Recombinant vector constructed from an encoding gene of a nitrilase mutant, a recombinant genetic engineered strain and application thereof
11525131 · 2022-12-13
Assignee
Inventors
Cpc classification
C12N9/78
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses a recombinant vector constructed from an encoding gene of a nitrilase mutant, a recombinant genetic engineered strain and application thereof the nucleotide sequence of the gene is shown in SEQ ID No. 5, and the amino acid sequence of the mutant is shown in SEQ ID No. 6. In the present invention, by the protein molecular modification, thermostability of the purified nitrilase LNIT5 is increased by up to 4.5 folds; and by utilizing recombinant E. coli containing the nitrilase mutant to hydrolyze 1-cyanocyclohexylacetonitrile at a high temperature (45° C.), product tolerance is increased, activity of NITS-L201F is increased by 20%, and the mutant NITLNIT5-AcN can completely hydrolyze 750 mM 1-cyanocyclohexylacetonitrile within 8 hours and achieve an doubled conversion rate. Therefore, the mutants obtained by the present invention have a good application prospect in efficiently catalyzing 1-cyanocyclohexylacetonitrile to synthesize gabapentin intermediate, 1-cyanocyclohexyl acetic acid.
Claims
1. A recombinant vector constructed from comprising an encoding gene of a nitrilase mutant, wherein the nucleotide sequence of the gene is shown in SEQ ID No:5.
2. The recombinant vector as claimed in claim 1, wherein the amino acid sequence of the mutant is shown in SEQ ID No:6.
3. The recombinant vector as claimed in claim 1, wherein the gene has the nucleotide sequence set forth in SEQ ID No:7.
4. The recombinant vector as claimed in claim 3, wherein the gene is obtained as follows: firstly, designing primers, using PCR amplification to obtain a nucleotide sequence that contains homologous arms and the nucleotide sequence of SEQ ID No:7; then, designing primers, using PCR amplification to obtain a linearized vector sequence containing homologous arms and the nucleotide sequence corresponding to the amino acids at region 1-323 of the nitrilase amino acid sequence set forth in SEQ ID NO:2 derived from an uncultured microorganism; fusing the two nucleotide sequences via homologous recombination to obtain the amino acid sequence of the nitrilase mutant.
5. The recombinant vector as claimed in claim 4, wherein the nucleotide sequence coding the amino acids at positions 324-371 is shown in SEQ ID No:7.
6. The recombinant vector as claimed in claim 4, wherein obtaining the gene further comprises designing primers I-f and I-r, using PCR amplification to obtain a nucleotide sequence that contains homologous arms and the nucleotide sequence of SEQ ID No:7; TABLE-US-00003 primer name primer sequence (5′ to 3′) I-f ACCTGGACGAAGAAGGTCGTCTGGATGTTAACACGCGTTCC I-r TTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGC
7. The recombinant vector as claimed in claim 4, wherein obtaining the gene further comprises designing primers P-f and P-r, using PCR amplification to obtain a linearized vector sequence containing homologous arms and the nucleotide sequence corresponding to amino acids at region 1-323 of the nitrilase amino acid sequence set forth in SEQ ID NO:2; TABLE-US-00004 primer name primer sequence (5′ to 3′) P-f TGAGATCCGGCTGCTAACAAA P-r ACGACCTTCTTCGTCCAGGTAA
8. The recombinant vector as claimed in claim 1, wherein the gene is ligated to an expression vector pET-28b(+) by enzymatic cutting and ligating to construct a recombinant vector pET-28b(+)-LNIT5.
