COMPOSITIONS FOR THE TREATMENT OF DISEASE

20190153471 ยท 2019-05-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides compositions and methods for the preparation, manufacture and therapeutic use of viral vectors, such as adeno-associated virus (AAV) particles having viral genomes encoding one or more antibodies or antibody fragments or antibody like polypeptides, for the prevention and/or treatment of diseases and/or disorders.

    Claims

    1. An AAV particle comprising a capsid and a viral genome, said viral genome comprising at least one inverted terminal repeat (ITR) region and a payload region, said payload region comprising a regulatory sequence operably linked to at least a first nucleic acid segment, said first nucleic acid segment encoding one or more polypeptides selected from the group consisting of SEQ ID NO: 2948-17938, and fragments thereof.

    2. The AAV particle of claim 1, wherein the capsid is a serotype selected from the group of consisting of SEQ ID NO: 1-898.

    3. The AAV particle of claim 2, wherein the regulatory sequence comprises a promoter.

    4. The AAV particle of claim 3, wherein the promoter is selected from the group consisting of human elongation factor 1-subunit (EF1), cytomegalovirus (CMV) immediate-early enhancer and/or promoter, chicken -actin (CBA) and its derivative CAG, glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.

    5. The AAV particle of claim 1, wherein the viral genome is single stranded.

    6. The AAV particle of claim 1, wherein the viral genome is self-complementary.

    7. The AAV particle of claim 1, wherein at least one region of the viral genome is codon-optimized.

    8. The AAV particle of claim 7, wherein the first nucleic acid segment is codon-optimized.

    9. The AAV particle of any of claims 1-8, wherein the first nucleic acid segment encodes one or more polypeptides selected from the group consisting of an antibody heavy chain, an antibody light chain, a linker, and combinations thereof.

    10. The AAV particle of claim 9, wherein any of the polypeptides encoded by first nucleic acid segment of the payload region is humanized.

    11. The AAV particle of claim 9, wherein the linker is selected from one or more of the members of the group given in Table 2.

    12. The AAV particle of claim 9, wherein the first nucleic acid segment encodes from 5 to 3, an antibody heavy chain, a linker, and an antibody light chain.

    13. The AAV particle of claim 9, wherein the first nucleic acid segment encodes from 5 to 3, an antibody light chain, a linker, and an antibody heavy chain.

    14. The AAV particle of claim 9, wherein the first nucleic acid segment encodes one or more antibody heavy chains.

    15. The AAV particle of claim 14, wherein the first nucleic acid segment encodes one or more antibody heavy chains selected from SEQ ID NO: 2948-17938, and fragments thereof.

    16. The AAV particle of claim 9, wherein the first nucleic acid segment encodes one or more antibody light chains.

    17. The AAV particle of claim 16, wherein the first nucleic acid segment encodes one or more antibody light chains selected from SEQ ID NO:2948-17938, and fragments thereof.

    18. The AAV particle of claim 9, wherein the first nucleic acid segment encodes one or more antibody heavy chains and one or more antibody light chains and, optionally one or more linkers.

    19. The AAV particle of any of claims 9-18, wherein said linker is selected from the group consisting of Table 2 and combinations thereof.

    20. The AAV particle of claim 1, wherein the first nucleic acid segment encodes an antibody, having at least 95% identity to any of the sequences selected from the group consisting of SEQ ID NO: 2948-17938.

    21. An AAV particle comprising a capsid and a viral genome, said viral genome comprising at least one inverted terminal repeat (ITR) region and a payload region comprising a regulatory sequence operably linked to at least a first nucleic acid segment, said first nucleic acid segment encoding a bispecific antibody derived from SEQ ID NO: 2948-17938 or portions or fragments thereof.

    22. The AAV particle of claim 21, wherein the bispecific antibody comprises a light and a heavy chain selected from two different starting antibodies selected from the group consisting of SEQ ID NO: 2948-17938.

    23. A method of producing a functional antibody in a subject in need thereof, comprising administering to said subject the AAV particle of any of claims 1-22.

    24. The method of claim 23, wherein the level or amount of the functional antibody in the target cell or tissue after administration to the subject is from about 0.001 ug/mL to 100 mg/mL.

    25. The method of claim 23, wherein the functional antibody is encoded by a single first nucleic acid segment of a viral genome within said AAV particle.

    26. The method of claim 23, wherein the functional antibody is encoded by two different viral genomes, said two different viral genomes packaged in separate capsids.

    27. A pharmaceutical composition comprising an AAV particle of any of the preceding claims in a pharmaceutically acceptable excipient.

    28. The pharmaceutical composition of claim 27, wherein the pharmaceutically acceptable excipient is saline.

    29. The pharmaceutical composition of claim 27, wherein the pharmaceutically acceptable excipient is 0.001% plutonic in saline.

    30. A method of expressing an antibody in a cell or tissue comprising administering the AAV particle of any of claims 1-29 via a delivery route selected from the group consisting of enteral (into the intestine), gastroenteral, epidural (into the dura mater), oral (by way of the mouth), transdermal, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intra-arterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraparenchymal (into brain tissue), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), or in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-articular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracoronal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), in traluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intramyocardial (within the myocardium), intraocular (within the eve), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratumor (within a tumor), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration which is then covered by a dressing which occludes the area), ophthalmic (to the external eve), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis and spinal.

    31. The method of claim 30, wherein the delivery route is intramuscular.

    32. The method of claim 31, wherein the intramuscular administration is to at least one limb.

    33. The method of claim 30, wherein the delivery route is intravascular.

    34. The method of claim 30, wherein the delivery route is intrathecal.

    35. The method of claim 30, wherein the delivery route is intracerebroventricular.

    36. The method of claim 30, wherein the delivery route is intraparenchymal.

    37. The method of claim 30, wherein the AAV particle is encapsulated in a nanoparticle.

    38. The method of claim 30, wherein the AAV particle is delivered by a device.

    39. The method of claim 38, wherein the device is a gene gun.

    40. A method of preventing a disease or disorder in a subject comprising administering to said subject the pharmaceutical composition of any of claims 27-29.

    41. The method of claim 40, wherein the administration is at a prophylactically effective dose.

    42. The method of claim 41, wherein the dose is from about 1 ug/mL to about 500 ug/mL of expressed polypeptide or 110e4 to 110e16 VG/mL from the pharmaceutical composition.

    43. The method of claim 42, wherein the pharmaceutical composition is administered once.

    44. The method of claim 42, wherein the pharmaceutical composition is administered more than once.

    45. The method of claim 42, wherein the pharmaceutical composition is administered daily, weekly, monthly or yearly.

    46. The method of claim 42, wherein the pharmaceutical composition is co-administered as part of a combination therapy.

    47. A method of treating a disease or disorder in a subject in need thereof comprising administering to said subject the pharmaceutical composition of any of claims 27-29.

    48. The method of claim 47, wherein said disease or disorder is selected from the group consisting of Parkinson's Disease, Dementia with Lewy Bodies, multiple system atrophy, decreased muscle mass, decreased muscle strength, decreased muscle function, spinal muscular atrophy, Alzheimer's Disease, Huntington's Disease, multiple sclerosis, amyotrophic lateral sclerosis, stroke, migraine, pain, neuropathies, psychiatric disorders, cancer, ocular diseases, systemic diseases of the blood, systemic diseases of the heart, systemic diseases of the bone, immune system, autoimmune disease, inflammation disorders and inflammation.

    49. The AAV particle of claim 1, wherein the viral genome comprises 2 ITR regions.

    50. The AAV particle of claim 1, wherein the at least one ITR region is derived from the same parental serotype as the capsid.

    51. The AAV particle of claim 1, wherein the at least one ITR region is derived from a different serotype as the capsid.

    52. The AAV particle of claim 1, wherein the at least one ITR region is derived from AAV 2.

    53. The AAV particle of claim 1, wherein the at least one ITR region is 100-150 nucleotides in length.

    54. The AAV particle of claim 1, wherein the at least one FIR region is 102 nucleotides in length.

    55. The AAV particle of claim 1, wherein the at least one ITR region is 140-142 nucleotides in length.

    56. The AAV particle of claim 1, wherein the at east one ITR region is 140 nucleotides in length.

    57. The AAV particle of claim 1, wherein the at least one ITR region is 141 nucleotides in length.

    58. The AAV particle of claim 1, wherein the at least one ITR region is 142 nucleotides in length.

    59. The AAV particle of claim 1, wherein the viral genome further comprises an intron or stuffer sequence.

    60. A method of producing an antibody in a subject comprising administering the AAV particle of claim 1 to said subject, with the proviso that the antibody is not a virus neutralizing antibody.

    61. A method of producing an antibody in a subject comprising administering the AAV particle of claim 1 to said subject, with the proviso that the antibody is not an HIV or HCV virus neutralizing antibody.

    62. The AAV particle of claim 1, wherein the payload region of the viral genome comprises a second nucleic acid segment, said second nucleic acid segment encoding an aptamer, siRNA, saRNA, ribozyme, microRNA, mRNA or combination thereof.

    63. The AAV particle of claim 62, wherein the second nucleic acid segment encodes an siRNA and said siRNA is designed to target the mRNA that encodes the target of the antibody encoded by the first nucleic acid segment.

    64. The AAV particle of claim 62, wherein the second nucleic acid segment encodes a microRNA and said microRNA is selected to target the mRNA that encodes the target of the antibody encoded by the first nucleic acid segment.

    65. The AAV particle of claim 62, wherein the second nucleic acid segment encodes an mRNA and said mRNA encodes one or more peptides inhibitors of the same target of the antibody encoded by the first nucleic acid segment.

    66. The AAV particle of claim 1 or 62, wherein the payload region of the viral genome comprises a third nucleic acid segment.

    67. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a nuclear export signal.

    68. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a polynucleotide or polypeptide which acts as a regulator of expression of the viral genome in which it is encoded.

    69. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a polynucleotide or polypeptide which acts as a regulator of expression of the payload region of the viral genome in which it is encoded.

    70. The AAV particle of claim 66, wherein the third nucleic acid segment encodes a polynucleotide or polypeptide which acts as a regulator of expression of the first nucleic acid segment of the payload region of the viral genome in which it is encoded.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0034] The foregoing and other objects, features and advantages will be apparent from the following description of particular embodiments of the invention, as illustrated in the accompanying drawings. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the invention.

    [0035] FIG. 1 is a schematic of vectored antibody delivery.

    [0036] FIG. 2 is a schematic of a viral genome of the invention.

    [0037] FIG. 3 is a schematic of payload regions. FIG. 3 discloses 5xG4S as SEQ ID NO: 17939)

    DETAILED DESCRIPTION OF THE INVENTION

    I. COMPOSITIONS OF THE INVENTION

    [0038] According to the present invention, compositions for delivering functional antibodies and/or antibody-based compositions by adeno-associated viruses (AAVs) are provided. AAV particles of the invention may be provided via any of several routes of administration, to a cell, tissue, organ, or organism, in vivo, ex vivo or in vitro.

    [0039] As used herein, an AAV particle is a virus which comprises a viral genome with at least one payload region and at least one inverted terminal repeat (ITR) region.

    [0040] As used herein, viral genome or vector genome refers to the nucleic acid sequence(s) encapsulated in an AAV particle. Viral genomes comprise at least one payload. region encoding polypeptides of the invention, antibodies, antibody-based compositions or fragments thereof.

    [0041] As used herein, a payload or payload region is any nucleic acid molecule which encodes one or more polypeptides of the invention. At a minimum, a payload region comprises nucleic acid sequences that encode an antibody, an antibody-based composition, or a fragment thereof, but may also optionally comprise one or more functional or regulatory elements to facilitate transcriptional expression and/or polypeptide translation.

    [0042] The nucleic acid sequences and polypeptides disclosed herein may be engineered to contain modular elements and/or sequence motifs assembled to enable expression of the antibodies or antibody-based compositions of the invention. In some embodiments, the nucleic acid sequence comprising the payload region may comprise one or more of a promoter region, an intron, a Kozak sequence, an enhancer or a polyadenylation sequence. Payload regions of the invention typically encode antibodies or antibody based compositions, which may include an antibody heavy chain domain, an antibody light chain domain, both antibody heavy and light chain domains, or fragments of the foregoing in combination with each other or in combination with other polypeptide moieties. In some cases, payload regions may also encode one or more linkers or joining regions between antibody heavy and light chain domains or fragments. The order of expression, structural position, or concatamer count (heavy chain, light chain, or linker) may be different within or among different payload regions. The identity, position and number of linkers expressed by payload regions may also vary.

    [0043] The payload regions of the invention may be delivered to one or more target cells, tissues, organs or organisms within the viral genome of an AAV particle.

    Adeno-Associated Viruses (AAVs) and AAV Particles

    [0044] Viruses of the Parvoviridae family are small non-enveloped icosahedral capsid viruses characterized by a single stranded DNA genome. Parvoviridae family viruses consist of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Due to its relatively simple structure, easily manipulated using standard molecular biology techniques, this virus family is useful as a biological tool. The genome of the virus may be modified to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to express or deliver a desired payload, which may be delivered to a target cell, tissue, organ, or organism.

    [0045] The parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, Parvoviridae: The Viruses and Their Replication, Chapter 69 in FIELDS VIROLOGY (3d Ed. 19963, the contents of which are incorporated by reference in their entirety.

    [0046] The Parvoviridae family comprises the Dependovirus genus which includes adeno-associated viruses (AAV) capable of replication in vertebrate hosts including, but not limited to, human primate, bovine, canine, equine, and ovine species.

    [0047] The AAV vector genonie is a linear, single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) in length. The AAV viral genome can comprise a payload region and at least one inverted terminal repeat (ITR) or ITR region. ITRs traditionally flank the coding nucleotide sequences for the non-structural proteins (encoded by Rep genes) and the structural proteins (encoded by capsid genes or Cap genes). While not wishing to be bound by theory, an AAV viral genome typically comprises two ITR sequences. The AAV vector genome comprises a characteristic T-shaped hairpin structure defined by the self-complementary terminal 145 nt of the 5 and 3 ends of the ssDNA which form an energetically stable double stranded region. The double stranded hairpin structures comprise multiple functions including, but not limited to, acting as an origin for DNA replication by functioning as primers for the endogenous DNA polymerase complex of the host viral replication cell.

    [0048] In addition to the encoded heterologous payload, AAV vectors may comprise the viral genome, in whole or in part, of any naturally occurring and/or recombinant AAV serotype nucleotide sequence or variant. AAV variants may have sequences of significant homology at the nucleic acid (genome or capsid) and amino acid levels (capsids), to produce constructs which are generally physical and functional equivalents, replicate by similar mechanisms, and assemble by similar mechanisms. Chiorini et al., J. Vir. 71: 6823433(1997); Srivastava et al., J. Vir. 45:555-64 (1983); Chiorini et al. J. Vir. 73:13094319 (1999); Rutledge et al., J. Vir. 72:309-319 (1998); and Wu et al., J. Vir. 74: 863547 (2000), the contents of each of which are incorporated herein by reference in their entirety.

    [0049] In one embodiment, AAV particles of the present invention are recombinant AAV viral vectors which are replication defective, lacking sequences encoding functional Rep and Cap proteins within their viral genome. These defective AAV vectors may lack most or all parental coding sequences and essentially carry only one or two AAV ITR sequences and the nucleic acid of interest for delivery to a cell, a tissue, an organ or an organism.

    [0050] In one embodiment, the viral genonie of the AAV particles of the present invention comprise at least one control element which provides for the replication, transcription and translation of a coding sequence encoded therein. Not all of the control elements need always be present as long as the coding sequence is capable of being replicated, transcribed and/or translated in an appropriate host cell. Non-limiting examples of expression control elements include sequences for transcription initiation and/or termination, promoter and/or enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficacy (e.g., Kozak consensus sequence), sequences that enhance protein stability, and/or sequences that enhance protein processing and/or secretion.

    [0051] According to the present invention, AAV particles for use in therapeutics and/or diagnostics comprise a virus that has been distilled or reduced to the minimum components necessary for transduction of a nucleic acid payload or cargo of interest. In this manner, AAV particles are engineered as vehicles for specific delivery while lacking the deleterious replication and/or integration features found in wild-type viruses.

    [0052] AAV vectors of the present invention may be produced recombinantly and may be based on adeno-associated virus (AAV) parent or reference sequences. As used herein, a vector is any molecule or moiety which transports, transduces or otherwise acts as a carrier of a heterologous molecule such as the nucleic acids described herein.

    [0053] In addition to single stranded AAV viral genomes (e.g., ssAAVs), the present invention also provides for self-complementary AAV (scAAVs) viral genomes. scAAV vector genomes contain DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.

    [0054] In one embodiment, the AAV particle of the present invention is an scAAV.

    [0055] In one embodiment, the AAV particle of the present invention is an ssAAV.

    [0056] Methods for producing and/or modifying AAV particles are disclosed in the art such as pseudotyped AAV vectors (PCT Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO 2005005610 and WO 2005072364, the content of each of which is incorporated herein by reference in its entirety).

    [0057] AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles can be packaged efficiently and be used to successfully infect the target cells at high frequency and with minimal toxicity. In some embodiments, the capsids of the AAV particles are engineered according to the methods described in US Publication Number US 20130195801, the contents of which are incorporated herein by reference in their entirety.

    [0058] In one embodiment, the AAV particles comprising a payload region encoding the polypeptides of the invention may be introduced into mammalian cells.

    AAV Serotypes

    [0059] AAV particles of the present invention comprise or be derived from any natural or recombinant AAV serotype. According to the present invention, the AAV particles may utilize or be based on a serotype selected from any of the following AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.4.5, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV 12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV 42.15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7/rh.48, AAV1-8/rh.49, AAV2-15/rh.62, AAV2-3/rh.61, AAV2-4/rh.50, AAV2-5/rh.51, AAV3.1/hu.6, AAV3.1/hu.9, AAV3-9/rh.52, AAV3-11/rh.53, AAV4-8/r11.64, AAV4-9/rh.54, AAV4-19/rh.55, AAV5-3/rh.57, AAV5-22/rh.58, AAV7.3/hu.7, AAV16.8/hu.10, AAV16.12/hu.11, AAV29.3/bb.1, AAV29.5/bb.2, AAV106.1/hu.37, AAV114.3/hu.40, AAV127.2/hu.41, AAV127.5/hu.42, AAV128.3/hu.44, AAV130.4/hu.48, AAV145.1/hu.53, AAV145.5/hu.54, AAV145.6/hu.55, AAV161.10/hu.60, AAV161.6/hu.61, AAV33.12/hu.17, AAV33.4/hu.15, AAV33.8/hu.16, AAV52/hu.19, AAV52.1./hu.20, AAV58.2/hu.25, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70, AAVpi.1, AAVpi.3, AAVpi.2, AAVrh.60, AAVrh.44, AAVrh.65, AAVrh.55, AAVrh.47, AAVrh.69, AAVrh.45, AAVrh.59, AAVhu.12, AAVH6, AAVLK03, AAVH-1/hu.1, AAVH-5/hu.3, AAVLG-10/rh.40, AAVLG-4/rh.38, AAVLG-9/hu.39, AAVN721-8/rh.43, AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AANCy.5R3, AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu. 2, AAVhu.3, AAVhu.4, AAVhu.5, AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu. 20, AAVhu. 21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AM/hu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2. AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.52AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, .AAVhu.63, AAVhu.64, AAVhu 66, AAVhu.67, AAVhu.14/9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32 , AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AACrh.48.1, AAVrh.48.1.2, AAVrh.48., 2AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVM.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R, R533A mutant, AAAV, BAAV, caprine AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV 8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 108, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8/rh.64, AAVLG-9/hu.39, AAV54.5/hu.23, AAV54.2/hu.22, AAV54.7/hu.24, AAV54.1/hu.21, AAV54.4R/hu.27, AAV46.2/hu.28, AAV46.6/hu.29, AAV128.1/hu.43, true type AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotypes, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1,AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3,AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLb-D1, AAV CLv-D2,AAV CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8,AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1/HSC1, AAVF11/HSC11, AAVF12/HSC12, AAVF13/HSC13, AAVF14/HSC14, AAVF15/HSC15, AAVF16/HSC16, AAVF17/HSC17, AAVF2/HSC2, AAVF3/HSC3, AAVF4/HSC4, AAVF5/HSC5, AAVF6/HSC6, AAVF7/HSC7, AAVF8/HSC8, AAVF9/HSC9, PHP.B, PHP.A, G2B-26, G2B-13, TH1.1-32 and/or TH1.1.-35 and variants thereof.

    [0060] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20030138772, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV1 (SEQ ID NO: 6 and 64 of US20030138772) AAV2 (SEQ ID NO: 7 and 70 of US20030138772), AAV3 (SEQ ID NO: 8 and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NO: 1-3 of US20030138772), AAV8 (SEQ ID NO: 4 and 95 of US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772) AAV11 (SEQ ID NO: 118 of US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772), AAV16.3 (US20030138772 SEQ ID NO: 10), AAV29.3/bb.1 (US20030138772 SEQ ID NO: 11), AAV29.4 (US20030138772 SEQ ID NO: 12), AAV29.5/bb.2 (US20030138772 SEQ ID NO: 13), AAV1.3 (US20030138772 SEQ ID NO: 14), AAV13.3 (US20030138772 SEQ ID NO: 15), AAV24.1 (US20030138772 SEQ ID NO: 16), AAV27.3 (US20030138772 SEQ ID NO: 17), AAV7.2 (US20030138772 SEQ ID NO: 18), AAVC1 (US20030138772 SEQ ID NO: 19), AAVC3 (US20030138772 SEQ ID NO: 20), AAVC5 (US20030138772 SEQ ID NO: 21), AAVF1 (US20030138772 SEQ ID NO: 22), AAVF3 (US20030138772 SEQ ID NO. 23), AAVF5 (US20030138772 SEQ ID NO: 24). AAVH6 (US20030138772 SEQ ID NO: 25), AAVH2 (US20030138772 SEQ ID NO: 26), AAV42-8 (US20030138772 SEQ ID NO: 27), AAV42-15 (US20030138772 SEQ ID NO: 28), AAV42-5b (US20030138772 SEQ ID NO: 29), AAV42-1b (US20030138772 SEQ ID NO: 30), AAV42-13 (US20030138772 SEQ ID NO: 31), AAV42-3a (US20030138772 SEQ ID NO: 32), AAV42-4 (US20030138772 SEQ ID NO: 33), AAV42-5a (US20030138772 SEQ ID NO: 34), AAV42-10 (US20030138772 SEQ ID NO: 35), AAV42-3b (US20030138772 SEQ ID NO: 36), AAV42-11 (US20030138772 SEQ ID NO: 37), AAV42-6b (US20030138772 SEQ ID NO: 38), AAV43-1 (US20030138772 SEQ ID NO: 39), AAV43-5 (US20030138772 SEQ ID NO: 40), AAV43-12 (US20030138772 SEQ ID NO: 41), AAV43-20 (US20030138772 SEQ ID NO: 42), AAV43-21 (US20030138772 SEQ ID NO: 43), AAV43-23 (US20030138772 SEQ ID NO: 44), AAV43-25 (US20030138772 SEQ ID NO: 45), AAV44.1 (US20030138772 SEQ ID NO: 46), AAV44.5 (US20030138772 SEQ ID NO: 47), AAV223.1 (US20030138772 SEQ ID NO: 48), AAV223.2 (US20030138772 SEQ ID NO: 49), AAV223.4 (US20030138772 SEQ ID NO: 50), AAV223.5 (US20030138772 SEQ ID NO: 51), AAV223.6 (US20030138772 SEQ ID NO: 52), AAV223.7 (US20030138772 SEQ ID NO: 53), AAVA3.4 (US20030138772 SEQ ID NO: 54), AAVA3.5 (US20030138772 SEQ ID NO: 55), AAVA3.7 (US20030138772 SEQ ID NO: 56), AAVA3.3 (US20030138772 SEQ ID NO: 57), AAV42.12 (US20030138772 SEQ ID NO: 58), AAV44.2 (US20030138772 SEQ ID NO: 59), AAV42-2 (US20030138772 SEQ ID NO: 9), or variants thereof.

    [0061] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20150159173, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV2 (SEQ ID NO: 7 and 23 of US20150159173), rh20 (SEQ ID NO: 1 of US20150159173), rh32/33 (SEQ ID NO: 2 of US20150159173), rh39 (SEQ ID NO: 3, 20 and 36 of US20150159173), rh46 (SEQ ID NO: 4 and 22 of US20150159173), rh73 (SEQ ID NO: 5 of US20150159173), rh74 (SEQ ID NO: 6 of US20150159173), AAV6.1 (SEQ ID NO: 29 of US20150159173), rh.8 (SEQ ID NO: 41 of US20150159173), rh.48.1 (SEQ ID NO: 44 of US20150159173), hu.44 (SEQ ID NO: 45 of US20150159173), hu.29 (SEQ ID NO: 42 of US20150159173), hu.48 (SEQ ID NO: 38 of US20150159173), rh54 (SEQ ID NO: 49 of US20150159173), AAV2 (SEQ ID NO: 7 of US20150159173), cy.5 (SEQ ID NO: 8 and 24 of US20150159173), rh.10 (SEQ ID NO: 9 and 25 of US20150159173), rh.13 (SEQ ID NO: 10 and 26 of US20150159173), AAV1 (SEQ ID NO: 11 and 27 of US20150159173), AAV3 (SEQ ID NO: 12 and 28 of US20150159173), AAV6 (SEQ ID NO: 13 and 29 of US20150159173), AAV7 (SEQ IT) NO: 14 and 30 of US20150159173), AAV8 (SEQ ID NO: 15 and 31 of US20150159173), hu.13 (SEQ ID NO: 16 and 32 of US20150159173), hu.26 (SEQ ID NO: 17 and 33 of US20150159173), hu.37 (SEQ ID NO: 18 and 34 of US20150159173), hu.53 (SEQ ID NO: 19 and 35 of US20150159173), rh.43 (SEQ ID NO: 21 and 37 of US20150159173), rh2 (SEQ ID NO: 39 of US20150159173), rh.37 (SEQ FD NO: 40 of US20150159173) rh.64 (SEQ ID NO: 43 of US20150159173) rh.48 (SEQ ID NO: 44 of US20150159173), ch.5 (SEES ID NO 46 of US20150159173), rh.67 (SEQ ID NO: 47 of US20150159173), rh.58 (SEQ ID NO: 48 of US20150159173), or variants thereof including, but not limited to Cy5R1, Cy5R2, Cy5R3, Cv5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rh.48.1, rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1, rh64R1, rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2, and hu.48R3.

    [0062] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 7,198,951, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 1-3 of U.S. Pat. No. 7,198,951), AAV2 (SEQ ID NO: 4 of U.S. Pat. No. 7,198,951), AAV1 (SEQ ID NO: 5 of U.S. Pat. No. 7,198,951), AAV3 (SEQ ID NO: 6 of U.S. Pat. No. 7,198,951), and AAV8 (SEQ ID NO: 7 of U.S. Pat. No. 7,198,951.).

    [0063] In some embodiments, the AAV serotype may be, or have, a mutation in the AAV9 sequence as described by N Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011), herein incorporated by reference in its entirety), such as hut not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

    [0064] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 6,156,303, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303), AAV6 (SEQ ID NO: 2, 7 and 11 of U.S. 6,156,303), AAV2 (SEQ ID NO: 3 and 8 of U.S. Pat. No. 6,156,303). AAV3A (SEQ ID NO: 4 and 9, of U.S. Pat. No. 6,156,303), or derivatives thereof.

    [0065] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20140359799, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV8 (SEQ ID NO: 1 of US20140359799), AAVDJ (SEQ ID NO: 2 and 3 of US20140359799), or variants thereof.

    [0066] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008), herein incorporated by reference in its entirety). The amino acid sequence of AAVDJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in U.S. Pat. No. 7,588,772, the contents of which are herein incorporated by reference in their entirety, may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gin) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, may comprise three mutations: (1) K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gin) and (3) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (1; Thr).

    [0067] In some embodiments, the AAV serotype may be, or have, a sequence of AAV4 as described in International. Publication No. WO199801.1244, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV4 (SEQ D NO: 1-20 of WO1998011244).

