METHOD FOR DETECTING AND ISOLATING INVASIVE CANCER STEM CELLS EMPLOYING CELL-SURFACE AMFR AND THE USE THEREOF
20190154695 ยท 2019-05-23
Inventors
- Kun-Chih TSAI (Taipei City, TW)
- Patrick Yuhmin YANG (Hillsborough, CA, US)
- Tze-Sian CHAN (Taipei City, TW)
Cpc classification
G01N33/57484
PHYSICS
C07K14/705
CHEMISTRY; METALLURGY
C12Y603/02019
CHEMISTRY; METALLURGY
C12N5/0695
CHEMISTRY; METALLURGY
A61K35/12
HUMAN NECESSITIES
G01N33/57492
PHYSICS
International classification
Abstract
The present disclosure provides an isolated invasive cancer stem cell (iCSC) or a substantially homogeneous iCSC population comprising said iCSC, which is positive for the marker AMFR on the cell membrane. The present disclosure also provides a method of detecting the iCSC within an established cancer or a collection of cancer cells. The present disclosure also provides a method of isolating the iCSC or a substantially homogeneous cell population comprising said iCSC from an established cancer or a collection of cancer cells.
Claims
1.-26. (canceled)
27. An isolated invasive cancer stem cell (iCSC) or a substantially homogeneous iCSC population comprising said iCSC, which is positive for the marker AMFR on the cell membrane.
28. The iCSC of claim 27, which is characterized by: (a) having stem-cell like properties; and (b) having invasive properties.
29. The iCSC of claim 27, wherein said stem-cell-like properties include: (a) expressing stem cell markers, which comprise, CD133, CD44, CD24, CD90, CD15, CD20, CD117, CD166, CD271, epithelial specific antigen (ESA), CXCR4, aldehyde dehydrogenase (ALDH), c-Met, nestin, nodal-activin, ABCG2, alpha2betal-integrin, alpha6-integrin or any combination of the foregoing; (b) expressing a low level of CD24 if said solid tumor is a breast cancer or a prostate cancer; (c) giving rise to additional stem-cell-like tumor cells; (d) being able to form a detectable tumor upon transplantation into an immunocompromised host; and/or (e) being able to regenerate the hierarchical organization of solid tumor tissues.
30. The iCSC of claim 27, wherein said cell membrane is within, the regions of invadopodia-like structures, said invadopodia-like structures are transient actin-based protrusions on a cancer cell that mediate focal degradation of extracellular matrix and cell invasion and tumor metastasis.
31. A method of detecting an isolated invasive cancer stem cell (iCSC) which is positive for the marker AMFR on the cell membrane within an established cancer or a collection of cancer cells, wherein the method comprises: (a) preparing a sample of said cancer or said collection of cancer cells; (b) contacting said sample with an agent that binds to AMFR on the membrane; and (c) determining whether said sample contains cancer cells expressing AMFR on the cell membrane, regardless of the expression of AMFR in the cell cytosol or nuclei, thereby detecting said iCSC.
32. The method of claim 31, wherein said cancer comprises, pancreatic, lung, prostate, liver, gastric, oral, esophageal, breast, kidney, bladder cancers, as well as neuroendocrine tumors, cholangiocarcinoma, malignant glioma, lymphoma, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia or chronic lymphocytic leukemia.
33. The method of claim 31, wherein said sample is a biopsy specimen, a surgical specimen, a blood-derived specimen, a urine specimen, a stool specimen, a cerebral spinal fluid specimen, a biliary juice specimen, a pancreatic juice specimen, cultured cells, and/or any combination thereof.
34. The method of claims 31, wherein said agent is selected from a group consisting of an antibody or the like, a peptide, an aptamer, or any molecule or compound that is sufficient to confer specific binding to AMFR on the cell surface with high affinity.
35. The method of claim 34, said antibody includes: polyclonal, monoclonal, genetically engineered forms of antibodies, chimeric antibodies, humanized antibodies, hetero-conjugate antibodies, single chain variable fragment (scFv) antibodies, polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen biding to the polypeptide, or antigen binding fragments of antibodies.
36. The method of claim 31, wherein said determining whether said sample contains cancer cells that express AMFR on the cell membrane comprise the methods of, immunofluorescence staining, immunohistochemistry, in situ PCR, ELISA, immunoblotting, proximity ligation analysis, flow cytometry, mass spectrometry, or protein, tissue or cell microarray.
37. A method of isolating an isolated invasive cancer stem cell (iCSC) which is positive for the marker AMFR on the cell membrane or a substantially homogeneous cell population comprising said iCSC from an established cancer or a collection of cancer cells, wherein the method comprises: (a) preparing a sample of said cancer or said collection of cancer cells; (b) contacting said sample with a binding agent that binds to AMFR on the cell surface; and (c) isolating cancer cells from said sample that express AMFR on the cell membrane, thereby isolating said iCSC.
38. The method of claim 37, wherein said method of isolating said iCSC is selected from the group consisting of fluorescence-activated cell sorting, magnetic-assisted cell sorting, or any means that are capable of selecting cells based on specific protein epitopes present on the cell surface.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DETAILED DESCRIPTION
[0058] It is well documented that many types of tumors contain cancer cells with heterogeneous phenotypes, reflecting aspects of the differentiation that normally occurs in the tissues from which the tumors arise. The variable expression of normal differentiation markers by cancer cells in a tumor suggests that some of the heterogeneity in tumors arises as a result of the anomalous differentiation of tumor cells. Examples of this include the variable expression of myeloid markers in chronic myeloid leukemia, the variable expression of neuronal markers within peripheral neurectodermal tumors, and the variable expression of milk proteins or the estrogen receptor within breast cancer.
[0059] Acute myeloid leukemia (AML) is characterized by the clonal expansion of immature myeloblasts initiating from rare LSCs. Studies have demonstrated that a certain ratio of leukemia consists of a heterogeneous cell fraction and is not configured with a homogenous cell population capable of clonal proliferation. Lapidot and Dick identified such heterogeneity in AML and reported that CD34+CD38 cells are transplanted selectively in CB17-scid and NOD/SCID mice (Lapidot et al., 1994). LSCs are responsible for tumor maintenance, and also give rise to large numbers of abnormally differentiating progeny that are not tumorigenic, thus meeting the criteria of cancer stem cells. Tumorigenic potential is contained within a subpopulation of cancer cells differentially expressing the markers of the present invention.
[0060] Recent studies have shown that, similar to leukemia and other hematologic malignancies, tumorigenic and non-tumorigenic populations of solid tumor cells, such as breast cancer cells, can be isolated based on their expression of cell surface markers (Al-Hajj et al., 2003; Ginestier et al., 2007). In many cases of solid tumor, only a small subpopulation of cells termed CSCs, tumor stem cells, or tumor-initiating cells had the ability to form new tumors. This work strongly supports the existence of CSCs in breast cancer. Further evidence for the existence of cancer stem cells occurring in solid tumors has been found in central nervous system (CNS) malignancies (Singh et al., 2004). Using culture techniques similar to those used to culture normal neuronal stem cells it has been shown that neuronal CNS malignancies contain a small population of cancer cells that are clonogenic in vitro and initiate tumors in vivo, while the remaining cells in the tumor do not have these properties.
[0061] CSCs in solid tumors are functionally characterized by being tumorigenetic, being able to give rise to additional tumorigenic cells (self-renew) and non-tumorigenic tumor cells (differentiation). The origins of solid tumor stem cells vary between different types of cancers or solid malignant tumors. Solid tumor stem cells may arise either as a result of genetic damage that deregulates the proliferation and differentiation of normal stem cells (Lapidot et al., Nature 367(6464): 645-8 (1994)) or by the dysregulated proliferation of a normal restricted progenitor or a normal differentiated cell type. Typically, solid tumors are visualized and initially identified according to their locations, not by their developmental origin.
[0062] The isolation and characterization of CSCs or LSCs have borrowed the concepts and principles of normal stem cell biology. For instance, CSCs and LSCs can be operationally characterized by cell surface markers recognized by reagents that specifically bind to the cell surface markers. It has often been possible to identify combinations of positive and negative markers that uniquely identify stem cells and allow their substantial enrichment in other contexts (see Morrison et al., Cell 96(5): 737-49 (1999); Morrison et al., Proc. Natl. Acad. Sci. USA 92(22): 10302-6 (1995); Morrison & Weissman, Immunity 1(8): 661-73 (1994)). For example, proteins, carbohydrates, or lipids on the surfaces of solid tumor stem cells can be immunologically recognized by antibodies specific for the particular protein or carbohydrate (for construction and use of antibodies to markers, see, Harlow, Using Antibodies: A Laboratory Manual (Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1999). The set of markers present on the cell surfaces of solid tumor stem cells (the cancer stem cells of the invention) and absent from the cell surfaces of these cells is characteristic for solid tumor stem cells. Therefore, solid tumor stem cells can be selected by positive and negative selection of cell surface markers. A reagent that binds to a solid tumor stem cell is a positive marker (i.e. a marker present on the cell surfaces of solid tumor stem cells) that can be used for the positive selection of solid tumor stem cells. A reagent that binds to a solid tumor stem cell negative marker (i.e., a marker not present on the cell surfaces of solid tumor stem cells but present on the surfaces of other cells obtained from solid tumors) can be used for the elimination of those solid tumor cells in the population that are not solid tumor stem cells (i.e., for the elimination of cells that are not solid tumor stem cells).
