NOVEL PEPTIDE STRUCTURES AND USE THEREOF IN THE TREATMENT OF TOXOPLASMOSIS
20190153083 ยท 2019-05-23
Inventors
- Matthieu JUSTE (Poitiers, FR)
- Isabelle Dimier-Poisson (Tours, FR)
- Nicolas AUBREY (Truyes, FR)
- Anne DI TOMMASO (La Riche, FR)
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
A61P33/02
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61K39/39575
HUMAN NECESSITIES
International classification
Abstract
The invention relates to a peptide structure which does not include a CH1 region, which recognises the SAG1 antigen of Toxoplasma gondii and which can neutralize the invasion of cells by Toxoplasma gondii, and to the use of said structure in the treatment of toxoplasmosis, in particular ocular toxoplasmosis, congenital toxoplasmosis and behavioural disorders linked to the presence of Toxoplasma gondii.
Claims
1. A method for treating toxoplasmosis, including ocular toxoplasmosis, congenital toxoplasmosis, and behavioral disorders related to the presence of Toxoplasma gondii, the method comprising administering a peptide construct not containing a CH1 region, recognizing the SAG1 antigen of Toxoplasma gondii and capable of neutralizing Toxoplasma gondii invasion of cells.
2. The method of claim 1, wherein the peptide construct comprises the variable regions of the heavy chain and the light chain of a first antibody recognizing the SAG1 antigen of Toxoplasma gondii, in particular the monoclonal antibody 4F11E12, and which may contain all or part of the constant region lacking a CH1 region, the heavy chain of a second antibody, in particular a murine IgG2a immunoglobulin, said peptide construct recognizing the SAG1 antigen of Toxoplasma gondii and being capable of neutralizing the invasion of the cells by Toxoplasma gondii.
3. The method of claim 1, wherein the peptide construct recognizes the conformational epitope formed by the amino acids at positions 35 to 37, 39, 41, 42, 45, 48, 50, 59 to 65 and 112 to 114 of the amino acid sequence SEQ ID NO: 3.
4. The method of claim 1, wherein the peptide construct comprises the following six CDRs: a CDR1 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 4, or consisting of the amino acid sequence SEQ ID NO: 4, a CDR2 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% % identity with the sequence SEQ ID NO: 5, or consisting of the amino acid sequence SEQ ID NO: 5, a CDR3 having at least 95%, at least 96%, at least 97%, at least 98% % or at least 99% identity with the sequence SEQ ID NO: 6, or consisting of the amino acid sequence SEQ ID NO: 6, a CDR4 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 7, or consisting of the amino acid sequence SEQ ID NO: 7, a CDR5 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 8, or consisting of the amino acid sequence SEQ ID NO: 8, and a CDR6 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 9, or consisting of the amino acid sequence SEQ ID NO: 9, provided that said peptide construct retains its ability to neutralize the invasion of cells by Toxoplasma gondii.
5. The method of claim 1, devoid of the CH2 and CH3 regions of the aforementioned second antibody, or comprising a CH3 region and devoid of CH2 region of the aforementioned second antibody, or comprising a CH2 region and a CH3 region of the aforementioned second antibody.
6. The method of claim 1, wherein the peptide construct is chosen from: scFv, in particular a scFv consisting of the amino acid sequence SEQ ID NO: 10, a scFv consisting of the amino acid sequence SEQ ID NO: 12, a scFv consisting of the amino acid sequence SEQ ID NO: 17, a scFv consisting of the amino acid sequence SEQ ID NO: 20, a scFv consisting of the amino acid sequence SEQ ID NO: 21, a scFv consisting of the amino acid sequence SEQ ID NO: 22, a scFv consisting of the amino acid sequence SEQ ID NO: 23, a scFv consisting of the amino acid sequence SEQ ID NO: 24, a scFv consisting of the amino acid sequence SEQ ID NO: 25, a scFv consisting of the amino acid sequence SEQ ID NO: 27, a scFv consisting of the amino acid sequence SEQ ID NO: 32, a scFv consisting of the amino acid sequence SEQ ID NO: 35, a scFv consisting of the amino acid sequence SEQ ID NO: 36, a scFv constit SEQ ID NO: 37, a scFv consisting of the amino acid sequence SEQ ID NO: 38 or a scFv consisting of the amino acid sequence SEQ ID NO: 39, a diabody, in particular a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 11, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 13, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 18, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 19, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 26, a diabody consisting of two acid sequences amines of sequence SEQ ID NO: 28, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 33 or a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 34, a single chain diabody, a minobody such as scFv-CH3, especially a scFv-CH3 consisting of the amino acid sequence SEQ ID NO: 14 or a scFv-CH3 consisting of the amino acid sequence SEQ ID NO: 29, and the diabody-CH3, in particular a diabody-CH3 consisting of two sequences of amino acids of sequence SEQ ID NO: 15 or a diabody-CH3 consisting of two amino acid sequences of sequence SEQ ID NO: 30, the scFv-Fc, in particular a scFv-Fc consisting of the acid sequence amino SEQ ID NO: 16 or a scFv-Fc consisting of the amino acid sequence SEQ ID NO: 31, or a diabody-Fc.
7. A pharmaceutical composition comprising as active substance a peptide construct containing no CH1 region, recognizing the SAG1 antigen of Toxoplasma gondii and capable of neutralizing the invasion of the cells by Toxoplasma gondii, optionally in combination with a pharmaceutically acceptable vehicle.
8. The pharmaceutical composition according to claim 7, wherein the peptide construct comprises the variable regions of the heavy chain and of the light chain of a first antibody recognizing the SAG1 antigen of Toxoplasma gondii, in particular the monoclonal antibody 4F11E12, and which may contain all or part of the constant region devoid of CH1 region, of the heavy chain of a second antibody, in particular a murine IgG2a immunoglobulin, said peptide construct recognizing the SAG1 antigen of Toxoplasma gondii and being capable of neutralizing the invasion cells by Toxoplasma gondii.
9. The pharmaceutical composition according to claim 7 wherein said peptide construct recognizes the conformational epitope formed by the amino acids at positions 35 to 37, 39, 41, 42, 45, 48, 50, 59 to 65 and 112 to 114 of the amino acid sequence SEQ ID NO: 3.
10. The pharmaceutical composition according to claim 7, wherein said peptide construct comprises the following six CDRs: a CDR1 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% % identity with the sequence SEQ ID NO: 4, or consisting of the amino acid sequence SEQ ID NO: 4, a CDR2 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 5, or consisting of the amino acid sequence SEQ ID NO: 5, a CDR3 having at least 95%, at least 96%, at least 97% at least 98% or at least 99% identity with the sequence SEQ ID NO: 6, or consisting of the amino acid sequence SEQ ID NO: 6, a CDR4 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 7, or consisting of the amino acid sequence SEQ ID NO: 7, a CDR5 having at least 95%, me ns 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 8, or consisting of the amino acid sequence SEQ ID NO: 8, and a CDR6 having at least at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 9, or consisting of the amino acid sequence SEQ ID NO: 9, provided that said peptide construct retains its ability to neutralize cell invasion by Toxoplasma gondii.
11. The pharmaceutical composition according to claim 7, wherein said peptide construct is devoid of the CH2 and CH3 regions of said second antibody, or comprises a CH3 region and is devoid of CH2 region of said second antibody, or comprises a CH2 region and a CH3 region of the aforesaid second antibody.
12. The pharmaceutical composition according to claim 7, in which the peptide construct is chosen from: scFv, in particular a scFv consisting of the amino acid sequence SEQ ID NO: 10, a scFv consisting of the sequence of amino acids SEQ ID NO: 12, a scFv consisting of the amino acid sequence SEQ ID NO: 17, a scFv consisting of the amino acid sequence SEQ ID NO: 20, a scFv consisting of the amino acid sequence SEQ ID NO: 21, a scFv consisting of the amino acid sequence SEQ ID NO: 22, a scFv consisting of the amino acid sequence SEQ ID NO: 23, a scFv consisting of the amino acid sequence SEQ ID NO: 24, a scFv consisting of the amino acid sequence SEQ ID NO: 25, a scFv consisting of the amino acid sequence SEQ ID NO: 27, a scFv consisting of the amino acid sequence SEQ ID NO: 32, a scFv consisting of the amino acid sequence SEQ ID NO: 35, a scFv consisting of the sequence number of amino acids SEQ ID NO: 36, a scFv consisting of the amino acid sequence SEQ ID NO: 37, a scFv consisting of the amino acid sequence SEQ ID NO: 38 or a scFv consisting of the amino acid sequence amino acids SEQ ID NO: 39, a diabody, in particular a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 11, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 13, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 18, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 19, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 26, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 28, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 33 or a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 34, a single chain diabody, a minibody such as scFv-CH3, in particular a scFv-CH3 consisting of the amino acid sequence SEQ ID NO: 14 or a scFv-CH3 consisting of the amino acid sequence SEQ ID NO: 29, and the diabodies CH3, in particular a diabody-CH3 consisting of two amino acid sequences of sequence SEQ ID NO: 15 or a diabody-CH3 consisting of two amino acid sequences of sequence SEQ ID NO: 30, the scFv-Fc, especially a scFv-Fc consisting of the amino acid sequence SEQ ID NO: 16 or a scFv-Fc consisting of the amino acid sequence SEQ ID NO: 31, or a diabody-Fc.
