence MiPGX1 PGX_De_F A MWGAGYGTBCTKCARCA SEQIDNo.19 GCATG PGX_De_R A AMTCRAACAARCTMCCA SEQIDNo.20 TC PGX_RC_F B GGGATCATTTACCCTTG SEQIDNo.21 GGAGAC PGX_RC_R B CCCCTTTACTTGCAATC SEQIDNo.22 CAGCC MiPGX_Tr_F C ATGGACGGGGATGCAAT SEQIDNo.23 GGCAACC MiPGX_Tr_R C TTAAATCATCTTAGCTG SEQIDNo.24 CAGCGCCTGC MiPGXl_RT_Fl F AAGGAAGGTACATGCCT SEQIDNo.25 GCAAACCT MiPGX1_RT_R1 F CGGTTTCCCTCAGTCAT SEQIDNo.26 GTCCCAAA

    Example 6: Cloning and Recombinant Expression of MiEH2

    [0104] The full length sequence of MiEH2 was amplified from the cDNA prepared from ripe Alphonso fruit RNA using Advantage2 polymerase mix, with terminal primers EHTOPO_F1 and EHTOPO_R1 (Table 1A). The resulting amplicon of MiEH2 was cloned in the pEXP5-CT/TOPO expression vectors. After confirming the correct orientation of the insert and presence of an uninterrupted reading frame by sequencing, recombinant plasmid of MiEH2 was transformed in BL21 (DE3) pLysS Rosetta cells for recombinant expression. Starter culture was initiated in 20 ml terrific broth (TB) comprising 100 g ml.sup.1 ampicillin and was incubated at 37 C.; 180 rpm for 24 hrs. Expression culture was started with 1 L TB medium inoculated with 1% final concentration of starter culture and 100 g ml.sup.1 ampicillin at 37 C., 180 rpm. Expression of recombinant protein was induced by 0.2 mM IPTG at 0.6 OD.sub.600. Post induction, expression culture was incubated at 16 C., 120 rpm for 12-14 hrs, after which cells were harvested by centrifugation and re-suspended in phosphate buffer pH 7 with 20 mM imidazole. Cells were lysed by sonication and 6His tagged recombinant proteins were purified on Ni-NTA matrix (Invitrogen, USA), and nonspecifically bound non-recombinant proteins were removed by low molarity imidazole containing phosphate buffer washes. Recombinant EH2 protein was eluted in phosphate buffer with 250 mM imidazole, pH 7.

    Example 7: Assays for Catalytic Activity of MiEH2

    [0105] MiEH2 activity assay was carried out initially in 500 l final volume of 100 mM phosphate citrate buffer pH 7.0 at 30 C. containing 200 M substrates viz. cis-stilbene oxide (CSO), trans-stilbene oxide (TSO) and 12(13) Epoxide of linoleic acid (12,13 EpOME). Similar activity assays were carried out with protein expressed from empty vector for confirmation of EH2 activity. Optimum pH was determined by calculating activity at varied range of pH in phosphate citrate buffer at 30 C., whereas temperature optima was determined by calculating MiEH2 activity in phosphate citrate buffer pH 7 at various temperatures. After incubation and catalytic activity of EH 2, products were extracted in chloroform:methanol (2:1); completely dried in vacuum evaporator and reconstituted in the methanol. HRMS analysis carried out by accurate mass (molecular ion) identification. Identified products from assay reaction were confirmed with mass and retention time indices of authentic standards R,R hydrobenzoin and meso hydro benzoin. Extracted compounds from CSO and TSO assay reactions were separated by water (A):methanol (B) solvent gradient, 0-1 min 80% (A)/20% (B); 1-2 min 60% (A)/40% (B); 2-4 min 40% (A)/60% (B); 4-11 min 20% (A)/80% (B); 11-16 min 0% (A)/100% (B), hold for 2 min and again back to 80% (A)/20% (B) in 3 min with 2 min hold at flow rate 500 l min.sup.1. Whereas compounds from assay reactions of 12,13 EpOME were separated by water (A):methanol (B) solvent gradient, at 0 min 70% (A)/30% (B); 0-2 min 50% (A)/50% (B); 2-12 min 0% (A)/100% (B), hold for 2 min and again back to 70% (A)/30% (B) in 3 min with 2 min hold at flow rate 500 l min.sup.1. Quantitative analysis of CSO and TSO assay products was done by plotting standard graph of product standards. Full scans for both programs were acquired on positive ion mode with AGC target value of 1E6, resolution of 70,000 at scan range 100-500 m/z, and maximum ion injection time (IT) of 250 ms.