[0063] Except cell surface markers, solid tumor stem cells can be operationally characterized by enzymatic markers. In a particular embodiment, said solid tumor stem cells can be characterized by the expression or the enzymatic activity of aldehyde dehydrogenase 1 (ALDH1). For example, the ALDH positive cell population, representing 6% of the normal breast epithelial cells, has stem cell characteristics. Phenotypic markers associated with stem and progenitor cells segregated with the ALDH positive population. Also the mammosphere initiating cells, which according to previous studies are likely to be the normal breast stem cells are contained in the ALDH positive fraction of the mammary epithelium (see U.S. Pat. No. 8,435,746). Furthermore, the ALDH positive population contains the cancer stem cell population, as shown by the ability to generate tumors in mice. As few as 500 ALDH positive cells generate tumors upon implantation in NOD/SCID mice, whereas the ALDH negative population is not tumorigenic, even when implanted in high numbers (50,000). The latency and size of the tumor correlated with the number of ALDH+ cell implanted.
[0064] ALDH positive cells can be detected in situ by immunostaining with ALDH 1 antibody or by the FACS-based enzymatic assay.
[0065] In order to access the proliferation or tumor-initiating potential of CSCs in vivo, CSCs can be injected into animals, preferably mammals, more preferably in rodents such as mice, and most preferably into immunocompromised mice, such as SCID mice, Beige/SCID mice or NOD/SCID mice. NOD/SCID mice are injected with the varying number of cells and observed for tumor formation. The injection can be by any method known in the art, following the enrichment of the injected population of cells for solid tumor stem cells.
[0066] In order the access the proliferative potential of CSCs in vitro, CSCs can be obtained from solid tumor tissue by dissociation of individual cells. Tissue from a particular tumor is removed using a sterile procedure, and the cells are dissociated using any method known in the art (see, Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989); Current Protocols in Molecular Biology, Ausubel et al., eds., (Wiley Interscience, New York, 1993), and Molecular Biology LabFax, Brown, ed. (Academic Press, 1991)), including treatment with enzymes such as trypsin, collagenase and the like, or by using physical methods of dissociation such as with a blunt instrument. Methods of dissociation are optimized by testing different concentrations of enzymes and for different periods of time, to maximize cell viability, retention of cell surface markers, and the ability to survive in culture (Worthington Enzyme Manual, Von Worthington, ed., Worthington Biochemical Corporation, 2000). Dissociated cells are centrifuged at low speed, between 200 and 2000 rpm, usually about 1000 rpm (210 g), and then resuspended in culture medium. For guidance to methods for cell culture, see Spector et al., Cells: A Laboratory Manual (Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1998). The dissociated tumor cells can be placed into any known culture medium capable of supporting cell growth, including HEM, DMEM, RPMI, F-12, and the like, containing supplements which are required for cellular metabolism such as glutamine and other amino acids, vitamins, minerals and useful proteins such as transferrin and the like. Medium may also contain antibiotics to prevent contamination with yeast, bacteria and fungi such as penicillin, streptomycin, gentamicin and the like. In some cases, the medium may contain serum derived from bovine, equine, chicken and the like. However, a preferred embodiment for proliferation of solid tumor stem cells is to use a defined, low-serum culture medium. A preferred culture medium for solid tumor stem cells is a defined culture medium comprising a mixture of Ham's F12, 2% fetal calf serum, and a defined hormone and salt mixture, either insulin, transferrin, and selenium or B27 supplement. Brewer et al., J. Neuroscience Res. 35: 567 (1993).
[0067] In certain embodiments, in vitro proliferation of CSCs isolated from pancreatic cancer is assessed by placing cells in serum-free medium, such as the Neurobasal Media (Invitrogen/Life Technologies) containing Glutamax, bFGF (20 ng/ml), EGF (20 ng/ml), N-2 and B27, at 10,000 cells/well in multi-well ultra-low attachment plates (Corning, Lowell, Mass., USA) (see Arensman et al. Oncogene 33: 899-908 (2014)). Likewise, in vitro proliferation of gastric cancer stem cells is assessed by placing cells in serum-free medium, such as epithelial basal medium (EBM-2; Lonza), supplemented with 4 mg/ml insulin (Sigma-Aldrich), B27, 20 ng/ml EGF and 20 ng/ml basic fibroblast growth factor (Invitrogen), in ultra-low attachment plates (see Jiang et al. Oncogene 31: 671-682 (2011)). In vitro proliferation of hepatoma stem cells is assessed by placing cells in serum-free medium, such as DMEM/F12 medium (Invitrogen), supplemented with 20 ng/ml human recombinant EGF (Sigma-Aldrich), 10 ng/ml human recombinant bFGF (Invitrogen), 4 /ml insulin (Sigma-Aldrich), B27 (1:50; Invitrogen), 500 units/ml penicillin (Invitrogen) and 500 g/ml streptomycin (Invitrogen), in ultra-low attachment plates (see Ma et al., Cell Stem Cell 7: 694-707 (2010)). In vitro proliferation of glioma stem cells is assessed by placing cells in serum-free medium, such as NSC proliferation medium (StemCell), supplemented with 20 ng/ml EGF (Sigma-Aldrich), 10 ng/ml bFGF (Sigma-Aldrich) and 0.3% agarose (Sigma-Aldrich) (see Zheng et al. Nature 455(23): 1129-133 (2008)). In vitro proliferation of glioma stem cells is assessed by placing cells in serum-free medium, such as DMEM/F12 medium, supplemented with glucose to 0.6%, 1% penicillin/streptomycin, 2 mM L-glutamine (Invitrogen), 4 g/ml heparin, 5 mM HEPES, 4 mg/ml BSA (Sigma-Aldrich), 10 ng/ml FGF basic and 20 ng/ml EGF (R&D Systems) (see Dieter et al. Cell Stem Cell 9: 357-65 (2011)). Cells are replenished with supplemented medium every second day. After 7-14 days, tumor spheres were visualized and counted by phase contrast microscopy. To propagate spheres in vitro, spheres were collected by gentle centrifugation and were dissociated to single cells using TrypLE Express (Invitrogen) or accutase (Millipore). Following dissociation, trypsin inhibitor (Invitrogen) was used to neutralize the reaction, and cells were sieved through a 40-m filter and re-seeded to generate spheres of the next generation.
[0068] The above-mentioned methods of accessing the proliferative potential of iCSCs or iLSCs in vitro can be employed for expanding the above mentioned iCSCs or iLSCs or substantially homogenous cell populations comprising said iCSCs or iLSCs.
[0069] Non-human animals, immunodeficient animals can be used for the grafting of the present invention since they are unlikely to have rejection reactions. Immunodeficient animals preferably used include non-human animals that lack functional T cells, for example, nude mice and nude rats, and non-human animals that lack both functional T and B cells, for example, SCID mice and NOD-SCID mice. It is more preferably to use mice that lack T, B, and NK cells and have excellent transplantability, including, for example, NOG or NSG mice. Regarding the weekly age of non-human animals, for example, 4 to 100-week-old athymic nude mice, SCID mice, NOD-SCID mice, or NOG mice are preferably used. NOG mice can be prepared, for example, by the method described in WO 2002/043477, and are available from the Central Institute for Experimental Animals or the Jackson Laboratory (NSG mice).
[0070] Cells to be grafted may be any cells, including cell masses, tissue fragments, individually dispersed cells, cells cultured after isolation, and cells isolated from a different animal into which the cells have been grafted; however, dispersed cells are preferred. The number of grafted cells may be 10.sup.6 or less; however, it is acceptable to graft more cells.
[0071] With respect to the grafting site, subcutaneous grafting is preferred because the graft technique is simple. The grafting site is not particularly limited, and it is preferable to select an appropriate grafting site depending on the animal used. There is no particular limitation on the grafting operation of NOG-established cancer cell lines, and the cells can be grafted by conventional grafting operations.
[0072] Detection and Isolation of AMFR-Positive CSC or LSC
[0073] The current invention provides methods for detecting iCSC or iLSC or substantially homogeneous iCSC or iLSC populations by determining the expression of AMFR on the cell surface in a biological sample obtained from an individual with a solid tumor or a hematopoietic cancer.
[0074] The human AMFR (NCBI Entrez Gene 267) encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. AMFR is located on chromosome 16 at gene map locus 16q21 and molecular mass of 72.996 Kd. AMFR sequences are publically available, for example form NCBI GenBank (e.g., accession numbers NM_001144.5 (mRNAs) and NP_001135.3 (proteins)).