    [0068] In some embodiments, the AAV serotype may be, or have, a mutation in the AAV2 sequence to generate AAV2G9 as described in international Publication No. WO2014144229 and herein incorporated by reference in its entirety.

    [0069] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2005033321, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV3-3 (SEQ ID NO: 217 of WO2005033321), AAV1 (SEQ ID NO: 219 and 202 of WO2005033321), AAV106.1/hu.37 (SEQ ID No: 10 of WO2005033321), AAV114.3/hu.40 (SEQ ID No: 11 of WO2005033321), AAV127.2/hu.41. (SEQ ID NO:6 and 8 of WO2005033321), AAV128.3/hu.44 (SEQ ID No: 81 of WO2005033321), AAV130.4/hu.48 (SEQ ID NO: 78 of WO2005033321), AAV145.1/hu.53 (SEQ ID No: 176 and 177 of WO2005033321), AAV145.6/hu.56 (SEQ ID NO: 168 and 192 of WO2005033321), AAV16.12/hu.11 (SEQ ID NO: 153 and 57 of WO2005033321), AAV16.8/hu.10 (SEQ ID NO: 156 and 56 of WO2005033321) AAV161.10/hu.60 (SEQ ID No: 170 of WO2005033321), AAV161.61/hu.61 (SEQ ID No: 174 of WO2005033321), AAV1-7/rh.48 (SEC) ID NO: 32 of WO2005033321), AAV1-8/rh.49 (SEQ ID NOs: 103 and 25 of WO2005033321), AAV2 (SEQ ID NO: 211 and 221 of WO2005033321), AAV2-15/rh.62 (SEQ ID No: 33 and 114 of WO2005033321), AAV2-3/rh.61 (SEQ ID NO: 21 of WO2005033321), AAV2-rh.50 (SEQ ID No: 23 and 108 of WO2005033321), AAV 2-5/rh.51 (SEQ ID NO: 104 and 22 of WO2005033321) AAV3.1/hu.6 (SEQ ID NO: 5 and 84 of WO2005033321), AAV3.1/hu.9 (SEQ ID NO: 155 and 58 of WO2005033321), AAV3-11/rh.53 (SEQ ID NO: 186 and 176 of WO2005033321), AAV3-3 (SEQ ID NO: 200 of WO2005033321), AAV33.12/hu.17 (SEQ ID NO:4 of WO2005033321), AAV33.4/hu.15 (SEQ ID No: 50 of WO2005033321), AAV33.8/hu.16 (SEQ ID No: 51 of WO2005033321), AAV3-9/rh.52 (SEQ ID NO: 96 and 18 of WO2005033321), AAV4-19/rh.55 (SEQ ID NO: 117 of WO2005033321), AAV4-4 (SEQ ID NO: 201 and 218 of WO2005033321), AAV4-9/rh.54 (SEQ ID NO: 116 of WO2005033321), AAV5 (SEQ ID NO: 199 and 216 of WO2005033321), AAV52.1/hu.20 (SEQ ID NO: 63 of WO2005033321), AAV52/hu.19 (SEQ ID NO: 133 of WO2005033321), AAV5-22/rh.58 (SEQ ID No: 27 of WO2005031321), AAV5-3/rh.57 (SEQ ID NO: 105 of WO2005033321), AAV5-3/rh.57 (SEQ ID No: 26 of WO2005033321), AAV58.2/hu.25 (SEQ ID No: 49 of WO2005033321), AAV6 (SEQ ID NO: 203 and 220 of WO2005033321), AAV7 (SEQ ID NO: 222 and 213 of WO2005033321), AAV7.3/hu.7 (SEQ ID No: 55 of WO2005033321), AAV8 (SEQ ID NO: 223 and 214 of WO2005033321), AAVH-1/hu.1 (SEQ ID No: 46 of WO2005033321), AAVH-5/hu.3 (SEQ ID No: 44 of WO2005033321), AAVhu.1 (SEQ ID NO: 144 of WO2005033321), AAVhu.10 (SEQ ID NO: 156 of WO2005033321), AAVhu.11 (SEQ ID NO: 153 of WO2005033321), AAVhu.12 (WO2005033321 SEQ ID NO: 59), AAVhu.13 (SEQ ID NO: 129 of WO2005033321), AAVhu.14/AAV9 (SEQ ID NO: 123 and 3 of WO2005033321), AAVhu.15 (SEQ ID NO: 147 of WO2005033321), AAVhu:16 (SEQ ID NO: 148 of WO2005033321), AAVhu.17 (SEQ ID NO: 83 of WO2005033321), AAVhu.18 (SEQ ID NO: 149 of WO2005033321), AAVhu.19 (SEQ ID NO: 133 of WO2005033321), AAVhu.2 (SEQ ID NO: 143 of WO2005033321), AAVhu.20 (SEQ ID NO: 134 of WO2005033321), AAVhu.21 (SEQ ID NO: 135 of WO2005033321), AAVhu.22 (SEQ ID NO: 138 of WO2005033321), AAVhu.23.2 (SEQ ID NO: 137 of WO2005033321), AAVhu.24 (SEQ ID NO: 136 of WO2005033321), AAVhu.25 (SEQ ID NO: 146 of WO2005033321), AAVhu.27 (SEQ ID NO: 140 of WO2005033321), AAVhu.29 (SEQ ID NO: 132 of WO2005033321), AAVhu.3 (SEQ ID NO: 145 of WO2005033321), AAVhu.31 (SEQ ID NO: 121 of WO2005033321), AAVhu.32 (SEQ ID NO: 122 of WO2005033321), AAVhu.34 (SEQ ID NO: 125 of WO2005033321), (SEQ ID NO: 164 of WO2005033321), AAVhu.37 (SEQ ID NO: 88 of WO2005033321), AAVhu.39 (SEQ ID NO: 102 of WO2005033321), AAVhu.4 (SEQ ID NO: 141 of WO2005033321), AAVhu.40 (SEQ ID NO: 87 of WO2005033321), AAVhu.41. (SEQ ID NO: 91 of WO2005033321), AAVhu.42 (SEQ ID NO: 85 of WO2005033321), AAVhu.43 (SEQ ID NO: 160 of WO2005033321), AAVhu.44 (SEQ ID NO: 144 of WO2005033321), AAVhu.43 (SEQ ID NO: 127 of WO2005033321), AAVhu.46 (SEQ ID NO: 159 of WO2005033321), AAVhu.47 (SEQ ID NO: 128 of WO2005033321), AAVhu.48 (SEQ ID NO: 137 of WO2005033321), AAVhu.49 (SEQ ID NO: 189 of WO2005033321), AAVhu.51 (SEQ ID NO: 190 of WO2005033321), AAVhu.52 (SEQ ID NO: 191 of WO2005033321), AAVhu.53 (SEQ ID NO: 186 of WO2005033321), AAVhu.54 (SEQ ID NO: 188 of WO2005033321), AAVhu.55 (SEQ ID NO: 187 of WO2005033321), AAVhu.56 (SEQ ID NO: 192 of WO2005033321), AAVhu.57 (SEQ ID NO: 193 of WO2005033321), AAVhu.58 (SEQ ID NO: 194 of WO2005033321), AAVhu.6 (SEQ ID NO: 84 of WO2005033321), AAVhu.60 (SEQ ID NO: 184 of WO2005033321), AAVhu.61 (SEQ ID NO: 185 of WO2005033321), AAVhu.63 (SEQ ID NO: 195 of WO2005033321), AAVhu.64 (SEQ ID NO: 196 of WO2005033321), AAVhu.66 (SEQ ID NO: 197 of WO2005033321), AAVhu.67 (SEQ ID NO: 198 of WO2005033321), AAVhu.7 (SEQ ID NO: 150 of WO2005033321), AAVhu.8 (WO2005033321 SEQ ID NO: 12), AAVhu.9 (SEQ ID NO: 155 of WO2005033321), AAVLG-10/rh.40 (SEQ ID No: 14 of WO2005033321), AAVLG-4/rh.38 (SEQ ID NO: 86 of WO2005033321), AAVLG-4/rh.38 (SEQ ID No: 7 of WO2005033321), AAVN721-8/rh.43 (SEQ ID NO: 163 of WO2005033321), AAVN721-8/rh.43 (SEQ ID No: 43 of WO2005033321), AAVpi.1 (WO2005033321 SEQ ID NO: 28), AAVpi.2 (WO2005033321 SEQ ID NO: 30), AAVpi.3 (WO2005033321 SEQ ID NO: 29), AAVrh.38 (SEQ ID NO: 86 of WO2005033321), AAVrh.40 (SEQ ID NO: 92 of WO2005033321), AAVrh.43 (SEQ ID NO: 163 of WO2005033321), AAVrh.44 (WO2005033321 SEQ ID NO: 34), AAVrh.45 (WO2005033321 SEQ ID NO: 41), AAVrh.47 (WO2005033321 SEQ ID NO: 38), AAVrh.48 (SEQ ID NO: 115 of WO2005033321), AAVrh.49 (SEQ ID NO: 103 of WO2005033321), AAVrh.50 (SEQ ID NO: 108 of WO2005033321), AAVrh.51 (SEQ ID NO: 104 of WO2005033321), AAVrh.52 (SEQ ID NO: 96 of WO2005033321), AAVrh.53 (SEQ ID NO: 97 of WO2005033321), AAVrh.55 (WO2005033321 SEQ ID NO: 37), AAVrh.56 (SEQ ID NO: 152 of WO2005033321), AAVrb.57 (SEQ ID NO: 105 of WO2005033321), AAVrh.58 (SEQ ID NO: 106 of WO2005033321), AAVrh.59 (WO2005033321 SEQ ID NO: 42), AAVrh.60 (WO2005033321 SEQ ID NO: 31), AAVrh.61 (SEQ ID NO: 107 of WO2005033321), AAVrh.62 (SEQ ID NO: 114 of WO2005033321), AAVrh.64 (SEQ ID NO: 99 of WO2005033321), AAVrh.65 (WO2005033321 SEQ ID NO: 35), AAVrh.68 (WO2005033321 SEQ ID NO: 16), AAVrh.69 (WO2005033321 SEQ ID NO: 39), AAVrh.70 (WO2005033321 SEQ ID NO: 20), AAVrh.72 (WO2005033321 SEQ ID NO: 9), or variants thereof including, but not limited to, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy:5, AAVcy.6AAVrh.12AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVM.25/42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh14. Non-limiting examples of variants include SEQ ID NO: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151,154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236, of WO2005033321, the contents of which are herein incorporated by reference in their entirety.

    [0070] In some embodiments, the AAV serotype may he, or have, a sequence as described in International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh8R (SEQ ID NO: 9 of WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10 of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of WO2015168666), or variants thereof.

    [0071] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,233,131, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVhE1.1 (SEQ ID NO:44 of U.S. Pat. No. 9,233,131), AAVhEr1.5 (SEQ ID NO:45 of U.S. Pat. No. 9,233,131), AAVhER1.14 (SEQ ID NO:46 of U.S. Pat. No. 9,233,131), AAVhEr1.8 (SEQ ID NO:47 of U.S. Pat. No. 9,233,131), AAVhEr1.16 (SEQ ID NO:48 of U.S. Pat. No. 9,233,131), AAVhEr1.18 (SEQ ID NO:49 of U.S. Pat. No. 9,233,131), AAVhEr1.35 (SEQ ID NO:50 of U.S. Pat. No. 9,233,131), AAVhEr1.7 (SEQ ID NO:51 of U.S. Pat. No. 9,233,131), AAVhEr1.36 (SEQ ID NO:52 of U.S. Pat. No. 9,233,131), AAVhEr2.29 (SEQ ID NO:53 of U.S. Pat. No. 9,233,131), AAVhEr2.4 (SEQ ID NO:54 of U.S. Pat. No. 9,233,131), AAVhEr2.16 (SEQ ID NO:5.5 of U.S. Pat. No. 9,233,131), AAVhEr2.30 (SEQ ID NO: 56 of U.S. Pat. No. 9,233,131), AAVhEr2.31 (SEQ ID NO:58 of U.S. Pat. No. 9,233,131), AAVhEr2.36 (SEQ ID NO:57 of U.S. Pat. No. 9,233,131), AAVhER1.23 (SEQ ID NO:53 of U.S. Pat. No. 9,233,131), AAVhEr3.1 (SEQ ID NO:59 of U.S. Pat. No. 9,233,131), AAV2.5T (SEQ ID NO:42 of U.S. Pat. No. 9,233,131), or variants thereof.

    [0072] In some embodiments, the AAV serotype may be, or have, a sequence as described in United. States Patent Publication No, US20150376607, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-PAEC (SEQ ID NO:1 of US20150376607), AAV-LK01 (SEQ ID NO:2 of US20150376607), AAV-LK02 (SEQ ID NO:3 of US20150376607), AAV-LK,03 (SEQ ID NO:4 of US20150376607), AAV-LK04 (SEQ ID NO:5 of US20150376607), AAV-LK05 (SEQ ID NO:6 of US20150376607), AAV-LK06 (SEQ ID NO:7 of US20150376607), AAV-LK07 (SEQ ID NO:8 of US20150376607), AAV-LK08 (SEQ ID NO:9 of US20150376607), (SEQ ID NO:10 of US20150376607), AAV-LK10 (SEQ ID NO:11 of US20150376607), AAV-LK11 (SEQ ID NO:12 of US20150376607), AAV-LK12 (SEQ ID NO:13 of US20150376607), AAV-LK13 (SEQ ID NO:14 of US20150376607), AAV-LK14 (SEQ ID NO:15 of US20150376607), AAV-LK15 (SEQ ID NO:16 of US20150376607), AAV-LK16 (SEQ ID NO:17 of US20150376607), AAV-LK17 (SEQ ID NO:18 of US20150376607), AAV-LK18 (SEQ ID NO:19 of US20150376607), AAV-LK19 (SEQ ID NO: 20 of US20150376607), AAV-PAEC2 (SEQ ID NO:21 of US20150376607), AAV-PAEC4 (SEQ IDNO:22 of US2015037 6607), AAV-PAEC6 (SEQ ID NO:23 of US20150376607), AAV-PAEC7 (SEQ ID NO:24 of US20150376607), AAV-PAEC8 (SEQ ID NO:25 of US20150376607), AAV-PAEC11 (SEQ ID NO:26 of US20150376607), AAV-PAEC12 (SEQ ID NO:27, of US20150376607) or variants thereof.

    [0073] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,163,261, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-2-pre-miRNA-101 (SEQ ID NO: 1 U.S. Pat. No. 9,1632,61), or variants thereof.

    [0074] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376240, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-8h (SEQ NO: 6 of US20150376240), AAV-8b (SEQ ID NO: 5 of US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ ID NO: 1 of US20150376240), or variants thereof.

    [0075] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017295, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV SM 10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffle 100-1 (SEQ ID NO: 23 of US20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of US20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of US20160017295), AAV Shuffle 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffle 10-6 (SEQ ID NO: 35 of US20160017295), AAV Shuffle 10-8 (SEQ ID NO: 36 of US20160017295), AAV Shuffle 100-2 (SEQ ID NO: 37 US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV SM 10-8 (SEQ ID NO: 39 of US20160017295), AAV SM 100-3 (SEQ ID NO: 40 of US20160017295), AAV SM 100-10 (SEQ ID NO: 41 of US20160017295), or variants thereof.

    [0076] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150238550, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BNP61 AAV (SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or variants thereof.

    [0077] In some embodiments, the AAV serotype may he or may have a sequence as described in United States Patent Publication No. US20150315612, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh.50 (SEQ ID NO: 108 of US20150315612), AAVrh.43 (SEQ ID NO: 163 of US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612), AAVrh.48 (SEQ ID NO: 115 of US20150315612), AAVhu.19 (SEQ ID NO: 133 of US20150315612), AAVhu.11 (SEQ ID NO: 1.53 of US20150315612), AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8/rh.64 (SEQ ID No: 15 of US20150315612), AAVLG-9/hu.39 (SEQ ID No: 24 of US20150315612), AAV54.5/hu.23 (SEQ ID No: 60 of US20150315612), AAV54.2/hu.22 (SEQ ID No: 67 of US20150315612), AAV54.7hu.24 (SEQ ID No: 66 of US20150315612), AAV54.1/hu.21 (SEQ ID No: 65 of US20150315612), AAV54.4R/hu.27 (SEQ ID No: 64 of US20150315612), AAV46.2/hu.28 (SEQ ID No: 68 of US20150315612), AAV46.6/hu.29 (SEQ ID No: 69 of US20150315612), AAV128.1/hu.43 (SEQ ID No: 80 of US20150315612), or variants thereof.

    [0078] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), UPenn AAV10 (SEQ ID NO: 8 of WO2015121501), Japanese AAV10 (SEQ ID NO: 9 of WO2015121501), or variants thereof.

    [0079] According to the present invention AAV capsid serotype selection or use may be from a variety of species. In one embodiment, the AAV may be an avian AAV (AAAV). The AAAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,238,800, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. Pat. No. 9,238,800), or variants thereof.

    [0080] In one embodiment, the AAV may be a bovine AAV (BAAV). The BAAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,193,769. the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of U.S. Pat. No. 9,193,769), or variants thereof. The BAAV serotype may be or have a sequence as described in U.S. Pat. No. 7,427,396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of US7,427,396), or variants thereof.

    [0081] In one embodiment, the AAV may be a caprine AAV. The caprine AAV serotype may be, or have a sequence as described in U.S. Pat. No. 7,427,396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Pat. No. 7,427,396), or variants thereof.

    [0082] In other embodiments, the AAV may be engineered as a hybrid AAV from two or more parental serotypes. In one embodiment, the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017005, the contents of which are herein incorporated by reference in its entirety.

    [0083] In one embodiment, the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering) as described by Pulitherla et al. (Molecular Therapy 19(6):1070-1078 (2011), the contents of which are herein incorporated by reference in their entirety. The serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F11I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G, W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A4667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C, T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A, G546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A, F535L), AAV9.58 (C1475T, C1579A, T492I, H527N), (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A, G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C, S490P), AAV9.90 (A1196T; Y399F), AA9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T, M559L) and AAV9.95 (T1605A; F535L).

    [0084] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016049230, the contents of which are herein incorporated by reference in their entirely, such as, but not limited to AAVF1/HSC1 (SEQ ID NO: 2 and 20 of WO2016049230), AAVF2/HSC2 (SEQ ID NO: 3 and 21 of WO2016049230), AAVF3/HSC3 (SEQ ID NO: 5 and 22 of WO2016049230), AAVF4/HSC4 (SEQ ID NO: 6 and 23 of WO2016049230), AAVF5/HSC5 (SEQ ID NO: 11 and 25 of WO2016049230), AAVF6/HSC6 (SEQ ID NO: 7 and 24 of WO2016049230), AAVF7/HSC7 (SEQ ID NO: 8 and 27 of WO2016049230), AAVF8/HSC8 (SEQ ID NO: 9 and 28 of WO2016049230), AAVF9/HSC9 (SEQ ID NO: 10 and 29 of WO2016049230), AAVF11/HSC11 (SEQ ID NO: 4 and 26 of WO2016049230), AAVF12/HSC12 (SEQ ID NO: 12 and 30 of WO2016049230), AAVF13/HSC13 (SEQ ID NO: 14 and 31 of WO2016049230), AAVF14/HSC14 (SEQ ID NO: 15 and 32 of WO2016049230), AAVF15/HSC15 (SEQ ID NO: 16 and 33 of WO2016049230), AAVF16/HSC16 (SEQ ID NO: 17 and 34 of WO2016049230), AAVF17/HSC17 (SEQ D NO: 13 and 35 of WO2016049230), or variants or derivatives thereof.

    [0085] In some embodiments, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 8,734,809, the contents of which are herein incorporated by reference in their entirety, such as, hut not limited to, AAV CBr-E1 (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809) AAV CBr-E2 (SEQ ID NO: 14 and 88 of U.S. Pat. No. 8,734,809), AAV CBr-E3 (SEQ ID NO: 15 and 89 of U.S. Pat. No. 8,7348,09), AAV CBr-E4 (SEQ ID NO: 16 and 90 of U.S. Pat. No. 8,734,809), AAV CBr-E5 (SEQ ID NO: 17 and 91 of U.S. Pat. No. 8,734,809), AAV CBr-e5 (SEQ ID NO: 18 and 92 of U.S. Pat. No. 8,734,809), AAV CBr-E6 (SEQ ID NO: 19 and 93 of U.S. Pat. No. 8,734,809), AAV CBr-E7 (SEQ ID NO: 20 and 94 of U.S. Pat. No. 8,734,809), AAV CBr-E8 (SEQ ID NO: 21 and 95 of U.S. Pat. No. 8,734,809), AAV CLv-D1 (SEQ ID NO: 22 and 96 of U.S. Pat. No. 8,734,809), AAV CLv-D2 (SEQ ID NO: 23 and 97 of U.S. Pat. No. 8,734,809), AAV CLv-D3 (SEQ ID NO: 24 and 98 of U.S. Pat. No. 8,734,809), AAV CLv-D4 (SEQ ID NO: 25 and 99 of U.S. Pat. No. 8,734,809), AAV CLv-D5 (SEQ ID NO: 26 and 100 of U.S. Pat. No. 8,734,809), AAV CLv-D6 (SEQ ID NO: 27 and 101 of U.S. Pat. No. 8,734,809), AAV CLv-D7 (SEQ ID NO: 28 and 102 of U.S. Pat. No. 8,734,809), AAV CLv-D8 (SEQ ID NO: 29 and 103 of U.S. Pat. No. 8,734,809), AAV (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809), AAV CLv-R1 (SEQ ID NO: 30 and 104 of U.S. Pat. No. 8,734,809), AAV CLv-R2 (SEQ ID NO: 31 and 105 of U.S. Pat. No. 8,734,809), AAV CLv-R3 (SEQ ID NO: 32 and 106 of U.S. Pat. No. 8,734,809), AAV CLv-R4 (SEQ ID NO: 33 and 107 of U.S. Pat. No. 8,734,809), AAV CLv-R5 (SEQ ID NO: 34 and 108 of U.S. Pat. No. 8,734,809), AAV CLv-R6 (SEQ ID NO: 35 and 109 of U.S. Pat. No. 8,734,809), AAV CLv-R7 (SEQ ID NO: 36 and 110 of U.S. Pat. No. 8,734,809), AAV CLv-R8 (SEQ ID NO: 37 and 111 of U.S. Pat. No. 8,734,809), AAV CLv-R9 (SEQ ID NO: 38 and 112 of U.S. Pat. No. 8,734,809), AAV CLg-F1 (SEQ ID NO: 39 and 113 of U.S. Pat. No. 8,734,809), AAV CLg-F2 (SEQ ID NO: 40 and 114 of U.S. Pat. No. 8,734,809), AAV CLg-F3 (SEQ ID NO: 41 and 115 of U.S. Pat. No. 8,734,809), AAV CLg-F4 (SEQ ID NO: 42 and 116 of U.S. Pat. No. 8,734,809), AAV CLg-F5 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CLg-F6 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CLg-F7 (SEQ ID NO: 44 and 11$ of U.S. Pat. No. 8,734,809), AAV CLg-F8 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CSp-1 (SEQ ID NO: 45 and 119 of U.S. Pat. No. 8,734,809), AAV CSp-10 (SEQ ID NO: 46 and 120 of U.S. Pat. No. 8,734,809), AAV CSp-11 (SEQ ID NO: 47 and 121 of U.S. Pat. No. 8,734,809), AAV CSp-2 (SEQ ID NO: 48 and 122 of U.S. Pat. No. 8,734,809), AAV CSp-3 (SEQ ID NO: 49 and 123 of U.S. Pat. No. 8,734,809), CSp-4 (SEQ ID NO: 50 and 124 of U.S. Pat. No. 8,734,809), AAV CSp-6 (SEQ ID NO: 51 and 125 of U.S. Pat. No. 8,734,809), AAV CSp-7 (SEQ ID NO: 52 and 126 of U.S. Pat. No. 8,734,809), AAV CSp-8 (SEQ ID NO: 53 and 127 of U.S. Pat. No. 8,734,809), AAV CSp-9 (SEQ ID NO: 54 and 128 of U.S. Pat. No. 8,734,809), AAV CHt-2 (SEQ ID NO: 55 and 129 of U.S. Pat. No. 8,734,809), AAV (SEQ ID NO: 56 and 130 of U.S. Pat. No. 8,734,809), AAV CKd-1 (SEQ ID NO: 57 and 131 of U.S. Pat. No. 8,734,809), AAV CKd-10 (SEQ ID NO: 58 and 132 of U.S. Pat. No. 8,734,809), AAV CKd-2 (SEQ ID NO: 59 and 133 of U.S. Pat. No. 8,734,809), AAV CKd-3 (SEQ ID NO: 60 and 134 of U.S. Pat. No. 8,734,809), AAV CKd-4 (SEQ ID NO: 61 and 135 of U.S. Pat. No. 8,734,809), AAV CKd-6 (SEQ ID NO: 62 and 136 of U.S. Pat. No. 8,734,809), AAV CKd-7 (SEQ ID NO: 63 and 137 of U.S. Pat. No. 8,734,809) AAV CKd-8 (SEQ ID NO: 64 and 138 of U.S. Pat. No. 8,734,809), AAV CLv-1 (SEQ ID NO: 35 and 139 of U.S. Pat. No. 8,734,809), AAV CLv-12 (SEQ ID NO: 66 and 140 of U.S. Pat. No. 8,734,809), AAV CLv-13 (SEQ ID NO: 67 and 141 of U.S. Pat. No. 8,734,809), AAV CLv-2 (SEQ ID NO: 68 and 142 of U.S. Pat. No. 8,734,809), AAV CLv-3 (SEQ ID NO: 69 and 143 of U.S. Pat. No. 8,734,809), AAV CLv-4 (SEQ ID NO: 70 and 144 of U.S. Pat. No. 8,734,809), AAV CLv-6 (SEQ ID NO: 71 and 145 of U.S. Pat. No. 8,734,809), AAV CLv-8 (SEQ ID NO: 72 and 146 of U.S. Pat. No. 8,734,809), AAV CKd-B1 (SEQ ID NO: 73 and 147 of U.S. Pat. No. 8,734,809), AAV CKd-B2 (SEQ ID NO: 74 and 148 of U.S. Pat. No. 8,734,809), AAV CKd-B3 (SEQ ID NO: 75 and 149 of U.S. Pat. No. 8,734,809), AAV CKd-B4 (SEQ ID NO: 76 and 150 of U.S. Pat. No. 8,734,809), AAV CKd-B5 (SEQ ID NO: 77 and 151 of U.S. Pat. No. 8,734,809), AAV CKd-B6 (SEQ ID NO: 78 and 152 of U.S. Pat. No. 8,734,809), AAV CKd-B7 (SEQ ID NO: 79 and 153 of U.S. Pat. No. 8,734,809), AAV CKd-B8 (SEQ ID NO: 80 and 154 of U.S. Pat. No. 8,734,809), AAV CKd-H1 (SEQ ID NO: 81 and 155 of U.S. Pat. No. 8,734,809), AAV CKd-H2 (SEQ ID NO: 82 and 156 of U.S. Pat. No. 8,734,809), AAV CKd-H3 (SEQ ID NO: 83 and 157 of U.S. Pat. No. 8,734,809), AAV CKd-H4 (SEQ ID NO: 84 and 158 of U.S. Pat. No. 8,734,809), AAV CKd-H5 (SEQ ID NO: 85 and 159 of U.S. Pat. No. 8,734,809), AAV CKd-H6 (SEQ ID NO: 77 and 151 of U.S. Pat. No. 8,734,809), AAV CHt-1 (SEQ ID NO: 86 and 160 of U.S. Pat. No. 8,734,809), AAV CLv1-1 (SEQ ID NO: 171 of U.S. Pat. No. 8,734,809), AAV CLv1-2 (SEQ ID NO: 172 of U.S. Pat. No. 8,734,809), AAV CLv1-3 (SEQ ID NO: 173 of U.S. Pat. No. 8,734,809), AAV CLv1-4 (SEQ ID NO: 174 of U.S. Pat. No. 8,734,809), AAV Clv1-7 (SEQ ID NO: 175 of U.S. Pat. No. 8,734,809), AAV Clv1-8 (SEQ ID NO: 176 of U.S. Pat. No. 8,734,809), AAV Clv1-9 (SEQ ID NO: 177 of U.S. Pat. No. 8,734,809), AAV Clv1-10 (SEQ ID NO: 178 of U.S. Pat. No. 8,734,809), AAV.VR-355 (SEQ fir) NO: 181 of U.S. Pat. No. 8,734,809), AAV.hu.48R3 (SEQ ID NO: 183 of U.S. Pat. No. 8,734,809), or variants or derivatives thereof.