13. A peptide construct not containing a CH1 region, recognizing the SAG1 antigen of Toxoplasma gondii and capable of neutralizing the invasion of the cells by Toxoplasma gondii, in particular comprising the variable regions of the heavy chain and the light chain of a first antibody recognizing the SAG1 antigen of Toxoplasma gondii, in particular the monoclonal antibody 4F11E12, and which may contain all or part of the constant region devoid of CH1 region, of the heavy chain of a second antibody, in particular a murine IgG2a immunoglobulin, subject to that said peptide construct is different from the sequence SEQ ID NO: 10.
14. The peptide construct according to claim 13, comprising the following six CDRs: a CDR1 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 4, or consisting of the amino acid sequence SEQ ID NO: 4, a CDR2 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 5, or consisting of the amino acid sequence SEQ ID NO: 5, a CDR3 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 6, or consisting of the amino acid sequence SEQ ID NO: 6, a CDR4 having at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the sequence SEQ ID NO: 7, or consisting of the amino acid sequence SEQ ID NO: 7, a CDR5 having at least 95%, at least 96%, at least 97%, minus 98% or at least 99% of ident with the sequence SEQ ID NO: 8, or consisting of the amino acid sequence SEQ ID NO: 8, and a CDR6 having at least 95%, at least 96%, at least 97%, at least 98% or at least at least 99% identity with the sequence SEQ ID NO: 9, or consisting of the amino acid sequence SEQ ID NO: 9, provided that said peptide construct retains its ability to neutralize the invasion of the cells by Toxoplasma gondii.
15. The peptide construct according to claim 13, chosen from: scFv, in particular a scFv consisting of the amino acid sequence SEQ ID NO: 12, a scFv consisting of the amino acid sequence SEQ ID NO: 17, a scFv consisting of the amino acid sequence SEQ ID NO: 20, a scFv consisting of the amino acid sequence SEQ ID NO: 21, a scFv consisting of the amino acid sequence SEQ ID NO: 22, a scFv constituted of the amino acid sequence SEQ ID NO: 23, a scFv consisting of the amino acid sequence SEQ ID NO: 24, a scFv consisting of the amino acid sequence SEQ ID NO: 25, a scFv consisting of amino acid sequence SEQ ID NO: 27, a scFv consisting of the amino acid sequence SEQ ID NO: 32, a scFv consisting of the amino acid sequence SEQ ID NO: 35, a scFv consisting of the amino acid sequence amino acid SEQ ID NO: 36, a scFv consisting of the amino acid sequence SEQ ID NO: 37, a scFv consisting of the amino acid sequence SEQ ID NO: 38 or a scFv consisting of the amino acid sequence SEQ ID NO: 39, a diabody, in particular a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 11 a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 13, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 18, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 19, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 26, a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 28, a diabody consisting of two acid sequences amines of sequence SEQ ID NO: 33 or a diabody consisting of two amino acid sequences of sequence SEQ ID NO: 34, a single chain diabody, a minibody such as scFv-CH3, in particular a scFv-CH3 consisting of the amino acid sequence SEQ ID NO: 14 or a scFv-CH3 consisting of the amino acid sequence SEQ ID NO: 29, and diabody-CH3, in particular a diabody-CH3 consisting of two amino acid sequences of sequence SEQ ID NO: 15 or a diabody-CH3 consisting of two amino acid sequences of sequence SEQ ID NO: 30, scFv-Fc, in particular a scFv-Fc consisting of the amino acid sequence SEQ ID NO: 16 or a scFv-Fc consisting of the acid sequence amino SEQ ID NO: 31, or a diabody-Fc.
Description
DESCRIPTION OF THE FIGURES
[0390]
A and B: tachyzotes alone.
C and D: tachyzotes with primary anti-histidine antibody and mouse anti-mouse IgG secondary antibody coupled to Alexa488 fluorochrome.
E and F: tachyzotes with the SG0 peptide construct.
G and H: tachyzotes with the SG5 peptide construct.
I and J: tachyzotes with the peptide construct DbF3S2.
[0391]
[0392] HFF cells were infected with tachyzotes transfected with a plasmid encoding -galatosidase. The peptide constructs (1.6 g of SG0, in a volume of 50 L prepared from a solution of 10.sup.9 g/mL according to paragraph 5. In vitro neutralization test of Example 1 (Materials and Methods), or 1.6 g of B6P (irrelevant antibody), in a volume of 50 L prepared from a solution of 113 g/mL, according to paragraph 5. In vitro neutralization test of Example 1 (Materials and Methods)) were added simultaneously to the parasites (100 tachyzotes). The graph represents the -galactosidase activity measured spectrophotometrically at 565 nm for each condition.
[0393] HFF cells (HFF alone) constitute the negative control of cellular invasion of the parasite and HFF cells in the presence of 100 tachyzotes of Toxoplasma gondii (100 Tachys) constitute the positive control.
[0394]
[0395] HFF cells were infected with tachyzotes transfected with a plasmid encoding -galatosidase. The peptide constructs (3 g of SG0, in a volume of 50 l prepared from a solution of 109 g/mL according to paragraph 5. In vitro neutralization test of Example 1 (Materials and Methods), or 3 g of B6P (irrelevant antibody), in a volume of 50 L, prepared from a solution of 113 g/mL according to paragraph 5. In vitro Neutralization Test of Example 1 (Materials and Methods)) were added simultaneously to the parasites. Two doses of parasites were used: 1000 tachyzote (1000T) and 10,000 tachyzotes (10000T). The graph represents the -galactosidase activity measured spectrophotometrically at 565 nm for each condition. HFF cells (HFF alone) constitute the negative control of cell invasion of the parasite and HFF cells in the presence of 1000 or 10,000 Toxoplasma gondii tachyzotes (Tachys alone) constitute the positive control.
[0396]
[0397] HFF cells (HFF alone) are the negative control of cellular invasion of the parasite and HFF cells in the presence of 1000 tachyzotes Toxoplasma gondii (Tachys alone) constitute the positive control.
[0398]
[0399] HFF cells (HFF alone) constitute the negative control of cellular invasion of the parasite and HFF cells in the presence of 100 Toxoplasma gondii tachyzotes (Tachys alone) constitute the positive control.
[0400]
[0401] HFF cells were infected with tachyzotes transfected with a plasmid encoding -galatosidase. The peptide constructs (1.5 g, 3 g and 6 g of SG0 (in a volume of 50 L, prepared from a solution of 160 g/mL according to paragraph 5. In vitro Neutralization Test of Example 1 (Materials and Methods); 1.5 g, 3 g and 6 g of SG5 (in a volume of 50 L, prepared from a solution of 147 g/mL according to paragraph 5. In vitro Neutralization Test of Example 1 (Materials and Methods); 1.5 g and 3 g of DbF3S2 (in a volume of 50 L, prepared from a solution of 155 g/mL according to paragraph 5. In vitro Neutralization Test of Example 1 (Materials and Methods)) were added simultaneously to the parasites. The graph represents the 1-galactosidase activity measured spectrophotometrically at 565 nm for each condition.
[0402] HFF cells (cells) constitute the negative control of the cellular invasion of the parasite and HFF cells in the presence of 100 tachyzotes of Toxoplasma gondii (cells+tachyzotes) constitute the positive control.
[0403]
[0404] Infected lot: the pregnant mice were infected by gavage with 10 cysts of the strain 76K of Toxoplasma gondii at day 11.
[0405] Batch infected and treated: the pregnant mice were infected by gavage with 10 cysts of the strain 76K of Toxoplasma gondii at day 11 and then treated with a daily intraperitoneal injection of 15 g of SiO (from a solution of SG0 at 120 g/mL) until farrowing.
[0406]
[0407]
[0408] HFF cells were infected with tachyzotes transfected with a plasmid encoding -galatosidase. Peptide constructs (5 g of SG0, in a volume of 50 L, prepared from a solution of 125 g/mL, or 5 g of SG2-HL, in a volume of 50 L, prepared from a solution at 75 g mL, or 5 g of SG2-LH, in a volume of 50 l, prepared from a solution of 90 g/mL, or 5 g of DbSG2, in a volume of 50 M, prepared from of a solution at 80 jg/mL, or 5 g of SG2-Fc2a, in a volume of 50 l, prepared from a solution of 85 g/mL, or 5 g of SG2-CH3, in a volume of 50 l, prepared from a 75 g/mL solution, according to paragraph 5. In vitro neutralization test of Example 1 (Materials and Methods), were added simultaneously to the parasites. A dose of 1000 tachyzote parasites was used. The graph represents the -galactosidase activity measured spectrophotometrically at 565 nm for each condition.
[0409] HFF cells (HFF alone) constitute the negative control of the cellular invasion of the parasite and HFF cells in the presence of 1000 tachyzotes of Toxoplasma gondii (T alone) constitute the positive control.
[0410]
[0411] The observation was carried out under a fluorescence microscope (objective 40). The observations are made by immunofluorescence using an antibody coupled to a fluorochrome.
A: negative control, tachyzotes in the presence of induced S2 cell supernatant.
B: tachyzotes with the peptide construct DbSG2 at 80 g/mL.
C: tachyzotes with the peptide construct SG2-HL at 75 g/mL.
D: tachyzotes with the peptide construct SG2-LH at 90 g/mL.