[0075] In a preferred embodiment, determining the expression of AMFR on the cell surface involve determining the expression of AMFR on the surface of invadopodia of podosomes-like structures in cells. Said invadopodia or podosomes-like structures are transient actin-based protrusions in a tumor cell or a leukemia cell that mediate focal degradation of extracellular matrix and cell invasion and tumor metastasis.
[0076] In these methods, first, samples obtained from cancer patients are prepared. In the present invention, a sample is not particularly limited as long as it is preferably an organ or tissue derived from a cancer patient. It is possible to use a frozen or unfrozen organ or tissue. Such samples include, for example, cancer (tumor) tissues isolated from cancer patients. In these methods, a sample is then contacted with an AMFR-binding agent.
[0077] Specifically, for example, organs or tissues are isolated from cancer patients, and specimens are prepared. The specimens can be used to detect, identify, or quantify the presence of cancer stem cells. Specimens can be appropriately prepared by using known methods, for example, the PFA-AMeX-Paraffin method (WO 09/078,386). The samples include, for example, frozen or unfrozen organs or tissues. First, samples from cancer patients are fixed in a PFA solution. PFA solution refers to a cell fixation solution which is an aqueous solution of 1 to 6% paraformaldehyde combined with a buffer such as phosphate buffer. It is preferable to use 4% PFA fixation solution (4% paraformaldehyde/0.01 M PBS (pH7.4)). For fixation with a PFA fixation solution, organs or tissues of interest are immersed in a PFA solution containing 1 to 6%, preferably 4% paraformaldehyde, at 0 to 8 Celsius degree., preferably at about 4 Celsius degree, for 2 to 40 hours, preferably for 6 to 30 hours. Then, fixed organs or tissues are washed with phosphate buffered saline or such. Washing may be carried out after excising portions from the observed organs or tissues.
[0078] Organs or tissues thus prepared are then embedded in paraffin by the AMeX method. The AMeX method is a paraffin embedding method with a series of the following steps: cold acetone fixation, dehydration with acetone, clearing in methylbenzoate and xylene, and paraffin embedding. Specifically, tissues are immersed in acetone at 25 to 8 Celsius degree, preferably at 20 to 6 Celsius degree, for 2 to 24 hours, preferably for 4 to 16 hours. Then, the tissues in acetone are warmed to room temperature. Alternatively, organs or tissues are transferred into acetone at room temperature. Then, dehydration is performed for 0.5 to 5 hours, preferably 1 to 4 hours at room temperature. Subsequently, the organs or tissues are cleared by immersion in methylbenzoate at room temperature for 0.5 to 3 hours, preferably for 0.5 to 2 hours, followed by immersion in xylene at room temperature for 0.5 to 3 hours, preferably 0.5 to 2 hours. Next, the organs or tissues are embedded in paraffin by penetration at 55 to 65 Celsius degree, preferably at 58 to 62 Celsius degree for 1 to 4 hours, preferably for 1 to 3 hours. The paraffin blocks of organs or tissues prepared by the PFA-AMeX method are stored at low temperature before use.
[0079] At the time of use, the paraffin blocks thus prepared are sliced into thin sections using a microtome or the like. Then, the thin sections are deparaffinized and rehydrated. Deparaffinization and rehydration can be performed by known methods. For example, deparaffinization can be performed using xylene and toluene, while rehydration can be carried out using alcohol and acetone. The resulting thin sections are stained, for example, by histochemistry, immunohistochemistry, or enzyme histochemistry for detection, identification, or quantitation. When the prepared samples are stained by histochemistry (special staining), it is possible to use any staining method commonly available for paraffin-embedded sections (for example, PAS staining, giemsa staining, and toluidine blue staining). For staining by enzyme histochemistry, the sections may be stained by any staining method available for sections (for example, various staining such as with ALP, ACP, TRAP, or esterase). In addition, histopathological tissues can be stained by the following: hematoxylin-eosin staining for general staining; van Gieson staining, azan staining, and Masson Trichrome staining for collagen fiber staining; Weigert staining and Elastica van Gieson staining for elastic fiber staining; Watanabe's silver impregnation staining and PAM staining (periodic acid methenamine silver stain) for reticular fibers/basal membrane staining, etc.
[0080] Staining with immunohistochemistry and enzyme histochemistry can be performed by direct methods using primary antibodies labeled with an enzyme or labeling substance, or indirect methods using non-labeled primary antibodies and labeled secondary antibodies. However, such methods are not limited thereto. Antibodies can be labeled by conventional methods. Labeling substances include, for example, radioisotopes, enzymes, fluorescent substances, and biotin/avidin.
[0081] The labeling substances may be those commercially available. Radioisotopes include, for example, .sup.32P, .sup.33P, .sup.131I, .sup.125I, .sup.3H, .sup.14C, and .sup.35S. Enzymes include, for example, alkaline phosphatase, horse radish peroxidase, .beta.-galactosidase, and .beta.-glucosidase. Fluorescent substances include, for example, fluorescein isothiocyanate and rhodamine. These may be commercially available. Labeling can be carried out by known methods.
[0082] Thin sections are stained, for example, by histochemistry, immunohistochemistry, or enzyme histochemistry for detection, identification, or quantitation.
[0083] In exemplary methods, determining the protein expression of AMFR on the cell surface comprises the use of antibodies specific to AMFR on the cell surface and immunohistochemistry staining on fixed (e.g., formalin-fixed) and/or wax-embedded (e.g., paraffin-embedded) pancreatic tumor tissues. Fixatives for tissue preparations or cells are well known in the art and include formalin, gluteraldehyde, methanol, or the like (Carson, Histotechology: A Self-Instructional Text, Chicago: ASCP Press, 1997). The immunohistochemistry methods may be performed manually or in an automated fashion.
[0084] Antibody reagents can be used in assays to detect expression of AMFR on the cell surface especially near the invadopodium or podosomes-like structures of tumor or cancer cells in patient samples using any of a number of immunoassays known to those skilled in the art. Immunoassay techniques and protocols are generally described in Price and Newman, Principles and Practice of Immunoassay, 2nd Edition, Grove's Dictionaries, 1997; and Gosling, Immunoassays: A Practical Approach, Oxford University Press, 2000. A variety of immunoassay techniques, including competitive and non-competitive immunoassays, can be used. See, e.g., Self et al., Curr. Opin. Biotechnol., 7:60-65 (1996). The term immunoassay encompasses techniques including, without limitation, enzyme immunoassays (EIA) such as enzyme multiplied immunoassay technique (EMIT), enzyme-linked immunosorbent assay (ELISA), IgM antibody capture ELISA (MAC ELISA), and microparticle enzyme immunoassay (MEIA); capillary electrophoresis immunoassays (CEIA); radioimmunoassays (RIA); immunoradiometric assays (IRMA); fluorescence polarization immunoassays (FPIA); and chemiluminescence assays (CL). If desired, such immunoassays can be automated. Immunoassays can also be used in conjunction with laser induced fluorescence. See, e.g., Schmalzing et al., Electrophoresis, 18:2184-93 (1997); Bao, J. Chromatogr. B. Biomed. Sci., 699:463-80 (1997). Liposome immunoassays, such as flow-injection liposome immunoassays and liposome immunosensors, are also suitable for use in the present invention. See, e.g., Rongen et al., J. Immunol. Methods, 204:105-133 (1997). In addition, nephelometry assays, in which the formation of protein/antibody complexes results in increased light scatter that is converted to a peak rate signal as a function of the marker concentration, are suitable for use in the methods of the present invention. Nephelometry assays are commercially available from Beckman Coulter (Brea, Calif.; Kit #449430) and can be performed using a Behring Nephelometer Analyzer (Fink et al., J. Clin. Chem. Clin. Biochem., 27:261-276 (1989)).
[0085] Specific immunological binding of the antibody to AMFR can be detected directly or indirectly. Direct labels include fluorescent or luminescent tags, metals, dyes, radionuclides, and the like, attached to the antibody. An antibody labeled with iodine-125 (.sup.125I) can be used. A chemiluminescence assay using a chemiluminescent antibody specific for the nucleic acid is suitable for sensitive, non-radioactive detection of protein levels. An antibody labeled with fluorochrome is also suitable. Examples of fluorochromes include, without limitation, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R-phycoerythrin, rhodamine, Texas red, and lissamine. Indirect labels include various enzymes well known in the art, such as horseradish peroxidase (HRP), alkaline phosphatase (AP), -galactosidase, urease, and the like. A horseradish-peroxidase detection system can be used, for example, with the chromogenic substrate tetramethylbenzidine (TMB), which yields a soluble product in the presence of hydrogen peroxide that is detectable at 450 nm. An alkaline phosphatase detection system can be used with the chromogenic substrate p-nitrophenyl phosphate, for example, which yields a soluble product readily detectable at 405 nm. Similarly, a -galactosidase detection system can be used with the chromogenic substrate o-nitrophenyl--D-galactopyranoside (ONPG), which yields a soluble product detectable at 410 nm. An urease detection system can be used with a substrate such as urea-bromocresol purple (Sigma Immunochemicals; St. Louis, Mo.).