    [0086] In some embodiments, the AAV serotype may he, or have, a sequence as described in International Publication No. WO2016065001, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV CHt-P2 (SEQ ID NO: 1 and 51 of WO2016065001), AAV CHt-P5 (SEQ ID NO: 2 and 52 of WO2016065001), AAV CHt-P9 (SEQ ID NO: 3 and 53 of WO2016065001), AAV CBr-7.1 (SEQ ID NO: 4 and 54 of WO2016065001), AAV CBr-7.2 (SEQ ID NO: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ ID NO: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NO: 7 and 57 of WO2016065001), AAV CBr-7.5 (SEQ ID NO: 8 and 58 of WO2016065001), AAV CBr-7.7 (SEQ ID NO: 9 and 59 of WO2016065001), AAV CBr-7.8 (SEQ ID NO: 10 and 60 of WO2016065001), AAV CBr-7.10 (SEQ ID NO: 11 and 61 of WO2016065001), AAV CKd-N3 (SEQ ID NO: 12 and 62 of WO2016065001), AAV CKd-N4 (SEQ ID NO: 13 and 63 of WO2016065001), AAV CKd-N9 (SEQ ID NO: 14 and 64 of WO2016065001), AAV CLv-L4 (SEQ ID NO: 15 and 65 of WO2016065001), AAV CLv-L5 (SEQ ID NO: 16 and 66 of WO2016065001), AAV CLv-L6 (SEQ ID NO: 17 and 67 of WO2016065001), AAV CLv-K1 (SEQ ID NO: 18 and 68 of WO2016065001), AAV CLv-K3 (SEQ ID NO: 19 and 69 of WO2016065001), AAV CLv-K6 (SEQ ID NO: 20 and 70 of WO2016065001), AAV CLv-M1 (SEQ ID NO: 21 and 71 of WO2016065001), AAV CLv-M11 (SEQ ID NO: 22 and 72 of WO2016065001), AAV CLv-M2 (SEQ ID NO: 23 and 73 of WO2016065001), AAV CLv-M5 (SEQ ID NO: 24 and 74 of WO2016065001), AAV CLv-M6 (SEQ ID NO: 25 and 75 of WO2016065001), AAV CLv-M7 (SEQ ID NO: 26 and 76 of WO2016065001), AAV CLv-M8 (SEQ ID NO: 27 and 77 of WO2016065001), AAV CLv-M9 (SEQ ID NO: 28 and 78 of WO2016065001), AAV CHt-P1 (SEQ ID NO: 29 and 79 of WO2016065001), AAV CHt-P6 (SEQ ID NO: 30 and 80 of WO2016065001), AAV CHt-P8 (SEQ ID NO: 31 and 81 of WO2016065001), AAV CHt-6.1 (SEQ ID NO: 32 and 82 of WO2016065001), AAV CHt-6.10 (SEQ ID NO: 33 and 83 of WO2016065001), AAV CHt-6.5 (SEQ ID NO: 34 and 84 of WO2016065001), AAV CHt-6.6 (SEQ ID NO: 35 and 85 of WO2016065001), AAV CHt-6.7 (SEQ ID NO: 36 and 86 of WO2016065001), AAV CHt-6.8 (SEQ ID NO: 37 and 87 of WO2016061001), AAV CSp-8.10 (SEQ ID NO: 38 and 88 of WO2016065001), AAV CSp-8.2 (SEQ ID NO: 39 and 89 of WO2016065001), AAV CSp-8.4 (SEQ ID NO: 40 and 90 of WO2016065001), AAV CSp-8.5 (SEQ ID NO: 41 and 91 of WO2016065001), AAV CSp-8.6 (SEQ ID NO: 42 and 92 of WO2016065001), AAV CSp-8.7 (SEQ ID NO: 43 and 93 of WO2016065001), AAV CSp-8.8 (SEQ ID NO: 44 and 94 of WO2016065001), AAV CSp-8.9 (SEQ ID NO: 45 and 95 of WO2016065001), AAV CBr-B7.3 (SEQ ID NO: 46 and 96 of WO2016065001), AAV CBr-B7.4 (SEQ ID NO: 47 and 97 of WO2016065001), AAV3B (SEQ ID NO: 48 and 98 of WO2016065001), AAV4 (SEQ ID NO: 49 and 99 of WO2016065001), AAV5 (SEQ ID NO: 50 and 100 of WO2016065001), or variants or derivatives thereof.

    [0087] In one embodiment, the AAV may be a, serotype selected from any of those found in Table 1.

    [0088] In one embodiment, the AAV may comprise a sequence, fragment or variant thereof, of the sequences in Table 1.

    [0089] In one embodiment, the AAV may be encoded by a sequence, fragment or variant as described in Table 1.