E: tachyzotes with the SG2-Fc2a peptide construct at 85 g/mL.
F: tachyzotes with the peptide construct SG2-CH3 at 75 g/mL.
EXAMPLES
Example 1: Materials and Methods
[0412] 1. Construction of the Expression Vectors
[0413] 1.1. Bacteria and Plasmids Used
[0414] 1.1.1. Bacteria and Plasmids Used for Expression of SG5 and SG0 Peptide Constructs
[0415] The bacteria Escherichia coli BL21 of genotype F-, ompT, hsdSB (r.sub.B-, m.sub.B-), dcm, gal, (DE3), pLysS, Cm.sup.r were used for the expression of the peptide constructs from the plasmid vector pET22b (NOVAGEN) (prokaryotic system), under the control of the T7 promoter.
[0416] The expression vector pET22b contains a pelB sequence allowing the export of the peptide constructs in the periplasm of the bacteria, an oxidizing domain making it possible to obtain correctly conformed peptide constructs. This sequence was fused with the VH and VL domain coding sequences of the peptide constructs, as well as the sequence of a peptide link. The plasmids also have a coding sequence for a histidine tag, facilitating the purification of the protein by affinity chromatography as well as its detection.
[0417] For the SG5 peptide construct, the pGEMT cloning vector (PROMEGA) was first used. The latter allowed the direct cloning of PCR products. Indeed, the plasmid pGEMT is linearized with the restriction enzyme EcoRV and has a thymidine at each of its ends for binding the adenine added to the amplicons by the Taq polymerases without exonuclease activity. This 3015 bp plasmid encodes, in particular, -lactamase (conferring on the host bacteria an ampicillin resistance) and comprises the -galactosidase -subunit gene (lacZ cassette). In the latter is located the multiple cloning site framed by the promoters T7 and SP6. The -galactosidase gene thus allows a blue-white screening of colonies possessing the recombinant plasmid on Lysogeny Broth (LB) agar medium supplemented with IPTG, X-gal and ampicillin: the bacteria having integrated the plasmid recombinant remain white while bacteria lacking the recombinant plasmid are stained blue.
[0418] The bacteria Escherichia coli TG1 of genotype supE thi-1 (lac-proAB) (mcrB-hsdSM5 (rK-mK-) [F traD36 proAB lacI.sup.q Z M15] were used for plasmid cloning.
[0419] 1.1.2. Bacteria and Plasmids Used for the Expression of scFvSG1 Peptide Constructs. SG2-HL. DbF3S2, DbF4S2, scFvF5S2. scFvF5S4. scFvF5S5. scFvF5S6 and Hum-scFvH2S
[0420] The bacteria Escherichia coli HB2151 of genotype K12, ara, (lac-pro), thi(FproAB, lacI.sup.q lacZ M15) were used for the expression of the peptide constructs scFvSG1. SG2-HL, DbF3S2, DbF4S2, scFvF5S2, scFvF5S4, scFvF5S5, scFvF5S6 and Hum-scFvH2S from plasmid vector pSW1 (PMID: 23680984) (prokaryotic system). These plasmids also have: i) modifications at the level of the VL allowing purification by protein-L (PpL), and ii) a coding sequence for a histidine tag that can be used for the purification of the protein by affinity chromatography as well as for its detection.
[0421] 1.1.3. Bacteria and Plasmids Used for the Expression of SG2-LH Peptide Constructs. DbSG2. SG2-CH3. SG2-Fc2a. SG2-HL and DbSG2-CH3
[0422] The bacteria Escherichia coli DH5a of genotype F/endA1, hsdR17, (rk mk+), supE44, thi-1, recA1, gyrA, (Nal1r), relA1, (lacZYA-argF) U169, deoR, (80dlac (lacZ) M15) were used for the expression of peptide constructs from the plasmid vector pMT-Bip (ThermoFischer) (eukaryotic system) under the control of the metallothionein promoter. This step aims to produce a sufficient amount of plasmids (containing an insert) before carrying out the transfection of eukaryotic cells with said plasmids.
[0423] The pMT-Bip expression vector contains a BiP sequence allowing the secretion of peptide constructs in the cell culture supernatant. This sequence was fused with the VH and VL domain coding sequences of the peptide constructs, as well as the sequence of a peptide link. In addition, these plasmids possess:
i) modifications at the level of the VL domain allowing purification by PpL, and
ii) a coding sequence for a histidine tag that can be used for the purification of the protein by affinity chromatography as well as for its detection.
[0424] 1.2. Purification of Bacterial Plasmids
[0425] 1.2.1 Plasmids pET22b and pSW1 and pGEMT
[0426] The bacteria (BL21 and HB21) were cultured for 16 hours at 37 C. in 5 mL of LB medium containing ampicillin (50 g/mL). The plasmids were then extracted and purified using the Plasmid Minikit I kit (Omega Biotek) according to the conditions mentioned by the supplier. The method used is that of alkaline lysis.
[0427] 1.2.2. PMT-BIP Plasmids
[0428] The bacteria (DH5a) were cultured for 16 hours at 37 C. in 100 mL of LB (Luria Broth) medium containing ampicillin (50 g/mL). The plasmids were then extracted and purified using the Plasmid Maxi Kit kit (QIAGEN) according to the conditions mentioned by the supplier. The method used is that of alkaline lysis.
[0429] 1.3. Techniques Used for the Construction of Recombinant Plasmids
[0430] 1.3.1. Gene Amplification by Polymerase Chain Reaction (PCR) for the SG5
[0431] The amplification of the nucleotide sequence coding for the variable domain of the VL light chain of the SG0 peptide construct was carried out by means of a PCR. The reaction consisted of a succession of 27 cycles consisting of a denaturation phase of the DNA (95 C.), a hybridization phase with the two primers of sequence SEQ ID NO: 70 and sequence SEQ ID NO: 71 presented in Table 1 (50 C.) and an extension phase by DNA polymerase from the primers (72 C.). The amplification reactions were carried out in a final volume of 50 L containing 0.25 units of GoTaq polymerase (Promega), 0.1 L of each primer, 0.1 mM of each dNTP, 10 L of 5 GoTaq buffer. Flexi Buffer (Promega) and 1 g of template DNA. The sense primer (SG5For) of sequence SEQ ID NO: 70 made it possible to introduce a BamHI site at the N-terminus of the amplified VL domain, and the sequence antisense primer (SG5rev). SEQ ID NO: 71 introduced a XhoI site at the C-terminus.
[0432] 1.3.2. Cloning of PCR Products
[0433] The PCR products were purified (using a Macherey Nagel Extraction Kit) and cloned using the pGEM-T vector (Promega). Their ligation was performed in a final volume of 10 L containing 2 g of PCR products, 100 ng of pGEM-T vector and 1 unit of T4 DNA ligase. The ligation was carried out at room temperature for 1 h, then the reaction mixture was used for the transformation of TG1 bacteria. The transformed bacteria were selected on LB medium (peptone 10 g/L, yeast extract 5 g/L and NaCl 10 g/L) supplemented with 50 g/mL ampicillin, 10 M X-gal and 100 IPTG.
[0434] 1.3.3. Enzymatic Digestion of DNA
[0435] The digests of the inserts (protein coding sequences of the SG0, SG2-LH, DbSG2, SG2-CH3 SG2-Fc2a, SG2-HL, DbSG2-CH3, scFvSG1, DbF3S2, DbF4S2, scFvF5S2, scFvF5S4 and Hum-scfvH2S peptide constructs and sequence coding the VL domain of the peptide construct SG0) as well as plasmids (pET22b, PMT-Bip, pSW1, pGEMT) were carried out using different pairs of endonucleases, using 10 units of enzymes per g of DNA in the presence of the recommended buffer. The reactions were incubated for 15 min at 37 C. The pairs of endonucleases used for each peptide construct and the expression vectors in which the inserts are subsequently cloned are shown in Table I.
TABLE-US-00001 TABLEI Names Peptidic Construc- Enzymatic Expression -tions Format PCR(5.fwdarw.3') Digestion vector SG5 diabody SG5ForSEQIDNO:70 BamHI/ pET22b (GGATCCCGATATTCAGGTTACCAG) XhoI SG5Rev,ofSEQIDNO:71 (TTTCTCGAGTTAGTGATGGTGATG) SG0 scFv SynthesisGenes PstI/XhoI pET22b SG2-LH scFv EcoRV/XhoI pMT-Bip DbSG2 Diabody PstI/XhoI pMT-Bip SG2-CH3 scFv-CH3 PstI/XhoI pMT-Bip SG2-Fc2a scFv-Fc KpnI/XhoI pMT-Bip SG2-HL scFv PstI/XhoI pMT-Bip DbSG2- Diabody- KpnI/XhoI pMT-Bip CH3 CH3 scFvSG1 scFv PstI/XhoI pSW1 SG2-HL scFv PstI/XhoI pSW1 DbF3S2 Diabody PstI/XhoI pSW1 DbF4S2 Diabody PstI/XhoI pSW1 scFvF5S2 scFv PstI/XhoI pSW1 scFvF5S4 scFv PstI/XhoI pSW1 scFvF5S5 scFv PstI/XhoI pSW1 scFvF5S6 scFv PstI/XhoI pSW1 Hum- scFv PstI/XhoI pSW1 scfvH2S
[0436] 1.3.4. DNA Electrophoresis
[0437] The DNA fragments were separated by agarose gel electrophoresis (1.5-2%) in TAE buffer (40 mM Tris-Acetate, 1 mM EDTA pH 8). The gels were supplemented with 0.1 g/mL of ethidium bromide (BET), which made it possible, after migration under a current of 100 V, to visualize the DNA under ultraviolet radiation. BenchTop and lkD (Promega) size markers were used to determine the size of the fragments analyzed.