[0086] A signal from the direct or indirect label can be analyzed, for example, using a spectrophotometer to detect color from a chromogenic substrate; a radiation counter to detect radiation such as a gamma counter for detection of .sup.125I; or a fluorometer to detect fluorescence in the presence of light of a certain wavelength. For detection of enzyme-linked antibodies, a quantitative analysis can be made using a spectrophotometer such as an EMAX Microplate Reader (Molecular Devices; Menlo Park, Calif.) in accordance with the manufacturer's instructions. If desired, the assays of the present invention can be automated or performed robotically, and the signal from multiple samples can be detected simultaneously.
[0087] The antibodies can be immobilized onto a variety of solid supports, such as magnetic or chromatographic matrix particles, the surface of an assay plate (e.g., microtiter wells), pieces of a solid substrate material or membrane (e.g., plastic, nylon, paper), in the physical form of sticks, sponges, papers, wells, and the like. An assay strip can be prepared by coating the antibody or a plurality of antibodies in an array on a solid support. This strip can then be dipped into the test sample and processed quickly through washes and detection steps to generate a measurable signal, such as a colored spot.
[0088] A detectable moiety can be used in the assays described herein. A wide variety of detectable moieties can be used, with the choice of label depending on the sensitivity required, ease of conjugation with the antibody, stability requirements, and available instrumentation and disposal provisions. Suitable detectable moieties include, but are not limited to, radionuclides, fluorescent dyes (e.g., fluorescein, fluorescein isothiocyanate (FICSC), Oregon Green rhodamine, Texas red, tetrarhodimine isothiocynate (TRICSC), Cy3, Cy5, etc.), fluorescent markers (e.g., green fluorescent protein (GFP), phycoerythrin, etc.), autoquenched fluorescent compounds that are activated by tumor-associated proteases, enzymes (e.g., luciferase, horseradish peroxidase, alkaline phosphatase, etc.), nanoparticles, biotin, digoxigenin, and the like.
[0089] We contemplated kits useful for facilitating the practice of a disclosed method. In one embodiment, kits are provided for detecting AMFR on the surface especially near the invadopodium or podosomes-like structures of said tumor cells or hematopoietic cancer cells from an individual with a malignant solid tumor or a hematopoietic cancer. In a preferred embodiment, a kit is provided for detecting AMFR protein on the cell surface in combination with one to a plurality of housekeeping genes or proteins (e.g., -actin, GAPDH, RPL13A, tubulin, and the likes well known in the art of protein biochemistry). The detection means can include means for detecting AMFR protein on the cell surface, such as an antibody or antibody fragment specific for the AMRF protein, or an aptamers specific for the AMFR protein. In a particular example, kits can include an antibody specific for the AMFR protein on the cell surface. Particular kit embodiments can further include, for instance, one or more (such as two, three or four) antibodies specific for a selected group of housekeeping proteins.
[0090] In some preferred embodiments, the primary detection means (e.g., nucleic acid probe, nucleic acid primers, or antibody) can be directly labeled with a fluorophore, chromophore, or enzyme capable of producing a detectable product (e.g., alkaline phosphates, horseradish peroxidase and others commonly known in the art). In other embodiments, kits are provided including secondary detection means, such as secondary antibodies or non-antibody hapten-binding molecules (e.g., avidin or streptavidin). In some such instances, the secondary detection means will be directly labeled with a detectable moiety. In other instances, the secondary or higher order antibody can be conjugated to a hapten (e.g., biotin, DNP, or FICSC), which is detectable by a cognate hapten binding molecule (e.g., streptavidin horseradish peroxidase, streptavidin alkaline phosphatase, or streptavidin QDot). Some kit embodiments can include colorimetric reagents in suitable containers to be used in concert with primary, secondary or higher order detection means that are labeled with enzymes for the development of such colorimetric reagents.
[0091] Antibodies or aptamers used in the methods provided here can be obtained from a commercially available source or prepared using techniques well known in the art. Antibodies are immunoglobulin molecules (or combinations thereof) that specifically binds to, or is immunologically reactive with, a particular antigen, and includes polyclonal, monoclonal, genetically engineered and otherwise modified forms of antibodies, including but not limited to chimeric antibodies, humanized antibodies, hetero-conjugate antibodies, single chain Fv antibodies, polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen biding to the polypeptide, and antigen binding fragments of antibodies. Antibody fragments include proteolytic antibody fragments, recombinant antibody fragments, complementarity determining region fragments, camelid antibodies (e.g., U.S. Pat. Nos. 6,015,695; 6,005,079; 5,874,541; 5,840,526; 5,800,988; and 5,759,808), and antibodies produced by cartilaginous and bony fishes and isolated binding domains thereof.
[0092] TABLE 1 shows exemplary commercial sources of antibodies for AMFR.
TABLE-US-00001 TABLE 1 Exemplary commercial sources of AMFR-specific antibodies Antibody type Source Catalog number Application Rabbit Polyclonal Aviva Systems ARP42995_T100 WB Biology Rabbit Polyclonal Novus NBP2-15374 WB, IHC Biologicals Rabbit Polyclonal LifeSpan LS-C144946-100 IHC, WB BioSciences Mouse Monoclonal Abcam ab54787 WB Rabbit Polyclonal Abcam ab191163 WB, IHC Rabbit Polyclonal United States 031834-AP-200ul WB Biological Rabbit Polyclonal United States 031834-APC-200 IF, WB Biological ul Rabbit Polyclonal Invitrogen PA5-29501 WB, IHC Antibodies Rabbit Polyclonal Invitrogen PA5-12051 WB, IHC, FACS Antibodies Rabbit Polyclonal GeneTex GTX112393 IHC-P, WB Rabbit Polyclonal Novus NBP1-49986 WB, IP Biologicals Rabbit Polyclonal Novus 35450002 WB, ELISA, IHC-P Biologicals Rabbit Polyclonal Abgent AP2162a WB, FC, IHC Rabbit Polyclonal LifeSpan LS-C319452-200 ELISA, WB BioSciences Rabbit Polyclonal LifeSpan LS-C251260-200 ELISA, WB BioSciences Rabbit Polyclonal MyBioSource MBS8502450 WB, IF, IHC Rabbit Polyclonal MyBioSource MBS9206813 WB, ELISA Rabbit Polyclonal Biorbyt orb163699 WB Rabbit Polyclonal Biorbyt orb181626 WB, IHC-P Rabbit Polyclonal Abbexa Ltd abx025052 FCM Rabbit Polyclonal Abbexa Ltd abx002685 WB, IHC, IF/ICC Rabbit Polyclonal NSJ F40060-0.08ML WB, IHC, FACS, Bioreagents ELISA Rabbit Polyclonal Source SBS503728 WB, IHC BioScience Rabbit Polyclonal Source SBS408404 IHC, WB BioScience Rabbit Polyclonal Abnova PAB5236 WB, ELISA Corporation Mouse Monoclonal Abnova H00000267-M01 ELISA, WB Corporation Rabbit Polyclonal Cell Signaling 9590S WB, IP Technology Rabbit Polyclonal Acris AP50160PU-N WB Antibodies GmbH Rabbit Polyclonal Acris AP12067PU-N WB, IHC Antibodies GmbH Rabbit Polyclonal antibodies-online ABIN2199949 IHC, WB Mouse Monoclonal antibodies-online ABIN2199947 ELISA, WB Rabbit Polyclonal St John's STJ22602 WB, IHC, IF Laboratory Rabbit Polyclonal Atlas HPA029018 IHC, WB Antibodies Rabbit Polyclonal Fitzgerald 70R-1149 WB Industries International Rabbit Polyclonal GenWay 18-003-44307 WB Biotech Rabbit Polyclonal GenWay GWB-330500 WB Biotech Rabbit Polyclonal Proteintech 16675-1-AP ELISA, WB, IP, Group IHC, IF Rabbit Polyclonal Bethyl A302-889A-M WB, IP Laboratories Rabbit Polyclonal Bethyl A302-889A-T WB, IP Laboratories Rabbit Polyclonal OriGene TA590740 WB, ELISA, IHC, Technologies IF Rabbit Polyclonal Bioss bs-6511R WB, IHC-P, IF Mouse Monoclonal Creative MOB-1971z WB, ELISA, IHC Biolabs Rabbit Polyclonal ProSci 29-818 ELISA, WB Goat Polyclonal Santa Cruz sc-21564 WB, IF, ELISA Mouse Monoclonal Santa Cruz sc-166358 WB, IP, IF, ELISA WB, Western blotting; IHC, immunohistochemistry; IF, immunofluorescence; ICC, immunocytochemistry; IP, immunoprecipitation; ELISA, enzyme-linked immunosorbent assay.