    TABLE-US-00001 TABLE 1 AAV Serotypes SEQ Serotype ID NO Reference Information AAV1 1 US20150159173 SEQ ID NO: 11, US20150315612 SEQ ID NO: 202 AAV1 2 US20160017295 SEQ ID NO: 1US20030138772 SEQ ID NO: 64, US20150159173 SEQ ID NO: 27, US20150315612 SEQ ID NO: 219, U.S. Pat. No. 7,198,951 SEQ ID NO: 5 AAV1 3 US20030138772 SEQ ID NO: 6 AAV1.3 4 US20030138772 SEQ ID NO: 14 AAV10 5 US20030138772 SEQ ID NO: 117 AAV10 6 WO2015121501 SEQ ID NO: 9 AAV10 7 WO2015121501 SEQ ID NO: 8 AAV11 8 US20030138772 SEQ ID NO: 118 AAV12 9 US20030138772 SEQ ID NO: 119 AAV2 10 US20150159173 SEQ ID NO: 7, US20150315612 SEQ ID NO: 211 AAV2 11 US20030138772 SEQ ID NO: 70, US20150159173 SEQ ID NO: 23, US20150315612 SEQ ID NO: 221, US20160017295 SEQ ID NO: 2, U.S. Pat. No. 6,156,303 SEQ ID NO: 4, U.S. Pat. No. 7,198,951 SEQ ID NO: 4, WO2015121501 SEQ ID NO: 1 AAV2 12 U.S. Pat. No. 6,156,303 SEQ ID NO: 8 AAV2 13 US20030138772 SEQ ID NO: 7 AAV2 14 U.S. Pat. No. 6,156,303 SEQ ID NO: 3 AAV2.5T 15 U.S. Pat. No. 9,233,131 SEQ ID NO: 42 AAV223.10 16 US20030138772 SEQ ID NO: 75 AAV223.2 17 US20030138772 SEQ ID NO: 49 AAV223.2 18 US20030138772 SEQ ID NO: 76 AAV223.4 19 US20030138772 SEQ ID NO: 50 AAV223.4 20 US20030138772 SEQ ID NO: 73 AAV223.5 21 US20030138772 SEQ ID NO: 51 AAV223.5 22 US20030138772 SEQ ID NO: 74 AAV223.6 23 US20030138772 SEQ ID NO: 52 AAV223.6 24 US20030138772 SEQ ID NO: 78 AAV223.7 25 US20030138772 SEQ ID NO: 53 AAV223.7 26 US20030138772 SEQ ID NO: 77 AAV29.3 27 US20030138772 SEQ ID NO: 82 AAV29.4 28 US20030138772 SEQ ID NO: 12 AAV29.5 29 US20030138772 SEQ ID NO: 83 AAV29.5 30 US20030138772 SEQ ID NO: 13 (AAVbb.2) AAV3 31 US20150159173 SEQ ID NO: 12 AAV3 32 US20030138772 SEQ ID NO: 71, US20150159173 SEQ ID NO: 28, US20160017295 SEQ ID NO: 3, U.S. Pat. No. 7,198,951 SEQ ID NO: 6 AAV3 33 US20030138772 SEQ ID NO: 8 AAV3.3b 34 US20030138772 SEQ ID NO: 72 AAV3-3 35 US20150315612 SEQ ID NO: 200 AAV3-3 36 US20150315612 SEQ ID NO: 217 AAV3a 37 U.S. Pat. No. 6,156,303 SEQ ID NO: 5 AAV3a 38 U.S. Pat. No. 6,156,303 SEQ ID NO: 9 AAV3b 39 U.S. Pat. No. 6,156,303 SEQ ID NO: 6 AAV3b 40 U.S. Pat. No. 6,156,303 SEQ ID NO: 10 AAV3b 41 U.S. Pat. No. 6,156,303 SEQ ID NO: 1 AAV4 42 US20140348794 SEQ ID NO: 17 AAV4 43 US20140348794 SEQ ID NO: 5 AAV4 44 US20140348794 SEQ ID NO: 3 AAV4 45 US20140348794 SEQ ID NO: 14 AAV4 46 US20140348794 SEQ ID NO: 15 AAV4 47 US20140348794 SEQ ID NO: 19 AAV4 48 US20140348794 SEQ ID NO: 12 AAV4 49 US20140348794 SEQ ID NO: 13 AAV4 50 US20140348794 SEQ ID NO: 7 AAV4 51 US20140348794 SEQ ID NO: 8 AAV4 52 US20140348794 SEQ ID NO: 9 AAV4 53 US20140348794 SEQ ID NO: 2 AAV4 54 US20140348794 SEQ ID NO: 10 AAV4 55 US20140348794 SEQ ID NO: 11 AAV4 56 US20140348794 SEQ ID NO: 18 AAV4 57 US20030138772 SEQ ID NO: 63, US20160017295 SEQ ID NO: 4, US20140348794 SEQ ID NO: 4 AAV4 58 US20140348794 SEQ ID NO: 16 AAV4 59 US20140348794 SEQ ID NO: 20 AAV4 60 US20140348794 SEQ ID NO: 6 AAV4 61 US20140348794 SEQ ID NO: 1 AAV42.2 62 US20030138772 SEQ ID NO: 9 AAV42.2 63 US20030138772 SEQ ID NO: 102 AAV42.3b 64 US20030138772 SEQ ID NO: 36 AAV42.3B 65 US20030138772 SEQ ID NO: 107 AAV42.4 66 US20030138772 SEQ ID NO: 33 AAV42.4 67 US20030138772 SEQ ID NO: 88 AAV42.8 68 US20030138772 SEQ ID NO: 27 AAV42.8 69 US20030138772 SEQ ID NO: 85 AAV43.1 70 US20030138772 SEQ ID NO: 39 AAV43.1 71 US20030138772 SEQ ID NO: 92 AAV43.12 72 US20030138772 SEQ ID NO: 41 AAV43.12 73 US20030138772 SEQ ID NO: 93 AAV43.20 74 US20030138772 SEQ ID NO: 42 AAV43.20 75 US20030138772 SEQ ID NO: 99 AAV43.21 76 US20030138772 SEQ ID NO: 43 AAV43.21 77 US20030138772 SEQ ID NO: 96 AAV43.23 78 US20030138772 SEQ ID NO: 44 AAV43.23 79 US20030138772 SEQ ID NO: 98 AAV43.25 80 US20030138772 SEQ ID NO: 45 AAV43.25 81 US20030138772 SEQ ID NO: 97 AAV43.5 82 US20030138772 SEQ ID NO: 40 AAV43.5 83 US20030138772 SEQ ID NO: 94 AAV4-4 84 US20150315612 SEQ ID NO: 201 AAV4-4 85 US20150315612 SEQ ID NO: 218 AAV44.1 86 US20030138772 SEQ ID NO: 46 AAV44.1 87 US20030138772 SEQ ID NO: 79 AAV44.5 88 US20030138772 SEQ ID NO: 47 AAV44.5 89 US20030138772 SEQ ID NO: 80 AAV4407 90 US20150315612 SEQ ID NO: 90 AAV5 91 U.S. Pat. No. 7,427,396 SEQ ID NO: 1 AAV5 92 US20030138772 SEQ ID NO: 114 AAV5 93 US20160017295 SEQ ID NO: 5, U.S. Pat. No. 7,427,396 SEQ ID NO: 2, US20150315612 SEQ ID NO: 216 AAV5 94 US20150315612 SEQ ID NO: 199 AAV6 95 US20150159173 SEQ ID NO: 13 AAV6 96 US20030138772 SEQ ID NO: 65, US20150159173 SEQ ID NO: 29, US20160017295 SEQ ID NO: 6, U.S. Pat. No. 6,156,303 SEQ ID NO: 7 AAV6 97 U.S. Pat. No. 6,156,303 SEQ ID NO: 11 AAV6 98 U.S. Pat. No. 6,156,303 SEQ ID NO: 2 AAV6 99 US20150315612 SEQ ID NO: 203 AAV6 100 US20150315612 SEQ ID NO: 220 AAV6.1 101 US20150159173 AAV6.12 102 US20150159173 AAV6.2 103 US20150159173 AAV7 104 US20150159173 SEQ ID NO: 14 AAV7 105 US20150315612 SEQ ID NO: 183 AAV7 106 US20030138772 SEQ ID NO: 2, US20150159173 SEQ ID NO: 30, US20150315612 SEQ ID NO: 181, US20160017295 SEQ ID NO: 7 AAV7 107 US20030138772 SEQ ID NO: 3 AAV7 108 US20030138772 SEQ ID NO: 1, US20150315612 SEQ ID NO: 180 AAV7 109 US20150315612 SEQ ID NO: 213 AAV7 110 US20150315612 SEQ ID NO: 222 AAV8 111 US20150159173 SEQ ID NO: 15 AAV8 112 US20150376240 SEQ ID NO: 7 AAV8 113 US20030138772 SEQ ID NO: 4, US20150315612 SEQ ID NO: 182 AAV8 114 US20030138772 SEQ ID NO: 95, US20140359799 SEQ ID NO: 1, US20150159173 SEQ ID NO: 31, US20160017295 SEQ ID NO: 8, U.S. Pat. No. 7,198,951 SEQ ID NO: 7, US20150315612 SEQ ID NO: 223 AAV8 115 US20150376240 SEQ ID NO: 8 AAV8 116 US20150315612 SEQ ID NO: 214 AAV-8b 117 US20150376240 SEQ ID NO: 5 AAV-8b 118 US20150376240 SEQ ID NO: 3 AAV-8h 119 US20150376240 SEQ ID NO: 6 AAV-8h 120 US20150376240 SEQ ID NO: 4 AAV9 121 US20030138772 SEQ ID NO: 5 AAV9 122 U.S. Pat. No. 7,198,951 SEQ ID NO: 1 AAV9 123 US20160017295 SEQ ID NO: 9 AAV9 124 US20030138772 SEQ ID NO: 100, U.S. Pat. No. 7,198,951 SEQ ID NO: 2 AAV9 125 U.S. Pat. No. 7,198,951 SEQ ID NO: 3 AAV9 126 U.S. Pat. No. 7,906,111 SEQ ID NO: 3; (AAVhu.14) WO2015038958 SEQ ID NO: 11 AAV9 127 U.S. Pat. No. 7,906,111 SEQ ID NO: 123; (AAVhu.14) WO2015038958 SEQ ID NO: 2 AAVA3.1 128 US20030138772 SEQ ID NO: 120 AAVA3.3 129 US20030138772 SEQ ID NO: 57 AAVA3.3 130 US20030138772 SEQ ID NO: 66 AAVA3.4 131 US20030138772 SEQ ID NO: 54 AAVA3.4 132 US20030138772 SEQ ID NO: 68 AAVA3.5 133 US20030138772 SEQ ID NO: 55 AAVA3.5 134 US20030138772 SEQ ID NO: 69 AAVA3.7 135 US20030138772 SEQ ID NO: 56 AAVA3.7 136 US20030138772 SEQ ID NO: 67 AAV29.3 137 US20030138772 SEQ ID NO: 11 (AAVbb.1) AAVC2 138 US20030138772 SEQ ID NO: 61 AAVCh.5 139 US20150159173 SEQ ID NO: 46, US20150315612 SEQ ID NO: 234 AAVcy.2 140 US20030138772 SEQ ID NO: 15 (AAV13.3) AAV24.1 141 US20030138772 SEQ ID NO: 101 AAVcy.3 142 US20030138772 SEQ ID NO: 16 (AAV24.1) AAV27.3 143 US20030138772 SEQ ID NO: 104 AAVcy.4 144 US20030138772 SEQ ID NO: 17 (AAV27.3) AAVcy.5 145 US20150315612 SEQ ID NO: 227 AAV7.2 146 US20030138772 SEQ ID NO: 103 AAVcy.5 147 US20030138772 SEQ ID NO: 18 (AAV7.2) AAV16.3 148 US20030138772 SEQ ID NO: 105 AAVcy.6 149 US20030138772 SEQ ID NO: 10 (AAV16.3) AAVcy.5 150 US20150159173 SEQ ID NO: 8 AAVcy.5 151 US20150159173 SEQ ID NO: 24 AAVCy.5R1 152 US20150159173 AAVCy.5R2 153 US20150159173 AAVCy.5R3 154 US20150159173 AAVCy.5R4 155 US20150159173 AAVDJ 156 US20140359799 SEQ ID NO: 3, U.S. Pat. No. 7,588,772 SEQ ID NO: 2 AAVDJ 157 US20140359799 SEQ ID NO: 2, U.S. Pat. No. 7,588,772 SEQ ID NO: 1 AAVDJ-8 158 U.S. Pat. No. 7,588,772; Grimm et al 2008 AAVDJ-8 159 U.S. Pat. No. 7,588,772; Grimm et al 2008 AAVF5 160 US20030138772 SEQ ID NO: 110 AAVH2 161 US20030138772 SEQ ID NO: 26 AAVH6 162 US20030138772 SEQ ID NO: 25 AAVhE1.1 163 U.S. Pat. No. 9,233,131 SEQ ID NO: 44 AAVhEr1.14 164 U.S. Pat. No. 9,233,131 SEQ ID NO: 46 AAVhEr1.16 165 U.S. Pat. No. 9,233,131 SEQ ID NO: 48 AAVhEr1.18 166 U.S. Pat. No. 9,233,131 SEQ ID NO: 49 AAVhEr1.23 167 U.S. Pat. No. 9,233,131 SEQ ID NO: 53 (AAVhEr2.29) AAVhEr1.35 168 U.S. Pat. No. 9,233,131 SEQ ID NO: 50 AAVhEr1.36 169 U.S. Pat. No. 9,233,131 SEQ ID NO: 52 AAVhEr1.5 170 U.S. Pat. No. 9,233,131 SEQ ID NO: 45 AAVhEr1.7 171 U.S. Pat. No. 9,233,131 SEQ ID NO: 51 AAVhEr1.8 172 U.S. Pat. No. 9,233,131 SEQ ID NO: 47 AAVhEr2.16 173 U.S. Pat. No. 9,233,131 SEQ ID NO: 55 AAVhEr2.30 174 U.S. Pat. No. 9,233,131 SEQ ID NO: 56 AAVhEr2.31 175 U.S. Pat. No. 9,233,131 SEQ ID NO: 58 AAVhEr2.36 176 U.S. Pat. No. 9,233,131 SEQ ID NO: 57 AAVhEr2.4 177 U.S. Pat. No. 9,233,131 SEQ ID NO: 54 AAVhEr3.1 178 U.S. Pat. No. 9,233,131 SEQ ID NO: 59 AAVhu.1 179 US20150315612 SEQ ID NO: 46 AAVhu.1 180 US20150315612 SEQ ID NO: 144 AAVhu.10 181 US20150315612 SEQ ID NO: 56 (AAV16.8) AAVhu.10 182 US20150315612 SEQ ID NO: 156 (AAV16.8) AAVhu.11 183 US20150315612 SEQ ID NO: 57 (AAV16.12) AAVhu.11 184 US20150315612 SEQ ID NO: 153 (AAV16.12) AAVhu.12 185 US20150315612 SEQ ID NO: 59 AAVhu.12 186 US20150315612 SEQ ID NO: 154 AAVhu.13 187 US20150159173 SEQ ID NO: 16, US20150315612 SEQ ID NO: 71 AAVhu.13 188 US20150159173 SEQ ID NO: 32, US20150315612 SEQ ID NO: 129 AAVhu.136.1 189 US20150315612 SEQ ID NO: 165 AAVhu.140.1 190 US20150315612 SEQ ID NO: 166 AAVhu.140.2 191 US20150315612 SEQ ID NO: 167 AAVhu.145.6 192 US20150315612 SEQ ID No: 178 AAVhu.15 193 US20150315612 SEQ ID NO: 147 AAVhu.15 194 US20150315612 SEQ ID NO: 50 (AAV33.4) AAVhu.156.1 195 US20150315612 SEQ ID No: 179 AAVhu.16 196 US20150315612 SEQ ID NO: 148 AAVhu.16 197 US20150315612 SEQ ID NO: 51 (AAV33.8) AAVhu.17 198 US20150315612 SEQ ID NO: 83 AAVhu.17 199 US20150315612 SEQ ID NO: 4 (AAV33.12) AAVhu.172.1 200 US20150315612 SEQ ID NO: 171 AAVhu.172.2 201 US20150315612 SEQ ID NO: 172 AAVhu.173.4 202 US20150315612 SEQ ID NO: 173 AAVhu.173.8 203 US20150315612 SEQ ID NO: 175 AAVhu.18 204 US20150315612 SEQ ID NO: 52 AAVhu.18 205 US20150315612 SEQ ID NO: 149 AAVhu.19 206 US20150315612 SEQ ID NO: 62 AAVhu.19 207 US20150315612 SEQ ID NO: 133 AAVhu.2 208 US20150315612 SEQ ID NO: 48 AAVhu.2 209 US20150315612 SEQ ID NO: 143 AAVhu.20 210 US20150315612 SEQ ID NO: 63 AAVhu.20 211 US20150315612 SEQ ID NO: 134 AAVhu.21 212 US20150315612 SEQ ID NO: 65 AAVhu.21 213 US20150315612 SEQ ID NO: 135 AAVhu.22 214 US20150315612 SEQ ID NO: 67 AAVhu.22 215 US20150315612 SEQ ID NO: 138 AAVhu.23 216 US20150315612 SEQ ID NO: 60 AAVhu.23.2 217 US20150315612 SEQ ID NO: 137 AAVhu.24 218 US20150315612 SEQ ID NO: 66 AAVhu.24 219 US20150315612 SEQ ID NO: 136 AAVhu.25 220 US20150315612 SEQ ID NO: 49 AAVhu.25 221 US20150315612 SEQ ID NO: 146 AAVhu.26 222 US20150159173 SEQ ID NO: 17, US20150315612 SEQ ID NO: 61 AAVhu.26 223 US20150159173 SEQ ID NO: 33, US20150315612 SEQ ID NO: 139 AAVhu.27 224 US20150315612 SEQ ID NO: 64 AAVhu.27 225 US20150315612 SEQ ID NO: 140 AAVhu.28 226 US20150315612 SEQ ID NO: 68 AAVhu.28 227 US20150315612 SEQ ID NO: 130 AAVhu.29 228 US20150315612 SEQ ID NO: 69 AAVhu.29 229 US20150159173 SEQ ID NO: 42, US20150315612 SEQ ID NO: 132 AAVhu.29 230 US20150315612 SEQ ID NO: 225 AAVhu.29R 231 US20150159173 AAVhu.3 232 US20150315612 SEQ ID NO: 44 AAVhu.3 233 US20150315612 SEQ ID NO: 145 AAVhu.30 234 US20150315612 SEQ ID NO: 70 AAVhu.30 235 US20150315612 SEQ ID NO: 131 AAVhu.31 236 US20150315612 SEQ ID NO: 1 AAVhu.31 237 US20150315612 SEQ ID NO: 121 AAVhu.32 238 US20150315612 SEQ ID NO: 2 AAVhu.32 239 US20150315612 SEQ ID NO: 122 AAVhu.33 240 US20150315612 SEQ ID NO: 75 AAVhu.33 241 US20150315612 SEQ ID NO: 124 AAVhu.34 242 US20150315612 SEQ ID NO: 72 AAVhu.34 243 US20150315612 SEQ ID NO: 125 AAVhu.35 244 US20150315612 SEQ ID NO: 73 AAVhu.35 245 US20150315612 SEQ ID NO: 164 AAVhu.36 246 US20150315612 SEQ ID NO: 74 AAVhu.36 247 US20150315612 SEQ ID NO: 126 AAVhu.37 248 US20150159173 SEQ ID NO: 34, US20150315612 SEQ ID NO: 88 AAVhu.37 249 US20150315612 SEQ ID NO: 10, (AAV106.1) US20150159173 SEQ ID NO: 18 AAVhu.38 250 US20150315612 SEQ ID NO: 161 AAVhu.39 251 US20150315612 SEQ ID NO: 102 AAVhu.39 252 US20150315612 SEQ ID NO: 24 (AAVLG-9) AAVhu.4 253 US20150315612 SEQ ID NO: 47 AAVhu.4 254 US20150315612 SEQ ID NO: 141 AAVhu.40 255 US20150315612 SEQ ID NO: 87 AAVhu.40 256 US20150315612 SEQ ID No: 11 (AAV114.3) AAVhu.41 257 US20150315612 SEQ ID NO: 91 AAVhu.41 258 US20150315612 SEQ ID NO: 6 (AAV127.2) AAVhu.42 259 US20150315612 SEQ ID NO: 85 AAVhu.42 260 US20150315612 SEQ ID NO: 8 (AAV127.5) AAVhu.43 261 US20150315612 SEQ ID NO: 160 AAVhu.43 262 US20150315612 SEQ ID NO: 236 AAVhu.43 263 US20150315612 SEQ ID NO: 80 (AAV128.1) AAVhu.44 264 US20150159173 SEQ ID NO: 45, US20150315612 SEQ ID NO: 158 AAVhu.44 265 US20150315612 SEQ ID NO: 81 (AAV128.3) AAVhu.44R1 266 US20150159173 AAVhu.44R2 267 US20150159173 AAVhu.44R3 268 US20150159173 AAVhu.45 269 US20150315612 SEQ ID NO: 76 AAVhu.45 270 US20150315612 SEQ ID NO: 127 AAVhu.46 271 US20150315612 SEQ ID NO: 82 AAVhu.46 272 US20150315612 SEQ ID NO: 159 AAVhu.46 273 US20150315612 SEQ ID NO: 224 AAVhu.47 274 US20150315612 SEQ ID NO: 77 AAVhu.47 275 US20150315612 SEQ ID NO: 128 AAVhu.48 276 US20150159173 SEQ ID NO: 38 AAVhu.48 277 US20150315612 SEQ ID NO: 157 AAVhu.48 278 US20150315612 SEQ ID NO: 78 (AAV130.4) AAVhu.48R1 279 US20150159173 AAVhu.48R2 280 US20150159173 AAVhu.48R3 281 US20150159173 AAVhu.49 282 US20150315612 SEQ ID NO: 209 AAVhu.49 283 US20150315612 SEQ ID NO: 189 AAVhu.5 284 US20150315612 SEQ ID NO: 45 AAVhu.5 285 US20150315612 SEQ ID NO: 142 AAVhu.51 286 US20150315612 SEQ ID NO: 208 AAVhu.51 287 US20150315612 SEQ ID NO: 190 AAVhu.52 288 US20150315612 SEQ ID NO: 210 AAVhu.52 289 US20150315612 SEQ ID NO: 191 AAVhu.53 290 US20150159173 SEQ ID NO: 19 AAVhu.53 291 US20150159173 SEQ ID NO: 35 AAVhu.53 292 US20150315612 SEQ ID NO: 176 (AAV145.1) AAVhu.54 293 US20150315612 SEQ ID NO: 188 AAVhu.54 294 US20150315612 SEQ ID No: 177 (AAV145.5) AAVhu.55 295 US20150315612 SEQ ID NO: 187 AAVhu.56 296 US20150315612 SEQ ID NO: 205 AAVhu.56 297 US20150315612 SEQ ID NO: 168 (AAV145.6) AAVhu.56 298 US20150315612 SEQ ID NO: 192 (AAV145.6) AAVhu.57 299 US20150315612 SEQ ID NO: 206 AAVhu.57 300 US20150315612 SEQ ID NO: 169 AAVhu.57 301 US20150315612 SEQ ID NO: 193 AAVhu.58 302 US20150315612 SEQ ID NO: 207 AAVhu.58 303 US20150315612 SEQ ID NO: 194 AAVhu.6 304 US20150315612 SEQ ID NO: 5 (AAV3.1) AAVhu.6 305 US20150315612 SEQ ID NO: 84 (AAV3.1) AAVhu.60 306 US20150315612 SEQ ID NO: 184 AAVhu.60 307 US20150315612 SEQ ID NO: 170 (AAV161.10) AAVhu.61 308 US20150315612 SEQ ID NO: 185 AAVhu.61 309 US20150315612 SEQ ID NO: 174 (AAV161.6) AAVhu.63 310 US20150315612 SEQ ID NO: 204 AAVhu.63 311 US20150315612 SEQ ID NO: 195 AAVhu.64 312 US20150315612 SEQ ID NO: 212 AAVhu.64 313 US20150315612 SEQ ID NO: 196 AAVhu.66 314 US20150315612 SEQ ID NO: 197 AAVhu.67 315 US20150315612 SEQ ID NO: 215 AAVhu.67 316 US20150315612 SEQ ID NO: 198 AAVhu.7 317 US20150315612 SEQ ID NO: 226 AAVhu.7 318 US20150315612 SEQ ID NO: 150 AAVhu.7 319 US20150315612 SEQ ID NO: 55 (AAV7.3) AAVhu.71 320 US20150315612 SEQ ID NO: 79 AAVhu.8 321 US20150315612 SEQ ID NO: 53 AAVhu.8 322 US20150315612 SEQ ID NO: 12 AAVhu.8 323 US20150315612 SEQ ID NO: 151 AAVhu.9 324 US20150315612 SEQ ID NO: 58 (AAV3.1) AAVhu.9 325 US20150315612 SEQ ID NO: 155 (AAV3.1) AAV-LK01 326 US20150376607 SEQ ID NO: 2 AAV-LK01 327 US20150376607 SEQ ID NO: 29 AAV-LK02 328 US20150376607 SEQ ID NO: 3 AAV-LK02 329 US20150376607 SEQ ID NO: 30 AAV-LK03 330 US20150376607 SEQ ID NO: 4 AAV-LK03 331 WO2015121501 SEQ ID NO: 12, US20150376607 SEQ ID NO: 31 AAV-LK04 332 US20150376607 SEQ ID NO: 5 AAV-LK04 333 US20150376607 SEQ ID NO: 32 AAV-LK05 334 US20150376607 SEQ ID NO: 6 AAV-LK05 335 US20150376607 SEQ ID NO: 33 AAV-LK06 336 US20150376607 SEQ ID NO: 7 AAV-LK06 337 US20150376607 SEQ ID NO: 34 AAV-LK07 338 US20150376607 SEQ ID NO: 8 AAV-LK07 339 US20150376607 SEQ ID NO: 35 AAV-LK08 340 US20150376607 SEQ ID NO: 9 AAV-LK08 341 US20150376607 SEQ ID NO: 36 AAV-LK09 342 US20150376607 SEQ ID NO: 10 AAV-LK09 343 US20150376607 SEQ ID NO: 37 AAV-LK10 344 US20150376607 SEQ ID NO: 11 AAV-LK10 345 US20150376607 SEQ ID NO: 38 AAV-LK11 346 US20150376607 SEQ ID NO: 12 AAV-LK11 347 US20150376607 SEQ ID NO: 39 AAV-LK12 348 US20150376607 SEQ ID NO: 13 AAV-LK12 349 US20150376607 SEQ ID NO: 40 AAV-LK13 350 US20150376607 SEQ ID NO: 14 AAV-LK13 351 US20150376607 SEQ ID NO: 41 AAV-LK14 352 US20150376607 SEQ ID NO: 15 AAV-LK14 353 US20150376607 SEQ ID NO: 42 AAV-LK15 354 US20150376607 SEQ ID NO: 16 AAV-LK15 355 US20150376607 SEQ ID NO: 43 AAV-LK16 356 US20150376607 SEQ ID NO: 17 AAV-LK16 357 US20150376607 SEQ ID NO: 44 AAV-LK17 358 US20150376607 SEQ ID NO: 18 AAV-LK17 359 US20150376607 SEQ ID NO: 45 AAV-LK18 360 US20150376607 SEQ ID NO: 19 AAV-LK18 361 US20150376607 SEQ ID NO: 46 AAV-LK19 362 US20150376607 SEQ ID NO: 20 AAV-LK19 363 US20150376607 SEQ ID NO: 47 AAV-PAEC 364 US20150376607 SEQ ID NO: 1 AAV-PAEC 365 US20150376607 SEQ ID NO: 48 AAV-PAEC11 366 US20150376607 SEQ ID NO: 26 AAV-PAEC11 367 US20150376607 SEQ ID NO: 54 AAV-PAEC12 368 US20150376607 SEQ ID NO: 27 AAV-PAEC12 369 US20150376607 SEQ ID NO: 51 AAV-PAEC13 370 US20150376607 SEQ ID NO: 28 AAV-PAEC13 371 US20150376607 SEQ ID NO: 49 AAV-PAEC2 372 US20150376607 SEQ ID NO: 21 AAV-PAEC2 373 US20150376607 SEQ ID NO: 56 AAV-PAEC4 374 US20150376607 SEQ ID NO: 22 AAV-PAEC4 375 US20150376607 SEQ ID NO: 55 AAV-PAEC6 376 US20150376607 SEQ ID NO: 23 AAV-PAEC6 377 US20150376607 SEQ ID NO: 52 AAV-PAEC7 378 US20150376607 SEQ ID NO: 24 AAV-PAEC7 379 US20150376607 SEQ ID NO: 53 AAV-PAEC8 380 US20150376607 SEQ ID NO: 25 AAV-PAEC8 381 US20150376607 SEQ ID NO: 50 AAVpi.1 382 US20150315612 SEQ ID NO: 28 AAVpi.1 383 US20150315612 SEQ ID NO: 93 AAVpi.2 384 US20150315612 SEQ ID NO: 30 AAVpi.2 385 US20150315612 SEQ ID NO: 95 AAVpi.3 386 US20150315612 SEQ ID NO: 29 AAVpi.3 387 US20150315612 SEQ ID NO: 94 AAVrh.10 388 US20150159173 SEQ ID NO: 9 AAVrh.10 389 US20150159173 SEQ ID NO: 25 AAV44.2 390 US20030138772 SEQ ID NO: 59 AAVrh.10 391 US20030138772 SEQ ID NO: 81 (AAV44.2) AAV42.1B 392 US20030138772 SEQ ID NO: 90 AAVrh.12 393 US20030138772 SEQ ID NO: 30 (AAV42.1b) AAVrh.13 394 US20150159173 SEQ ID NO: 10 AAVrh.13 395 US20150159173 SEQ ID NO: 26 AAVrh.13 396 US20150315612 SEQ ID NO: 228 AAVrh.13R 397 US20150159173 AAV42.3A 398 US20030138772 SEQ ID NO: 87 AAVrh.14 399 US20030138772 SEQ ID NO: 32 (AAV42.3a) AAV42.5A 400 US20030138772 SEQ ID NO: 89 AAVrh.17 401 US20030138772 SEQ ID NO: 34 (AAV42.5a) AAV42.5B 402 US20030138772 SEQ ID NO: 91 AAVrh.18 403 US20030138772 SEQ ID NO: 29 (AAV42.5b) AAV42.6B 404 US20030138772 SEQ ID NO: 112 AAVrh.19 405 US20030138772 SEQ ID NO: 38 (AAV42.6b) AAVrh.2 406 US20150159173 SEQ ID NO: 39 AAVrh.2 407 US20150315612 SEQ ID NO: 231 AAVrh.20 408 US20150159173 SEQ ID NO: 1 AAV42.10 409 US20030138772 SEQ ID NO: 106 AAVrh.21 410 US20030138772 SEQ ID NO: 35 (AAV42.10) AAV42.11 411 US20030138772 SEQ ID NO: 108 AAVrh.22 412 US20030138772 SEQ ID NO: 37 (AAV42.11) AAV42.12 413 US20030138772 SEQ ID NO: 113 AAVrh.23 414 US20030138772 SEQ ID NO: 58 (AAV42.12) AAV42.13 415 US20030138772 SEQ ID NO: 86 AAVrh.24 416 US20030138772 SEQ ID NO: 31 (AAV42.13) AAV42.15 417 US20030138772 SEQ ID NO: 84 AAVrh.25 418 US20030138772 SEQ ID NO: 28 (AAV42.15) AAVrh.2R 419 US20150159173 AAVrh.31 420 US20030138772 SEQ ID NO: 48 (AAV223.1) AAVC1 421 US20030138772 SEQ ID NO: 60 AAVrh.32 422 US20030138772 SEQ ID NO: 19 (AAVC1) AAVrh.32/33 423 US20150159173 SEQ ID NO: 2 AAVrh.33 424 US20030138772 SEQ ID NO: 20 (AAVC3) AAVC5 425 US20030138772 SEQ ID NO: 62 AAVrh.34 426 US20030138772 SEQ ID NO: 21 (AAVC5) AAVF1 427 US20030138772 SEQ ID NO: 109 AAVrh.35 428 US20030138772 SEQ ID NO: 22 (AAVF1) AAVF3 429 US20030138772 SEQ ID NO: 111 AAVrh.36 430 US20030138772 SEQ ID NO: 23 (AAVF3) AAVrh.37 431 US20030138772 SEQ ID NO: 24 AAVrh.37 432 US20150159173 SEQ ID NO: 40 AAVrh.37 433 US20150315612 SEQ ID NO: 229 AAVrh.37R2 434 US20150159173 AAVrh.38 435 US20150315612 SEQ ID NO: 7 (AAVLG-4) AAVrh.38 436 US20150315612 SEQ ID NO: 86 (AAVLG-4) AAVrh.39 437 US20150159173 SEQ ID NO: 20, US20150315612 SEQ ID NO: 13 AAVrh.39 438 US20150159173 SEQ ID NO: 3, US20150159173 SEQ ID NO: 36, US20150315612 SEQ ID NO: 89 AAVrh.40 439 US20150315612 SEQ ID NO: 92 AAVrh.40 440 US20150315612 SEQ ID No: 14 (AAVLG-10) AAVrh.43 441 US20150315612 SEQ ID NO: 43, (AAVN721-R) US20150159173 SEQ ID NO: 21 AAVrh.43 442 US20150315612 SEQ ID NO: 163, (AAVN721-8) US20150159173 SEQ ID NO: 37 AAVrh.44 443 US20150315612 SEQ ID NO: 34 AAVrh.44 444 US20150315612 SEQ ID NO: 111 AAVrh.45 445 US20150315612 SEQ ID NO: 41 AAVrh.45 446 US20150315612 SEQ ID NO: 109 AAVrh.46 447 US20150159173 SEQ ID NO: 22, US20150315612 SEQ ID NO: 19 AAVrh.46 448 US20150159173 SEQ ID NO: 4, US20150315612 SEQ ID NO: 101 AAVrh.47 449 US20150315612 SEQ ID NO: 38 AAVrh.47 450 US20150315612 SEQ ID NO: 118 AAVrh.48 451 US20150159173 SEQ ID NO: 44, US20150315612 SEQ ID NO: 115 AAVrh.48.1 452 US20150159173 AAVrh.48.1.2 453 US20150159173 AAVrh.48.2 454 US20150159173 AAVrh.48 455 US20150315612 SEQ ID NO: 32 (AAV1-7) AAVrh.49 456 US20150315612 SEQ ID NO: 25 (AAV1-8) AAVrh.49 457 US20150315612 SEQ ID NO: 103 (AAV1-8) AAVrh.50 458 US20150315612 SEQ ID NO: 23 (AAV2-4) AAVrh.50 459 US20150315612 SEQ ID NO: 108 (AAV2-4) AAVrh.51 460 US20150315612 SEQ ID No: 22 (AAV2-5) AAVrh.51 461 US20150315612 SEQ ID NO: 104 (AAV2-5) AAVrh.52 462 US20150315612 SEQ ID NO: 18 (AAV3-9) AAVrh.52 463 US20150315612 SEQ ID NO: 96 (AAV3-9) AAVrh.53 464 US20150315612 SEQ ID NO: 97 AAVrh.53 465 US20150315612 SEQ ID NO: 17 (AAV3-11) AAVrh.53 466 US20150315612 SEQ ID NO: 186 (AAV3-11) AAVrh.54 467 US20150315612 SEQ ID NO: 40 AAVrh.54 468 US20150159173 SEQ ID NO: 49, US20150315612 SEQ ID NO: 116 AAVrh.55 469 US20150315612 SEQ ID NO: 37 AAVrh.55 470 US20150315612 SEQ ID NO: 117 (AAV4-19) AAVrh.56 471 US20150315612 SEQ ID NO: 54 AAVrh.56 472 US20150315612 SEQ ID NO: 152 AAVrh.57 473 US20150315612 SEQ ID NO: 26 AAVrh.57 474 US20150315612 SEQ ID NO: 105 AAVrh.58 475 US20150315612 SEQ ID NO: 27 AAVrh.58 476 US20150159173 SEQ ID NO: 48, US20150315612 SEQ ID NO: 106 AAVrh.58 477 US20150315612 SEQ ID NO: 232 AAVrh.59 478 US20150315612 SEQ ID NO: 42 AAVrh.59 479 US20150315612 SEQ ID NO: 110 AAVrh.60 480 US20150315612 SEQ ID NO: 31 AAVrh.60 481 US20150315612 SEQ ID NO: 120 AAVrh.61 482 US20150315612 SEQ ID NO: 107 AAVrh.61 483 US20150315612 SEQ ID NO: 21 (AAV2-3) AAVrh.62 484 US20150315612 SEQ ID No: 33 (AAV2-15) AAVrh.62 485 US20150315612 SEQ ID NO: 114 (AAV2-15) AAVrh.64 486 US20150315612 SEQ ID No: 15 AAVrh.64 487 US20150159173 SEQ ID NO: 43, US20150315612 SEQ ID NO: 99 AAVrh.64 488 US20150315612 SEQ ID NO: 233 AAVRh.64R1 489 US20150159173 AAVRh.64R2 490 US20150159173 AAVrh.65 491 US20150315612 SEQ ID NO: 35 AAVrh.65 492 US20150315612 SEQ ID NO: 112 AAVrh.67 493 US20150315612 SEQ ID NO: 36 AAVrh.67 494 US20150315612 SEQ ID NO: 230 AAVrh.67 495 US20150159173 SEQ ID NO: 47, US20150315612 SEQ ID NO: 113 AAVrh.68 496 US20150315612 SEQ ID NO: 16 AAVrh.68 497 US20150315612 SEQ ID NO: 100 AAVrh.69 498 US20150315612 SEQ ID NO: 39 AAVrh.69 499 US20150315612 SEQ ID NO: 119 AAVrh.70 500 US20150315612 SEQ ID NO: 20 AAVrh.70 501 US20150315612 SEQ ID NO: 98 AAVrh.71 502 US20150315612 SEQ ID NO: 162 AAVrh.72 503 US20150315612 SEQ ID NO: 9 AAVrh.73 504 US20150159173 SEQ ID NO: 5 AAVrh.74 505 US20150159173 SEQ ID NO: 6 AAVrh.8 506 US20150159173 SEQ ID NO: 41 AAVrh.8 507 US20150315612 SEQ ID NO: 235 AAVrh.8R 508 US20150159173, WO2015168666 SEQ ID NO: 9 AAVrh.8R 509 WO2015168666 SEQ ID NO: 10 A586R mutant AAVrh.8R 510 WO2015168666 SEQ ID NO: 11 R533A mutant BAAV 511 U.S. Pat. No. 9,193,769 SEQ ID NO: 8 (bovine AAV) BAAV 512 U.S. Pat. No. 9,193,769 SEQ ID NO: 10 (bovine AAV) BAAV 513 U.S. Pat. No. 9,193,769 SEQ ID NO: 4 (bovine AAV) BAAV 514 U.S. Pat. No. 9,193,769 SEQ ID NO: 2 (bovine AAV) BAAV 515 U.S. Pat. No. 9,193,769 SEQ ID NO: 6 (bovine AAV) BAAV 516 U.S. Pat. No. 9,193,769 SEQ ID NO: 1 (bovine AAV) BAAV 517 U.S. Pat. No. 9,193,769 SEQ ID NO: 5 (bovine AAV) BAAV 518 U.S. Pat. No. 9,193,769 SEQ ID NO: 3 (bovine AAV) BAAV 519 U.S. Pat. No. 9,193,769 SEQ ID NO: 11 (bovine AAV) BAAV 520 U.S. Pat. No. 7,427,396 SEQ ID NO: 5 (bovine AAV) BAAV 521 U.S. Pat. No. 7,427,396 SEQ ID NO: 6 (bovine AAV) BAAV 522 U.S. Pat. No. 9,193,769 SEQ ID NO: 7 (bovine AAV) BAAV 523 U.S. Pat. No. 9,193,769 SEQ ID NO: 9 (bovine AAV) BNP61 AAV 524 US20150238550 SEQ ID NO: 1 BNP61 AAV 525 US20150238550 SEQ ID NO: 2 BNP62 AAV 526 US20150238550 SEQ ID NO: 3 BNP63 AAV 527 US20150238550 SEQ ID NO: 4 caprine AAV 528 U.S. Pat. No. 7,427,396 SEQ ID NO: 3 caprine AAV 529 U.S. Pat. No. 7,427,396 SEQ ID NO: 4 true type AAV 530 WO2015121501 SEQ ID NO: 2 (ttAAV) AAAV 531 U.S. Pat. No. 9,238,800 SEQ ID NO: 12 (Avian AAV) AAAV 532 U.S. Pat. No. 9,238,800 SEQ ID NO: 2 (Avian AAV) AAAV 533 U.S. Pat. No. 9,238,800 SEQ ID NO: 6 (Avian AAV) AAAV 534 U.S. Pat. No. 9,238,800 SEQ ID NO: 4 (Avian AAV) AAAV 535 U.S. Pat. No. 9,238,800 SEQ ID NO: 8 (Avian AAV) AAAV 536 U.S. Pat. No. 9,238,800 SEQ ID NO: 14 (Avian AAV) AAAV 537 U.S. Pat. No. 9,238,800 SEQ ID NO: 10 (Avian AAV) AAAV 538 U.S. Pat. No. 9,238,800 SEQ ID NO: 15 (Avian AAV) AAAV 539 U.S. Pat. No. 9,238,800 SEQ ID NO: 5 (Avian AAV) AAAV 540 U.S. Pat. No. 9,238,800 SEQ ID NO: 9 (Avian AAV) AAAV 541 U.S. Pat. No. 9,238,800 SEQ ID NO: 3 (Avian AAV) AAAV 542 U.S. Pat. No. 9,238,800 SEQ ID NO: 7 (Avian AAV) AAAV 543 U.S. Pat. No. 9,238,800 SEQ ID NO: 11 (Avian AAV) AAAV 544 U.S. Pat. No. 9,238,800 SEQ ID NO: 13 (Avian AAV) AAAV 545 U.S. Pat. No. 9,238,800 SEQ ID NO: 1 (Avian AAV) AAV Shuffle 546 US20160017295 SEQ ID NO: 23 100-1 AAV Shuffle 547 US20160017295 SEQ ID NO: 11 100-1 AAV Shuffle 548 US20160017295 SEQ ID NO: 37 100-2 AAV Shuffle 549 US20160017295 SEQ ID NO: 29 100-2 AAV Shuffle 550 US20160017295 SEQ ID NO: 24 100-3 AAV Shuffle 551 US20160017295 SEQ ID NO: 12 100-3 AAV Shuffle 552 US20160017295 SEQ ID NO: 25 100-7 AAV Shuffle 553 US20160017295 SEQ ID NO: 13 100-7 AAV Shuffle 554 US20160017295 SEQ ID NO: 34 10-2 AAV Shuffle 555 US20160017295 SEQ ID NO: 26 10-2 AAV Shuffle 556 US20160017295 SEQ ID NO: 35 10-6 AAV Shuffle 557 US20160017295 SEQ ID NO: 27 10-6 AAV Shuffle 558 US20160017295 SEQ ID NO: 36 10-8 AAV Shuffle 559 US20160017295 SEQ ID NO: 28 10-8 AAV SM 100-10 560 US20160017295 SEQ ID NO: 41 AAV SM 100-10 561 US20160017295 SEQ ID NO: 33 AAV SM 100-3 562 US20160017295 SEQ ID NO: 40 AAV SM 100-3 563 US20160017295 SEQ ID NO: 32 AAV SM 10-1 564 US20160017295 SEQ ID NO: 38 AAV SM 10-1 565 US20160017295 SEQ ID NO: 30 AAV SM 10-2 566 US20160017295 SEQ ID NO: 10 AAV SM 10-2 567 US20160017295 SEQ ID NO: 22 AAV SM 10-8 568 US20160017295 SEQ ID NO: 39 AAV SM 10-8 569 US20160017295 SEQ ID NO: 31 AAVF1/HSC1 570 WO2016049230 SEQ ID NO: 20 AAVF2/HSC2 571 WO2016049230 SEQ ID NO: 21 AAVF3/HSC3 572 WO2016049230 SEQ ID NO: 22 AAVF4/HSC4 573 WO2016049230 SEQ ID NO: 23 AAVF5/HSC5 574 WO2016049230 SEQ ID NO: 25 AAVF6/HSC6 575 WO2016049230 SEQ ID NO: 24 AAVF7/HSC7 576 WO2016049230 SEQ ID NO: 27 AAVF8/HSC8 577 WO2016049230 SEQ ID NO: 28 AAVF9/HSC9 578 WO2016049230 SEQ ID NO: 29 AAVF11/HSC11 579 WO2016049230 SEQ ID NO: 26 AAVF12/HSC12 580 WO2016049230 SEQ ID NO: 30 AAVF13/HSC13 581 WO2016049230 SEQ ID NO: 31 AAVF14/HSC14 582 WO2016049230 SEQ ID NO: 32 AAVF15/HSC15 583 WO2016049230 SEQ ID NO: 33 AAVF16/HSC16 584 WO2016049230 SEQ ID NO: 34 AAVF17/HSC17 585 WO2016049230 SEQ ID NO: 35 AAVF1/HSC1 586 WO2016049230 SEQ ID NO: 2 AAVF2/HSC2 587 WO2016049230 SEQ ID NO: 3 AAVF3/HSC3 588 WO2016049230 SEQ ID NO: 5 AAVF4/HSC4 589 WO2016049230 SEQ ID NO: 6 AAVF5/HSC5 590 WO2016049230 SEQ ID NO: 11 AAVF6/HSC6 591 WO2016049230 SEQ ID NO: 7 AAVF7/HSC7 592 WO2016049230 SEQ ID NO: 8 AAVF8/HSC8 593 WO2016049230 SEQ ID NO: 9 AAVF9/HSC9 594 WO2016049230 SEQ ID NO: 10 AAVF11/HSC11 595 WO2016049230 SEQ ID NO: 4 AAVF12/HSC12 596 WO2016049230 SEQ ID NO: 12 AAVF13/HSC13 597 WO2016049230 SEQ ID NO: 14 AAVF14/HSC14 598 WO2016049230 SEQ ID NO: 15 AAVF15/HSC15 599 WO2016049230 SEQ ID NO: 16 AAVF16/HSC16 600 WO2016049230 SEQ ID NO: 17 AAVF17/HSC17 601 WO2016049230 SEQ ID NO: 13 AAV CBr-E1 602 U.S. Pat. No. 8,734,809 SEQ ID NO: 13 AAV CBr-E2 603 U.S. Pat. No. 8,734,809 SEQ ID NO: 14 AAV CBr-E3 604 U.S. Pat. No. 8,734,809 SEQ ID NO: 15 AAV CBr-E4 605 U.S. Pat. No. 8,734,809 SEQ ID NO: 16 AAV CBr-E5 606 U.S. Pat. No. 8,734,809 SEQ ID NO: 17 AAV CBr-e5 607 U.S. Pat. No. 8,734,809 SEQ ID NO: 18 AAV CBr-E6 608 U.S. Pat. No. 8,734,809 SEQ ID NO: 19 AAV CBr-E7 609 U.S. Pat. No. 8,734,809 SEQ ID NO: 20 AAV CBr-E8 610 U.S. Pat. No. 8,734,809 SEQ ID NO: 21 AAV CLv-D1 611 U.S. Pat. No. 8,734,809 SEQ ID NO: 22 AAV CLv-D2 612 U.S. Pat. No. 8,734,809 SEQ ID NO: 23 AAV CLv-D3 613 U.S. Pat. No. 8,734,809 SEQ ID NO: 24 AAV CLv-D4 614 U.S. Pat. No. 8,734,809 SEQ ID NO: 25 AAV CLv-D5 615 U.S. Pat. No. 8,734,809 SEQ ID NO: 26 AAV CLv-D6 616 U.S. Pat. No. 8,734,809 SEQ ID NO: 27 AAV CLv-D7 617 U.S. Pat. No. 8,734,809 SEQ ID NO: 28 AAV CLv-D8 618 U.S. Pat. No. 8,734,809 SEQ ID NO: 29 AAV CLv-E1 619 U.S. Pat. No. 8,734,809 SEQ ID NO: 13 AAV CLv-R1 620 U.S. Pat. No. 8,734,809 SEQ ID NO: 30 AAV CLv-R2 621 U.S. Pat. No. 8,734,809 SEQ ID NO: 31 AAV CLv-R3 622 U.S. Pat. No. 8,734,809 SEQ ID NO: 32 AAV CLv-R4 623 U.S. Pat. No. 8,734,809 SEQ ID NO: 33 AAV CLv-R5 624 U.S. Pat. No. 8,734,809 SEQ ID NO: 34 AAV CLv-R6 625 U.S. Pat. No. 8,734,809 SEQ ID NO: 35 AAV CLv-R7 626 U.S. Pat. No. 8,734,809 SEQ ID NO: 36 AAV CLv-R8 627 U.S. Pat. No. 8,734,809 SEQ ID NO: 37 AAV CLv-R9 628 U.S. Pat. No. 8,734,809 SEQ ID NO: 38 AAV CLg-F1 629 U.S. Pat. No. 8,734,809 SEQ ID NO: 39 AAV CLg-F2 630 U.S. Pat. No. 8,734,809 SEQ ID NO: 40 AAV CLg-F3 631 U.S. Pat. No. 8,734,809 SEQ ID NO: 41 AAV CLg-F4 632 U.S. Pat. No. 8,734,809 SEQ ID NO: 42 AAV CLg-F5 633 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CLg-F6 634 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CLg-F7 635 U.S. Pat. No. 8,734,809 SEQ ID NO: 44 AAV CLg-F8 636 U.S. Pat. No. 8,734,809 SEQ ID NO: 43 AAV CSp-1 637 U.S. Pat. No. 8,734,809 SEQ ID NO: 45 AAV CSp-10 638 U.S. Pat. No. 8,734,809 SEQ ID NO: 46 AAV CSp-11 639 U.S. Pat. No. 8,734,809 SEQ ID NO: 47 AAV CSp-2 640 U.S. Pat. No. 8,734,809 SEQ ID NO: 48 AAV CSp-3 641 U.S. Pat. No. 8,734,809 SEQ ID NO: 49 AAV CSp-4 642 U.S. Pat. No. 8,734,809 SEQ ID NO: 50 AAV CSp-6 643 U.S. Pat. No. 8,734,809 SEQ ID NO: 51 AAV CSp-7 644 U.S. Pat. No. 8,734,809 SEQ ID NO: 52 AAV CSp-8 645 U.S. Pat. No. 8,734,809 SEQ ID NO: 53 AAV CSp-9 646 U.S. Pat. No. 8,734,809 SEQ ID NO: 54 AAV CHt-2 647 U.S. Pat. No. 8,734,809 SEQ ID NO: 55 AAV CHt-3 648 U.S. Pat. No. 8,734,809 SEQ ID NO: 56 AAV CKd-1 649 U.S. Pat. No. 8,734,809 SEQ ID NO: 57 AAV CKd-10 650 U.S. Pat. No. 8,734,809 SEQ ID NO: 58 AAV CKd-2 651 U.S. Pat. No. 8,734,809 SEQ ID NO: 59 AAV CKd-3 652 U.S. Pat. No. 8,734,809 SEQ ID NO: 60 AAV CKd-4 653 U.S. Pat. No. 8,734,809 SEQ ID NO: 61 AAV CKd-6 654 U.S. Pat. No. 8,734,809 SEQ ID NO: 62 AAV CKd-7 655 U.S. Pat. No. 8,734,809 SEQ ID NO: 63 AAV CKd-8 656 U.S. Pat. No. 8,734,809 SEQ ID NO: 64 AAV CLv-1 657 U.S. Pat. No. 8,734,809 SEQ ID NO: 65 AAV CLv-12 658 U.S. Pat. No. 8,734,809 SEQ ID NO: 66 AAV CLv-13 659 U.S. Pat. No. 8,734,809 SEQ ID NO: 67 AAV CLv-2 660 U.S. Pat. No. 8,734,809 SEQ ID NO: 68 AAV CLv-3 661 U.S. Pat. No. 8,734,809 SEQ ID NO: 69 AAV CLv-4 662 U.S. Pat. No. 8,734,809 SEQ ID NO: 70 AAV CLv-6 663 U.S. Pat. No. 8,734,809 SEQ ID NO: 71 AAV CLv-8 664 U.S. Pat. No. 8,734,809 SEQ ID NO: 72 AAV CKd-B1 665 U.S. Pat. No. 8,734,809 SEQ ID NO: 73 AAV CKd-B2 666 U.S. Pat. No. 8,734,809 SEQ ID NO: 74 AAV CKd-B3 667 U.S. Pat. No. 8,734,809 SEQ ID NO: 75 AAV CKd-B4 668 U.S. Pat. No. 8,734,809 SEQ ID NO: 76 AAV CKd-B5 669 U.S. Pat. No. 8,734,809 SEQ ID NO: 77 AAV CKd-B6 670 U.S. Pat. No. 8,734,809 SEQ ID NO: 78 AAV CKd-B7 671 U.S. Pat. No. 8,734,809 SEQ ID NO: 79 AAV CKd-B8 672 U.S. Pat. No. 8,734,809 SEQ ID NO: 80 AAV CKd-H1 673 U.S. Pat. No. 8,734,809 SEQ ID NO: 81 AAV CKd-H2 674 U.S. Pat. No. 8,734,809 SEQ ID NO: 82 AAV CKd-H3 675 U.S. Pat. No. 8,734,809 SEQ ID NO: 83 AAV CKd-H4 676 U.S. Pat. No. 8,734,809 SEQ ID NO: 84 AAV CKd-H5 677 U.S. Pat. No. 8,734,809 SEQ ID NO: 85 AAV CKd-H6 678 U.S. Pat. No. 8,734,809 SEQ ID NO: 77 AAV CHt-1 679 U.S. Pat. No. 8,734,809 SEQ ID NO: 86 AAV CLv1-1 680 U.S. Pat. No. 8,734,809 SEQ ID NO: 171 AAV CLv1-2 681 U.S. Pat. No. 8,734,809 SEQ ID NO: 172 AAV CLv1-3 682 U.S. Pat. No. 8,734,809 SEQ ID NO: 173 AAV CLv1-4 683 U.S. Pat. No. 8,734,809 SEQ ID NO: 174 AAV Clv1-7 684 U.S. Pat. No. 8,734,809 SEQ ID NO: 175 AAV Clv1-8 685 U.S. Pat. No. 8,734,809 SEQ ID NO: 176 AAV Clv1-9 686 U.S. Pat. No. 8,734,809 SEQ ID NO: 177 AAV Clv1-10 687 U.S. Pat. No. 8,734,809 SEQ ID NO: 178 AAV.VR-355 688 U.S. Pat. No. 8,734,809 SEQ ID NO: 181 AAV.hu.48R3 689 U.S. Pat. No. 8,734,809 SEQ ID NO: 183 AAV CBr-E1 690 U.S. Pat. No. 8,734,809 SEQ ID NO: 87 AAV CBr-E2 691 U.S. Pat. No. 8,734,809 SEQ ID NO: 88 AAV CBr-E3 692 U.S. Pat. No. 8,734,809 SEQ ID NO: 89 AAV CBr-E4 693 U.S. Pat. No. 8,734,809 SEQ ID NO: 90 AAV CBr-E5 694 U.S. Pat. No. 8,734,809 SEQ ID NO: 91 AAV CBr-e5 695 U.S. Pat. No. 8,734,809 SEQ ID NO: 92 AAV CBr-E6 696 U.S. Pat. No. 8,734,809 SEQ ID NO: 93 AAV CBr-E7 697 U.S. Pat. No. 8,734,809 SEQ ID NO: 94 AAV CBr-E8 698 U.S. Pat. No. 8,734,809 SEQ ID NO: 95 AAV CLv-D1 699 U.S. Pat. No. 8,734,809 SEQ ID NO: 96 AAV CLv-D2 700 U.S. Pat. No. 8,734,809 SEQ ID NO: 97 AAV CLv-D3 701 U.S. Pat. No. 8,734,809 SEQ ID NO: 98 AAV CLv-D4 702 U.S. Pat. No. 8,734,809 SEQ ID NO: 99 AAV CLv-D5 703 U.S. Pat. No. 8,734,809 SEQ ID NO: 100 AAV CLv-D6 704 U.S. Pat. No. 8,734,809 SEQ ID NO: 101 AAV CLv-D7 705 U.S. Pat. No. 8,734,809 SEQ ID NO: 102 AAV CLv-D8 706 U.S. Pat. No. 8,734,809 SEQ ID NO: 103 AAV CLv-E1 707 U.S. Pat. No. 8,734,809 SEQ ID NO: 87 AAV CLv-R1 708 U.S. Pat. No. 8,734,809 SEQ ID NO: 104 AAV CLv-R2 709 U.S. Pat. No. 8,734,809 SEQ ID NO: 105 AAV CLv-R3 710 U.S. Pat. No. 8,734,809 SEQ ID NO: 106 AAV CLv-R4 711 U.S. Pat. No. 8,734,809 SEQ ID NO: 107 AAV CLv-R5 712 U.S. Pat. No. 8,734,809 SEQ ID NO: 108 AAV CLv-R6 713 U.S. Pat. No. 8,734,809 SEQ ID NO: 109 AAV CLv-R7 714 U.S. Pat. No. 8,734,809 SEQ ID NO: 110 AAV CLv-R8 715 U.S. Pat. No. 8,734,809 SEQ ID NO: 111 AAV CLv-R9 716 U.S. Pat. No. 8,734,809 SEQ ID NO: 112 AAV CLg-F1 717 U.S. Pat. No. 8,734,809 SEQ ID NO: 113 AAV CLg-F2 718 U.S. Pat. No. 8,734,809 SEQ ID NO: 114 AAV CLg-F3 719 U.S. Pat. No. 8,734,809 SEQ ID NO: 115 AAV CLg-F4 720 U.S. Pat. No. 8,734,809 SEQ ID NO: 116 AAV CLg-F5 721 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CLg-F6 722 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CLg-F7 723 U.S. Pat. No. 8,734,809 SEQ ID NO: 118 AAV CLg-F8 724 U.S. Pat. No. 8,734,809 SEQ ID NO: 117 AAV CSp-1 725 U.S. Pat. No. 8,734,809 SEQ ID NO: 119 AAV CSp-10 726 U.S. Pat. No. 8,734,809 SEQ ID NO: 120 AAV CSp-11 727 U.S. Pat. No. 8,734,809 SEQ ID NO: 121 AAV CSp-2 728 U.S. Pat. No. 8,734,809 SEQ ID NO: 122 AAV CSp-3 729 U.S. Pat. No. 8,734,809 SEQ ID NO: 123 AAV CSp-4 730 U.S. Pat. No. 8,734,809 SEQ ID NO: 124 AAV CSp-6 731 U.S. Pat. No. 8,734,809 SEQ ID NO: 125 AAV CSp-7 732 U.S. Pat. No. 8,734,809 SEQ ID NO: 126 AAV CSp-8 733 U.S. Pat. No. 8,734,809 SEQ ID NO: 127 AAV CSp-9 734 U.S. Pat. No. 8,734,809 SEQ ID NO: 128 AAV CHt-2 735 U.S. Pat. No. 8,734,809 SEQ ID NO: 129 AAV CHt-3 736 U.S. Pat. No. 8,734,809 SEQ ID NO: 130 AAV CKd-1 737 U.S. Pat. No. 8,734,809 SEQ ID NO: 131 AAV CKd-10 738 U.S. Pat. No. 8,734,809 SEQ ID NO: 132 AAV CKd-2 739 U.S. Pat. No. 8,734,809 SEQ ID NO: 133 AAV CKd-3 740 U.S. Pat. No. 8,734,809 SEQ ID NO: 134 AAV CKd-4 741 U.S. Pat. No. 8,734,809 SEQ ID NO: 135 AAV CKd-6 742 U.S. Pat. No. 8,734,809 SEQ ID NO: 136 AAV CKd-7 743 U.S. Pat. No. 8,734,809 SEQ ID NO: 137 AAV CKd-8 744 U.S. Pat. No. 8,734,809 SEQ ID NO: 138 AAV CLv-1 745 U.S. Pat. No. 8,734,809 SEQ ID NO: 139 AAV CLv-12 746 U.S. Pat. No. 8,734,809 SEQ ID NO: 140 AAV CLv-13 747 U.S. Pat. No. 8,734,809 SEQ ID NO: 141 AAV CLv-2 748 U.S. Pat. No. 8,734,809 SEQ ID NO: 142 AAV CLv-3 749 U.S. Pat. No. 8,734,809 SEQ ID NO: 143 AAV CLv-4 750 U.S. Pat. No. 8,734,809 SEQ ID NO: 144 AAV CLv-6 751 U.S. Pat. No. 8,734,809 SEQ ID NO: 145 AAV CLv-8 752 U.S. Pat. No. 8,734,809 SEQ ID NO: 146 AAV CKd-B1 753 U.S. Pat. No. 8,734,809 SEQ ID NO: 147 AAV CKd-B2 754 U.S. Pat. No. 8,734,809 SEQ ID NO: 148 AAV CKd-B3 755 U.S. Pat. No. 8,734,809 SEQ ID NO: 149 AAV CKd-B4 756 U.S. Pat. No. 8,734,809 SEQ ID NO: 150 AAV CKd-B5 757 U.S. Pat. No. 8,734,809 SEQ ID NO: 151 AAV CKd-B6 758 U.S. Pat. No. 8,734,809 SEQ ID NO: 152 AAV CKd-B7 759 U.S. Pat. No. 8,734,809 SEQ ID NO: 153 AAV CKd-B8 760 U.S. Pat. No. 8,734,809 SEQ ID NO: 154 AAV CKd-H1 761 U.S. Pat. No. 8,734,809 SEQ ID NO: 155 AAV CKd-H2 762 U.S. Pat. No. 8,734,809 SEQ ID NO: 156 AAV CKd-H3 763 U.S. Pat. No. 8,734,809 SEQ ID NO: 157 AAV CKd-H4 764 U.S. Pat. No. 8,734,809 SEQ ID NO: 158 AAV CKd-H5 765 U.S. Pat. No. 8,734,809 SEQ ID NO: 159 AAV CKd-H6 766 U.S. Pat. No. 8,734,809 SEQ ID NO: 151 AAV CHt-1 767 U.S. Pat. No. 8,734,809 SEQ ID NO: 160 AAV CHt-P2 768 WO2016065001 SEQ ID NO: 1 AAV CHt-P5 769 WO2016065001 SEQ ID NO: 2 AAV CHt-P9 770 WO2016065001 SEQ ID NO: 3 AAV CBr-7.1 771 WO2016065001 SEQ ID NO: 4 AAV CBr-7.2 772 WO2016065001 SEQ ID NO: 5 AAV CBr-7.3 773 WO2016065001 SEQ ID NO: 6 AAV CBr-7.4 774 WO2016065001 SEQ ID NO: 7 AAV CBr-7.5 775 WO2016065001 SEQ ID NO: 8 AAV CBr-7.7 776 WO2016065001 SEQ ID NO: 9 AAV CBr-7.8 777 WO2016065001 SEQ ID NO: 10 AAV CBr-7.10 778 WO2016065001 SEQ ID NO: 11 AAV CKd-N3 779 WO2016065001 SEQ ID NO: 12 AAV CKd-N4 780 WO2016065001 SEQ ID NO: 13 AAV CKd-N9 781 WO2016065001 SEQ ID NO: 14 AAV CLv-L4 782 WO2016065001 SEQ ID NO: 15 AAV CLv-L5 783 WO2016065001 SEQ ID NO: 16 AAV CLv-L6 784 WO2016065001 SEQ ID NO: 17 AAV CLv-K1 785 WO2016065001 SEQ ID NO: 18 AAV CLv-K3 786 WO2016065001 SEQ ID NO: 19 AAV CLv-K6 787 WO2016065001 SEQ ID NO: 20 AAV CLv-M1 788 WO2016065001 SEQ ID NO: 21 AAV CLv-M11 789 WO2016065001 SEQ ID NO: 22 AAV CLv-M2 790 WO2016065001 SEQ ID NO: 23 AAV CLv-M5 791 WO2016065001 SEQ ID NO: 24 AAV CLv-M6 792 WO2016065001 SEQ ID NO: 25 AAV CLv-M7 793 WO2016065001 SEQ ID NO: 26 AAV CLv-M8 794 WO2016065001 SEQ ID NO: 27 AAV CLv-M9 795 WO2016065001 SEQ ID NO: 28 AAV CHt-P1 796 WO2016065001 SEQ ID NO: 29 AAV CHt-P6 797 WO2016065001 SEQ ID NO: 30 AAV CHt-P8 798 WO2016065001 SEQ ID NO: 31 AAV CHt-6.1 799 WO2016065001 SEQ ID NO: 32 AAV CHt-6.10 800 WO2016065001 SEQ ID NO: 33 AAV CHt-6.5 801 WO2016065001 SEQ ID NO: 34 AAV CHt-6.6 802 WO2016065001 SEQ ID NO: 35 AAV CHt-6.7 803 WO2016065001 SEQ ID NO: 36 AAV CHt-6.8 804 WO2016065001 SEQ ID NO: 37 AAV CSp-8.10 805 WO2016065001 SEQ ID NO: 38 AAV CSp-8.2 806 WO2016065001 SEQ ID NO: 39 AAV CSp-8.4 807 WO2016065001 SEQ ID NO: 40 AAV CSp-8.5 808 WO2016065001 SEQ ID NO: 41 AAV CSp-8.6 809 WO2016065001 SEQ ID NO: 42 AAV CSp-8.7 810 WO2016065001 SEQ ID NO: 43 AAV CSp-8.8 811 WO2016065001 SEQ ID NO: 44 AAV CSp-8.9 812 WO2016065001 SEQ ID NO: 45 AAV CBr-B7.3 813 WO2016065001 SEQ ID NO: 46 AAV CBr-B7.4 814 WO2016065001 SEQ ID NO: 47 AAV3B 815 WO2016065001 SEQ ID NO: 48 AAV4 816 WO2016065001 SEQ ID NO: 49 AAV5 817 WO2016065001 SEQ ID NO: 50 AAV CHt-P2 818 WO2016065001 SEQ ID NO: 51 AAV CHt-P5 819 WO2016065001 SEQ ID NO: 52 AAV CHt-P9 820 WO2016065001 SEQ ID NO: 53 AAV CBr-7.1 821 WO2016065001 SEQ ID NO: 54 AAV CBr-7.2 822 WO2016065001 SEQ ID NO: 55 AAV CBr-7.3 823 WO2016065001 SEQ ID NO: 56 AAV CBr-7.4 824 WO2016065001 SEQ ID NO: 57 AAV CBr-7.5 825 WO2016065001 SEQ ID NO: 58 AAV CBr-7.7 826 WO2016065001 SEQ ID NO: 59 AAV CBr-7.8 827 WO2016065001 SEQ ID NO: 60 AAV CBr-7.10 828 WO2016065001 SEQ ID NO: 61 AAV CKd-N3 829 WO2016065001 SEQ ID NO: 62 AAV CKd-N4 830 WO2016065001 SEQ ID NO: 63 AAV CKd-N9 831 WO2016065001 SEQ ID NO: 64 AAV CLv-L4 832 WO2016065001 SEQ ID NO: 65 AAV CLv-L5 833 WO2016065001 SEQ ID NO: 66 AAV CLv-L6 834 WO2016065001 SEQ ID NO: 67 AAV CLv-K1 835 WO2016065001 SEQ ID NO: 68 AAV CLv-K3 836 WO2016065001 SEQ ID NO: 69 AAV CLv-K6 837 WO2016065001 SEQ ID NO: 70 AAV CLv-M1 838 WO2016065001 SEQ ID NO: 71 AAV CLv-M11 839 WO2016065001 SEQ ID NO: 72 AAV CLv-M2 840 WO2016065001 SEQ ID NO: 73 AAV CLv-M5 841 WO2016065001 SEQ ID NO: 74 AAV CLv-M6 842 WO2016065001 SEQ ID NO: 75 AAV CLv-M7 843 WO2016065001 SEQ ID NO: 76 AAV CLv-M8 844 WO2016065001 SEQ ID NO: 77 AAV CLv-M9 845 WO2016065001 SEQ ID NO: 78 AAV CHt-P1 846 WO2016065001 SEQ ID NO: 79 AAV CHt-P6 847 WO2016065001 SEQ ID NO: 80 AAV CHt-P8 848 WO2016065001 SEQ ID NO: 81 AAV CHt-6.1 849 WO2016065001 SEQ ID NO: 82 AAV CHt-6.10 850 WO2016065001 SEQ ID NO: 83 AAV CHt-6.5 851 WO2016065001 SEQ ID NO: 84 AAV CHt-6.6 852 WO2016065001 SEQ ID NO: 85 AAV CHt-6.7 853 WO2016065001 SEQ ID NO: 86 AAV CHt-6.8 854 WO2016065001 SEQ ID NO: 87 AAV CSp-8.10 855 WO2016065001 SEQ ID NO: 88 AAV CSp-8.2 856 WO2016065001 SEQ ID NO: 89 AAV CSp-8.4 857 WO2016065001 SEQ ID NO: 90 AAV CSp-8.5 858 WO2016065001 SEQ ID NO: 91 AAV CSp-8.6 859 WO2016065001 SEQ ID NO: 92 AAV CSp-8.7 860 WO2016065001 SEQ ID NO: 93 AAV CSp-8.8 861 WO2016065001 SEQ ID NO: 94 AAV CSp-8.9 862 WO2016065001 SEQ ID NO: 95 AAV CBr-B7.3 863 WO2016065001 SEQ ID NO: 96 AAV CBr-B7.4 864 WO2016065001 SEQ ID NO: 97 AAV3B 865 WO2016065001 SEQ ID NO: 98 AAV4 866 WO2016065001 SEQ ID NO: 99 AAV5 867 WO2016065001 SEQ ID NO: 100 AAVPHP.B or 868 WO2015038958 SEQ ID NO: 8 and 13; G2B-26 GenBankALU85156.1 AAVPHP.B 869 WO2015038958 SEQ ID NO: 9 AAVG2B-13 870 WO2015038958 SEQ ID NO: 12 AAVTH1.1-32 871 WO2015038958 SEQ ID NO: 14 AAVTH1.1-35 872 WO2015038958 SEQ ID NO: 15