9. A recombinant genetically engineered strain transformed by with the recombinant vector as claimed in claim 1.
10. The recombinant genetically engineered strain as claimed in claim 9, wherein the recombinant genetically engineered strain is obtained by transforming the recombinant vector into a host cell, wherein the host cell is E. coli BL21 (DE3).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
SPECIFIC EMBODIMENT
(8) The present invention is further illustrated below with specific examples, but protection scope of the present invention is not limited to these examples:
Example 1: Acquisition of Nitrilase LNIT5
(9) According to protein NCBI database, BLAST was run by using a nitrilase derived from A. facilis CCTCC NO: M 209044 as a template, and a nitrilase gene (GenBank Accession no: AAR97494.1) was screened from the results. The screened nitrilase is derived from an uncultured microorganism, and 76% similar to the nitrilase derived from A. facilis CTCCC NO: M 209044. According to the amino acid sequence of the screened nitrilase and codons which Escherichia coli prefers, codon optimization was carried out, the amino acid sequence of the nitrilase LNIT5 is shown in SEQ ID No. 2, and the nucleotide sequence encoding the enzyme is shown in SEQ ID No. 1.
Example 2: Construction of Recombinant Expression Vector pET-28b(+)-LNIT5 and the Recombinant Strain
(10) The recombinant expression vector pET-28b(+)-LNIT5 containing the nitrilase LNIT5 gene was synthesized by the total-synthetic method and via conventional operation of genetic engineering. The constructed expression vector pET-28b(+)-LNIT5 was transferred into a receptor strain, E. coli BL21 (DE3), which was then plated on a LB agar plate containing kanamycin (at the final concentration of 50 μg/mL) and cultured overnight at 37° C. The colonies grown on the plate were randomly selected, and the plasmid was extracted and identified by agarose gel electrophoresis to obtain the recombinant strain E. coli BL21 (DE3)/pET-28b(+)-LNIT5.
(11) TABLE-US-00001 TABLE 1 primer design table Primer name Primer sequence (5′ to 3′) L201F-f CCGGACGTTCCGCAGTTTGGCGCAGGTGCGAATG L201F-r CATTCGCACCTGCGCCAAACTGCGGAACGTCCGG I-f ACCTGGACGAAGAAGGTCGTCTGGATGTTAACACGCGT TCC I-r TTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG C P-f TGAGATCCGGCTGCTAACAAA P-r ACGACCTTCTTCGTCCAGGTAA
Example 3: Construction of Nitrilase LNIT5 Mutant
(12) The expression plasmid pET-28b(+)-LNIT5 was used as a template, and the site-directed mutagenesis was carried out by amplification of the whole plasmid. The PCR system (50 μL) was as follows: 0.5-20 ng of the template, 10-15 pmol of each primer (L201F-f and L201F-r, whose sequences is seen in in table 1), 5× PrimeSTAR Buffer (Mg.sup.2+ plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98° C. for 3 min; (2) denaturation at 98° C. for 10 s; (3) anneal at 60° C. for 5 s; (4) extension at 72° C. for 6.5 min, wherein steps (2)˜(4) were cycled 30 times; and (5) finally, extension at 72° C. for 5 min, preservation at 4° C. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, and then introduced into the host strain E. coli BL21 (DE3), which was then plated on a LB plate containing 50 μg/mL kanamycin to obtain monoclones. The selected monoclonal plasmid was extracted, and sequenced and verified by Beijing TSINGKE Biological Technology CO., LTD. to obtain the mutant LNIT5-L201F, whose amino acid sequence was shown in SEQ ID No. 4, and nucleotide sequence was shown in SEQ ID. No. 3.
(13) Using the recombinant expression plasmid pET-28b(+)-AcN containing the nitrilase AcN gene derived from A. facilis CTCCC NO: M 209044 as a template, the nucleotide sequence containing homologous arms and the nucleotide sequence corresponding to the amino acids at the C-terminal region 324-381 of the nitrilase AcN (the amino acid sequence of the amino acids at region 324-381 is shown in SEQ ID No. 8, and the nucleotide sequence is shown in SEQ ID No. 7) was obtained by PCR amplification. The PCR system (50 μL) was as follows: 0.5-20 ng of the template, 10-15 pmol of each of primers I-f and I-r, 5× PrimeSTAR Buffer (Mg.sup.2+ plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98° C. for 3 min; (2) denaturation at 98° C. for 10 s; (3) anneal at 60° C. for 5 s; (4) extension at 72° C. for 10 s, wherein steps (2)˜(4) were cycled 30 times; and (5) finally, extension at 72° C. for 5 min, preservation at 4° C. The obtained PCR product was separated by agarose gel electrophoresis, and about 150 bp DNA fragments were recovered for use.