[0093] Methods of generating antibodies (e.g., monoclonal or polyclonal antibodies) are well known in the art (e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988). For example, peptide fragments of AMFR can be conjugated to carrier molecules (or nucleic acids encoding such epitopes) can be injected into non-human mammals (e.g., mice or rabbits), followed by boost injections, to produce an antibody response. Serum isolated from immunized animals may be isolated for the polyclonal antibodies contained therein, or spleens from immunized animals may be used for the production of hybridomas and monoclonal antibodies. Antibodies can be further purified before use.
[0094] Aptamers used in the methods disclosed herein include single stranded nucleic acid molecule (e.g., DNA or RNA) that assumes a specific, sequence-specific shape and binds to the AMFR protein with high affinity and specificity. In another example, an aptamer is a peptide aptamer that binds to one of the AMFR protein with high affinity and specificity. Peptide aptamers include a peptide loop which is specific for the target protein attached at both ends to a protein scaffold. The scaffold may be any protein which is stable, soluble, small, and non-toxic. Peptide aptamer selection can be made using different systems, such as the yeast two-hybrid system or the Lex A interaction trap system.
[0095] In certain embodiments of the present invention, a kit may include a carrier means, such as a box, a bag, a vial, a tube, a satchel, plastic carton, wrapper, or other container. In some examples, kit components will be enclosed in a single packing unit, which may have compartments into which one or more components of the kit can be placed. In other examples, a kit includes one or more containers that can retain, for example, one or more biological samples to be tested. In some embodiments, a kit may include buffers and other reagents that can be used for the practice of a particular disclosed method. Such kits and appropriate contents are well known to those skilled in the art.
[0096] The present invention further provides methods for isolating iCSC or iLSCs or substantially homogeneous iCSC or iLSC populations from an established solid tumor or an established hematopoietic cancer. An embodiment of the methods includes a method for isolating AMFR-positive iCSC or iLSCs or substantially homogeneous iCSC or iLSC populations, which comprises the steps of: (a) preparing a sample of said solid tumor or said hematopoietic cancer; (b) contacting said sample with a binding agent that binds to AMFR on the cell surface; and (c) isolating tumor cells or cancer cells from said sample that express AMFR on the cell surface, thereby isolating said invasive tumor stem cell or said invasive leukemia stem cell.
[0097] In the above method, isolating AMFR-positive iCSCs or iLSCs or substantially homogeneous iCSC or iLSC populations involves the use of fluorescence-activated cell sorting (FACS), magnetic-assisted cell sorting, or any means that are capable of selecting cells based on specific protein epitopes present on the cell surface.
[0098] The technique of flow cytometry, such as fluorescence-assisted cell sorting (FACS) and the tumor-xenograft animal model are often used to enrich for specific CSC populations. This technique has the advantage of being able to simultaneously isolate phenotypically pure populations of viable normal and tumor cells for molecular analysis. Thus, flow cytometry allows us to test the functions of the cell populations and use them in biological assays in addition to studying their gene expression profiles. Furthermore, such cells can also be characterized in biological assays. For example, mesenchymal (stromal) cells can be analyzed for production of growth factors, matrix proteins and proteases, endothelial cells can be analyzed for production of specific factors involved in solid tumor growth support (such as neo-vascularization), and different subsets of tumor cells from a solid tumor can be isolated and analyzed for tumorigenicity, drug resistance and metastatic potential.
[0099] Diagnosis of Aggressive Solid Tumors or Hematopoietic Cancers
[0100] The present provides methods for diagnosing an aggressive solid tumor or an aggressive hematopoietic cancer comprising the steps of: (a) obtaining a first biological sample containing tumor or cancer cells from a first individual; (b) determining the frequency of said tumor or cancer cells with AMFR on their cell surface in said first biological sample; (c) comparing said frequency in said first biological sample with a second biological sample selected from the group consisting of an earlier obtained biological sample from said individual or a control biological sample obtained from a second individual without said solid tumor or hematopoietic cancer; and (d) determining if said frequency in said first biological sample is different (higher or lower) than that in said second biological sample.
[0101] The methods for diagnosing an aggressive solid tumor or an aggressive hematopoietic cancer can enable the prediction of clinical prognosis, including disease recurrence, metastasis, treatment response, and overall survival in any subject with a solid tumor or a hematopoietic cancer. Accordingly, the present invention can be used to screen subjects with solid tumor or hematopoietic cancer for poor clinical prognosis, including, for example, disease recurrence following treatments, which can direct treatment decisions and the choice of treatment modalities for subjects with said solid tumor or hematopoietic cancer. Thus, the subject and the caregiver can make better informed decisions of whether or not to perform surgery, neo-adjuvant (i.e., before surgery), adjuvant therapy (i.e., after surgery), including, without limitation, radiation treatment, chemotherapy treatment, treatment with biological agents, or hormone therapy, and/or other alternate treatment(s).
[0102] Disclosed methods involve determining the frequency of tumor or cancer cells with AMFR on their cell surface in an individual and then comparing the frequency to the frequency of said AMFR-positive tumor or cancer cells determined from an earlier obtained sample for the same individual or a control sample obtained from an individual without said solid tumor or hematopoietic cancer.
[0103] In a preferred embodiment, the frequency of AMFR-positive tumor or cancer cells in a large number of persons or tissues with said solid tumor or hematopoietic cancer and whose clinical prognosis data are available as measured using a tissue sample or biopsy or other biological sample such a cell, serum or blood can be used to determine a reference level. Thus, said frequency of AMFR-positive tumor or cancer cells in an individual determined by defining levels wherein said individuals whose tumors have said frequency of AMFR-positive tumor or cancer cells above that said reference level(s) are predicted as having a higher or lower risk of tumor aggressiveness, poor clinical prognosis or disease progression than those with expression levels below said reference level(s). Variation of levels of said frequency of AMFR-positive tumor or cancer cells from the reference range (either up or down) indicates that the individual has a higher or lower degree of aggressiveness or risk of poor clinical prognosis or disease progression than those with expression levels below said reference level(s).
[0104] In exemplary methods, determining the protein expression levels comprises the use of antibodies specific to said gene markers and immunohistochemistry staining on fixed (e.g., formalin-fixed) and/or wax-embedded (e.g., paraffin-embedded) prostate tumor tissues. Fixatives for tissue preparations or cells and antibody regents useful for this application have been described above.
[0105] Definitions
[0106] The term stem cells is well known in the art and denotes to cells that are capable of generating a plurality of progenies with varying proliferative and developmental potentials. Stem cells have extensive proliferative capacity and are capable of self-renewal (see, Potten et al., Development 110: 1001 (1990); U.S. Pat. Nos. 5,750,376, 5,851,832, 5,753,506, 5,589,376, 5,824,489, 5,654,183, 5,693,482, 5,672,499, and 5,849,553, all incorporated by reference). Cells in some animal tissues, such as bone marrow, gut, secretory glands, and skin, are constantly replenished from a small population of stem cells in each tissue. Thus, the maintenance of tissues (whether during normal life or in response to injury and disease) depends upon the replenishing of the tissues from precursor cells in response to specific developmental signals.
[0107] As used herein the terms cancer stem cells (CSCs) or tumor stem cells are used interchangeably and refer to a population of cells from a solid tumor that: (1) have extensive proliferative capacity; (2) are capable of asymmetric cell division to generate one or more kinds of differentiated progeny with reduced proliferative or developmental potential; and (3) are capable of symmetric cell divisions for self-renewal or self-maintenance. These properties of CSCs confer them the ability to form palpable tumors upon serial transplantation into an immunocompromised mouse compared to the majority of tumor cells that fail to form tumors. CSCs undergo self-renewal versus differentiation in a chaotic manner to form tumors with abnormal cell types that can change over time as mutations occur.
[0108] As used herein tumorigenic refers to the functional features of a solid tumor stem cell including the properties of self-renewal (giving rise to additional tumorigenic cancer stem cells) and proliferation to generate all other tumor cells (giving rise to differentiated and thus non-tumorigenic tumor cells) that allow solid tumor stem cells to form a tumor.
[0109] As used herein, the terms stem cell cancer marker(s), cancer stem cell marker(s), tumor stem cell marker(s), or solid tumor stem cell marker(s) refer to a gene or genes or a protein, polypeptide, or peptide expressed by the gene or genes whose expression level, alone or in combination with other genes, is correlated with the presence of tumorigenic cancer cells compared to non-tumorigenic cells. The correlation can relate to either an increased or decreased expression of the gene (e.g. increased or decreased levels of mRNA or the peptide encoded by the gene).
[0110] As used herein, the term Enriched, as in an enriched population of cells, can be defined based upon the increased number of cells having a particular marker in a fractionated set of cells as compared with the number of cells having the marker in the unfractionated set of cells. However, the term enriched can be preferably defined by tumorigenic function as the minimum number of cells that form tumors at limit dilution frequency in test mice.
[0111] As used herein, the term podosomes or invadopodia refer to transient actin-based protrusions in motile cells or invasive cancer cells that mediate focal degradation of ECM by the localized proteolytic activity of proteases.