1.3.5. Purifications of DNA Fragments from Agarose
[0438] After electrophoretic migration, the agarose bands containing the DNA fragments resulting from the enzymatic digestions were excised and purified using the Nucleospin Extract II kit (Macherey-Nagel) according to the conditions mentioned by the supplier. The principle of purification is based on the DNA affinity for silica in the presence of high sodium concentration. A volume of DNA, to be purified, supplemented with two volumes of a binding solution (Binding Buffer NT) was deposited on a silica membrane. While the DNA fragments larger than 50 bp are membrane-bound, the dNTPs, oligonucleotides and proteins present in the PCR product were removed by centrifugation (11,000 g, 1 min). The membrane was then cleaned of remaining salts and proteins by washing with 700 of lower salinity NT3 buffer containing ethanol (centrifugation at 11,000 g, 1 min). It was then dried by centrifugation (2 min at 11,000 g).
[0439] The purified DNA retained by the column was finally eluted in milliQ water by centrifugation (11,000 g, 1 min).
[0440] 1.3.6. Ligation Vector-Insert
[0441] The ligation was performed in a final volume of 10 L of ligation medium (consisting of ligase buffer and water) containing 1 unit of T4 DNA ligase (Promega) and 200 ng of pGEMT vector, pET22b, pSW1 or pMT.-Bip (previously digested). The amount of insert was adjusted so that the vecteuninsert molar ratio was 1:3. The reactions were then incubated overnight at 4 C.
[0442] 1.4. Transformation of Competent Bacteria
[0443] 1.4.1. Preparation of Competent Bacteria
[0444] The bacteria were made competent by CaCl.sub.2) treatment. The bacteria were first cultured to the exponential growth phase (A.sub.600 nm=0.4) in LB medium. Then, the culture was placed at 4 C. for 10 min and then centrifuged (20 min, 3000 g, 4 C.). The bacterial pellet was resuspended with 10 mL of a CaCl.sub.2 solution. at 0.1M and put in the ice (4 C.) for about 1:30. Centrifugation (20 min, 3000 g, 4 C.) recovered the bacterial pellet which was resuspended in 2 mL of 0.1M CaCl.sub.2) solution and then kept at 4 C. in ice until use.
[0445] 1.4.2. Bacterial Transformation
[0446] 5 L of the ligation product was added to 200 L of competent bacteria. The mixture was incubated for 30 min at 4 C. Thermal shock was achieved by placing the sample 90 seconds at 42 C. and then 2 min at 4 C. The bacteria were put back into culture by adding 800 L of LB medium for 45 min at 37 C. with shaking (200 rpm).
[0447] Only the bacterial transformation with the plasmid pGEMT required the prior addition of X-Gal and IPTG (0.84 mM) on LB agar/ampicillin agar (1 g/L) thus allowing a white screening, blue. Subsequently, the protocol was similar for all the transformations: 200 L of the transformation was plated on LB agar/ampicillin agar. The dishes were then incubated overnight at 37 C.
[0448] 2. Protein Production
[0449] 2.1. Protein Expression in Bacterial System
[0450] 2.1.1. Bacterial Strain: Escherichia coli
[0451] The expression system that was chosen to produce the recombinant proteins required Escherichia coli bacterial strains BL21pLysS and/or HB2151, depending on the vectors used.
[0452] 2.1.2. Bacterial Production
[0453] The peptide constructs were produced in the periplasm of the transformed bacteria Escherichia coli BL21pLysS or HB2151 by the different plasmids.
[0454] Preculture of the bacteria was performed in 5 mL of LB medium and incubated overnight at 37 C. with shaking (200 rpm). A volume of 500 L of this preculture was used to seed 500 mL of 2YT medium containing 50 tg/mL of ampicillin. Then the culture was incubated for 8 h at 37 C. with shaking (150 rpm). Induction of the production of the peptide constructs was achieved by the addition of 0.84 mM IPTG, and the bacterial culture was incubated overnight (16 C., shaking 75 rpm).
[0455] 2.1.3. Periplasmic Extraction
[0456] The proteins produced were extracted from the periplasm by osmotic shock. The IPTG-induced culture was centrifuged (5000 g, 10 min, 4 C.). The pellet was taken up in 10 mL of TES buffer (0.2M Tris pH8, 0.5 mM EDTA, 0.5M sucrose) and incubated for 30 minutes in ice. Then 15 mL of one quarter diluted TES was added and the solution was incubated for 30 min in ice. Further centrifugation (10,000 g, 10 min, 4 C.) removed cell debris and recovered the periplasm containing the protein of interest. The supernatant was then dialyzed against PBS buffer (Phosphate Buffered Saline: 27 mM KCl, 1.4 mM NaCl, 15 mM KH.sub.2PO.sub.4 anhydrous, 80 mM Na.sub.2HPO.sub.4, pH 7.4).
[0457] 2.2. Expression of Proteins in the Eukaryotic System
[0458] Proteins were produced in Schneider Drosophila S2 insect cells (SD-S2). After thawing, the cells were cultured in S2 medium (Schneider Drosophila 2 medium, 10% fetal calf serum, Penicillin-Streptomycin 1%). Transfection of the cells was performed with the Lipofectamine 2000 kit (LifeTechnology) according to the manufacturer's recommendations. Thus, these cells were first transfected transiently with the plasmid pMT-Bip containing the sequences of interest. The supernatants were analyzed 4 days later on 12% acrylamide gel by Western blot after transfer on nitrocellulose membrane to ensure that the proteins were well produced. In parallel, SD-S2 cells were stably transfected with the plasmid pMT-Bip containing the sequences of interest and the plasmid pMT-Bip containing a hygromycin resistance gene. The transfected cells were selected by resistance to hygromycin (300 g/mL) added to the S2 culture medium. Induction of protein production was feasible as soon as the cells reached sufficient multiplication kinetics after about three weeks of selection.
[0459] A production cycle is organized as follows: the cells were cultured in S2-hygromycin medium for 5 days after which the cells were recovered by centrifugation (700 g, 10 min, 30 C.), repeated in 10 mL of Schneider Drosophila medium, then counted with Trypan Blue on Malassez cell. The cells were then reintroduced into 225 cm 3 culture flasks in induction medium (Schneider Drosophila 2 Medium, Penicillin-Streptomycin 1%, CuSO.sub.4 1 mM) so as to obtain 400 mL of cells at a density of 5.Math.10.sup.6 cells/mL. Copper sulfate activates transgene expression through the metallothionein promoter. Culture supernatants were removed 96 h after induction and then centrifuged (700 g, 10 min, 30 C.) to remove the cells. Part of the transfected cells was not induced and was re-cultured to begin a new cycle of recombinant protein production.
[0460] 3. Purification of Proteins
[0461] 3.1. Purification of Recombinant Proteins by Nickel-Agarose Column Affinity Chromatography
[0462] The purification of the recombinant proteins is based on the affinity of the nickel atoms with the histidine residues of the C-terminal label of the protein. First, in order to remove as much debris as possible, the periplasm was centrifuged for 10 min at 5,000 g at room temperature. 300 mL of nickel-agarose gel (Miltenyi Biotec) per 50 mL of periplasm were added to the supernatant and then the solution was stirred slowly for 1 h 30 min.
[0463] Centrifugation for 3 min at 500 g allowed to harvest all the gel, which was loaded on a chromatography column. Then, washing was carried out with 25 mL of PBS and then 5 mL of a glycine solution (0.1M, pH 6). Elution of the protein was performed with 5 mL of a 0.1M glycine solution at pH 3. Fractions of 1 mL were recovered and immediately neutralized by addition of 1M Tris. They were then dialyzed against a PBS buffer at 4 C. overnight.
[0464] After dialysis, the absorbance at 280 nm was measured in order to estimate the protein concentration according to the Beer-Lambert law A=lC (A: absorbance, : molar extinction coefficient, l: length of the tank; C: concentration).
[0465] 3.2. Purification of Recombinant Proteins by Affinity Chromatography on PpL-Agarose Column
[0466] First, in order to remove as much debris as possible, the bacterial periplasm or cell culture supernatant was centrifuged for 10 min at 5,000 g at room temperature. 300 L of agarose per 50 mL of periplasm or culture supernatant was added to the centrifugation supernatant, and then the solution was stirred slowly for 1 h 30 min.
[0467] A centrifugation of 3 min at 500 g allowed to harvest all the gel, which was loaded on a chromatography column. Then, washing was carried out with 25 mL of PBS and then 5 mL of a glycine solution (0.1M, pH 6). The elution of the protein was carried out with 5 mL of a 0.1M glycine solution at pH 3 and then with 5 mL of a 0.1M glycine solution at pH 2.
[0468] Fractions of 1 mL were recovered and immediately neutralized by addition of 1M Tris. They were then dialyzed against a PBS buffer at 4 C. overnight. After dialysis, the absorbance at 280 nm was measured in order to estimate the protein concentration according to the Beer-Lambert law A=lC (A: absorbance, : molar extinction coefficient, l: length of the tank; C: concentration).