(14) Using the expression plasmid pET-28b(+)-LNIT5 as a template, a pET-28b(+) linear vector plasmid containing homologous arms and the nucleotide sequence corresponding to amino acids at the N-terminal region 1-323 of the nitrilase LNIT5 was obtained by PCR amplification. The PCR system (50 μL) was as follows: 0.5-20 ng of the template, 10-15 pmol of each of primers P-f and P-r, 5× PrimeSTAR Buffer (Mg.sup.2+ plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98° C. for 3 min; (2) denaturation at 98° C. for 10 s; (3) anneal at 60° C. for 5 s; (4) extension at 72° C. for 6.5 min, wherein steps (2)˜(4) were cycled 30 times; and (5) finally, extension at 72° C. for 5 min, preservation at 4° C. The PCR product was verified by agarose gel electrophoresis, digested with restriction endonuclease DpnI, and the target fragments were obtained by PCR purification kit.
(15) Finally, homologous recombination was achieved using the ClonExpress® II One Step Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing). The expression plasmid containing the fusion protein was introduced into the host strain E. coli BL21 (DE3), which was then plated onto a LB plate containing 50 μg/mL kanamycin to obtain monoclones. The selected monoclonal plasmid was extracted, and sequenced and verified by Beijing TSINGKE Biological Technology CO., LTD. to obtain fusion protein NIT.sub.LNIT5-AcN, whose amino acid sequence was shown in SEQ ID No. 6, and nucleotide sequence was shown in SEQ ID No. 5.
Example 4: Expression of the Wild-Type or the Mutant-Type Nitrilase
(16) The transformants E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN obtained in example 2 and example 3 were respectively inoculated into LB medium, cultured at 37° C. for 10-12 hours, the resulting inocula were respectively inoculated to LB medium containing kanamycin (with the final concentration of 50 mg/L) with 2% incubating volume, amplified and cultured at 37° C. When OD.sub.600 of the culture medium reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added with the final concentration of 0.1 mM, and the bacteria solution was subjected to induced expression at 28° C. for 10 hours. The wet cells were harvested by centrifugation and washed with normal saline twice.
Example 5: Purification of the Wild-Type or the Mutant-Type Nitrilase
(17) (1) 50 mM NaH.sub.2PO.sub.4 buffer (pH 8.0) containing 300 mM NaCl was added to the wet cells obtained in example 4, the cells were resuspended, ultrasonic broken (400 W, 15 min, 1 s breaking, 1 s pause) and followed by centrifugation at 12,000×g for 20 min to remove cell debris. The supernatant was a crude enzyme solution for separation and purification.
(18) (2) After pre-filling the 20 mL Ni-NTA affinity column, equilibration was performed using equilibrium buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) at a flow rate of 2 mL/min.
(19) (3) After the Ni-NTA column was washed with 8-10 column volume, the obtained crude enzyme solution was applied onto the Ni-NTA column at a flow rate of 1 mL/min, and the target protein bound to the column. After loading, a large amount of unbound protein impurities which did not bind to the resin would be directly removed.
(20) (4) The weakly adsorbed protein impurities were eluted with elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 50 mM imidazole, pH 8.0) at a flow rate of 2 mL/min.
(21) (5) The target protein was eluted with protein elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 250 mM imidazole, pH 8.0) at a flow rate of 2 mL/min and collected.