    [0090] Each of the patents, applications and/or publications listed in Table 1 are hereby incorporated by reference in their entirety.

    [0091] In one embodiment, the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2015038958, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 2 and 11 of WO2015038958 or SEQ ID NO: 127 and 126 respectively herein), PHP.B (SEQ ID NO: 8 and 9 of WO2015038958, herein SEQ ID NO: 868 and 869), G2B-13 (SEQ ID NO: 12 of WO2015038958, herein SEQ ID NO: 870), G2B-26 (SEQ ID NO: 13 of WO2015038958, herein SEQ ID NO: 868 and 869). TH1.1-32 (SEQ ID NO: 14 of WO2015038958, herein SEQ ID NO: 871), TH1.1-3.5 (SEQ ID NO: 15 of WO2015038958, herein SEQ ID NO: 872) or variants thereof. Further, any of the targeting peptides or amino acid inserts described in WO2015038958, May be inserted into any parent AAV serotype, such as, but not limited to, AAV9 (SEQ ID NO: 126 for the DNA sequence and SEQ ID NO: 127 for the amino acid sequence). In one embodiment, the amino acid insert is inserted between amino acids 586-592 of the parent AAV (e.g., AAV9). In another embodiment, the amino acid insert is inserted between amino acids 588-589 of the parent AAV sequence. The amino acid insert may be, but is not limited to, any of the following amino acid sequences, TLAVPFK (SEQ ID NO: 1 of WO2015038958; herein SEQ ID NO: 873), KFPVALT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 87), LAVPFK (SEQ ID NO: 31 of WO2015038958; herein SEQ ID NO: 875), AVPFK (SEQ ID NO: 32 of WO2015038958; herein SEQ ID NO: 876), VPFK (SEQ ID NO: 33 of WO2015038958; herein SEQ ID NO: 877), TLAVPF (SEQ ID NO: 34 of WO2015038958; herein SEQ ID NO: 878), TLAVP (SEQ ID NO: 35 of WO2015038958; herein SEQ ID NO: 879), TLAV (SEQ ID NO: 36 of WO2015038958; herein SEQ ID NO: 880), SVSKPFL (SEQ ID NO: 28 of WO2015038958; herein SEQ ID NO: 881), FTLTTPK (SEQ ID NO: 29 of WO2015038958; herein SEQ ID NO: 882), MNATKNV (SEQ ID NO: 30 of WO2015038958; herein SEQ ID NO: 883), QSSQTPR (SEC) ID NO: 54 of WO2015038958; herein SEQ ID NO: 884), ILGTGTS (SEQ ID NO: 55 of WO2015038958; herein SEQ ID NO: 885), TRTNPEA (SEQ ID NO: 56 of WO2015038958; herein SEQ ID NO: 886), NGGTSSS (SEQ ID NO: 58 of WO2015038958; herein SEQ ID NO: 887), or YTLSQGW (SEQ ID NO: 60 of WO2015038958; herein SEQ ID NO: 888). Non-limiting examples of nucleotide sequences that may encode the amino acid inserts include the following, AAGTTTCCTGTGGCGTTGACT (for SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 889), ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24 and 49 of WO2015038958; herein SEQ ID NO: 890), AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 25 of WO2015038958; herein SEQ ID NO: 891), TTTACGTTGACGACGCCTAAG (SEQ ID NO: 26 of WO2015038958; herein SEQ ID NO: 892), ATGAATGCTACGAAGAATGTG (SEQ ID NO: 27 of WO2015038958; herein SEQ ID NO: 893), CAGTCGTCGCAGACGCCTAGG (SEQ ID NO: 48 of WO2015038958; herein SEQ ID NO: 894), ATTCTGGGGACTGGTACTTCG (SEQ ID NO: 50 and 52 of WO2015038958, herein SEQ ID NO: 895), ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51 of WO2015038958; herein SEQ ID NO: 896), AATGGGOGGACTAGTAGTTCT (SEQ ID NO: 53 of WO2015038958; herein SEQ ID NO: 89), or TATACTTTGTCGCAGGGTTGG (SEQ ID NO: 59 of WO2015038958, herein SEQ ID NO: 898).

    Viral Genome Component: Inverted Terminal Repeats (ITRs)

    [0092] The AAV particles of the present invention comprise a viral genome with at least one ITR region and a payload region. In one embodiment, the viral genome has two ITRs. These two ITRs flank the payload region at the 5 and 3 ends. The ITRs function as origins of replication comprising recognition sites for replication. ITRs comprise sequence regions which can be complementary and symmetrically arranged. ITRs incorporated into viral genomes of the invention may be comprised of naturally-occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

    [0093] The ITRs may be derived from the same serotype as the capsid, selected from any of the serotypes listed in Table 1, or a derivative thereof. The ITR may be of a different serotype than the capsid. In one embodiment, the AAV particle has more than one ITR. In a non-limiting example, the AAV particle has a viral genome comprising two ITRs. In one embodiment, the ITRs are of the same serotype as one another. In another embodiment, the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid. In one embodiment both ITRs of the viral genome of the AAV particle are AAV2 ITRs.

    [0094] Independently, each ITR may be about 100 to about 150 nucleotides in length. An ITR may be about 100-105 nucleotides in length, 106-110 nucleotides in length, 111-115 nucleotides in length, 116-120 nucleotides in length, 121-125 nucleotides in length, 126-130 nucleotides in length, 131-135 nucleotides in length, 136-140 nucleotides in length, 141-145 nucleotides in length or 146-150 nucleotides in length. In one embodiment, the ITRs are 140-142 nucleotides in length. Non-limiting examples of ITR length are 102, 140, 141, 142, 145 nucleotides in length, and those having at least 95% identity thereto.

    Viral Genome Component: Promoters

    [0095] In one embodiment, the payload region of the viral genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety). Non-limiting examples of elements to enhance the transgene target specificity and expression include promoters, endogenous mil As, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.

    [0096] A person skilled in the art may recognize that expression of the poly peptides of the invention in a target cell may require a specific promoter, including but not limited to, a promoter that is species specific, inducible, tissue,-specific, or cell cycle-specific (Parr et al., Nat. Med. 3:1145-9 (1997); the contents of which are herein incorporated by reference in their entirety).

    [0097] In one embodiment, the promoter is deemed to be efficient when it drives expression of the polypeptide(s) encoded in the payload region of the viral genome of the AAV particle.

    [0098] In one embodiment, the promoter is a promoter deemed to be efficient when it drives expression in the cell being targeted.

    [0099] In one embodiment, the promoter drives expression of the polypeptides of the invention (e.g., a functional antibody) for a period of time in targeted tissues. Expression driven by a promoter may be for a period of 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years. Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-.5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months. 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years or 5-10 years.

    [0100] In one embodiment, the promoter drives expression of the polypeptides of the invention (e.g., a functional antibody) for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months. 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 3(years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years, or more than 65 years.

    [0101] Promoters may be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters, plant promoters and mammalian promoters. In some embodiments, the promoters may be human promoters. In some embodiments, the promoter may he truncated.

    [0102] Promoters which drive or promote expression in most tissues include, but are not limited to, human elongation factor 1-subunit (EF1), cytomegalovirus (CMV) immediate-early enhancer and/or promoter, chicken -actin (CBA) and its derivative CAG, glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.

    [0103] Non-limiting examples of muscle-specific promoters include mammalian muscle creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, mammalian troponin I (TNNI2) promoter, and mammalian skeletal alpha-actin (ASKA) promoter (see, e.g. U.S. Patent Publication US 20110212529, the contents of which are herein incorporated by reference in their entirety)

    [0104] Non-limiting examples of tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca.sup.2+/calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light (NFL) or heavy (NFH), -globin minigene n2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters. Non-limiting examples of tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters. A non-limiting example of a tissue-specific expression element for oligodendrocytes includes the myelin basic protein (MBP) promoter.

    [0105] In one embodiment, the promoter may be less than 1 kb. The promoter may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480. 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590. 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800 nucleotides. The promoter may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800 600-700, 600-800 or 700-800.