[0112] As used herein, the term epithelial-mesenchymal transition (EMT)) refers to the ability of epithelial cells to transition into mesenchymal cells by obtaining their characteristics. EMT does not occur in normal cells except during the process of embryogenesis. Epithelial cells, which are bound together tightly and exhibit polarity, change into mesenchymal cells that are bound together more loosely, exhibit a loss of polarity, and have the ability to move. These mesenchymal cells can spread into tissues around the primary tumor, and also separate from the tumor, invade blood and lymph vessels, and move to new locations where they divide and form additional tumors. Drug resistance, metastasis, or recurrence of cancer can be explained by such additional tumor formation.
[0113] As used herein, the present invention the present invention provides substantially homogeneous iCSC or iLSC populations comprising said iCSCs or iLSC of the present invention. Substantially homogeneous means that, when immunodeficient animals are grafted with 1000 cells, 100 cells, or 10 cells and analyzed for the frequency of formation of cancer cell populations using Extreme Limiting Dilution Analysis (Hu Y & Smyth G K., J Immunol Methods. 2009 Aug. 15; 347(1-2): 70-8) utilizing, for example, the method described in Hu Y & Smyth G K., J Immunol Methods. 2009 Aug. 15; 347 (1-2):70-8 or Ishizawa K & Rasheed Z A. et al., Cell Stem Cell. 2010 Sep. 3; 7(3):279-82, the frequency of cancer stem cells is 1/20 or more, preferably 1/10 or more, more preferably 1/5 or more, even more preferably 1/3 or more, still more preferably 1/2 or more, and yet more preferably 1/1.
[0114] As used herein, the term expansion of iCSC or iLSC refers to, for example, proliferation by spheroid culture or grafting and passaging in non-human animals, but is not particularly limited thereto.
[0115] As used herein, the term aggressive solid tumors refers to those solid tumors associated with high likelihoods of invading into surrounding tissues and/or developing metastatic lesions at distant sites.
[0116] As used herein, the term aggressive hematopoietic cancers refers to those hematopoietic cancers associated with high likelihoods of causing severe damage to the bone marrow and/or invading the liver, the lymph nodes, the central nervous system or any tissues outside the bone marrow.
[0117] As used herein, the term clinical prognosis refers to the outcome of subjects with solid tumors or blood cancers comprising the likelihood of tumor recurrence, survival, disease progression, and response to treatments. The recurrence of tumor or cancer after treatment is indicative of a more aggressive cancer, a shorter survival of the host (e.g., cancer patients), an increased likelihood of an increase in the size, volume or number of tumors, and/or an increased likelihood of failure of treatments.
[0118] As used herein, the term predicting clinical prognosis refers to providing a prediction of the probable course or outcome of pancreatic cancer, including prediction of metastasis, multidrug resistance, disease free survival, overall survival, recurrence, etc. The methods can also be used to devise a suitable therapy for cancer treatment, e.g., by indicating whether or not the cancer is still at an early stage or if the cancer had advanced to a stage where aggressive therapy would be ineffective.
[0119] AMFR refers to nucleic acids, e.g., gene, pre-mRNA, mRNA, and polypeptides, polymorphic variants, alleles, mutants, and interspecies homologs that: (1) have an amino acid sequence that has greater than about 60% amino acid sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a region of over a region of at least about 25, 50, 100, 200, 500, 1000, or more amino acids, to a polypeptide encoded by a referenced nucleic acid or an amino acid sequence described herein; (2) specifically bind to antibodies, e.g., polyclonal antibodies, raised against an immunogen comprising a referenced amino acid sequence, immunogenic fragments thereof, and conservatively modified variants thereof; (3) specifically hybridize under stringent hybridization conditions to a nucleic acid encoding a referenced amino acid sequence, and conservatively modified variants thereof; (4) have a nucleic acid sequence that has greater than about 60% nucleotide sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or higher nucleotide sequence identity, preferably over a region of at least about 10, 15, 20, 25, 50, 100, 200, 500, 1000, or more nucleotides, to a reference nucleic acid sequence. A polynucleotide or polypeptide sequence is typically from a mammal including, but not limited to, primate, e.g., human; rodent, e.g., rat, mouse, hamster; cow, pig, horse, sheep, or any mammal. The nucleic acids and proteins of the invention include both naturally occurring or recombinant molecules. Truncated and alternatively spliced forms of these antigens are included in the definition.
[0120] As used herein, the term metastasis refers to a process where cancer spreads or travels from the primary site to another location in the body, resulting in development of similar cancer lesions at the new site. Metastatic or metastasizing cell refers to a cell that has left the primary site of the disease due to loss of adhesive contact to adjacent cells and has invaded into neighboring body structures via blood or lymphatic circulation.
[0121] As used herein, the term recurrence refers to that, after partial resection of an organ to remove a malignant tumor from a cancer patient, or after postoperative chemotherapy, the same malignant tumor has reappeared in the remaining organ.
[0122] The details of one or more embodiments of the invention have been set forth in the accompanying description above. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. Other features, objects, and advantages of the invention will be apparent from the description and from the claims.
[0123] In the specification and the appended claims, the singular forms include plural referents. Unless defined otherwise in this specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents and publications cited in this specification are incorporated by reference.
EXAMPLES
[0124] The following examples are given for illustrative purposes only and are not intended to be limiting unless otherwise specified. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
[0125] This example describes that cell-surface AMFR marks a subpopulation of CSCs in gastric cancer and pancreatic cancer.
[0126] We analyzed the expression of cell surface AMFR in gastric cancer and pancreatic cancer cells by the fluorescence-assisted cell sorting (FACS) analysis. We measured the proportion of primary gastric cancer-derived AGS cells (American Type Culture Collections) and metastatic gastric cancer SNU-16 cells (American Type Culture Collections) that expressed the surface marker CD90, which have been shown to contain the enriched CSCs in gastric cancer (Jiang et al., 2012). We also measured the proportion of primary pancreatic cancer-derived PANC-1 cells and metastatic pancreatic cancer-derived AsPC-1 cells (both from American Type Culture Collections) that expressed that surface markers CD133 and CD90, which have been shown to contain the enriched CSCs in pancreatic cancer (Wang et al., 2013). For the FACS analysis, cells were dissociated, antibody-labeled (1-2 g per 10.sup.6 cells1 hour) and resuspended in HBSS/2% FBS as previously described (Hermann et al., 2007; Li et al., 2007). The antibodies used included anti-CD90 antibody PE-anti-CD90 (BD Biosciences) and anti-AMFR (PA5-12051; Thermo Scientific) in conjunction with Alexa Fluor 488-anti-mouse IgG (Invitrogen). Flow cytometry was done using a FACSAria III (BD Biosciences).
[0127] As shown in
[0128] As shown in
Example 2
[0129] This example describes that cell-surface AMFR marks a subpopulation of glioma stem cells.
[0130] We analyzed the expression of cell surface AMFR in malignant glioma by the FACS analysis. We measured the proportion of two malignant glioma (glioblastoma) cell lines, U-87MG and Hs-683 cells (both obtained from American Type Culture Collections) that expressed the surface marker CD133, which have been shown to contain the enriched glioma stem cells (Singh et al., 2004). For the FACS analysis, cells were dissociated, antibody-labeled (1-2 g per 10.sup.6 cells1 hour) and resuspended in HBSS/2% FBS as previously described (Hermann et al., 2007; Li et al., 2007). The antibodies used included APC-anti-CD133 (Miltenyi Biotec, Bergisch Gladbach, Germany) and anti-AMFR (PAS-12051; Thermo Scientific) in conjunction with Alexa Fluor 488-anti-mouse IgG (Invitrogen). Flow cytometry was done using a FACSAria III (BD Biosciences).
[0131] As shown in
Example 3
[0132] This example describes that cell-surface AMFR marks a subpopulation of CSCs in lung cancer and prostate cancer.
[0133] We analyzed the expression of cell surface AMFR in lung cancer and prostate cancer cells by the FACS analysis. We measured the proportion of primary lung adenocarcinoma-derived A-549 cells or a primary lung squamous cell carcinoma-derived line, NCI-H520 cells (both obtained from American Type Culture Collections) that expressed CD133, which have been shown to contain the enriched CSCs in non-small cell lung cancer (NSCLC) (Eramo et al., 2008). We also measured the proportion of primary prostate cancer-derived 22Rv-1 cells or metastatic prostate cancer PC-3 cells (both obtained from American Type Culture Collection) that expressed that surface markers CD44 and CD133, which have been shown to contain the enriched CSCs in prostate cancer (Dubrovska et al., 2009; Richardson et al., 2004). For the FACS analysis, cells were dissociated, antibody-labeled (1-2 g per 10.sup.6 cells1 hour) and resuspended in HBSS/2% FBS as previously described (Hermann et al., 2007; Li et al., 2007). The antibodies used included APC-anti-CD133 (Miltenyi Biotec, Bergisch Gladbach, Germany), PE-anti-CD44 (BD Biosciences), and anti-AMFR (PAS-12051; Thermo Scientific) in conjunction with Alexa Fluor 488-anti-mouse IgG (Invitrogen). Flow cytometry was done using a FACSAria III (BD Biosciences).