(22) (6) The collected enzyme solution was dialyzed using a dialysis bag (Economical Biotech Membrane, 14 KD, 34 mm Width, purchased from Sangon Biotech (Shanghai) Co., Ltd.) with a sodium chloride aqueous solution with the mass concentration of 0.9% as the dialysate, and the retention was purified nitrilase.
(23) (7) The purified proteins were analyzed by SD S-PAGE.
Example 6: Determination of Activity of the Purified Nitrilases
(24) The activity of the purified nitrilases from example 5 was determined. A reaction system (10 mL) for nitrilase activity assay was as follows: sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (100 mM, pH 7.0), 200 mM 1-cyanocyclohexylacetonitrile, and 75 mg of the purified nitrilase. The reaction solution was preheated at 45° C. for 10 min and then reacted at 150 rpm for 10 min. 500 μL of the supernatant was sampled, and 500 μL of 2 M HCl was added to terminate the reaction, and the conversion rate of 1-cyanocyclohexyl acetic acid was determined by liquid chromatography (Shimadzu LC-16) external standard method. The column is)(Bridge BEH C18 Column (130 Å, 5 μm, 4.6 mm×250 mm, 1/pkg, Waters), and the mobile phase was a buffer (0.58 g/L diammonium phosphate, 1.83 g/L sodium perchlorate, pH was adjusted to 1.8 by perchloric acid) and acetonitrile in a ratio of 76:24 (v/v), the flow rate was 1 mL/min, the ultraviolet detection wavelength was 215 nm, and the column temperature was 40° C. Enzyme activity definition (U): the amount of enzyme required to catalyze the formation of 1 μmol of 1-cyanocyclohexyl acetic acid per minute at 45° C., in pH 7.0, 100 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer was defined as 1 U. The results were shown in
Example 7: Determination of Thermostability of the Wild-Type or the Mutant-Type Nitrilase at 45° C.
(25) The thermostability of the purified nitrilases from example 5 was measured. A certain amount of the purified nitrilase was taken into a 50 mL sterile polypropylene centrifuge tube and stored in a 45° C. constant temperature water bath. The protein was sampled for measurement of activity of the protein at different time intervals according to the method as described in example 6. With the activity of the protein before stored in a 45° C. constant temperature water bath as a control, residual activities of the protein at every time interval were calculated.
(26) As shown in
Example 8: Determination of Activity of Recombinant E. coli Containing the Wild-Type or the Mutant-Type Nitrilase
(27) The nitrilase activities of recombinant E. coli containing the wild-type or the mutant-type nitrilase E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21(DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN obtained in example 4 were measured. A reaction system (10 mL) for nitrilase activity assay was as follows: sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1-cyanocyclohexylacetonitrile with the final concentration of 100 mM, 10 g/L of the E. coli wet cells. The reaction solution was preheated at 45° C. for 10 min and then reacted at 150 rpm for 10 min. 500 μL of the supernatant was sampled, and conversion rate of 1-cyanocyclohexyl acetic acid was measured by liquid chromatography (Shimadzu LC-16) external standard method. The conditions of liquid chromatography were described in example 6, and the results were shown in
Example 9: Determination of Thermostability of Recombinant E. coli Containing the Wild-Type or the Mutant-Type Nitrilase at 45° C.
(28) The resting cells of the recombinant E. coli containing the wild-type or the mutant-type nitrilase, E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21(DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN, obtained in example 4, were respectively suspended in sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) to obtain a 20 g/L bacterial suspension, and stored in a 45° C. constant temperature water bath. The bacterial suspension was sampled for measurement of activity of the resting cells at different time intervals according to the method as described in example 8. With the activity of the resting cells before stored in a 45° C. constant temperature water bath as a control, residual activities of the resting cells at each time interval were calculated, and the results were shown in table 2.