    TABLE-US-00004 TABLE 3 Biochemical characterization and enzyme kinetics of MiEH2 MiEH2 Optimum temperature 45 C. Optimum pH 8 Vmax (M min.sup.1mg.sup.1) TSO- 1055.55 55.55 CSO- 26.5252 4.81 Km (mM) TSO- 0.113 0.003 CSO- 0.165 0.044 Vmax/Km min.sup.1mg.sup.11) TSO- 9.336 CSO- 0.160

    Example 8: Transient Expression of SEQ ID No. 1 in Plant Expression Vector Via Agroinfiltration

    [0106] The full length sequence of MiEH2, i.e. SEQ ID No. 1 was cloned in a pBI121 plant expression vector between CaMV 35S promoter and GusA gene. Terminal primers were designed (Table 1A) to clone genes at BamHI restriction site. Resulted correct oriented construct pBI121+SEQ ID No. 1 and pBI121 empty vector as control were transformed in the Agrobacterium GV3101 strain for transient expression studies. Separate Agrobacterium cultures (5 mL) were initiated from individual colonies in YEB medium having appropriate antibiotics and incubated overnight at 28 C. This culture was transferred to 50 mL induction medium comprising 0.5% beef extract, 0.1% yeast extract, 0.5% peptone, 0.5% sucrose, 2 mM MgSO4, 20 mM acetosyringone, 10 mM MES, pH 5.6, having appropriate antibiotics, and again grown overnight. Cultures were recovered by centrifugation on the next day, resuspended in infiltration medium (10 mM MgCl.sub.2, 10 mM MES, 200 mM acetosyringone, pH 5.6) till optical density reached 1.0. This suspension was again incubated at 28 C. with gentle agitation for 2 hrs.

    [0107] Over expression studies for EH2 were carried out by Agrobacterium mediated infiltration in ethylene treated mango fruits at 3DAH stage by using hypodermic syringe. Equal volumes of said constructs i.e. pBI121+MiEH2 and pBI121 empty vector construct were used for infiltration in two different halves of same mango fruit separated by fruit stone. Earlier studies during initial trials confirmed Agrobacterium mediated infiltration does not spread beyond fruit stone in case of mango. Thus control (empty vector) and test over expressions were carried out in same fruit to avoid error in lactone content analysis. Five distinct mango fruits were used for overexpression study of MiEH2. Infiltrated fruits were kept at 25 C. for 2 days in 12 hr dark and 12 hr light conditions, after 2 days; part from each fruit halves was checked by Gus staining (Kapila et al. 1997; Spolaore et al. 2001) to confirm expression of MiEH2 under 35S promoter along with GusA, remaining part of fruit pulp stored in 80 C. until used for lactone analysis by gas chromatography. Similar conditions were also used for transient expression of MiPGX in a plant expression vector via agroinfiltration. Two days post infiltration a part of fruit was checked by Gus staining (FIG. 2b) to confirm expression of GusA along with SEQ ID No. 1. The remaining tissue was used for lactone content analysis. Lactones were analysed from control and test region of fruits. A total of 8 lactones viz. -butyrolactone, -valerolactone, -hexalactone, -hexalactone, -octalactone, -octalactone, -decalactone and -decalactone were detected from all tissues in GC-MS analysis. Quantitative analysis of lactones by GC-FID showed increased lactone content (FIG. 4). In case of transient expression of SEQ ID No. 1, over expression significantly increased contents of -valerolactone, -hexalactone and -hexalactone, this increase was 1.46, 1.96 and 1.98 folds more, respectively compared to control tissue.

    Example 9: Transient Expression of SEQ ID No. 4 in Plant Expression Vector Via Agroinfiltration

    [0108] The full length sequence of SEQ ID No. 4 was cloned in a pBI121 plant expression vector between CaMV 35S promoter and GusA gene. Terminal primers were designed to clone gene in pBI121 vector. Resulted correct oriented construct pBI121+SEQ ID No. 4 and the empty vector as control were transformed in Agrobacterium GV3101 strain for transient expression. Separate Agrobacterium cultures (5 mL) were initiated from individual colonies in YEB medium having appropriate antibiotics and incubated overnight at 28 C. This culture was transferred to a 50 mL induction medium as described in Example 8. Cultures were recovered by centrifugation on the next day, resuspended in infiltration medium (10 mM MgCl.sub.2, 10 mM MES, 200 mM acetosyringone, pH 5.6) till optical density reached 1.0. This suspension was again incubated at 28 C. with gentle agitation for 2 hrs.