    [0106] In one embodiment, the promoter may be a combination of two or more components of the same or different starting or parental promoters such as, hut not limited to, CMV and CBA. Each component may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 469, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800. Each component ma have a length between 200-300, 200-400, 200-500, 200-600 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 499-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800. In one embodiment, the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence.

    [0107] In one embodiment, the viral genoine comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include CMV, CBA (including derivatives CAG, CBh, etc.), EF-1, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). Yu et al. (Molecular Pain 2011, 7:63; the contents of which are herein incorporated by reference in their entirety) evaluated the expression of eGFP under the CAG, EF1, PGK and UBC promoters in rat DRG cells and primary DRG cells using lentiviral vectors and found that UBC showed weaker expression than the other 3 promoters and only 10-12% glial expression was seen for all promoters. Soderblom et al. (E. Neuro 2015; the contents of which are herein incorporated by reference in its entirety) evaluated the expression of eGFP AAV8 with CMV and UBC promoters and AAV2 with the CMV promoter after injection in the motor cortex. Intranasal administration of a plasmid containing a UBC or EF1 promoter showed a sustained airway expression greater than the expression with the CMV promoter (See e.g., Gill et al., Gene Therapy 2001, Vol. 8, 1539-1546; the contents of which are herein incorporated by reference in their entirety). Husain et al. (Gene Therapy 2009; the contents of which are herein incorporated by reference in its entirety) evaluated an HH construct with a hGUSB promoter, a HSV-1 LAT promoter and an NSE promoter and found that the HH construct showed weaker expression than NSE in mouse brain. Passini and Wolfe (J. Viral. 2001, 12382-12392, the contents of which are herein incorporated by reference in its entirety) evaluated the long-term effects of the HH vector following an intraventricular injection in neonatal mice and found that there was sustained expression for at least 1 year. Low expression in all brain regions was found by Xu et al. (Gene Therapy 2001, 8, 1323-1332; the contents of which are herein incorporated by reference in their entirety) when NFL and NFH promoters were used as compared to the CMV-lacZ, CMV-luc, EF, GFAP, hENK, nAChR, PPE, PPE+wpre, NSE (0.3 kb), NSF (1.8 kb) and NSE (1.8 kb+wpre). Xu et al. found that the promoter activity in descending order was NSE (1.8 kb), EF, NSE (0.3 kb), GFAP, CMV, hENK, PPE, NFL and NFH. NFL is a 650-nucleotide promoter and NFH is a 920-nucleotide promoter which are both absent in the liver but NFH is abundant in the sensory proprioceptive neurons, brain and spinal cord and NFH is present in the heart. Scn8a is a 470 nucleotide promoter which expresses throughout the DRG, spinal cord and brain with particularly high expression seen in the hippocampal neurons and cerebellar Purkinje cells, cortex, thalamus and hypothalamus (See e.g., Drews et al. Identification of evolutionary conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A, Mamm Genome (2007) 18:723-731; and Raymond et al. Expression of Alternatively Spliced Sodium channel a-subunit genes. Journal of Biological Chemistry (2004) 279(44) 46234-46241; the contents of each of which are herein incorporated by reference in their entireties).

    [0108] Any of promoters taught by the aforementioned Yu, Soderblom, Gill, Husain, Passini, Xu, Drews or Raymond may be used in the present inventions.

    [0109] In one embodiment, the promoter is not cell specific.

    [0110] In one embodiment, the promoter is an ubiquitin c (UBC) promoter. The UBC promoter may have a size of 300-350 nucleotides. As a non-limiting example, the UBC promoter is 332 nucleotides.

    [0111] In one embodiment, the promoter is a -glucuronidase (GUSB) promoter. The GUSB promoter may have a size of 350-400 nucleotides. As anon-limiting example, the GUSB promoter is 378 nucleotides.

    [0112] In one embodiment, the promoter is a neurofilament light (NFL) promoter. The NFL promoter may have a size of 600-700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides.

    [0113] In one embodiment, the promoter is a neurofilament heavy (NFH) promoter. The NFH promoter may have a size of 900-950 nucleotides. As a non-limiting example, the NFH promoter is 920 nucleotides.

    [0114] In one embodiment, the promoter is a scn8a promoter. The scn8a promoter may have a. size of 450-500 nucleotides. As a non-limiting example, the scn8a promoter is 470 nucleotides.

    [0115] In one embodiment, the promoter is a phosphoglycerate kinase 1 (PGK) promoter.

    [0116] In one embodiment, the promoter is a chicken -actin (CBA) promoter.

    [0117] In one embodiment, the promoter is a cytomegalovirus (CMV) promoter.

    [0118] In one embodiment, the promoter is a liver or a skeletal muscle promoter. Non-limiting examples of liver promoters include human -1-antitrypsin (hAAT) and thyroxine binding globulin (TBG). Non-limiting examples of skeletal muscle promoters include Desmin, MCK or synthetic C5-12.

    [0119] In one embodiment, the promoter is a RNA pol III promoter. As a non-limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RNA pol III promoter is H1.

    [0120] In one embodiment, the viral genome comprises two promoters. As anon-limiting example, the promoters are an EF1 promoter and a CMV promoter.

    [0121] In one embodiment, the viral genome comprises an enhancer element, a promoter and/or a 5UTR intron. The enhancer element, also referred to herein as an enhancer, may be, but is not limited to, a CMV enhancer, the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSF, Synapsin, MeCP2, and GFAP promoter and the 5UTR/intron may be, but is not limited to, SV40, and CBA-MVM. As a non-limiting example, the enhancer, promoter and/or intron used in combination may be: (I) CMV enhancer, CMV promoter, SV40 5UTR intron; (2) CMV enhancer, CBA promoter, SV 40 5UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM intron, (4) UBC promoter; (5) GUSB promoter; (6) NSF promoter; (7) Synapsin promoter; (8) MeCF2 promoter and (9) GFAP promoter.

    [0122] In one embodiment, the viral genome comprises an engineered promoter.

    [0123] In another embodiment, the viral genome comprises a promoter from a naturally expressed protein.

    Viral Genome Component: Untranslated Regions (UTRs)

    [0124] By definition, wild type untranslated regions (UTRs) of a gene are transcribed but not translated. Generally, the 5 UTR starts at the transcription start site and ends at the start codon and the 3 UTR starts immediately following the stop codon and continues until the termination signal for transcription.

    [0125] Features typically found in abundantly expressed genes of specific target organs may be engineered into UTRs to enhance the stability and protein production. As a non-limiting example, a 5 UTR from mRNA normally expressed in the liver (e.g., albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII) may be used in the viral genomes of the AAV particles of the invention to enhance expression in hepatic cell lines or liver.

    [0126] While not wishing to be bound by theory, wild-type 5 untranslated regions (UTRs) include features which play roles in translation initiation. Kozak sequences, which are commonly known to he involved in the process by which the ribosome initiates translation of many genes, are usually included in 5 UTRs. Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another G.

    [0127] In one embodiment, the 5UTR in the viral genome includes a Kozak sequence.

    [0128] In one embodiment, the 5UTR in the viral genome does not include a Kozak sequence.

    [0129] While not wishing to be bound by theory, wild-type 3 UTRs are known to have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and firictional properties, the AU rich elements (ARES) can be separated into three classes (Chen et al, 1995, the contents of which are herein incorporated by reference in its entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of an AUUUA motif within U-rich regions. Class II AREs, such as, but not limited to, GM-CSF and TNFa, possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Class III ARES, such as, but not limited to, c-Jun and Myogenin, are less well defined. These U rich regions do not contain an AUUUA motif. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3 UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

    [0130] Introduction, removal or modification of 3 UTR AU rich elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, e.g., payload regions of viral genomes, one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, ARES can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.

    [0131] In one embodiment, the 3 UTR of the viral genome may include an oligo(dT) sequence for templated addition of a poly-A tail.

    [0132] In one embodiment, the viral genome may include at least one miRNA seed, binding site or full sequence. microRNAs (or miRNA or miR) are 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation. A microRNA sequence comprises a seed region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence of the nucleic acid.

    [0133] In one embodiment, the viral genome may be engineered to include, alter or remove at least one miRNA binding site, sequence or seed region.

    [0134] Any UTR from any gene known in the art may be incorporated into the viral genome of the AAV particle. These UTRs, or portions thereof, may be placed in the same orientation as in the gene from which they were selected or they may be altered in orientation or location. In one embodiment, the UTR used in the viral genome of the AAV particle may be inverted, shortened, lengthened, made with one or more other 5 UTRs or 3 UTRs known in the art. As used herein, the term altered as it relates to a UTR, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3 or 5 UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides.

    [0135] In one embodiment, the viral genome of the AAV particle comprises at least one artificial UTRs which is not a variant of a wild type UTR.

    [0136] In one embodiment, the viral genome of the AAV particle comprises UTRs which have been selected from a family of transcripts whose proteins share a common function, structure, feature or property.

    Viral Genome Component: Polyadenylation Sequence

    [0137] In one embodiment, the viral genome of the AAV particles of the present invention comprise at least one polyadenylation sequence. The viral genome of the AAV particle may comprise a polyadenylation sequence between the 3 end of the payload coding sequence and the 5 end of the 3ITR.

    [0138] In one embodiment, the polyadenylation sequence or polyA sequence may range from absent to about 500 nucleotides in length. The polyadenylation sequence may be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 281 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491 492, 493, 494, 495, 496, 497, 498, 499 and 500 nucleotides in length.

    [0139] In one embodiment, the polyadenylation sequence is 50-100 nucleotides in length.

    [0140] In one embodiment, the polyadenylation sequence is 50-150 nucleotides in length.

    [0141] In one embodiment, the polyadenylation sequence is 50-160 nucleotides in length.

    [0142] In one embodiment, the polyadenylation sequence is 50-200 nucleotides in length.

    [0143] In one embodiment, the polyadenylation sequence is 60-100 nucleotides in length.

    [0144] In one embodiment, the polyadenylation sequence is 60-150 nucleotides in length.

    [0145] In one embodiment, the polyadenylation sequence is 60-160 nucleotides in length.

    [0146] In one embodiment, the polyadenylation sequence is 60-200 nucleotides in length.

    [0147] In one embodiment, the polyadenylation sequence is 70-100 nucleotides in length.

    [0148] In one embodiment, the polyadenylation sequence is 70-150 nucleotides in length.

    [0149] In one embodiment, the polyadenylation sequence is 70-160 nucleotides in length.

    [0150] In one embodiment, the polyadenylation sequence is 70-200 nucleotides in length.

    [0151] In one embodiment, the polyadenylation sequence is 80-100 nucleotides in length.

    [0152] In one embodiment, the polyadenylation sequence is 80-150 nucleotides in length.

    [0153] In one embodiment, the polyadenylation sequence is 80-160 nucleotides in length.

    [0154] In one embodiment, the polyadenylation sequence is 80-200 nucleotides in length.

    [0155] In one embodiment, the polyadenylation sequence is 90-100 nucleotides in length.

    [0156] In one embodiment, the polyadenylation sequence is 90-150 nucleotides in length.

    [0157] In one embodiment, the polyadenylation sequence is 90-160 nucleotides in length.

    [0158] In one embodiment, the polyadenylation sequence is 90-200 nucleotides in length.

    Viral Genome Component: Linkers

    [0159] Viral genomes of the invention may be engineered with one or more spacer or linker regions to separate coding or non-coding regions.

    [0160] In one embodiment, the payload region of the AAV particle may optionally encode one or more linker sequences. In some cases, the linker may be a peptide linker that may be used to connect the polypeptides encoded by the payload region (i.e., light and heavy antibody chains during expression). Some peptide linkers may be cleaved after expression to separate heavy and light chain domains, allowing assembly of mature antibodies or antibody fragments. Linker cleavage may be enzymatic. In some cases, linkers comprise an enzymatic cleavage site to facilitate intracellular or extra.cellular cleavage. Some payload regions encode linkers that interrupt polypeptide synthesis during translation of the linker sequence from an mRNA transcript. Such linkers may facilitate the translation of separate protein domains (e.g., heavy and light chain antibody domains) from a single transcript. In some cases, two or more linkers are encoded by a payload region of the viral genome. Non-limiting examples of linkers that may be encoded by the payload region of an AAV particle viral genome are given in Table 2.