[0469] 4. Protein Analysis
[0470] 4.1. Structural Analysis: FPLC (Fast Protein Liquid Chromatography
[0471] The purifications of the peptide constructs were analyzed by exclusion-diffusion chromatography on a Superdex column (Biosciences). 200 L of peptide constructs (fractions collected after purification by chromatography on a nickel-agarose column or on a PpL-agarose column) were loaded onto the column.
[0472] Protein elution was performed with PBS at a flow rate of 0.5 mL/min before performing an absorbance measurement at 280 nm.
[0473] 4.2. Electrophoresis in Polyacrylamide Gel (SDS-PAGE) Under Denaturing Conditions
[0474] Protein samples (fractions collected after purification by chromatography on a nickel-agarose column or on a PpL-agarose column) were diluted in loading buffer (Tris-HCl pH 6.8 100 mM, SDS (Sodium Dodecyl Sulfate) 4%, -1% mercapto-ethanol, 0.2% bromophenol blue, 20% glycerol) and then denatured by heating at 95 C. for 5 min. They were then deposited on a 12% polyacrylamide gel and were then migrated under a current of 60 mA. The proteins present in the gel were visualized after 30 min staining with Coomassie blue (0.25% Coomassie blue, 45% methanol and 10% acetic acid) and bleaching with the discoloration buffer.
[0475] 4.3. Characterization of Proteins by Immuno-Detection
[0476] 4.3.1. Antibodies Used for Protein Detection
[0477] An anti-histidine monoclonal antibody (Sigma) was used to detect the presence of proteins with the histidine tag. An alkaline phosphatase-coupled murine anti-IgG antibody (Sigma) was used as a secondary antibody to reveal the presence of the anti-histidine monoclonal antibody. HRP (Horse Radish Peroxidase) -induced anti-histidine antibody (Miltenyi Biotec) was used to directly reveal the presence of proteins with the histidine Lag. HRP (Horse Radish Peroxidase) coupled L (PpL) protein is used to directly reveal the presence of proteins recognized by protein L.
[0478] 4.3.2. Western Blot
[0479] Passive protein transfer on nitrocellulose membrane was performed overnight. The next day, the membrane was first saturated with a TNT solution (15 mM Tris-HCl, 140 mM NaCl pH 8, 0.05% Tween 20) supplemented with 5% skim milk powder for 1 h.
Peptide Constructs with the Tag Histidine:
[0480] Anti-histidine monoclonal antibody was added to the membrane at 1/2000 dilution for 1 h while stirring. The membrane was washed three times with TNT and then incubated with the secondary murine anti-mouse IgG antibody coupled to alkaline phosphatase (diluted 1/5000 in TNT) for 1 hour with shaking. The washing of the membrane was carried out twice with TNT then with buffer R (100 mM Tris-HCl, 100 mM NaCl 5 mM MgCl.sub.2 H.sub.2O, pH 9.5). The presence of the antibodies was revealed by the reaction of the alkaline phosphatase with its substrate (BCIP: Bromo Chloro Indolyl Phosphate) in the presence of NBT (Nitro Blue Tetrazolium) and the color reaction was stopped by rinsing with distilled water.
[0481] 4.3.3. ELISA
[0482] A 96-well plate (NUNC Maximax) was coated with 10 g/mL of toxoplasma total extract (ET) diluted in carbonate buffer (0.1M Na.sub.2CO.sub.3, NaHCO.sub.3, pH 9.6) at 100 L/well. The plate was left overnight at 4 C.
[0483] The next day, the saturation of the non-specific sites was carried out by 200 L/well of PBS-Tween supplemented with 3% of BSA (Bovine Serum Albumin) for 1 h 30-2 h at 37 C. The plate was then washed 3 times with 0.05% PBS-Tween. The samples (fractions containing the proteins of the peptide constructs collected after purification by chromatography on a nickel-agarose column or on a PpL-agarose column) were deposited in duplicate in a final volume of 100 L/well. After incubation for 1 h 30 at 37 C., 3 washes with PBS-Tween 0.05% were carried out.
Peptide Constructs with the Tag Histidine:
[0484] The anti-histidine antibody coupled to peroxidase, diluted 1/1000 in PBS, was added at a rate of 100 L/well. After 1 h incubation at 37 C. the revelation was carried out by adding 100 L/well of TMB (3,3, 5,5-tetramethylbenzidine) for 5 to 10 min at room temperature and in darkness. The reaction was stopped by adding 50 L of 2N H.sub.2SO.sub.4 solution. The plate was read at 450 nm by a plate reader.
[0485] 4.3.4. Indirect Immunofluorescence
[0486] The immunofluorescence technique consisted of fixing tachyzotes of Toxoplasma gondii on wells and bringing together the peptide constructs to be tested. The binding of the peptide construct to the parasite was revealed by an antibody coupled to a fluorochrome. First, the supernatant of a tachyzote culture was recovered and centrifuged (3500 rpm, 15 min) and then the pellet was resuspended with 5 mL of PBS. This step has been executed three times. The third time, the pellet was resuspended so as to obtain 5.Math.10.sup.6 tachyzotes/mL. 20 L, (i.e 1.105 tachyzotes) were deposited on each well, then left to dry under a hood all night. The wells were then stored at 20 C. until use.
[0487] Without waiting for the cups to thaw, the tachyzotes were fixed in a cold acetone bath for 2 minutes. Each well was then rinsed three times with PBS. Then 30 L of sample (fractions containing the proteins of the peptide constructs collected after purification by chromatography on a nickel-agarose column or on a PpL-agarose column) were deposited and incubated in a humid chamber at 4 C. for 16 hours.
[0488] At the end of the incubation, three washes with PBS were performed before depositing 40 L of the primary anti-histidine antibody (diluted 1/50) per well. The wells were incubated for 1 h 30 at 37 C. in a humid chamber. After 3 rinses with PBS, the secondary anti-mouse IgG antibody coupled to Alexa488 fluorochrome (dilution 1/500) was added and the wells were incubated in a humid chamber at 37 C. for 1 h 30 min. In order to remove unbound antibodies, 3 washes with PBS were performed. Finally, a blade was then attached to the wells. The observation was carried out under a fluorescence microscope (objective 40).
[0489] 5. In Vitro Neutralization Test
[0490] HFF (Human Foreskin Fibroblast) line cells were placed in a 96-well plate (P96), at 2.Math.10.sup.4 cells/well, in 100 DMEM (Dulbecco's Modified Eagle Medium) medium supplemented with 1% glutamine, 1% FCS (Fetal Calf Serum), 1% penicillin-streptomycin, without phenol red, and then incubated for 24 h (37 C., 5% CO.sub.2). Tachyzotes, of a RH strain of Toxoplasma gondii transfected with a plasmid encoding -galactosidase were used. The -galactosidase gene is under the control of the promoter of the gene encoding the SAG1 protein.
[0491] For each well, a volume of 50 L of DMEM medium containing 100 tachyzotes was added to 50 L of a solution containing from 1.5 to 10 g of peptide construction to be tested for a pre-incubation of one hour. Then the 100 l of the pre-incubated solution were placed in the presence of the cells: the peptide constructs and the parasites were therefore added simultaneously.
[0492] Alternatively, when this is explicitly mentioned, a volume of 50 M of DMEM medium containing 100 tachyzotes was added to each well and then 50 L of a solution containing from 1.5 to 10 g of peptide construction to be tested were placed in each well, presence of cells and parasites without pre-incubation (with a delay of 5 min after the addition of tachyzotes).
[0493] In both cases, the volume of 50 L of the solution containing from 1.5 to 10 g of peptide construction was prepared in the following manner: from a solution containing the peptide construction at different concentrations according to the peptic construction a volume was determined so that this volume contains the desired peptide building mass. This volume was removed and then supplemented with a buffer solution until a volume of 50 l was obtained.
[0494] The plate was incubated for 4 days at 37 C. unless otherwise indicated under 5% CO.sub.2.
[0495] In order to analyze the action of each peptide construct, 150 L of supernatant was removed from each well and 50 L of lysis buffer (0.1% Triton 100) was added to each well. The wells were then scraped to lyse all the cells. On a new P96, 50 L of lysate was deposited in each well, to which 50 L of a solution of CPRG (Chlorophenol Red-PD-galactopyranoside, 1 L) in HEPES (100 L, pH 8). Cleaved by the -galactosidase present in tachyzotes, the CPRG produces a soluble red compound, measurable by spectophotometry. The plate was then incubated at 37 C. for 20 min so that the enzyme could act. Staining was measured at 565 nm.
[0496] 6. In Vivo Neutralization Test
[0497] 6.1. Congenital Toxoplasmosis Model
[0498] Male and female swiss OF1 mice (January), non-consanguineous albino mice, were used.
[0499] For each experiment, the protocol was as follows: [0500] At D1, the setting to the male was carried out by placing 2 females in the presence of a male during 48 h.