[0134] As shown in
[0135] As shown in
Example 4
[0136] This example describes that cell-surface AMFR marks a significant proportion of LSCs in acute myeloid leukemia.
[0137] We analyzed the expression of cell surface AMFR in AML cells by the FACS analysis. We measured the proportion of AML THP-1 cells and HL-60 cells (both obtained from American Type Culture Collections) that expressed CD34 but lacked the expression of CD38, which have been shown to contain the enriched LSCs in AML (van Rhenen et al., 2005). For the FACS analysis, cells were dissociated, antibody-labeled (1-2 g per 10.sup.6 cells1 hour) and resuspended in HBSS/2% FBS as previously described (Hermann et al., 2007; Li et al., 2007). The antibodies used included FITC-CD34, APC-CD38 (both from BD Biosciences) and anti-AMFR (PAS-12051; Thermo Scientific) in conjunction with Alexa Fluor 488-anti-mouse IgG (Invitrogen). Flow cytometry was done using a FACSAria III (BD Biosciences).
[0138] As shown in
Example 5
[0139] This example describes AMFR as a specific marker of mesenchymal-like and invasive CSCs.
[0140] We isolated three subpopulations of cells from pancreatic cancer PANC-1 cells according to the expression of the cell-surface markers CD133 and CD44, which have been shown to contain the enriched CSCs in pancreatic cancer (Wang et al., 2013), and AMFR, including CD133.sup.+CD44.sup.+AMFR.sup.+ cells (representing AMFR-positive CSC s), CD133.sup.+CD44.sup.+AMFR.sup. cells (representing AMFR-negative CSCs), and cells in the other subpopulations (representing non-CSC cancer cells). In brief, PANC-1 cells (American Type Culture Collections) were dissociated, antibody-labeled (1-2 g per 10.sup.6 cells1 hour) and resuspended in HBSS/2% FBS as previously described (Al-Hajj et al., 2003; Li et al., 2007). The antibodies used included PE-anti-CD44, APC-anti-CD133 (Multenyi Biotec) and anti-AMFR (LifeSpan BioSciences) in conjunction with Alexa Fluor 488-anti-mouse IgG (Invitrogen). Cell sorting was performed using FACSAria III cell sorter (BD Biosciences). Of note, the AMFR antibody used recognizes an epitope located between amino acids 4-33 located within the transmembrane domain (amino acids 1-308) of human AMFR, whereby it does not interfere with its ability to bind to AMF, which is mediated through the C-terminal part (amino acids 309-643) of AMFR (Haga et al., 2006).
[0141] Cells in the respective cell subpopulation were collected and analyzed for their transcript levels of a panel of gene markers widely associated with EMT or pleuripotency by quantitative real-time PCR (qRT-PCR), which was performed on the amplified RNA using the LightCycler FastStart DNA MASTERPLUS SYBR Green I Kit (Roche Diagnostics GmbH) and Q-Cycler 96 (Hain Lifescience). Oligonucleotide primers were designed using Primer Bank (http://pga.mgh.harvard.edu/primerbank/index.html). Cells in the respective cell subpopulations collected were also analyzed for their invasive capacities using the modified Boyden chamber assay. Briefly, the freshly sorted cells were seeded on upper wells of 48-well Neuro Probe AP48 chemotaxis chambers (Neuro Probe). The 8-m pore polycarbonate filter was coated with a thin layer of type I collagen (BD Biosciences) with pancreatic stellate cells (PSCs)-conditioned media in the lower wells as chemoattractant. After an incubation period of 12 hours, the uninvaded cells were wiped off the top side of the filter and the invaded cells were fixed, stained with CYTOX-green (Invitrogen) and counted using a fluorescence microscope.
[0142] As shown in
[0143] As shown in
[0144] To functionally validate that AMFR-positive cells are mesenchymal-like and pro-invasive, we compared the invasive capacity of AMFR-positive PANC-1 cells with that in AMFR-negative cells. As shown in
Example 6
[0145] This example describes that AMFR is present on the surface of the invadopodia in mesenchymal-like CSCs.
[0146] Invadopodia are important cellular structure that mediate cancer cell invasion. Specifically, invadopodia are transient actin-based protrusions in invasive cancer cells that mediate focal degradation of extracellular matrix (ECM) by the localized proteolytic activity of proteases (Chen, 1989; Paz et al., 2014). Cancer cells use invadopodia during mesenchymal-type migration to degrade and invade extracellular matrix structures. Interestingly, AMFR has recently been found to stably localize to the lipid raft caveolae and partially colocalize with its constituent protein caveolin-1 (Benlimame et al., 1998). Consistently, caveolin-1 has been reported to serve as a negative regulator of the lipid-raft-dependent uptake of AMFR (Le et al., 2002). Some recent research also suggests that lipid rafts are required for the assembly and function of invadopodia in cancer cells. Consistently, caveolin-1 accumulates at invadopodia and its down-regulation inhibits Invadopodia-mediated ECM degradation (Yamaguchi et al., 2009). Depletion of caveolin-1 disrupts the association of essential components of invadopodia, including Src kinases, 1-integrin and urokinase receptor (uPAR), thereby compromising the migration of cancer cells on ECM (Wei et al., 1999). Taken together these findings, we consider the possibility that AMFR may specifically exist in the caveolae on the membrane of invadopodia in mesenchymal-like CSCs and contribute to their formation and functions, thereby promoting the invasive behaviors of mesenchymal-like CSCs and promoting cancer metastasis. To address this possibility, we isolated three subpopulations of cells from pancreatic cancer PANC-1 cells according to the expression of CD44, CD133 and AMFR, including CD44.sup.+CD133.sup.+AMFR.sup.+ cells (representing AMFR-positive CSCs), CD44.sup.+CD133.sup.+AMFR.sup. cells (representing AMFR-negative CSCs), and cells in the other subpopulations (representing non-CSC cancer cells). To induce invadopodium formation, we plated each of the three subpopulations of cells onto high-density fibrillar collagen (HDFC), which consists of a thin layer of densely packed fibrillar collagen type I compressed by centrifugation (Artym et al., 2015). HDFC can more potentially induce cellular invadopodia formation in a variety of cancer cells compared with gelatin which is used in the standard invadopodia assay. We immuno-stained the cells seeded on HDFC with antibodies against the invadopodium markers F-actin (Alexa Fluor-647 Phalloidin; Invitrogen) and cortactin (Abcam) as well as AMFR (Thermo Scientific) and evaluated the staining patterns using confocal imaging analysis (LSM 5 Pascal Confocal microscopy, Zeiss).
[0147] As shown in
[0148] As shown in
[0149] To further verify that AMFR exists specifically on the invadopodia of CSCs, we isolated the invadopodium proteins using a previously reported cell fractionation protocol in which cells adherent to HDFC were sheared away from the surface of the HDFC matrix, permitting the invadopodia that remained embedded in the HDFC stratum to be subsequently extracted to obtain an enriched invadopodia fraction (Attanasio et al., 2011; Bowden et al., 1999). Using this approach, we were able to fractionate PANC-1 cells that were seeded on HDFC into the invadopodia fraction and the cell body fraction. As shown in
Example 7
[0150] The example describes that AMFR is present in the invadopodia or podosomes of LSCs.
[0151] In Example 4, we demonstrated that AMFR is exclusively expressed by CD34.sup.+CD38.sup. LSCs in AML cells, including THP-1 cells (representing acute monocytic leukemia) and HL-60 cells (representing acute promyeoblastic leukemia). Published studies revealed that podosomes, which are the functional equivalents of invadopodia in normal motile cells, mediate the invasive behaviors of leukocytes such as macrophages, lymphocytes and dendritic cells (Carman et al., 2007; Linder, 2009; Linder et al., 2000; Olivier et al., 2006). Specifically, podosomes mediate the migration and matrix degradation abilities of macrophages (Cougoule et al., 2010) and the ability of lymphocytes to penetrate the endothelium though transcellular diapedesis (Carman et al., 2007). Our findings in Example 6 that AMFR is mainly present in the invadopodia of mesenchymal-like CSCs, together with the similarity between podosomes and invadopodia, raised the possibility that AMFR may also exist on the surface of the podosomes in LSCs and mediate their formation and functions. To address this possibility, we isolated CD34.sup.+CD38.sup. LSCs from THP-1 cells and cells in the other populations (representing non-stem like AML cells). To induce invadopodium formation in the isolated cells, we treated them with phorbal 12-myristate 13-acetate (PMA; 5 nM72 hours) and then seeded them onto high-density fibrillar collagen (HDFC) using the methods described in Example 6. We then immunostained the cells seeded on HDFC with antibodies against the posodome markers F-actin (Alexa Fluor-647 Phalloidin; Invitrogen) and cortactin (Abcam) as well as AMFR (Thermo Scientific) and evaluated the staining patterns using confocal imaging analysis.