    TABLE-US-00002 TABLE 2 Linkers Linker SEQ ID NO or No. Description SEQUENCE L1 Internal ribosome entry site (IRES) 899 L2 Foot and month disease virus 2A (F2A) 900 L3 Porcine teschovirus-1 virus 2A (P2A) 901 L4 Furin cleavage site (F) 902 L5 5xG4S (5xG4S disclosed as SEQ ID NO: 17939) 903 L6 1,4-alpha-glucan-branching enzyme CHP L7 1,4-alpha-glucan-branching enzyme 904 L8 1,4-beta-N-acetylmuramidase FKK L9 1,4-beta-N-acetylmuramidase 905 L10 1,4-beta-N-acetylmuramidase 906 L11 1,4-beta-N-acetylmuramidase 907 L12 1,4-beta-N-acetylmuramidase 908 L13 1,4-beta-N-acetylmuramidase 909 L14 1,4-beta-N-acetylmuramidase 910 L15 1,4-beta-N-acetylmuramidase 911 L16 1,4-beta-N-acetylmuramidase 912 L17 1,4-beta-N-acetylmuramidase 913 L18 1,4-beta-N-acetylmuramidase 914 L19 150aa long hypothetical transcriptional regulator 915 L20 150aa long hypothetical transcriptional regulator 916 L21 1-deoxy-D-xylulose 5-phosphate reductoisomerase 917 L22 1-deoxy-D-xylulose 5-phosphate reductoisomerase 918 L23 1-deoxy-D-xylulose 5-phosphate reductoisomerase 919 L24 1-deoxy-D-xylulose 5-phosphate reductoisomerase 920 L25 235aa long hypothetical biotin-[acetyl-CoA-carboxylase] ligase 921 L26 235aa long hypothetical biotin-[acetyl-CoA-carboxylase] ligase 922 L27 235aa long hypothetical biotin-[acetyl-CoA-carboxylase] ligase 923 L28 2-dehydropantoate 2-reductase 924 L29 2-dehydropantoate 2-reductase 925 L30 2-dehydropantoate 2-reductase 926 L31 2-dehydropantoate 2-reductase 927 L32 2-dehydropantoate 2-reductase 928 L33 2-dehydropantoate 2-reductase 929 L34 2-dehydropantoate 2-reductase, putative 930 L35 2-dehydropantoate 2-reductase, putative 931 L36 4-alpha-glucanotransferase 932 L37 4-alpha-glucanotransferase 933 L38 4-alpha-glucanotransferase 934 L39 4-diphosphocytidyl-2C-methyl-D-erythritol kinase HAA L40 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 935 L41 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 936 L42 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 937 L43 4-diphosphocytidyl-2C-methyl-D-erythritol kinase 938 L44 4-hydroxyphenylpyruvate dioxygenase 939 L45 5-13 amino acids from the N termini of human Ck and CH1 domains linker 940 L46 5-13 amino acids from the N termini of human Ck and CH1 domains linker ERK L47 5-13 amino acids from the N termini of human Ck and CH1 domains linker 941 L48 5-13 amino acids from the N termini of human Ck and CH1 domains linker 942 L49 5-13 amino acids from the N termini of human Ck and CH1 domains linker 943 L50 5-13 amino acids from the N termini of human Ck and CH1 domains linker 944 L51 5-exonuclease 945 L52 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase ARL L53 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 946 L54 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 947 L55 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 948 L56 5-methyltetrahydropteroyltriglutamate--homocysteinemethyltransferase 949 L57 5-nucleotidase 950 L58 5-nucleotidase 951 L59 5-nucleotidase 952 L60 5-nucleotidase 953 L61 704aa long hypothetical glycosyltransferase 954 L62 704aa long hypothetical glycosyltransferase 955 L63 80 kDa nuclear cap binding protein 956 L64 80 kDa nuclear cap binding protein 957 L65 80 kDa nuclear cap binding protein 958 L66 80 kDa nuclear cap binding protein 959 L67 Acetaldehyde dehydrogenase (acylating) 960 L68 Acetaldehyde dehydrogenase (acylating) 961 L69 Acetolactate synthase isozyme III small subunit 962 L70 Acetylcholine receptor protein, alpha chain 963 L71 Acetylcholine receptor protein, beta chain 964 L72 Aconitate hydratase 2 965 L73 Aconitate hydratase 2 966 L74 Aconitate hydratase 2 967 L75 Aconitate hydratase 2 968 L76 Aconitate hydratase 2 969 L77 Acriflavine resistance protein B DWY L78 Acriflavine resistance protein B GGS L79 Acriflavine resistance protein B IDQ L80 Acriflavine resistance protein B NKV L81 Acriflavine resistance protein B SEA L82 Acriflavine resistance protein B 970 L83 Acriflavine resistance protein B 971 L84 Acriflavine resistance protein B 972 L85 Acriflavine resistance protein B 973 L86 Acriflavine resistance protein B 974 L87 Acriflavine resistance protein B 975 L88 Acriflavine resistance protein B 976 L89 Acriflavine resistance protein B 977 L90 Acriflavine resistance protein B 978 L91 Acriflavine resistance protein B 979 L92 Acriflavine resistance protein B 980 L93 Acriflavine resistance protein B 981 L94 Acriflavine resistance protein B 982 L95 Acriflavine resistance protein B 983 L96 Acriflavine resistance protein B 984 L97 Acriflavine resistance protein B 985 L98 Acriflavine resistance protein B 986 L99 Acriflavine resistance protein B 987 L100 Acriflavine resistance protein B 988 L101 Acriflavine resistance protein B 989 L102 Acriflavine resistance protein B 990 L103 Acriflavine resistance protein B 991 L104 Acriflavine resistance protein B 992 L105 Acriflavine resistance protein B 993 L106 Acyl-CoA thioesterase II 994 L107 Acyl-CoA thioesterase II 995 L108 Acyl-CoA thioesterase II 996 L109 Acyl-CoA thioesterase II 997 L110 Acyl-CoA thioesterase II 998 L111 Acyl-coenzyme A thioesterase 4 999 L112 Acyl-coenzyme A thioesterase 4 1000 L113 Acyl-coenzyme A thioesterase 4 1001 L114 Acyl-coenzyme A thioesterase 4 1002 L115 Acyl-coenzyme A thioesterase 4 1003 L116 Adenine glycosylase 1004 L117 Adenylate cyclase 1005 L118 Aerolysin 1006 L119 Aerolysin 1007 L120 Agglutinin DWK L121 Agglutinin isolectin 1 1008 L122 Agglutinin isolectin 1 1009 L123 Aldehyde ferredoxin oxidoreductase 1010 L124 Aldehyde oxidoreductase 1011 L125 Aldehyde oxidoreductase 1012 L126 Aldehyde oxidoreductase 1013 L127 Aldehyde oxidoreductase 1014 L128 Aldehyde oxidoreductase 1015 L129 Alkyl hydroperoxide reductase subunit F 1016 L130 Alkyl hydroperoxide reductase subunit F 1017 L131 Alkyl hydroperoxide reductase subunit F 1018 L132 Alkyl hydroperoxide reductase subunit F 1019 L133 Alkyl hydroperoxide reductase subunit F 1020 L134 Alkyl hydroperoxide reductase subunit F 1021 L135 Alkyl hydroperoxide reductase subunit F 1022 L136 Alkyl hydroperoxide reductase subunit F 1023 L137 Alkyl hydroperoxide reductase subunit F 1024 L138 Alkyl hydroperoxide reductase subunit F 1025 L139 Allantoicase 1026 L140 Allantoicase 1027 L141 Alliin lyase 1 SAV L142 Alliin lyase 1 1028 L143 Alliin lyase 1 1029 L144 Alliin lyase 1 1030 L145 Alliin lyase 1 1031 L146 Alpha amylase 1032 L147 Alpha amylase 1033 L148 Alpha-actinin 1 1034 L149 Alpha-actinin 1 1035 L150 Alpha-adaptin C 1036 L151 Alpha-amylase 1037 L152 Alpha-glucuronidase LSD L153 Alpha-glucuronidase 1038 L154 Alpha-glucuronidase 1039 L155 Alpha-glucuronidase 1040 L156 Alpha-glucuronidase 1041 L157 Alpha-glucuronidase 1042 L158 Alpha-glucuronidase 1043 L159 Alpha-glucuronidase 1044 L160 Alpha-glucuronidase 1045 L161 Alpha-glucuronidase 1046 L162 Alpha-glucuronidase 1047 L163 Alpha-glucuronidase 1048 L164 Alpha-glucuronidase 1049 L165 Alpha-glucuronidase 1050 L166 Alpha-glucuronidase 1051 L167 Alpha-glucuronidase 1052 L168 Alpha-glucuronidase 1053 L169 Alpha-glucuronidase 1054 L170 Alpha-glucuronidase 1055 L171 Alpha-glucuronidase 1056 L172 Alpha-glucuronidase 1057 L173 Alpha-glucuronidase 1058 L174 Alpha-L-arabinofuranosidase B 1059 L175 Alpha-mannosidase 1060 L176 Alr2269 protein 1061 L177 AMP nucleosidase 1062 L178 AMP nucleosidase 1063 L179 AMP nucleosidase 1064 L180 Angiopoietin-1 receptor DAG L181 Angiopoietin-1 receptor NSG L182 Angiopoietin-1 receptor TSA L183 Angiopoietin-1 receptor VPR L184 Angiopoietin-1 receptor 1065 L185 Angiopoietin-1 receptor 1066 L186 Angiopoietin-1 receptor 1067 L187 Angiopoietin-1 receptor 1068 L188 Angiopoietin-1 receptor 1069 L189 Angiopoietin-1 receptor 1070 L190 Angiopoietin-1 receptor 1071 L191 Angiopoietin-1 receptor 1072 L192 Angiopoietin-1 receptor 1073 L193 Angiopoietin-1 receptor 1074 L194 Angiopoietin-1 receptor 1075 L195 Angiopoietin-1 receptor 1076 L196 Angiopoietin-1 receptor 1077 L197 Angiopoietin-1 receptor 1078 L198 Angiopoietin-1 receptor 1079 L199 Angiopoietin-1 receptor 1080 L200 Angiopoietin-1 receptor 1081 L201 Angiopoietin-1 receptor 1082 L202 Angiopoietin-1 receptor 1083 L203 Angiopoietin-1 receptor 1084 L204 Angiopoietin-1 receptor 1085 L205 Annexin A2 QNK L206 Annexin A2 1086 L207 Annexin A2 1087 L208 Anthranilate phosphoribosyltransferase 1088 L209 AP-2 complex subunit beta-2 1089 L210 Archaeosine tRNA-guanine transglycosylase LGI L211 Archaeosine tRNA-guanine transglycosylase 1090 L212 Archaeosine tRNA-guanine transglycosylase 1091 L213 Archaeosine tRNA-guanine transglycosylase 1092 L214 Archaeosine tRNA-guanine transglycosylase 1093 L215 Archaeosine tRNA-guanine transglycosylase 1094 L216 Archaeosine tRNA-guanine transglycosylase 1095 L217 Archaeosine tRNA-guanine transglycosylase 1096 L218 Archeal exosome RNA binding protein rrp4 1097 L219 Archeal exosome RNA binding protein rrp4 1098 L220 Archeal exosome RNA binding protein rrp4 1099 L221 Arginyl-tRNA synthetase IDY L222 Arginyl-tRNA synthetase 1100 L223 Arginyl-tRNA synthetase 1101 L224 Arginyl-tRNA synthetase 1102 L225 Arrestin 1103 L226 Arrestin 1104 L227 Arsenite oxidase 1105 L228 Artificial linker PGS L229 Artificial linker ATK L230 Artificial linker ASK L231 Artificial linker 1106 L232 Artificial linker 1107 L233 Artificial linker 1108 L234 Artificial linker 1109 L235 Artificial linker 1110 L236 Artificial linker 1111 L237 ATP phosphoribosyltransferase ANR L238 ATP-dependent DNA helicase YDP L239 ATP-dependent DNA helicase 1112 L240 ATP-dependent DNA helicase 1113 L241 ATP-dependent DNA helicase 1114 L242 ATP-dependent DNA helicase 1115 L243 ATP-dependent DNA helicase 1116 L244 ATP-dependent DNA helicase 1117 L245 ATP-dependent DNA helicase 1118 L246 ATP-dependent DNA helicase 1119 L247 AT-rich DNA-binding protein 1120 L248 AT-rich DNA-binding protein 1121 L249 Axonin-1 DEG L250 Axonin-1 ECF L251 Axonin-1 1122 L252 Axonin-1 1123 L253 Axonin-1 1124 L254 Axonin-1 1125 L255 Axonin-1 1126 L256 Axonin-1 1127 L257 Axonin-1 1128 L258 Bacilysin biosynthesis protein BacB 1129 L259 Bacilysin biosynthesis protein BacB 1130 L260 Bacilysin biosynthesis protein BacB 1131 L261 Bacilysin biosynthesis protein BacB 1132 L262 Bacilysin biosynthesis protein BacB 1133 L263 Bacteriophage Mu transposase 1134 L264 Bacteriophage Mu transposase 1135 L265 Benzoyl-CoA-dihydrodiol lyase 1136 L266 Benzoyl-CoA-dihydrodiol lyase 1137 L267 Benzoyl-CoA-dihydrodiol lyase 1138 L268 Benzoyl-CoA-dihydrodiol lyase 1139 L269 Benzoyl-CoA-dihydrodiol lyase 1140 L270 Benzoylformate decarboxylase 1141 L271 Benzoylformate decarboxylase 1142 L272 Benzoylformate decarboxylase 1143 L273 Beta-amylase 1144 L274 Beta-galactosidase AIS L275 Beta-galactosidase 1145 L276 Beta-galactosidase 1146 L277 Beta-galactosidase 1147 L278 Beta-galactosidase 1148 L279 Beta-galactosidase 1149 L280 Beta-galactosidase 1150 L281 Beta-galactosidase 1151 L282 Beta-galactosidase 1152 L283 Beta-galactosidase 1153 L284 Beta-galactosidase 1154 L285 Beta-galactosidase 1155 L286 Beta-galactosidase 1156 L287 Beta-galactosidase 1157 L288 Beta-galactosidase 1158 L289 Beta-galactosidase 1159 L290 Beta-galactosidase 1160 L291 Beta-galactosidase 1161 L292 Beta-galactosidase 1162 L293 Beta-galactosidase 1163 L294 Beta-galactosidase 1164 L295 Beta-galactosidase 1165 L296 Beta-galactosidase 1166 L297 Beta-N-acetylhexosaminidase QRE L298 Beta-N-acetylhexosaminidase 1167 L299 Beta-N-acetylhexosaminidase 1168 L300 Beta-N-acetylhexosaminidase 1169 L301 Bifunctional NMN adenylyltransferase/Nudix hydrolase 1170 L302 Bifunctional purine biosynthesis protein PURH 1171 L303 Biliverdin reductase A EHV L304 Biliverdin reductase A LME L305 Biliverdin reductase A 1172 L306 Biliverdin reductase A 1173 L307 Biodegradative arginine decarboxylase TVQ L308 Biodegradative arginine decarboxylase 1174 L309 Biodegradative arginine decarboxylase 1175 L310 Biodegradative arginine decarboxylase 1176 L311 Biodegradative arginine decarboxylase 1177 L312 Biodegradative arginine decarboxylase 1178 L313 Biodegradative arginine decarboxylase 1179 L314 Biodegradative arginine decarboxylase 1180 L315 Biodegradative arginine decarboxylase 1181 L316 Biodegradative arginine decarboxylase 1182 L317 Biodegradative arginine decarboxylase 1183 L318 Biodegradative arginine decarboxylase 1184 L319 Biodegradative arginine decarboxylase 1185 L320 Biotin carboxylase 1186 L321 Bowman-Birk trypsin inhibitor 1187 L322 Bpt4 gene 59 helicase assembly protein KQI L323 BRCA1-associated RING domain protein 1 1188 L324 BRCA1-associated RING domain protein 1 1189 L325 BRCA1-associated RING domain protein 1 1190 L326 Breast cancer 2 1191 L327 Breast cancer 2 1192 L328 Breast cancer 2 1193 L329 Breast cancer 2 1194 L330 Breast cancer 2 1195 L331 Breast cancer 2 1196 L332 Butyrate response factor 2 1197 L333 C4b-binding protein YKR L334 C4b-binding protein 1198 L335 C5a peptidase 1199 L336 C5a peptidase 1200 L337 C5a peptidase 1201 L338 C5a peptidase 1202 L339 C5a peptidase 1203 L340 C5a peptidase 1204 L341 C5a peptidase 1205 L342 C5a peptidase 1206 L343 C5a peptidase 1207 L344 C5a peptidase 1208 L345 C5a peptidase 1209 L346 C5a peptidase 1210 L347 C5a peptidase 1211 L348 Calcium-binding protein 1212 L349 CarA 1213 L350 CarA 1214 L351 Carbamoyl phosphate synthetase (small chain) 1215 L352 Carbamoyl phosphate synthetase (small chain) 1216 L353 Carbamoyl phosphate synthetase (small chain) 1217 L354 Carbamoyl phosphate synthetase (small chain) 1218 L355 Carbamoyl phosphate synthetase (small chain) 1219 L356 Carbon monoxide dehydrogenase/acetyl-CoA synthase subunitalpha 1220 L357 Carboxypeptidase Gp180 residues 503-882 HRG L358 Catabolite activation-like protein 1221 L359 Catabolite activation-like protein 1222 L360 Catechol 2,3-dioxygenase 1223 L361 Cation-independent mannose 6-phosphate receptor 1224 L362 CD3 epsilon and gamma ectodomain fragment complex 1225 L363 CD3 epsilon and gamma ectodomain fragment complex 1226 L364 Cell filamentation protein SNP L365 Cell filamentation protein 1227 L366 Cell filamentation protein 1228 L367 Cellular coagulation factor XIII zymogen DIT L368 Cellular coagulation factor XIII zymogen NSD L369 Cellular coagulation factor XIII zymogen TDT L370 Cellular coagulation factor XIII zymogen 1229 L371 Cellular coagulation factor XIII zymogen 1230 L372 Cellular coagulation factor XIII zymogen 1231 L373 Cellular coagulation factor XIII zymogen 1232 L374 Cellular coagulation factor XIII zymogen 1233 L375 Cellular coagulation factor XIII zymogen 1234 L376 Cellular coagulation factor XIII zymogen 1235 L377 Cellular coagulation factor XIII zymogen 1236 L378 Cellular coagulation factor XIII zymogen 1237 L379 Cellular coagulation factor XIII zymogen 1238 L380 Cellular coagulation factor XIII zymogen 1239 L381 Cellular coagulation factor XIII zymogen 1240 L382 Cellular coagulation factor XIII zymogen 1241 L383 Cellular coagulation factor XIII zymogen 1242 L384 Cellular coagulation factor XIII zymogen 1243 L385 Cellular coagulation factor XIII zymogen 1244 L386 Cellular coagulation factor XIII zymogen 1245 L387 Cellular coagulation factor XIII zymogen 1246 L388 Cellular coagulation factor XIII zymogen 1247 L389 Cellulase 1248 L390 Cellulase 1249 L391 Cellulase 1250 L392 Cellulase 1251 L393 Cellulase 1252 L394 Cellulase 1253 L395 Cellulase 1254 L396 Cellulase 1255 L397 Cellulase 1256 L398 Cellulase linker 1257 L399 Cellulase linker 1258 L400 Cellulase linker 1259 L401 Cellulase linker 1260 L402 Chaperone protein FimC KLR L403 Chaperone protein FimC QAA L404 Chaperone protein FimC 1261 L405 Chaperone protein FimC 1262 L406 Chaperone protein HscB RHP L407 Chaperone protein HscB 1263 L408 CheB methylesterase 1264 L409 CheB methylesterase 1265 L410 CheB methylesterase 1266 L411 Chelatase, putative 1267 L412 Chemotaxis receptor methyltransferase cheR 1268 L413 Chemotaxis receptor methyltransferase cheR 1269 L414 Chemotaxis receptor methyltransferase cheR 1270 L415 Cholesterol oxidase 1271 L416 Cholesterol oxidase 1272 L417 Cholesterol oxidase 1273 L418 Cholesterol oxidase 1274 L419 Cholesterol oxidase 1275 L420 Cholesterol oxidase 1276 L421 Cholesterol oxidase 1277 L422 Cholesterol oxidase 1278 L423 Cholesterol oxidase 1279 L424 Cholesterol oxidase 1280 L425 Cholesterol oxidase 1281 L426 Cholesterol oxidase 1282 L427 Chromatin structure-remodeling complex protein RSC4 KNL L428 Chromatin structure-remodeling complex protein RSC4 1283 L429 Chromatin structure-remodeling complex protein RSC4 1284 L430 Chromatin structure-remodeling complex protein RSC4 1285 L431 Chromodomain-helicase-DNA-binding protein 1 1286 L432 Chromodomain-helicase-DNA-binding protein 1 1287 L433 Cleavable disulfide 1288 L434 Cleavable disulfide 1289 L435 Cleavable disulfide 1290 L436 Cleavable disulfide 1291 L437 Cleavable disulfide 1292 L438 Cleavable disulfide 1293 L439 Cleavable disulfide 1294 L440 Cleavable disulfide 1295 L441 Cleavable disulfide 1296 L442 Cleavable disulfide 1297 L443 Cleavable disulfide 1298 L444 Colicin Ia 1299 L445 Collagen adhesin 1300 L446 Complement C3 beta chain 1301 L447 Complement C3 beta chain 1302 L448 Complement C3 beta chain 1303 L449 Complement C3 beta chain 1304 L450 Complement decay-accelerating factor EIY L451 Complement factor H KRP L452 Complement receptor type 2 1305 L453 Conserved hypothetical protein 1306 L454 Conserved hypothetical protein MTH1747 DIR L455 Conserved hypothetical protein MTH1747 1307 L456 Conserved hypothetical protein MTH1747 1308 L457 Conserved hypothetical protein MTH1747 1309 L458 Conserved hypothetical protein MTH1747 1310 L459 Conserved hypothetical protein MTH1747 1311 L460 Conserved hypothetical protein MTH1747 1312 L461 Conserved hypothetical protein MTH1747 1313 L462 Conserved protein (MTH177) 1314 L463 Creatine amidinohydrolase 1315 L464 Cruciferin 1316 L465 Cruciferin 1317 L466 Cruciferin 1318 L467 Cruciferin 1319 L468 Cruciferin 1320 L469 Cruciferin 1321 L470 Cruciferin 1322 L471 CSL3 1323 L472 CSL3 1324 L473 CTP synthase 1325 L474 CTP synthase 1326 L475 Cullin homolog HKN L476 Cullin homolog 1327 L477 Cullin homolog 1328 L478 Cullin homolog 1329 L479 Cullin homolog 1330 L480 Cullin homolog 1331 L481 Cyclin A2 1332 L482 Cysteine-rich secretory protein 1333 L483 Cytidine deaminase 1334 L484 Cytidine deaminase 1335 L485 Cytidine deaminase 1336 L486 Cytochrome b-c1 complex subunit Rieske, mitochondrial 1337 L487 Cytochrome c oxidase subunit 2 QAV L488 Cytochrome c oxidase subunit 2 1338 L489 Cytochrome c oxidase subunit 2 1339 L490 Cytochrome c oxidase subunit 2 1340 L491 Cytochrome c oxidase subunit 2 1341 L492 Cytochrome c4 GGK L493 Cytochrome c4 QGM L494 D-aminopeptidase 1342 L495 DDMC 1343 L496 DDMC 1344 L497 Deltex protein 1345 L498 Deoxyuridine 5-triphosphate nucleotidohydrolase 1346 L499 Diaminopimelate epimerase 1347 L500 Diaminopimelate epimerase 1348 L501 Diaminopimelate epimerase 1349 L502 Di-heme peroxidase SGC L503 Di-heme peroxidase 1350 L504 Dihydropyrimidine dehydrogenase 1351 L505 Dihydropyrimidine dehydrogenase 1352 L506 Dihydropyrimidine dehydrogenase 1353 L507 Dihydropyrimidine dehydrogenase 1354 L508 Dihydropyrimidine dehydrogenase 1355 L509 Dihydropyrimidine dehydrogenase 1356 L510 Dihydropyrimidine dehydrogenase 1357 L511 Dihydropyrimidine dehydrogenase 1358 L512 Dihydropyrimidine dehydrogenase 1359 L513 Dihydropyrimidine dehydrogenase 1360 L514 Dihydropyrimidine dehydrogenase 1361 L515 Dihydropyrimidine dehydrogenase 1362 L516 Dihydropyrimidine dehydrogenase 1363 L517 Dihydropyrimidine dehydrogenase 1364 L518 Dihydropyrimidine dehydrogenase 1365 L519 Dihydropyrimidine dehydrogenase 1366 L520 Dihydropyrimidine dehydrogenase 1367 L521 Dihydropyrimidine dehydrogenase 1368 L522 Dihydropyrimidine dehydrogenase 1369 L523 Dihydropyrimidine dehydrogenase 1370 L524 Dihydropyrimidine dehydrogenase 1371 L525 Dihydropyrimidine dehydrogenase 1372 L526 Dihydropyrimidine dehydrogenase 1373 L527 Dihydropyrimidine dehydrogenase 1374 L528 Dihydropyrimidine dehydrogenase 1375 L529 Dihydropyrimidine dehydrogenase 1376 L530 Dihydropyrimidine dehydrogenase 1377 L531 Dihydropyrimidine dehydrogenase 1378 L532 Dihydropyrimidine dehydrogenase 1379 L533 Dihydropyrimidine dehydrogenase 1380 L534 Dihydropyrimidine dehydrogenase 1381 L535 Discoidin-1 subunit A 1382 L536 Discoidin-1 subunit A 1383 L537 Discoidin-1 subunit A 1384 L538 Dissimilatory copper-containing nitritereductase 1385 L539 D-lactate dehydrogenase DTF L540 D-lactate dehydrogenase 1386 L541 D-lactate dehydrogenase 1387 L542 D-lactate dehydrogenase 1388 L543 D-lactate dehydrogenase 1389 L544 D-lactate dehydrogenase 1390 L545 D-lactate dehydrogenase 1391 L546 DNA damage-binding protein 1 LCA L547 DNA damage-binding protein 1 1392 L548 DNA damage-binding protein 1 1393 L549 DNA damage-binding protein 1 1394 L550 DNA damage-binding protein 1 1395 L551 DNA damage-binding protein 1 1396 L552 DNA damage-binding protein 1 1397 L553 DNA damage-binding protein 1 1398 L554 DNA damage-binding protein 1 1399 L555 DNA damage-binding protein 1 1400 L556 DNA damage-binding protein 1 1401 L557 DNA damage-binding protein 1 1402 L558 DNA damage-binding protein 1 1403 L559 DNA damage-binding protein 1 1404 L560 DNA damage-binding protein 1 1405 L561 DNA damage-binding protein 1 1406 L562 DNA damage-binding protein 1 1407 L563 DNA damage-binding protein 1 1408 L564 DNA damage-binding protein 1 1409 L565 DNA damage-binding protein 1 1410 L566 DNA damage-binding protein 1 1411 L567 DNA damage-binding protein 1 1412 L568 DNA damage-binding protein 1 1413 L569 DNA gyrase B ALS L570 DNA gyrase B 1414 L571 DNA gyrase B 1415 L572 DNA gyrase B 1416 L573 DNA gyrase B 1417 L574 DNA gyrase B 1418 L575 DNA gyrase B 1419 L576 DNA gyrase B 1420 L577 DNA gyrase B 1421 L578 DNA gyrase B 1422 L579 DNA gyrase B 1423 L580 DNA gyrase B 1424 L581 DNA ligase 1425 L582 DNA ligase 1426 L583 DNA ligase 1427 L584 DNA ligase 1428 L585 DNA ligase 1429 L586 DNA mismatch repair protein MutS MDA L587 DNA mismatch repair protein MutS SII L588 DNA mismatch repair protein MutS 1430 L589 DNA mismatch repair protein MutS 1431 L590 DNA mismatch repair protein MutS 1432 L591 DNA mismatch repair protein MutS 1433 L592 DNA mismatch repair protein MutS 1434 L593 DNA polymerase FSP L594 DNA polymerase RQF L595 DNA polymerase 1435 L596 DNA polymerase 1436 L597 DNA polymerase 1437 L598 DNA polymerase 1438 L599 DNA polymerase 1439 L600 DNA polymerase 1440 L601 DNA polymerase 1441 L602 DNA polymerase 1442 L603 DNA polymerase alpha subunit B 1443 L604 DNA polymerase alpha subunit B 1444 L605 DNA polymerase alpha subunit B 1445 L606 DNA polymerase alpha subunit B 1446 L607 DNA polymerase alpha subunit B 1447 L608 DNA polymerase alpha subunit B 1448 L609 DNA polymerase alpha subunit B 1449 L610 DNA polymerase alpha subunit B 1450 L611 DNA polymerase alpha subunit B 1451 L612 DNA polymerase alpha subunit B 1452 L613 DNA polymerase eta ALS L614 DNA polymerase eta 1453 L615 DNA polymerase eta 1454 L616 DNA polymerase eta 1455 L617 DNA polymerase eta 1456 L618 DNA polymerase eta 1457 L619 DNA polymerase I AGV L620 DNA polymerase I ELE L621 DNA polymerase I 1458 L622 DNA primase DHK L623 DNA primase 1459 L624 DNA primase 1460 L625 DNA primase 1461 L626 DNA primase 1462 L627 DNA primase 1463 L628 DNA primase 1464 L629 DNA primase 1465 L630 DNA primase/helicase AGY L631 DNA primase/helicase 1466 L632 DNA primase/helicase 1467 L633 DNA primase/helicase 1468 L634 DNA primase/helicase 1469 L635 DNA primase/helicase 1470 L636 DNA primase/helicase 1471 L637 DNA primase/helicase 1472 L638 DNA primase/helicase 1473 L639 DNA primase/helicase 1474 L640 DNA primase/helicase 1475 L641 DNA topoisomerase 2 EES L642 DNA topoisomerase 2 IPI L643 DNA topoisomerase 2 KEL L644 DNA topoisomerase 2 1476 L645 DNA topoisomerase 2 1477 L646 DNA topoisomerase 2 1478 L647 DNA topoisomerase 2 1479 L648 DNA topoisomerase 2 1480 L649 DNA topoisomerase 2 1481 L650 DNA topoisomerase 2 1482 L651 DNA topoisomerase 2 1483 L652 DNA topoisomerase 2 1484 L653 DNA topoisomerase I 1485 L654 DNA topoisomerase I 1486 L655 DNA topoisomerase I 1487 L656 DNA topoisomerase II, alpha isozyme PDL L657 DNA topoisomerase II, alpha isozyme 1488 L658 DNA topoisomerase II, alpha isozyme 1489 L659 DNA topoisomerase II, alpha isozyme 1490 L660 DNA topoisomerase II, alpha isozyme 1491 L661 DNA topoisomerase II, alpha isozyme 1492 L662 DNA topoisomerase II, alpha isozyme 1493 L663 DNA topoisomerase II, alpha isozyme 1494 L664 DNA topoisomerase II, alpha isozyme 1495 L665 DNA topoisomerase VI A subunit 1496 L666 DNA topoisomerase VI A subunit 1497 L667 DNA topoisomerase VI A subunit 1498 L668 DNA topoisomerase VI A subunit 1499 L669 DNA topoisomerase VI A subunit 1500 L670 DNA topoisomerase VI A subunit 1501 L671 DNA-3-methyladenine glycosylase 2 1502 L672 DNA-binding response regulator MtrA 1503 L673 DNA-directed RNA polymerase beta chain 1504 L674 DNA-directed RNA polymerase beta chain 1505 L675 DNA-directed RNA polymerase beta chain 1506 L676 DNA-directed RNA polymerase beta chain 1507 L677 DNA-directed RNA polymerase beta chain 1508 L678 DNA-directed RNA polymerase beta chain 1509 L679 DNA-directed RNA polymerase beta chain 1510 L680 DNA-directed RNA polymerase beta chain 1511 L681 DNA-directed RNA polymerase II 14.2 kDa polypeptide 1512 L682 DNA-directed RNA polymerase II 14.2 kDa polypeptide 1513 L683 DNA-directed RNA polymerase, subunit E (rpoe1) 1514 L684 DNA-directed RNA polymerase, subunit E (rpoe1) 1515 L685 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide ITP L686 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1516 L687 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1517 L688 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1518 L689 DNA-directed RNA polymerases I, II, and III 27 kDa polypeptide 1519 L690 Drosophila neuroglian 1520 L691 Dystroglycan 1521 L692 Dystrophin 1522 L693 Dystrophin 1523 L694 Dystrophin 1524 L695 Dystrophin 1525 L696 Dystrophin 1526 L697 Dystrophin 1527 L698 Dystrophin 1528 L699 E2A DNA-binding protein 1529 L700 E2A DNA-binding protein 1530 L701 E3 sumo-protein ligase SIZ1 1531 L702 E3 sumo-protein ligase SIZ1 1532 L703 E3 sumo-protein ligase SIZ1 1533 L704 Early switch protein xol-1 2.2k splice form 1534 L705 EGF-like module containing mucin-like hormonereceptor-like 2 precursor 1535 L706 EGF-like module containing mucin-like hormonereceptor-like 2 precursor 1536 L707 Elongation factor 1-gamma 1 1537 L708 Elongation factor 1-gamma 1 1538 L709 Elongation factor g 1539 L710 Elongation factor G 1540 L711 Elongation factor G 1541 L712 Elongation factor G 1542 L713 Elongation factor G 1543 L714 Elongation factor G 1544 L715 Elongation factor G 1545 L716 Elongation factor G 1546 L717 Elongation factor G 1547 L718 Elongation factor G 1548 L719 Elongation factor P 1549 L720 Elongation factor Ts 1550 L721 Elongation factor Ts 1551 L722 Elongation factor Ts 1552 L723 Elongation factor Tu (ef-Tu) 1553 L724 Endoglucanase 1554 L725 Endonuclease PI-SceI 1555 L726 Endonuclease PI-SceI 1556 L727 Endonuclease PI-SceI 1557 L728 Endonuclease PI-SceI 1558 L729 Endonuclease PI-SceI 1559 L730 Endonuclease PI-SceI 1560 L731 Endonuclease PI-SceI 1561 L732 Endonuclease PI-SceI 1562 L733 Endonuclease PI-SceI 1563 L734 Enterobactin synthetase component F 1564 L735 Enterobactin synthetase component F 1565 L736 Enterobactin synthetase component F 1566 L737 Enterobactin synthetase component F 1567 L738 Enterobactin synthetase component F 1568 L739 Enterobactin synthetase component F 1569 L740 Enterobactin synthetase component F 1570 L741 Enterobactin synthetase component F 1571 L742 Enterobactin synthetase component F 1572 L743 Enterochelin esterase 1573 L744 Epo receptor EVV L745 Epo receptor 1574 L746 Erythrocyte binding antigen region II 1575 L747 Erythrocyte binding antigen region II 1576 L748 Erythrocyte binding antigen region II 1577 L749 Erythrocyte binding antigen region II 1578 L750 Erythrocyte binding antigen region II 1579 L751 E-selectin 1580 L752 Esterase EstA SAP L753 Esterase EstA 1581 L754 Esterase EstA 1582 L755 Eukaryotic peptide chain release factor GTP-binding subunit 1583 L756 Exonuclease I RQP L757 Exonuclease I 1584 L758 FascIclIn I SDP L759 FascIclIn I 1585 L760 Fibrillin-1 1586 L761 Fibrillin-1 1587 L762 Fibrillin-1 1588 L763 Fibrillin-1 1589 L764 Fibrillin-1 1590 L765 Fibronectin 1591 L766 Fibronectin 1592 L767 Fibronectin 1593 L768 Flagellar hook protein FlgE 1594 L769 Flagellar hook protein FlgE 1595 L770 