[0501] The female mice were then monitored daily to determine which pregnant and non-pregnant mice were pregnant. [0502] At D11, corresponding to midgut, the pregnant female mice were all infected by gavage with cysts of the Toxoplasma gondii strain 76k. The mice were then separated into 2 lots. The first batch, called the infected control, consisted of mice infected only with T. gondii. The second batch, called infected and treated, consisted of infected mice but also treated by the peptide construction. In the latter batch, mice infected with T. gondii received daily, from the day of infection (at mid-gestation) and until parturition, the peptide construct by intraperitoneal injection (15 or 27 g/mL), mouse/day from a preparation at 120 g/mL). [0503] After the birth of the young mice, a follow-up of the protection as well as the induced immune response were realized. For this, the young mice were regularly monitored (height/weight) before being sacrificed at the age of 4-5 weeks of life. Their brains were then collected and crushed to evaluate the parasite load, a parameter reflecting the protection.
[0504] Moreover, a study of the cellular response was also performed on splenocytes by cytokine assay (interleukin 10 (IL-10), interferon- (IFNy)).
[0505] 6.2. Ocular Toxoplasmosis Model
[0506] Female mice, swiss OF1, non-consanguineous albinos, (January), were used and distributed in different batches: [0507] Lot 1: the mice received by intravitreal injection 200 tachyzotes of the strain of Toxoplasma gondii ME49 at OJ. [0508] Lot 2: The mice received by intravitreal injection 600 ng of peptide construction (from a preparation at 120 g/mL) on D0. [0509] Lot 3: the mice were simultaneously injected intravitreally with 200 tachyzotes of the ME49 strain and 600 ng of peptide construction (from a preparation at 120 g/mL) on D0.
[0510] The injections, under a volume of 5, into the limbus (junction between the cornea and the sclera) were performed under general isoflurane anesthesia using a 250 l Hamilton syringe (Dutscher) on which was mounted a 32 gauge needle (Dutscher).
[0511] The eyes of the mice were then examined under a binocular magnifying glass under general isoflurane anesthesia at D1, D2, D6 and D7 in order to perform the clinical examination. This was performed on the anterior segment (cornea, sclera, conjunctiva, crystalline, aqueous humor) and the posterior segment (vitreous, retina). These clinical examinations were done with a binocular magnifying glass. Corneal hydration was respected to prevent the occurrence of exposure keratitis or corneal edema that would have disrupted the examination.
[0512] The eyes examined were divided into five clinical stages: [0513] 0: no inflammatory sign, [0514] 1: Tyndall in anterior chamber or moderate vitreen, [0515] 2: Tyndall in anterior or severe vitreous chamber and/or dilatation of the iris and/or conjunctivo-scleral vessels (posterior subcapsular cataract), [0516] 3: corneal disorders and precipitated retrocorneal and/or very severe hyalite, [0517] 4: secondary cataract.
Immunohistochemistry
[0518] At D8, the mice were sacrificed. Whole eyes were taken after internal and external canthotomy, removed from the oculomotor muscles and conjunctiva by Vannas scissors and enucleated by traction on the optic nerve. The eyes were frozen at 80 C., directly or after being fixed in 4% paraformaldehyde (one eye per mouse), after inclusion in the embedding medium: oct embadding matrix cellpath. The frozen blocks were cut with cryostat (Leica CM3050) at 10 microns, deposited on a slide (4 cuts per slide) and allowed to dry overnight. Slides can be used directly or frozen at 80 C. and thawed for 1 h. The slides were fixed in four successive acetone baths of 3 min, 60, 70, 80 and 90% then in a 4% paraformaldehyde bath for 3 min and washed twice in PBS for 5 min.
[0519] Tagging of tachyzotes at the retinal sections was then performed via the use of an infection serum and a secondary antibody (extravidin FITC). 50 of serum of infection were deposited by cutting. The slides rested for 2 hours in a humid chamber at 37 C., then 3 washes were carried out for 3 min with PBS (baths). The secondary antibody was deposited for 30 min: extravidin FITC (sigma E2761) (diluted to 1/1000) (labeling of tachyzotes in green). The three washes for 3 min in PBS at room temperature were renewed and the counterstaining was done with Hoescht (Molecular Probes 1333342 H3573) diluted in water at 1/2000 (staining of the nuclei in blue) for a minute. 50 L per cut have been deposited. The slides were then washed 3 times for 3 min at room temperature (baths) and mounted with Vectashield H1000 without leaving bubbles. After drying, the slides were observed under a fluorescence microscope.
Example 2 Production and Analysis of Proteins of Peptide Construction SG0
1. Construction of the Expression Vector
[0520] The gene coding for the SG0 peptide construct, represented by the sequence SEQ ID NO: 10, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0521] The vector containing the gene encoding the SG0 peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pET22b, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli BL21 bacteria.
2. Production, Purification and Protein Analysis
[0522] The proteins of the SGI peptide construct were produced in a bacterial system (Escherichia coli BL21). The proteins produced were extracted from the periplasm by osmotic shock.
[0523] The proteins were then purified by affinity chromatography on a nickel-agarose column.
[0524] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 3 Production and Analysis of Peptides of Peptide Construction SG5
1. Construction of the Expression Vector
[0525] The nucleotide sequence of SG5 represented by the sequence SEQ ID NO: 11 was obtained using a PCR technique.
[0526] First, the nucleotide sequence of the variable domain of the light chain (VL domain) of the SG0 peptide construct was amplified by PCR. The PCR product was then purified and cloned into the pGEMT vector.
[0527] TG1 bacteria were transformed with the pGEMT vector. After culturing the bacteria, the plasmid was purified using the Plasmid Minikit I kit. The plasmid was then digested with BamHI and XhoI. The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment, coding the variable domain of the light chain of the peptide construct SG0 (insert), was then inserted into the expression vector pET22b, previously digested with the same pair of endonucleases, via a ligation.
[0528] BL21 bacteria made competent were then transformed with the ligation product.
2. Production, Purification and Protein Analysis
[0529] The proteins of the SG5 peptide construct were produced in a bacterial system (Escherichia coli BL21). The proteins produced were extracted from the periplasm by osmotic shock.
[0530] The proteins were then purified by affinity chromatography on a nickel-agarose column. The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 4 Production and Analysis of Proteins of the Peptide Construction SG2-LH
1. Construction of the Expression Vector
[0531] The gene coding for the SG2-LH peptide construct represented by the sequence SEQ ID NO: 27, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in the eukaryotic system.
[0532] The vector containing the gene encoding the SG2-LH peptide construct was then digested with a pair of endonucleases (Table 1). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the pMT-Bip expression vector, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli DH5 bacteria, in order to obtain after culture and purification (maxi prep) a sufficiently large amount of plasmid to perform the transfection of S2 cells.
2. Production, Purification and Protein Analysis
[0533] The proteins of the peptide construct SG2-LH were produced in eukaryotic system. The proteins produced were secreted into the culture medium of S2 cells after induction with copper sulphate.
[0534] The proteins were then purified by affinity column chromatography on PpL agarose.
[0535] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 5: Production and Analysis of Peptide Construction Proteins DbSG2
1. Construction of the Expression Vector
[0536] The gene coding for the DbSG2 peptide construct represented by the sequence SEQ ID NO: 13 was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in the eukaryotic system.
[0537] The vector containing the gene encoding the peptide construct DbSG2 was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the pMT-Bip expression vector, previously digested with the same pair of endonucleases (Table 1) via a ligation. The ligation products were used to transform Escherichia coli DH5 bacteria, in order to obtain after culture and purification (maxi prep) a sufficiently large amount of plasmid to perform the transfection of S2 cells.
2. Production, Purification and Protein Analysis
[0538] The proteins of the peptide construct DbSG2 have been produced in the eukaryotic system. The proteins produced were secreted into the culture medium of S2 cells after induction with copper sulphate.
[0539] The proteins were then purified by affinity column chromatography on PpL agarose.
[0540] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 6: Production and Analysis of Proteins of the Peptide Construction SG2-CH3
1. Construction of the Expression Vector
[0541] The gene coding for the SG2-CH3 peptide construct represented by the sequence SEQ ID NO: 14, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in the eukaryotic system.
[0542] The vector containing the gene encoding the SG2-CH3 peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the pMT-Bip expression vector, previously digested with the same pair of endonucleases (Table 1) via a ligation. The ligation products were used to transform Escherichia coli DH5a bacteria, in order to obtain after culture and purification (maxi prep) a sufficiently large amount of plasmid to perform the transfection of S2 cells.
2. Production, Purification and Protein Analysis
[0543] The proteins of the SG2-CH3 peptide construct were produced in the eukaryotic system. The proteins produced were secreted into the culture medium of S2 cells after induction with copper sulphate.
[0544] The proteins were then purified by affinity column chromatography on PpL agarose.
[0545] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 7 Production and Analysis of Proteins of the SG2-Fc2a Peptide Construction
1. Construction of the Expression Vector
[0546] The gene coding for the SG2-Fc2a peptide construct represented by the sequence SEQ ID NO: 16 was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in the eukaryotic system.
[0547] The vector containing the gene encoding the SG2-Fc2a peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the pMT-Bip expression vector, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli DH5 bacteria, in order to obtain after culture and purification (maxi prep) a sufficiently large amount of plasmid to perform the transfection of S2 cells.
2. Production, Purification and Protein Analysis
[0548] The proteins of the SG2-Fc2a peptide construct were produced in the eukaryotic system. The proteins produced were secreted into the culture medium of S2 cells after induction with copper sulphate.