[0152] As shown in
Example 8
[0153] The example describes that AMFR contribute to CSC-mediated cancer progression and metastasis.
[0154] In our findings in Example 7, we have provided compelling evidences showing that AMFR is present in the invadopodium of CSCs. A growing body of evidence revealing that invadopodia exist in vivo and may play a critical role for tumor invasion and metastasis (Gligorijevic et al., 2012; Yamaguchi, 2012; Yamaguchi et al., 2005b). Specifically, invadopodia may contribute to cancer cell invasion into the surrounding stroma, intravasation into the vasculature and extravasation (Gligorijevic et al., 2012; Paz et al., 2014). These findings collectively raised the possibility that AMFR may play a critical role in CSC-mediated cancer metastasis and thus designed a series of in vivo studies to address this possibility. To address this possibility, we transduced pancreatic cancer PANC-1 cells with a lentivirus vector encoding a fusion construct of green fluorescence protein and firefly luciferase (FFLuc; UBC-EGFP-T2A-Luc; System Biosciences, CA, USA) and GFP-positive cells were enriched by FACS. We then isolated three subpopulations of cells from the resultant PANC-1-FFLuc cells according to the expression of CD44, CD133 and AMFR, including CD133.sup.+CD44.sup.+AMFR.sup.+ cells (representing AMFR-positive CSCs) and CD133.sup.+CD44.sup.+AMFR.sup. cells (representing AMFR-negative CSCs). The freshly sorted cells (10.sup.4 cells) were then inoculated into the pancreatic tails of 8-week-old NOD/SCID mice and the tumor mass was serially quantified by bioluminescence (BLI; the IVIS Imaging System, Caliper Life Sciences, Waltham, Mass.) according to the manufacturer's recommendations. We then compared the speed and the extent of lymph node and intra-abdominal metastasis following orthotopic cell inoculation among different cell groups.
[0155] As shown in
TABLE-US-00002 SequenceListing <110> Kun-ChihTSAIandPatrickYuminYANG <120> Methodfordetectingandisolatinginvasivecancerstemcells employingcell-surfaceAMFRandtheusethereof <150> US62/355,362 <151> 2016-06-28 <160> 3 <210> 1 <211> 1932 <212> DNA <213> Homosapiens <400> 1 atgccgctgctcttcctcgagcgcttcccctggcccagcctccgcacctacacgggcctc 60 agcggcctggccctgctgggcaccatcatcagcgcctaccgcgcgctcagccagcccgag 120 gccggccccggcgagccggaccagctaacggcctcgctgcagcctgagccgccggcgccc 180 gcccggccgagcgccgggggaccccgggcccgcgatgtggcccagtacctgctctcagac 240 agcctcttcgtgtgggttctagtaaataccgcttgctgtgttttgatgttggtggctaag 300 ctcatccagtgtattgtgtttggccctcttcgagtgagtgagagacagcatctcaaagac 360 aaattttggaattttattttctacaagttcattttcatctttggtgtgctgaatgtccag 420 acagtggaagaggtggtcatgtggtgcctctggtttgccggacttgtctttctgcacctg 480 atggttcagctctgcaaggatcgatttgaatatctttccttctcgcccaccacgccgatg 540 agcagccacggtcgagtcctgtccctgttggttgccatgctgctttcctgctgtggactg 600 gcggccgtctgctccatcaccggctacacccacggaatgcacaccttggctttcatggct 660 gcagagtctcttcttgtgacagtgaggactgctcatgtgattttacgatacgtaattcac 720 ctctgggacctcaaccacgaagggacgtgggaaggaaaggggacgtatgtctattacaca 780 gactttgtcatggagctcactctcctgtccctggacctcatgcaccatattcacatgttg 840 ttatttggcaacatctggttatccatggccagcctggtcatctttatgcagctgcgttac 900 ctgtttcatgaggtgcaacgtcgaattcgtcggcacaagaactatctacgtgtggttgga 960 aacatggaggccaggtttgcagttgcaactccagaggagctggctgtcaacaatgacgac 1020 tgtgccatctgttgggactccatgcaggctgcgcggaaactgccctgtggacatcttttc 1080 cacaactcctgtcttcgttcctggctagaacaagacacctcctgtccaacatgcagaatg 1140 tctcttaatattgccgacaataatcgtgtcagggaagaacatcaaggagagaacttggat 1200 gagaatttggttcctgtagcagcagccgaagggagacctcgcttaaaccaacacaatcac 1260 ttcttccatttcgatgggtctcggattgcgagctggctgccgagtttttcggttgaagtg 1320 atgcacaccaccaacattcttggcattacgcaggccagcaactcccagctcaatgcaatg 1380 gctcatcagattcaagagatgtttccccaggttccataccatctggtactgcaggacctc 1440 cagctgacacgctcagttgaaataacaacagacaatattttagaaggacggattcaagta 1500 ccttttcctacacagcggtcagatagcatcagacctgcattgaacagtcctgtggaaagg 1560 ccaagcagtgaccaggaagagggagaaacttctgctcagaccgagcgtgtgccactggac 1620 ctcagtcctcgcctggaggagacgctggacttcggcgaggtggaagtggagcccagtgag 1680 gtggaagacttcgaggctcgtgggagccgcttctccaagtctgctgatgagagacagcgc 1740 atgctggtgcagcgtaaggacgaactcctccagcaagctcgcaaacgtttcttgaacaaa 1800 agttctgaagatgatgcggcctcagagagcttcctcccctcggaaggtgcgtcctctgac 1860 cccgtgaccctgcgtcgaaggatgctggctgccgccgcggaacggaggcttcagaagcag 1920 cagacctcctag 1932 <210> 2 <211> 924 <212> DNA <213> Homosapiens <400> 2 atgccgctgctcttcctcgagcgcttcccctggcccagcctccgcacctacacgggcctc 60 agcggcctggccctgctgggcaccatcatcagcgcctaccgcgcgctcagccagcccgag 120 gccggccccggcgagccggaccagctaacggcctcgctgcagcctgagccgccggcgccc 180 gcccggccgagcgccgggggaccccgggcccgcgatgtggcccagtacctgctctcagac 240 agcctcttcgtgtgggttctagtaaataccgcttgctgtgttttgatgttggtggctaag 300 ctcatccagtgtattgtgtttggccctcttcgagtgagtgagagacagcatctcaaagac 360 aaattttggaattttattttctacaagttcattttcatctttggtgtgctgaatgtccag 420 acagtggaagaggtggtcatgtggtgcctctggtttgccggacttgtctttctgcacctg 480 atggttcagctctgcaaggatcgatttgaatatctttccttctcgcccaccacgccgatg 540 agcagccacggtcgagtcctgtccctgttggttgccatgctgctttcctgctgtggactg 600 gcggccgtctgctccatcaccggctacacccacggaatgcacaccttggctttcatggct 660 gcagagtctcttcttgtgacagtgaggactgctcatgtgattttacgatacgtaattcac 720 ctctgggacctcaaccacgaagggacgtgggaaggaaaggggacgtatgtctattacaca 780 gactttgtcatggagctcactctcctgtccctggacctcatgcaccatattcacatgttg 840 ttatttggcaacatctggttatccatggccagcctggtcatctttatgcagctgcgttac 900 ctgtttcatgaggtgcaacgtcga 924 <210> 3 <211> 795 <212> DNA <213> Homosapiens <400> 3 atgtctcttaatattgccgacaataatcgtgtcagggaagaacatcaaggagagaacttg 60 gatgagaatttggttcctgtagcagcagccgaagggagacctcgcttaaaccaacacaat 120 cacttcttccatttcgatgggtctcggattgcgagctggctgccgagtttttcggttgaa 180 gtgatgcacaccaccaacattcttggcattacgcaggccagcaactcccagctcaatgca 240 atggctcatcagattcaagagatgtttccccaggttccataccatctggtactgcaggac 300 ctccagctgacacgctcagttgaaataacaacagacaatattttagaaggacggattcaa 360 gtaccttttcctacacagcggtcagatagcatcagacctgcattgaacagtcctgtggaa 420 aggccaagcagtgaccaggaagagggagaaacttctgctcagaccgagcgtgtgccactg 480 gacctcagtcctcgcctggaggagacgctggacttcggcgaggtggaagtggagcccagt 540 gaggtggaagacttcgaggctcgtgggagccgcttctccaagtctgctgatgagagacag 600 cgcatgctggtgcagcgtaaggacgaactcctccagcaagctcgcaaacgtttcttgaac 660 aaaagttctgaagatgatgcggcctcagagagcttcctcccctcggaaggtgcgtcctct 720 gaccccgtgaccctgcgtcgaaggatgctggctgccgccgcggaacggaggcttcagaag 780 cagcagacctcctag 795