    Example 10: Qualitative and Quantitative Analysis of Lactones

    [0109] Aroma volatile extraction was carried out from 5 g of tissues obtained from transient expression study (demonstrated in example 8) by solvent extraction method as mentioned earlier (Kulkarni et al. 2012; Pandit et al. 2009a). GC-MSD and GC-FID analysis for lactones was carried out using a 7890B GC system Agilent Technologies coupled with Agilent 5977A MSD (Agilent technologies, CA, USA). Aroma volatiles were separated on GsBP-5MS (GeneralSeparation Technologies, Newark, Del.) capillary column (30 m0.32 mm i.d.0.25 m film thickness). Other chromatographic conditions were maintained as mentioned by Kulkarni et al. 2012. To understand effect of gene over expression by transient expression on lactone biosynthesis, qualitative and quantitative analysis for lactones alone was carried out in the present study. Lactones were identified by matching generated spectra with NIST 2011 and Wiley 10.sup.th edition mass spectral libraries. Identified compounds were confirmed by matching retention time and spectra of authentic standards procured from Sigma Aldrich (St. Louis, Mo., USA). Absolute quantification was done using internal standard by normalizing concentrations of all the lactones with that of known concentration of nonyl acetate.

    Example 11: Quantitative Real-Time PCR

    [0110] Quantitative real-time PCR was performed using FastStart Universal SYBR Green master mix (Roche Inc. Indianapolis, Ind., USA) and elongation factor 1 (EF1) as an endogenous control employing the primers mentioned earlier (Pandit et al. 2010). Transcript of SEQ ID No. 1 was amplified using gene specific primers Seq. Id no. 17 and 18 (Table1A) and quantification was done by ViiA 7 Real-Time PCR System (Applied Biosystems, CA, USA) having thermal cycle program of initial denaturation at 95 C. for 10 min with subsequent 40 cycles of 95 C. for 3 sec and 60 C. for 30 sec followed by a dissociation curve analysis of transcripts. The analysis was carried out through pulp and skin tissues from developing and ripening stages of Alphonso, Pairi and Kent mango fruits. The expression patterns of genes from hypothesized lactone biosynthetic pathway included the isolation of full length gene sequences of peroxygenase (PGX by degenerate primer (Table 1B) approach. RACE reactions with gene specific primers (Table 1B) were carried out to obtain ends of cDNAs. Gene specific primers SEQ ID No. 25 and 26 (Table1B) were designed to carry out quantitative real time PCR. Quantitative real-time PCR analysis of peroxygenase PGX, was carried out in a similar way as that of MiEH2.

    Example 12: Variable Lactone Content of Different Mango Cultivars Through RT-PCR

    [0111] Transient over expression studies of SEQ ID No. 1 resulted in significant increase in the lactone content thereby confirming involvement of epoxide hydrolase 2 in lactone biosynthetic pathway in Alphonso mango. Lactone content varies amid different mango cultivars. In order to determine the role of epoxide hydrolase 2 enzyme in the lactone biosynthetic pathway fruits from low lactone containing mango cultivar Pairi and lactone less cultivar Kent along with the fruits from high lactone containing Alphonso were studied for their SEQ ID No. 1 transcripts profile through real time PCR analysis. Pulp and skin tissues from Alphonso, Pairi and Kent cultivar through various stages of fruit development and ripening were analyzed to check transcript profiles of MiPGX1, and MiEH2. The relative quantification of transcripts from Alphonso, Pairi and Kent showed ripening specific appearance of MiPGX1 (FIG. 6). In Alphonso Pulp and skin tissues optimum transcript levels of MiPGX1 were observed at mid ripe stage (10DAH stage), this finding correlates with earlier studies of the present inventor where first appearance of lactones was observed at 10 DAH stage during ripening of mango (Kulkarni et al. 2012; Pandit et al. 2009b). Similar to the Alphonso, optimum transcript levels of MiPGX1 were observed at mid ripe stage of Pairi fruit ripening.

    Advantages of the Invention

    [0112] The nucleotide sequences deciphered in the present invention aid in overexpression of lactones in the mangoes, thereby increasing the flavor quality in such fruits. [0113] Transient expression of the disclosed sequences in mango via agroinfiltration results in the increased lactone concentration level in mango. [0114] Gene specific primers employed in the present invention may be used commercially in the synthesis of the said nucleotide sequences.