[0549] The proteins were then purified by affinity column chromatography on PpL agarose. The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 8: Production and Analysis of Proteins of the Peptide Construction SG2-HL
1. Production in Eukaryotic System
1.1. Construction of the Expression Vector
[0550] The gene coding for the SG2-HL peptide construct represented by the sequence SEQ ID NO: 12, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in the eukaryotic system.
[0551] The vector containing the gene encoding the SG2-HL peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the pMT-Bip expression vector, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli DH5 bacteria, in order to obtain after culture and purification (maxi prep) a sufficiently large amount of plasmid to perform the transfection of S2 cells.
1.2. Production, Purification and Protein Analysis
[0552] The proteins of the SG2-HL peptide construct were produced in the eukaryotic system. The proteins produced were secreted into the culture medium of S2 cells after induction with copper sulphate. The proteins were then purified by affinity column chromatography on PpL agarose.
[0553] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
2. Production in Prokaryotic System
2.1. Construction of the Expression Vector
[0554] The gene coding for the SG2-HL peptide construct represented by the sequence SEQ ID NO: 12, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0555] The vector containing the gene encoding the SG2-HL peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2.2. Production, Purification and Protein Analysis
[0556] The proteins of the SG2-HL peptide construct were produced in a prokaryotic system (Escherichia coli HB2151). The proteins produced were extracted from the periplasm by osmotic shock.
[0557] The proteins were then purified by affinity chromatography on a PpL-agarose column.
[0558] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 9 Production and Analysis of Peptide Construction Proteins DbSG2-CH3
1. Construction of the Expression Vector
[0559] The gene encoding the peptide construct DbSG2-CH3 represented by the sequence SEQ ID NO: 15, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in the eukaryotic system.
[0560] The vector containing the gene encoding the peptide construct DbSG2-CH3 was then digested using a pair of endonucleases (Table 1). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the pMT-Bip expression vector, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli DH5a bacteria, in order to obtain after culture and purification (maxi prep) a sufficiently large amount of plasmid to perform the transfection of S2 cells.
2. Production, Purification and Protein Analysis
[0561] The proteins of the peptide construction DbSG2-CH3 were produced in eukaryotic system. The proteins produced were secreted into the culture medium of S2 cells after induction with copper sulphate.
[0562] The proteins were then purified by affinity column chromatography on PpL agarose.
[0563] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 10: Production and Analysis of Proteins of the Peptide Construct scFvSG1
1. Construction of the Expression Vector
[0564] The gene coding for the scFvSG1 peptide construct represented by the sequence SEQ ID NO: 17, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned in a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system. The vector containing the gene coding for the scFvSG1 peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0565] The proteins of the peptide construct scFvSG1 were produced in prokaryotic system (Escherichia coli HB21 1). The proteins produced were extracted from the periplasm by osmotic shock.
[0566] The proteins were then purified by affinity chromatography on a PpL-agarose column.
[0567] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 11: Production and Analysis of Proteins of Peptide Construction DbF3S2
1. Construction of the Expression Vector
[0568] The gene encoding the peptide construct DbF3S2 represented by the sequence SEQ ID NO: 18, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0569] The vector containing the gene coding for the peptide construct DbF3S2 was then digested using a pair of endonucleases (Table 1). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0570] The proteins of the peptide construct DbF3S2 were produced in prokaryotic system (Escherichia coli HB2151). The proteins produced were extracted from the periplasm by osmotic shock.
[0571] The proteins were then purified by affinity chromatography on a PpL-agarose column.
[0572] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 12: Production and Analysis of Peptide Construction Proteins DbF4S2
1. Construction of the Expression Vector
[0573] The gene encoding the peptide construct DbF4S2 represented by the sequence SEQ ID NO: 19, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0574] The vector containing the gene encoding the peptide construct DbF4S2 was then digested using a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0575] The proteins of the peptide construction DbF4S2 were produced in prokaryotic system (Escherichia coli HB2151). The proteins produced were extracted from the periplasm by osmotic shock.
[0576] The proteins were then purified by affinity chromatography on a PpL-agarose column. The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 13: Production and Analysis of Peptide Construction Proteins scFvF5S2
1. Construction of the Expression Vector
[0577] The gene coding for the scFvF5S2 peptide construct represented by the sequence SEQ ID NO: 20, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0578] The vector containing the gene coding for the scFvF5S2 peptide construct was then digested with a pair of endonucleases (Table 1). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table 1) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0579] The proteins of the peptide construct scFvF5S2 were produced in a prokaryotic system (Escherichia coli HB21 1). The proteins produced were extracted from the periplasm by osmotic shock.
[0580] The proteins were then purified by affinity chromatography on a Ppl-agarose column.
[0581] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 14: Production and Analysis of Peptide Construction Proteins scFvF5S4
1. Construction of the Expression Vector
[0582] The gene coding for the scFvF5S4 peptide construct represented by the sequence SEQ ID NO: 21, was obtained by synthesis from the company Thermo Fisher Scientifique GENEA T, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0583] The vector containing the gene coding for the scFvF5S4 peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0584] The proteins of the peptide construct scFvF5S4 were produced in prokaryotic system (Escherichia coli HB21 1). The proteins produced were extracted from the periplasm by osmotic shock.
[0585] The proteins were then purified by affinity chromatography on a PpL-agarose column. The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 15: Production and Analysis of Proteins of the Peptide Construct scFvF5S5
1. Construction of the Expression Vector
[0586] The gene coding for the scFvF5S5 peptide construct represented by the sequence SEQ ID NO: 22, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system. The vector containing the gene coding for the scFvF5S5 peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table 1) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0587] The proteins of the peptide construct scFvF5S5 were produced in prokaryotic system (Escherichia coli HB21 1). The proteins produced were extracted from the periplasm by osmotic shock.
[0588] The proteins were then purified by affinity chromatography on a Ppl-agarose column.
[0589] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 16: Production and Analysis of Proteins of the Peptide Construct scFvF5S6
1. Construction of the Expression Vector
[0590] The gene coding for the scFvF5S6 peptide construct represented by the sequence SEQ ID NO: 23, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned in a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0591] The vector containing the gene coding for the scFvF5S6 peptide construct was then digested with a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0592] The proteins of the peptide construct scFvF5S6 were produced in a prokaryotic system (Escherichia coli HB2151). The proteins produced were extracted from the periplasm by osmotic shock.
[0593] The proteins were then purified by affinity chromatography on a PpL-agarose column.
[0594] The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 17: Production and Analysis of Hum-scFvH2S Peptide Constructs
1. Construction of the Expression Vector
[0595] The gene coding for the Hum-scFvH2S peptide construct represented by the sequence SEQ ID NO: 24, was obtained by synthesis from the company Thermo Fisher Scientific GENEART, cloned into a vector. The nucleotide sequences encoding the variable domains of the heavy (VH) and light (VL) chains were optimized for production of the protein in a prokaryotic system.
[0596] The vector containing the gene coding for the Hum-scFvH2S peptide construct was then digested using a pair of endonucleases (Table I). The DNA fragment resulting from the double digestion was then isolated by agarose gel electrophoresis and then purified. This DNA fragment encoding the peptide construct (insert) was then inserted into the expression vector pSW1, previously digested with the same pair of endonucleases (Table I) via a ligation. The ligation products were used to transform Escherichia coli HB2151 bacteria.
2. Production, Purification and Protein Analysis
[0597] The proteins of the Hum-scFvH2S peptide construct were produced in a prokaryotic system (Escherichia coli HB2151). The proteins produced were extracted from the periplasm by osmotic shock.
[0598] The proteins were then purified by affinity chromatography on a PpL-agarose column. The purified proteins were then analyzed by FPLC (structural analysis) and then by polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The proteins were then characterized by immuno-detection using a Western blot.
Example 18 Analysis of the Fixation of the Peptide Construction SG0 on Toxoplasma gondii
[0599] The fixation of the SG0 peptide construct on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods).
[0600] Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.Math.10.sup.5 tachyzotes per well. The sample containing the SG0 peptide construct was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
[0601] The results are shown in
[0602] The presence of fluorescence in part F of
Example 19: Analysis of the Fixation of the SG5 Peptide Construct on Toxoplasma gondii
[0603] The fixation of the SG5 peptide construct on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods). Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.Math.10.sup.5 tachyzotes per well.
[0604] The sample containing the SG5 peptide construct was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
[0605] The results are shown in
[0606] The presence of fluorescence in part H of
Example 20: Analysis of the Fixation of the Peptide Construction DbF3S2 on Toxoplasma gondii
[0607] The fixation of the DbF3S2 peptide construct on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods). Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.Math.10.sup.5 tachyzotes per well.
[0608] The sample containing the peptide construct DbF3S2 was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
[0609] The results are shown in
[0610] The presence of fluorescence in part J of
Example 21: Analysis of the Fixation of the Peptide Construction scFvF5S2 on Toxoplasma gondii
[0611] The fixation of the scFvF5S2 peptide construct on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods). Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.10 tachyzotes per well.
[0612] The sample containing the scFvF5S2 peptide construct was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
Example 22: Analysis of the Fixation of the Peptide Construction scFvF5S4 on Toxoplasma gondii
[0613] The attachment of the peptide construct scFvF5S4 to Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods). Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.Math.10.sup.5 tachyzotes per well.
[0614] The sample containing the scFvF5S4 peptide construct was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
Example 23: Analysis of the Fixation of the Peptide Construction scFvF5S5 on Toxoplasma gondii
[0615] The fixation of the scFvF5S5 peptide construct on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods).