(29) TABLE-US-00002 TABLE 2 Thermostability of E. coli resting cells containing the nitrilase mutants at 45° C. Residual Residual activity after activity after Mutants 14 hours 24 hours E. coli BL21 (DE3)/pET-28b(+)-LNIT5 71.5% 40% E. coli BL21 96.8% 78% (DE3)/pET-28b(+)-LNIT5-L201F E. coli BL21 98.5% 89% (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN E. coli BL21 (DE3) 0 0 E. coli BL21 (DE3)/pET-28b(+) 0 0
Example 10: Hydrolysis of 400 mM 1-Cyanocycloalkaneacetonitrile by Recombinant E. coli Containing the Wild-Type or the Mutant-Type Nitrilase
(30) 0.5 g of wet cells of E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21(DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN, obtained by the method as described in example 4, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) respectively, 0.592 g of 1-cyanocyclohexylacetonitrile was added with the final concentration of 400 mM, and the reaction was carried out in a 45° C. constant temperature water bath. Samples were taken at different times, centrifuged at 12000 rpm, and the precipitates were discarded. The treated reaction solutions were analyzed for profiling the product concentration by high performance liquid chromatography. The HPLC conditions were as described in example 6.
(31) As shown in
Example 11: Hydrolysis of 750 mM 1-Cyanocycloalkaneacetonitrile by Recombinant E. coli Containing the Nitrilase Mutant NIT.SUB.LNIT5-AcN
(32) 0.5 g of the E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN wet cells obtained by the method as described in example 4, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1.11 g of 1-cyanocyclohexylacetonitrilewas added with the final concentration of 0.75 M, and the reaction was carried out in 45° C. constant temperature water bath. Samples were taken at different times, centrifuged at 12000 rpm for 3 min, and the precipitates were discarded. The treated reaction solution was analyzed for profiling the product concentration by high performance liquid chromatography. The HPLC conditions were as described in example 6.
(33) As shown in
Example 12: Hydrolysis of 1.0 M 1-Cyanocycloalkaneacetonitrile by Recombinant E. coli Containing the Nitrilase Mutant NIT.SUB.LNIT5-AcN
(34) 0.5 g of the E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN wet cells obtained by the method as described in example 4, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1.48 g of 1-cyanocyclohexylacetonitrile (at a final concentration of 1.0M) was added, and the reaction was carried out in 45° C. constant temperature water bath. Samples were taken at different times, centrifuged at 12000 rpm for 3 min, and the precipitates were discarded. The treated reaction solution was analyzed for profiling the product concentration by high performance liquid chromatography. The analysis conditions of HPLC were as described in example 6.
(35) As shown in
Example 13: Hydrolysis of 750 mM 1-Cyanocycloalkaneacetonitrile by the Immobilized Cells
(36) 2 g of the E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN wet cells obtained by the method as described in example 4, were suspended in 20 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), diatomite was added into the suspension with the final concentration of 0.006 g/mL, and the mixture was stirred at room temperature for 1 h. Subsequently, polyethyleneimine (added in the form of a 5% (w/w) aqueous solution) was added into the mixture with the final concentration of 3% (v/v), and stirred at room temperature for 1 hour. Finally, glutaraldehyde (added in the form of a 25% (w/w) aqueous solution) was added with the final concentration of 1% (v/v) and the mixture was stirred for 1 hour, and the immobilized cells were obtained by vacuum filtration.
(37) All the immobilized cells obtained above (the amount of the immobilized cells was 100 g/L calculated by resting cells) were suspended in 20 mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer system (200 mM, pH=7.0), 2.22 g of 1-cyanocyclohexylacetonitrile were added with the final concentration of 750 mM, and the reaction was carried out in 45° C. constant temperature water bath for 8 hours per batch. After the completion of each batch of the reaction, vacuum filtration was carried out for the solid-liquid separation, and the resulting reaction solution was analyzed by high performance liquid chromatography for profiling the concentration of the product according to the method described in example 6, and the recovered immobilized cells were applied into the next batch of reaction. As a result, the prepared immobilized cells were reused for 6 batches, and the conversion rate of each batch was more than 99%.