[0616] Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.10 tachyzotes per well. The sample containing the peptide construct scFvF5S5 was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
Example 24: Analysis of the Fixation of the Peptide Construction scFvF5S6 on Toxoplasma gondii
[0617] The fixation of the peptide construct scFvF5S6 on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods).
[0618] Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.Math.10.sup.5 tachyzotes per well. The sample containing the scFvF5S6 peptide construct was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
Example 25: Efficacy of the SG0 Construct on the In Vitro Neutralization of HFF Cell Invasion by Toxoplasma gondii Tachyzotes
[0619] HFF line cells were plated in a 96-well plate (P96) at 2.Math.10.sup.4 cells/well. For each well, a certain volume of a solution of SG0 at 109 g mL was taken so that it contained 1.5 g, 1.6 g, 3 g, 6 g or 10 g of SG0 then this last was completed with a buffer solution until a volume of 50 l.
[0620] After 24 h incubation of the HFF cells in the wells, the 50 l of the solution containing the peptide construct SG0 at different concentrations, so that the amounts of SG0 are 1.5 g, 1.6 g, 3 g, 6 g or 10 g, were added to each well, either simultaneously with the addition of 100, 1000 or 10,000 tachyzotes, of a RH strain of Toxoplasma gondii, transfected with a plasmid encoding -galactosidase, after a preincubation of one hour, or with a delay of 5 min after the addition of tachyzotes (without preincubation). The plate was incubated for 4 days at 37 C., or at room temperature, under 5% CO2.
[0621] The in vitro neutralization of HFF cell invasion by Toxoplasma gondii tachyzotes is evaluated by measuring the optical density (OD) at the 565 nm wavelength.
[0622] The results are presented in
[0623] The SG0 peptide construct inhibits the cellular invasion of HFF cells by Toxoplasma gondii tachyzotes compared to the irrelevant B6P antibody regardless of the amount of tachyzotes (100, 1000 or 10.000) (
[0624] The inhibition effect persists that one is in physiological condition (37 C.) or at ambient temperature (
[0625] Pre-incubation is not a prerequisite for the inhibitory power of SG0, since without pre-incubation. SG0 is able to inhibit cell invasion as efficiently as pre-incubation (
Example 26: Efficacy of SG5 Construction on the In Vitro Neutralization of HFF Cell Invasion by Toxoplasma gondii Tachyzotes
[0626] HFF line cells were plated in a 96-well plate (P96) at 2.Math.10.sup.4 cells/well.
[0627] For each well, a certain volume of a solution of SG5 at 147 g/mL was taken so that it contained 1.5 g, 3 g or 6 g of SG5, then the latter was supplemented with a solution buffer until a volume of 50 L is obtained. After 24 h incubation of the HFF cells in the wells, the 50 of the solution containing the SG5 peptide construct at different concentrations, so that the amounts of SG5 are 1.5 g, 3 g or 6 g, have in each well, simultaneously with 100 tachyzotes, were added a RH strain of Toxoplasma gondii, transfected with a plasmid encoding -galactosidase. The plate was incubated for 4 days at 37 C. under 5% CO 2.
[0628] The in vitro neutralization of HFF cell invasion by Toxoplasma gondii tachyzotes is evaluated by measuring the optical density (OD) at the 565 nm wavelength.
[0629] The results are shown in
[0630] SG5 is able to inhibit cellular invasion by the parasite. In addition, a dose-dependent effect is observed.
Example 27: Efficacy of the DbF3S2 Construct on the In Vitro Neutralization of HFF Cell Invasion by Toxoplasma gondii Tachyzotes
[0631] HFF line cells were plated in a 96-well plate (P96) at 2.Math.10.sup.4 cells/well.
[0632] For each well, a certain volume of a solution of DbF3S2 at 155 g/mL was taken in such a way that it contained 1, 5 g or 3 g of DbF3S2 and the latter was then supplemented with a buffer solution up to to obtain a volume of 50 i.
[0633] After 24 hours of incubation of the HFF cells in the wells, the 50 L of the solution containing the peptide construct DbF3S2 at different concentrations, so that the amounts of DbF3S2 are 1, 5 g or 3 g, were added, in each well, simultaneously with 100 tachyzotes, of a RH strain of Toxoplasma gondii, transfected with a plasmid encoding J-galactosidase. The plate was incubated for 4 days at 37 C. under 5% CO.sub.2.
[0634] The in vitro neutralization of HFF cell invasion by Toxoplasma gondii tachyzotes is evaluated by measuring the optical density (OD) at the 565 nm wavelength.
[0635] The results are shown in
Example 28: Efficacy of the Peptide Construction SG0 in the Treatment of Toxoplasmosis in a Mouse Model of Congenital Toxoplasmosis
[0636] Male and female swiss OF1 mice (January), non-consanguineous albino mice, were used.
[0637] Three experiments were performed, including parameters (number of mice per lot (mouse number/lot), number of Toxoplasma gondii strain 76K cysts administered (# of cysts (76K)) and amount of SG0 administered daily to treated mice. (Quantity of SG0 in g)) are summarized in Table II.
TABLE-US-00002 TABLE II EXPERIENCE 1 EXPERIENCE 2 EXPERIENCE 3 Infected Infected & Infected Infected & Infected Infected & Witness treated Witness treated Witness treated Number mice/lot 6 7 2 2 3 3 No cystes (76K) 10 10 30 30 30 30 Quantity of SG0 (g) 15 27 15
[0638] The results of experiment 1 are shown in
Example 29: Efficacy of SG0 Peptide Construction in the Treatment of Toxoplasmosis in a Mouse Model of Ocular Toxoplasmosis
[0639] Female OF1 (January) swiss mice, non-consanguineous albinos, were used.
[0640] The eyes of the mice were examined under a binocular magnifying glass, under general isoflurane anesthesia, on D1, D2, D6 and D7 in order to perform the clinical examination on the anterior segment (cornea, sclera, conjunctiva, crystalline, aqueous humor) and the posterior segment (vitreous, retina).
[0641] At day 8, the mice were sacrificed, the eyes removed and frozen. Sections of the eyes were made and placed on a slide (4 cuts per slide) and allowed to dry overnight. The slides were observed under a fluorescence microscope.
[0642] The results are shown in
[0643] The labeling carried out with the infection serum seems to highlight the presence of tachyzotes in the retina of the mice injected intravitreously with parasites alone (line ME49, box 3 of
[0644] These results indicate that peptide construction SG0 limits parasite proliferation.
Example 30: Efficacy of SG0, SG2-HL, SG2-LH, DbSG2, SG2-Fc2a and SG2-CH3 Constructs on the In Vitro Neutralization of HFF Cell Invasion by Toxoplasma gondii Tachyzotes
[0645] HFF line cells were plated in a 96-well plate (P96) at 2.Math.10.sup.4 cells/well.
[0646] For each well, a certain volume of a 125 g/mL solution of SG0, 75 g/mL SG2-HL, 90 g/mL SG2-LH, 80 g mL DbSG2, SG2-Fc2a at 85 g/mL, or of SG2-CH3 at 75 g/mL was taken so that it contains 5 g of SiO, 5 g of SG2-HL, 5 g of SG2-LH, 5 g of DbSG2, 5 g of SG2-Fc2a or 5 g of SG2-CH3, then the latter was supplemented with a buffer solution until a volume of 50 l.
[0647] After 24 h incubation of the HFF cells in the wells, the 50 L of the solution containing the peptide construct SG0, SG2-HL, SG2-LH, DbSG2, SG2-Fc2a or SG2-CH3, so that the amounts of 5 g constructs were added in each well, simultaneously with 1000 tachyzotes, of a RH strain of Toxoplasma gondii, transfected with a plasmid encoding -galactosidase. The plate was incubated for 4 days at 37 C. under 5% CO 2.
[0648] The in vitro neutralization of HFF cell invasion by Toxoplasma gondii tachyzotes is evaluated by measuring the optical density (OD) at the 565 nm wavelength.
[0649] The results are shown in
[0650] SG0 is able to inhibit cellular invasion by the parasite.
[0651] SG2-HL is able to inhibit cellular invasion by the parasite.
[0652] SG2-LH is able to inhibit cellular invasion by the parasite.
[0653] DbSG2 is able to inhibit cellular invasion by the parasite.
[0654] SG2-Fc2a is able to inhibit cellular invasion by the parasite.
[0655] SG2-CH3 is able to inhibit cellular invasion by the parasite. Example 31; Analysis of the fixation of the peptide construct DbSG2, SG2-HL,
[0656] SG2-LH. SG2-Fc2a and SG2-CH3 on Toxoplasma gondii
[0657] The fixation of the peptide constructs DbSG2. SG2-HL. SG2-LH, SG2-Fc2a and SG2-CH3 on Toxoplasma gondii is observed by immunofluorescence, according to the protocol described in paragraph 4.3.4 of Example 1 (Materials and Methods). Tachyzotes of Toxoplasma gondii were fixed on cups at the rate of 1.Math.10.sup.5 tachyzotes per well.
[0658] The sample containing the peptide construct DbSG2, SG2-HL, SG2-LH, SG2-Fc2a or SG2-CH3 was plated on the wells which were incubated in a humid chamber at 4 C. overnight.
[0659] The results are shown in
[0660] The presence of fluorescence in parts B to F of