Flagellar hook protein FlgE 1596 L771 Flagellar hook protein FlgE 1597 L772 Flagellar hook protein FlgE 1598 L773 Flagellar hook protein FlgE 1599 L774 Flagellar hook protein FlgE 1600 L775 Flavohemoprotein 1601 L776 Flexible G/S rich linker G L777 Flexible G/S rich linker S L778 Flexible G/S rich linker GG L779 Flexible G/S rich linker GS L780 Flexible G/S rich linker GGS L781 Flexible G/S rich linker GGG L782 Flexible G/S rich linker 1602 L783 Flexible G/S rich linker 1603 L784 Flexible G/S rich linker 1604 L785 Flexible G/S rich linker 1605 L786 Flexible G/S rich linker 1606 L787 Flexible G/S rich linker 1607 L788 Flexible G/S rich linker 1608 L789 Flexible G/S rich linker 1609 L790 Flexible G/S rich linker 1610 L791 Flexible G/S rich linker 1611 L792 Flexible G/S rich linker 1612 L793 Flexible G/S rich linker 1613 L794 Flexible G/S rich linker 1614 L795 Flexible G/S rich linker 1615 L796 Focal adhesion kinase 1 1616 L797 FolC bifunctional protein 1617 L798 FolC bifunctional protein 1618 L799 FolC bifunctional protein 1619 L800 FolC bifunctional protein 1620 L801 FolC bifunctional protein 1621 L802 FolC bifunctional protein 1622 L803 FolC bifunctional protein 1623 L804 FolC bifunctional protein 1624 L805 Follistatin 1625 L806 Formate dehydrogenase (large subunit) YDK L807 Formate dehydrogenase (large subunit) 1626 L808 Formate dehydrogenase (large subunit) 1627 L809 Formate dehydrogenase (large subunit) 1628 L810 Formate dehydrogenase (large subunit) 1629 L811 Formate dehydrogenase (large subunit) 1630 L812 Formate dehydrogenase (large subunit) 1631 L813 Formate dehydrogenase (large subunit) 1632 L814 Formate dehydrogenase (large subunit) 1633 L815 Formate dehydrogenase (large subunit) 1634 L816 Formate dehydrogenase (large subunit) 1635 L817 Formate dehydrogenase (large subunit) 1636 L818 Formate dehydrogenase (large subunit) 1637 L819 Formate dehydrogenase, nitrate-inducible major subunit 1638 L820 Formate dehydrogenase, nitrate-inducible, major subunit 1639 L821 Formate dehydrogenase, nitrate-inducible, major subunit 1640 L822 Formate dehydrogenase, nitrate-inducible, major subunit 1641 L823 Formate dehydrogenase, nitrate-inducible, major subunit 1642 L824 Formate dehydrogenase, nitrate-inducible, major subunit 1643 L825 Formate dehydrogenase, nitrate-inducible, major subunit 1644 L826 Formate dehydrogenase, nitrate-inducible, major subunit 1645 L827 Formate dehydrogenase, nitrate-inducible, major subunit 1646 L828 Formate dehydrogenase, nitrate-inducible, major subunit 1647 L829 Formate dehydrogenase, nitrate-inducible, major subunit 1648 L830 Formate dehydrogenase, nitrate-inducible, major subunit 1649 L831 Formate dehydrogenase, nitrate-inducible, major subunit 1650 L832 Formate dehydrogenase, nitrate-inducible, major subunit 1651 L833 Fumarylacetoacetate hydrolase 1652 L834 Galactose oxidase GSV L835 Galactose oxidase GWK L836 Galactose oxidase IAE L837 Galactose oxidase KRQ L838 Galactose oxidase QDT L839 Galactose oxidase TPN L840 Galactose oxidase 1653 L841 Galactose oxidase 1654 L842 Galactose oxidase 1655 L843 Galactose oxidase 1656 L844 Galactose oxidase 1657 L845 Galactose oxidase 1658 L846 Galactose oxidase 1659 L847 Galactose oxidase 1660 L848 Galactose oxidase 1661 L849 Galactose oxidase 1662 L850 Galactose oxidase 1663 L851 Galactose oxidase 1664 L852 Galactose oxidase 1665 L853 Galactose oxidase 1666 L854 Galactose oxidase 1667 L855 Galactose oxidase 1668 L856 Galactose oxidase 1669 L857 Galactose oxidase 1670 L858 Galactose oxidase 1671 L859 Galactose oxidase 1672 L860 Galactose oxidase 1673 L861 Galactose oxidase 1674 L862 Galactose oxidase 1675 L863 Galactose oxidase 1676 L864 Gamma B-crystallin 1677 L865 Gamma-delta T-cell receptor 1678 L866 Gelation factor DSS L867 Gelation factor 1679 L868 Gelation factor 1680 L869 Gelation factor 1681 L870 Gene activator alpha 1682 L871 Gingipain R 1683 L872 Glucodextranase 1684 L873 Glucodextranase 1685 L874 Glucodextranase 1686 L875 Glucosamine-fructose-6-phosphate aminotransferase YEQ L876 Glucosamine-fructose-6-phosphate aminotransferase 1687 L877 Glucosamine-fructose-6-phosphate aminotransferase 1688 L878 Glucosamine-fructose-6-phosphate aminotransferase 1689 L879 Glucosamine-fructose-6-phosphate aminotransferase 1690 L880 Glucosamine-fructose-6-phosphate aminotransferase 1691 L881 Glucosamine-fructose-6-phosphate aminotransferase 1692 L882 Glucosamine-fructose-6-phosphate aminotransferase 1693 L883 Glucosamine-fructose-6-phosphate aminotransferase 1694 L884 Glucosamine-fructose-6-phosphate aminotransferase 1695 L885 Glucosamine-fructose-6-phosphate aminotransferase 1696 L886 Glucose-1-phosphate adenylyltransferase small subunit 1697 L887 Glucose-1-phosphate adenylyltransferase small subunit 1698 L888 GIucose-6-phosphate isomerase KNA L889 Glucose-6-phosphate isomerase VGF L890 Glucose-6-phosphate isomerase 1699 L891 Glucose-6-phosphate isomerase 1700 L892 Glucose-6-phosphate isomerase, conjectural 1701 L893 Glutamate dehydrogenase 1702 L894 Glutamate dehydrogenase 1703 L895 Glutamate receptor interacting protein 1704 L896 Glutamate synthase [NADPH] large chain 1705 L897 Glutamate synthase [NADPH] large chain 1706 L898 Glutamate synthase [NADPH] large chain 1707 L899 Glutamate synthase [NADPH] large chain 1708 L900 Glutamate synthase [NADPH] large chain 1709 L901 Glutamate synthase [NADPH] large chain 1710 L902 Glutamate synthase [NADPH] large chain 1711 L903 Glutamine synthetase 1712 L904 Glutamine synthetase 1713 L905 Glutamyl-tRNA synthetase 1714 L906 Glutamyl-tRNA synthetase 1715 L907 Glutamyl-tRNA synthetase 1716 L908 Glutamyl-tRNA synthetase 1717 L909 Glutamyl-tRNA synthetase 1718 L910 Glutamyl-tRNA synthetase 1719 L911 Glutamyl-tRNA synthetase 1720 L912 Glutamyl-tRNA synthetase 1721 L913 Glutaredoxin 2 1722 L914 Glutathione S-transferase 1723 L915 Glutathione S-transferase 1724 L916 Glutathione S-transferase 1725 L917 Glutathione S-transferase 1-6 1726 L918 Glutathione S-transferase A1 1727 L919 Glutathione S-transferase I NKP L920 Glutathione S-transferase I 1728 L921 Glutathione synthetase 1729 L922 Glutathione transferase GST1-4 1730 L923 Glutathione transferase GST1-4 1731 L924 Glutathione transferase sigma class 1732 L925 Glycerol-3-phosphate dehydrogenase [NAD(P)+] 1733 L926 Glycine cleavage system transcriptionalrepressor, putative 1734 L927 Glycolipid-anchored surface protein 2 1735 L928 Glycolipid-anchored surface protein 2 1736 L929 Glycyl-tRNA synthetase KFA L930 Glycyl-tRNA synthetase 1737 L931 Glycyl-tRNA synthetase 1738 L932 Glycyl-tRNA synthetase 1739 L933 Glycyl-tRNA synthetase 1740 L934 Glycyl-tRNA synthetase 1741 L935 Glycyl-tRNA synthetase 1742 L936 Glycyl-tRNA synthetase 1743 L937 Glycyl-tRNA synthetase 1744 L938 Glycyl-tRNA synthetase 1745 L939 Growth hormone receptor 1746 L940 Growth hormone receptor 1747 L941 Harmonin 1748 L942 HasR protein 1749 L943 HasR protein 1750 L944 Hemin transport protein HemS 1751 L945 Hemin transport protein HemS 1752 L946 Hemin transport protein HemS 1753 L947 Hemoglobin 1754 L948 Hemolytic lectin CEL-iii 1755 L949 Hepatocyte nuclear factor 6 1756 L950 Histidyl-tRNA synthetase 1757 L951 HNH homing endonuclease 1758 L952 HNH homing endonuclease 1759 L953 HNH homing endonuclease 1760 L954 Homoserine dehydrogenase 1761 L955 Homoserine kinase 1762 L956 Homosetine kinase 1763 L957 Homoserine kinase 1764 L958 Homoserine kinase 1765 L959 HTH-type transcriptional regulator MqsA (Ygit/B3021) 1766 L960 HTH-type transcriptional repressor YvoA 1767 L961 HTH-type transcriptional repressor YvoA 1768 L962 Human IgG1 middle hinge linker 1769 L963 Human IgG1 upper hinge linker 1770 L964 Human IgG3 middle hinge linker 1771 L965 Human IgG3m15 middle hinge linker 1772 L966 Human IgG4 lower hinge linker 1773 L967 Human IgG4 middle hinge linker 1774 L968 Human IgG4 upper hinge linker 1775 L969 Hybrid cluster protein 1776 L970 Hybrid cluster protein 1777 L971 Hybrid cluster protein 1778 L972 Hybrid cluster protein 1779 L973 Hybrid cluster protein 1780 L974 Hypothetical conserved protein, GK1056 1781 L975 Hypothetical membrane spanning protein 1782 L976 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1783 L977 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1784 L978 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1785 L979 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1786 L980 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1787 L981 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1788 L982 Hypothetical methylmalonyl-CoA decarboxylase alpha subunit 1789 L983 Hypothetical protein AEP L984 Hypothetical protein 1790 L985 Hypothetical protein APE0525 PTL L986 Hypothetical protein APE0525 1791 L987 Hypothetical protein LOC449832 1792 L988 Hypothetical protein LOC449832 1793 L989 Hypothetical protein PA4388 1794 L990 Hypothetical protein PA5201 ASE L991 Hypothetical protein PA5201 QDP L992 Hypothetical protein PA5201 VKL L993 Hypothetical protein PA5201 1795 L994 Hypothetical protein PA5201 1796 L995 Hypothetical protein PA5201 1797 L996 Hypothetical protein PA5201 1798 L997 Hypothetical protein PA5201 1799 L998 Hypothetical protein PA5201 1800 L999 Hypothetical protein PA5201 1801 L1000 Hypothetical protein PA5201 1802 L1001 Hypothetical protein PA5201 1803 L1002 Hypothetical protein PA5201 1804 L1003 Hypothetical protein PA5201 1805 L1004 Hypothetical protein PA5201 1806 L1005 Hypothetical protein PA5201 1807 L1006 Hypothetical protein PA5201 1808 L1007 Hypothetical protein PA5201 1809 L1008 Hypothetical protein PA5201 1810 L1009 Hypothetical protein PA5201 1811 L1010 Hypothetical protein PA5201 1812 L1011 Hypothetical protein PA5201 1813 L1012 Hypothetical protein PA5201 1814 L1013 Hypothetical protein PH0495 ASN L1014 Hypothetical protein PH0495 1815 L1015 Hypothetical protein PH0495 1816 L1016 Hypothetical protein PH0495 1817 L1017 Hypothetical protein PH0495 1818 L1018 Hypothetical protein PH0510 1819 L1019 Hypothetical protein PH0510 1820 L1020 Hypothetical protein PH1313 1821 L1021 Hypothetical protein PH1313 1822 L1022 Hypothetical protein SLR0953 1823 L1023 Hypothetical protein SLR0953 1824 L1024 Hypothetical protein SLR0953 1825 L1025 Hypothetical protein SLR0953 1826 L1026 Hypothetical protein SLR0953 1827 L1027 Hypothetical protein YIGZ 1828 L1028 Hypothetical protein YIGZ 1829 L1029 Hypothetical protein YJIA 1830 L1030 Hypothetical protein YJIA 1831 L1031 Hypothetical protein YJIA 1832 L1032 Hypothetical protein YJIA 1833 L1033 Hypothetical protein YJIA 1834 L1034 Hypothetical tRNA/rRNA methyltransferase YJFH 1835 L1035 Hypothetical tRNA/rRNA methyltransferase YJFH 1836 L1036 IclR transcriptional regulator 1837 L1037 IclR transcriptional regulator 1838 L1038 IclR transcriptional regulator 1839 L1039 IclR transcriptional regulator 1840 L1040 Integrase 1841 L1041 Interferon, alpha-inducible protein (clone IFI-15k) 1842 L1042 Interleukin-1 receptor, type I AIF L1043 Interleukin-1 receptor, type I 1843 L1044 Interleukin-1 receptor, type I 1844 L1045 Interleukin-1 receptor, type I 1845 L1046 Interleukin-12 subunit p40 FFI L1047 Interleukin-12 subunit p40 1846 L1048 Interleukin-12 subunit p40 1847 L1049 Interleukin-12 subunit p40 1848 L1050 Interleukin-12 subunit p40 1849 L1051 Interleukin-12 subunit p40 1850 L1052 lnterleukin-12 subunit p40 1851 L1053 Interleukin-12 subunit p40 1852 L1054 Interleukin-2 receptor alpha chain 1853 L1055 Interleukin-2 receptor alpha chain 1854 L1056 Internalin B VTQ L1057 Internalin B 1855 L1058 Internalin B 1856 L1059 Internalin B 1857 L1060 Internalin B 1858 L1061 Internalin B 1859 L1062 Internalin B 1860 L1063 Internalin B 1861 L1064 Internalin B 1862 L1065 Internalin B 1863 L1066 Internalin B 1864 L1067 Internalin B 1865 L1068 Internalin B 1866 L1069 Intimin SLV L1070 Intimin 1867 L1071 Intimin 1868 L1072 Intimin 1869 L1073 Intron-encoded DNA endonuclease I-anil 1870 L1074 Intron-encoded DNA endonuclease I-anil 1871 L1075 Invasin KST L1076 Invasin 1872 L1077 Invasin 1873 L1078 Invasin 1874 L1079 Invasin 1875 L1080 Invasin 1876 L1081 Invasin 1877 L1082 Invasin 1878 L1083 Invasin 1879 L1084 Invasin 1880 L1085 Invasin 1881 L1086 Invasin 1882 L1087 Invasin 1883 L1088 Iron hydrogenase 1 GAE L1089 Iron hydrogenase 1 1884 L1090 Iron hydrogenase 1 1885 L1091 Iron hydrogenase 1 1886 L1092 Iron hydrogenase 1 1887 L1093 Iron hydrogenase 1 1888 L1094 Iron hydrogenase 1 1889 L1095 Iron hydrogenase 1 1890 L1096 Iron hydrogenase 1 1891 L1097 Iron hydrogenase 1 1892 L1098 Iron hydrogenase 1 1893 L1099 Iron hydrogenase 1 1894 L1100 Iron hydrogenase 1 1895 L1101 Iron hydrogenase 1 1896 L1102 Iron transport protein 1897 L1103 Isoflavanone 4-O-methyltransferase 1898 L1104 Isoflavanone 4-O-methyltransferase 1899 L1105 Junctional adhesion molecule 1 1900 L1106 Junctional adhesion molecule 1 1901 L1107 Junctional adhesion molecule 1 1902 L1108 Kanamycin nucleotidyltransferase 1903 L1109 Kanamycin nucleotidyltransferase 1904 L1110 Kanamycin nucleotidyltransferase 1905 L1111 Kanamycin nucleotidyltransferase 1906 L1112 Kelch-like protein 11 1907 L1113 Kexin ISE L1114 Kexin 1908 L1115 Kexin 1909 L1116 Kexin 1910 L1117 Kexin 1911 L1118 Kexin 1912 L1119 Kexin 1913 L1120 Kexin 1914 L1121 Ku70 1915 L1122 Ku70 1916 L1123 Ku70 1917 L1124 Ku70 1918 L1125 Ku80 1919 L1126 Laccase-1 1920 L1127 Laccase-1 1921 L1128 Laccase-1 1922 L1129 Laccase-1 1923 L1130 Laminin DKC L1131 L-aspartate dehydrogenase SAS L1132 L-aspartate dehydrogenase 1924 L1133 L-aspartate dehydrogenase 1925 L1134 Leucine dehydrogenase 1926 L1135 Leucine dehydrogenase 1927 L1136 Light chain of HyHel10 antibody fragment (fab) 1928 L1137 Lin2111 protein 1929 L1138 Lin2111 protein 1930 L1139 Lipopolysaccharide-responsive and beige-like anchor protein 1931 L1140 Lipopolysaccharide-responsive and beige-like anchor protein 1932 L1141 Lipovitellin (LV-1N, LV-1C) 1933 L1142 Lipovitellin (LV-1N, LV-1C) 1934 L1143 Lipovitellin (LV-1N, LV-1C) 1935 L1144 Lipovitellin (LV-1N, LV-1C) 1936 L1145 Lipovitellin (LV-1N, LV-1C) 1937 L1146 Lipoxygenase-1 1938 L1147 Lipoxygenase-1 1939 L1148 Low affinity immunoglobulin gamma Fc region receptor II-A 1940 L1149 Luciferase 1941 L1150 LysR-type regulatory protein 1942 L1151 Macrolide-specific efflux protein MacA ATE L1152 Macrolide-specific efflux protein MacA 1943 L1153 Macrolide-specific efflux protein MacA 1944 L1154 Magnesium transporter, putative 1945 L1155 Main hemagglutinin component 1946 L1156 Major centromere autoantigen B 1947 L1157 Major surface antigen p30 1948 L1158 Major surface antigen p30 1949 L1159 Major vault protein 1950 L1160 Major vault protein 1951 L1161 Maltose phosphorylase 1952 L1162 Maltose phosphorylase 1953 L1163 Maltose phosphorylase 1954 L1164 Maltose phosphorylase 1955 L1165 Maltose phosphorylase 1956 L1166 Manganese-dependent inorganic pyrophosphatase 1957 L1167 Manganese-dependent inorganic pyrophosphatase 1958 L1168 Mannan-binding lectin 1959 L1169 Mannan-binding lectin 1960 L1170 Mannan-binding lectin 1961 L1171 Mannitol dehydrogenase HNA L1172 Mannitol dehydrogenase 1962 L1173 Membrane cofactor protein RET L1174 Membrane cofactor protein 1963 L1175 Membrane-associated prostaglandin E synthase-2 1964 L1176 Membrane-associated prostaglandin E synthase-2 1965 L1177 Membrane-associated prostaglandin E synthase-2 1966 L1178 Membrane-associated prostaglandin E synthase-2 1967 L1179 Membrane-associated prostaglandin E synthase-2 1968 L1180 Membrane-bound lytic murein transglycosylase A 1969 L1181 Methionyl-tRNA synthetase 1970 L1182 Methyl-accepting chemotaxis protein VRP L1183 Methyl-accepting chemotaxis protein 1971 L1184 Methyl-accepting chemotaxis protein 1972 L1185 Methyl-accepting chemotaxis protein 1973 L1186 Methyl-coenzyme M reductase 1974 L1187 Methyl-coenzyme M reductase 1975 L1188 Methyl-coenzyme M reductase 1976 L1189 Methyl-coenzyme M reductase 1977 L1190 Methylene tetrahydromethanopterin dehydrogenase 1978 L1191 Methylene tetrahydromethanopterin dehydrogenase 1979 L1192 Mg2+ transporter MgtE 1980 L1193 Mg2+ transporter MgtE 1981 L1194 Mg2+ transporter MgtE 1982 L1195 Mitochondrial aconitase 1983 L1196 Mitochondrial aconitase 1984 L1197 Modification methylase TaqI EGK L1198 Modification methylase TaqI PAT L1199 Modification methylase TaqI 1985 L1200 Modification methylase TaqI 1986 L1201 Modification methylase TaqI 1987 L1202 Modification methylase TaqI 1988 L1203 Modification methylase TaqI 1989 L1204 Modification methylase TaqI 1990 L1205 Modification methylase TaqI 1991 L1206 Modification methylase TaqI 1992 L1207 Multidrug-efflux transporter 1 regulator 1993 L1208 Muramoyl-pentapeptide carboxypeptidase 1994 L1209 MutL 1995 L1210 MutL 1996 L1211 MutL 1997 L1212 MutL 1998 L1213 MutL 1999 L1214 MutL 2000 L1215 MutL 2001 L1216 MutL 2002 L1217 MutL 2003 L1218 MutM (Fpg) protein 2004 L1219 MutM (Fpg) protein 2005 L1220 MutM (Fpg) protein 2006 L1221 MutM (Fpg) protein 2007 L1222 Myotubularin-related protein 2 THW L1223 Myotubularin-related protein 2 2008 L1224 Myotubularin-related protein 2 2009 L1225 Myotubularin-related protein 2 2010 L1226 Myotubularin-related protein 2 2011 L1227 Myotubularin-related protein 2 2012 L1228 N utilization substance protein A EIP L1229 N utilization substance protein A 2013 L1230 N utilization substance protein A 2014 L1231 N utilization substance protein A 2015 L1232 N-acetylglucosamine kinase CAY L1233 N-acetylglucosamine kinase ISP L1234 N-acetylglucosamine kinase 2016 L1235 N-acyl-D-glutamate deacylase 2017 L1236 N-acyl-D-glutamate deacylase 2018 L1237 N-acyl-D-glutamate deacylase 2019 L1238 N-acyl-D-glutamate deacylase 2020 L1239 N-acyl-D-glutamate deacylase 2021 L1240 N-acyl-D-glutamate deacylase 2022 L1241 N-acyl-D-glutamate deacylase 2023 L1242 NAD-dependent malic enzyme 2024 L1243 NAD-dependent malic enzyme 2025 L1244 NADH peroxidase ADT L1245 NADH peroxidase AVG L1246 NADH peroxidase TLI L1247 NADH peroxidase 2026 L1248 NADH peroxidase 2027 L1249 NADH peroxidase 2028 L1250 NADH peroxidase 2029 L1251 NADH peroxidase 2030 L1252 NADH peroxidase 2031 L1253 NADH pyrophosphatase 2032 L1254 Naphthalene 1,2-dioxygenase alpha subunit 2033 L1255 Naphthalene 1,2-dioxygenase alpha subunit 2034 L1256 NEDD8-activating enzyme E1 catalytic subunit 2035 L1257 NEDD8-activating enzyme E1 regulatory subunit 2036 L1258 NEDD8-activating enzyme E1 regulatory subunit 2037 L1259 NEDD8-activating enzyme E1 regulatory subunit 2038 L1260 Nei endonuclease VIII-Like 1 2039 L1261 Nei endonuclease VIII-Like 1 2040 L1262 Nei endonuclease VIII-Like 1 2041 L1263 Nei endonuclease VIII-Like 1 2042 L1264 Neural cell adhesion molecule 2 2043 L1265 Neural cell adhesion molecule 2 2044 L1266 Neural cell adhesion molecule 2 2045 L1267 Neural cell adhesion molecule 2 2046 L1268 Neural cell adhesion molecule 2 2047 L1269 Neuroplastin 2048 L1270 Neuroplastin 2049 L1271 Neuroplastin 2050 L1272 Neutrophil cytosol factor 1 2051 L1273 Nickel responsive regulator 2052 L1274 NifU-like protein 2, chloroplast 2053 L1275 Nitric oxide reductase ILM L1276 Nitric oxide reductase 2054 L1277 Nitric oxide reductase 2055 L1278 Nitric oxide reductase 2056 L1279 Nitric oxide reductase 2057 L1280 Nitric oxide reductase 2058 L1281 NK receptor 2059 L1282 Nuclear factor of activated t-cells, cytoplasmic2 2060 L1283 Nucleolin RBD12 2061 L1284 O-GlcNAcase NagJ 2062 L1285 Orange carotenoid protein EGV L1286 Orange carotenoid protein 2063 L1287 Orange carotenoid protein 2064 L1288 Orn/Lys/Arg decarboxylase family protein LEL L1289 Orn/Lys/Arg decarboxylase family protein 2065 L1290 Orn/Lys/Arg decarboxylase family protein 2066 L1291 Orn/Lys/Arg decarboxylase family protein 2067 L1292 Orn/Lys/Arg decarboxylase family protein 2068 L1293 Orn/Lys/Arg decarboxylase family protein 2069 L1294 Orn/Lys/Arg decarboxylase family protein 2070 L1295 Orn/Lys/Arg decarboxylase family protein 2071 L1296 Osteoclast-stimulating factor 1 2072 L1297 Oxygen-independent coproporphyrinogen III oxidase 2073 L1298 Oxygen-independent coproporphyrinogen III oxidase 2074 L1299 Oxygen-independent coproporphyrinogen III oxidase 2075 L1300 Oxygen-independent coproporphyrinogen III oxidase 2076 L1301 Oxygen-independent coproporphyrinogen III oxidase 2077 L1302 Oxygen-independent coproporphyrinogen III oxidase 2078 L1303 Oxygen-independent coproporphyrinogen III oxidase 2079 L1304 Oxygen-independent coproporphyrinogen III oxidase 2080 L1305 Oxygen-independent coproporphyrinogen III oxidase 2081 L1306 Oxygen-independent coproporphyrinogen III oxidase 2082 L1307 Paraneoplastic encephalomyelitis antigen HuD 2083 L1308 Paraneoplastic encephalomyelitis antigen HuD 2084 L1309 Penicillin binding protein 4 2085 L1310 Penicillin binding protein 4 2086 L1311 Penicillin binding protein 4 2087 L1312 Penicillin binding protein 4 2088 L1313 Penicillin binding protein 4 2089 L1314 Penicillin binding protein 4 2090 L1315 Penicillin binding protein 4 2091 L1316 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F DGV L1317 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F 2092 L1318 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F 2093 L1319 Peptide-N(4)-(N-acetyl-beta-D-glucosaminyl)asparagine amidase F 2094 L1320 Peroxisomal primary amine oxidase 2095 L1321 Peroxisomal primary amine oxidase 2096 L1322 Peroxisome biogenesis factor 1 2097 L1323 Pesticidial crystal protein Cry2Aa 2098 L1324 Pesticidial crystal protein Cry2Aa 2099 L1325 Pesticidial crystal protein Cry2Aa 2100 L1326 Phase 1 flagellin DLT L1327 Phase 1 flagellin 2101 L1328 Phase 1 flagellin 2102 L1329 Phase 1 flagellin 2103 L1330 Phase 1 flagellin 2104 L1331 Phase 1 flagellin 2105 L1332 Phase 1 flagellin 2106 L1333 Phase 1 flagellin 2107 L1334 Phase 1 flagellin 2108 L1335 Phase 1 flagellin 2109 L1336 Phase 1 flagellin 2110 L1337 Phase 1 flagellin 2111 L1338 Phase 1 flagellin 2112 L1339 Phenylalanyl-tRNA synthetase beta chain LGL L1340 Phenylalanyl-tRNA synthetase beta chain 2113 L1341 Phenylalanyl-tRNA synthetase beta chain 2114 L1342 Phenylalanyl-tRNA synthetase beta chain 2115 L1343 Phenylalanyl-tRNA synthetase beta chain 2116 L1344 Phenylalanyl-tRNA synthetase beta chain 2117 L1345 Phenylalanyl-tRNA synthetase beta chain 2118 L1346 Phenylalanyl-tRNA synthetase beta chain 2119 L1347 Phenylalanyl-tRNA synthetase beta chain 2120 L1348 Phenylalanyl-tRNA synthetase beta chain 2121 L1349 Phenylalanyl-tRNA synthetase beta chain 2122 L1350 Phenylalanyl-tRNA synthetase beta chain 2123 L1351 Phenylalanyl-tRNA synthetase beta chain 2124 L1352 Phenylalanyl-tRNA synthetase beta chain 2125 L1353 Phosphatase 2126 L1354 Phosphatase 2127 L1355 Phosphatase 2128 L1356 Phosphatidylinositol transfer protein Sec14p YGT L1357 Phosphatidylinositol transfer protein Sec14p 2129 L1358 Phosphatidylinositol transfer protein Sec14p 2130 L1359 Phosphatidylserine synthase 2131 L1360 Phosphatidylserine synthase 2132 L1361 Phosphatidylserine synthase 2133 L1362 Phosphoglycolate phosphatase 2134 L1363 Phosphoglycolate phosphatase 2135 L1364 Phosphoglycolate phosphatase 2136 L1365 Phosphoglycolate phosphatase 2137 L1366 Phospholipase D 2138 L1367 Phospholipase D 2139 L1368 Phospholipase D 2140 L1369 Phosphoribosylamine--glycine ligase 2141 L1370 Phosphoribosylamine--glycine ligase 2142 L1371 Phosphotransferase system, enzyme I 2143 L1372 Photosystem II d1 protease 2144 L1373 Photosystem II d1 protease 2145 L1374 Photosystem II d1 protease 2146 L1375 Photosystem II d1 protease 2147 L1376 Photosystem II d1 protease 2148 L1377 Phthalate dioxygenase reductase 2149 L1378 P-hydroxybenzoate hydroxylase DGL L1379 P-hydroxybenzoate hydroxylase IDL L1380 P-hydroxybenzoate hydroxylase RLK L1381 P-hydroxybenzoate hydroxylase 2150 L1382 P-hydroxybenzoate hydroxylase 2151 L1383 P-hydroxybenzoate hydroxylase 2152 L1384 P-hydroxybenzoate hydroxylase 2153 L1385 P-hydroxybenzoate hydroxylase 2154 L1386 P-hydroxybenzoate hydroxylase 2155 L1387 P-hydroxybenzoate hydroxylase 2156 L1388 P-hydroxybenzoate hydroxylase 2157 L1389 P-hydroxybenzoate hydroxylase 2158 L1390 P-hydroxybenzoate hydroxylase 2159 L1391 P-hydroxybenzoate hydroxylase 2160 L1392 P-hydroxybenzoate hydroxylase 2161 L1393 P-hydroxybenzoate hydroxylase 2162 L1394 P-hydroxybenzoate hydroxylase 2163 L1395 P-hydroxybenzoate hydroxylase 2164 L1396 P-hydroxybenzoate hydroxylase 2165 L1397 P-hydroxybenzoate hydroxylase 2166 L1398 Phytase LNF L1399 Phytase QSN L1400 Phytase 2167 L1401 Phytase 2168 L1402 Phytase 2169 L1403 Phytase 2170 L1404 Phytase 2171 L1405 Phytase 2172 L1406 Phytase 2173 L1407 Phytase 2174 L1408 Pirin LKS L1409 Pirin SGE L1410 Pirin 2175 L1411 Pirin 2176 L1412 Pirin 2177 L1413 Pirin 2178 L1414 Pirin 2179 L1415 Pirin 2180 L1416 Poly(A) polymerase 2181 L1417 Poly(A) polymerase 2182 L1418 Poly(A) polymerase 2183 L1419 Poly(A) polymerase 2184 L1420 Poly(A) polymerase 2185 L1421 Poly(A) polymerase 2186 L1422 Poly(A) polymerase 2187 L1423 Poly(A) polymerase 2188 L1424 Poly(A) polymerase 2189 L1425 Poly(A) polymerase 2190 L1426 Poly(A) polymerase 2191 L1427 Poly(A) polymerase 2192 L1428 Poly(rC)-binding protein 2 2193 L1429 Polymerase x 2194 L1430 Polymerase x 2195 L1431 Polypeptide N-acetylgalactosaminyltransferase 2 2196 L1432 Polypeptide N-acetylgalactosaminyltransferase 2 2197 L1433 Polyphosphate kinase 2198 L1434 Polyphosphate kinase 2199 L1435 Polyphosphate kinase 2200 L1436 Polypyrimidine tract-binding protein 2201 L1437 Porcine pancreatic spasmolytic polypeptide 2202 L1438 Possible 3-mercaptopyruvate sulfurtransferase LFR L1439 Possible 3-mercaptopyruvate sulfurtransferase YGM L1440 Possible 3-mercaptopyruvate sulfurtransferase 2203 L1441 Possible 3-mercaptopyruvate sulfurtransferase 2204 L1442 Possible 3-mercaptopyruvate sulfurtransferase 2205 L1443 Postsynaptic density protein 95 2206 L1444 Postsynaptic density protein 95 2207 L1445 Predicted sugar phosphatases of the HAD superfamily IAI L1446 Predicted sugar phosphatases of the HAD superfamily 2208 L1447 Predicted sugar phosphatases of the HAD superfamily 2209 L1448 Predicted sugar phosphatases of the HAD superfamily 2210 L1449 Predicted sugar phosphatases of the HAD superfamily 2211 L1450 Predicted sugar phosphatases of the HAD superfamily 2212 L1451 Predicted sugar phosphatases of the HAD superfamily 2213 L1452 Predicted sugar phosphatases of the HAD superfamily 2214 L1453 Predicted sugar phosphatases of the HAD superfamily 2215 L1454 Preprotein translocase SecA ITF L1455 Preprotein translocase SecA LID L1456 Preprotein translocase SecA 2216 L1457 Preprotein translocase SecA 2217 L1458 Preprotein translocase SecA 2218 L1459 Preprotein translocase SecA 2219 L1460 Preprotein translocase SecA 2220 L1461 Preprotein translocase SecA 2221 L1462 Preprotein translocase SecA 2222 L1463 Preprotein translocase SecA 2223 L1464 Preprotein translocase SecA 2224 L1465 Preprotein translocase SecA 2225 L1466 Preprotein translocase SecA 2226 L1467 Preprotein translocase SecA 2227 L1468 Preprotein translocase SecA 2228 L1469 Preprotein translocase SecA 2229 L1470 Preprotein translocase SecA 2230 L1471 Preprotein translocase SecA 2231 L1472 Preprotein translocase SecA 2232 L1473 PrfA ING L1474 Probable 16s rRNA-processing protein RimM 2233 L1475 Probable biphenyl-2,3-diol 1,2-dioxygenase BphC 2234 L1476 Probable chorismate mutase LLA L1477 Probable chorismate mutase 2235 L1478 Probable chorismate mutase 2236 L1479 Probable ferredoxin-dependent nitrite reductase NirA VPL L1480 Probable ferredoxin-dependent nitrite reductase NirA WGI L1481 Probable ferredoxin-dependent nitrite reductase NirA 2237 L1482 Probable ferredoxin-dependent nitrite reductase NirA 2238 L1483 Probable ferredoxin-dependent nitrite reductase NirA 2239 L1484 Probable ferredoxin-dependent nitrite reductase NirA 2240 L1485 Probable ferredoxin-dependent nitrite reductase NirA 2241 L1486 Probable ferredoxin-dependent nitrite reductase NirA 2242 L1487 Probable ferredoxin-dependent nitrite reductase NirA 2243 L1488 Probable ferredoxin-dependent nitrite reductase NirA 2244 L1489 Probable ferredoxin-dependent nitrite reductase NirA 2245 L1490 Probable ferredoxin-dependent nitrite reductase NirA 2246 L1491 Probable ferredoxin-dependent nitrite reductase NirA 2247 L1492 Probable ferredoxin-dependent nitrite reductase NirA 2248 L1493 Probable galactokinase 2249 L1494 Probable galactokinase 2250 L1495 Probable galactokinase 2251 L1496 Probable galactokinase 2252 L1497 Probable galactokinase 2253 L1498 Probable galactokinase 2254 L1499 Probable galactokinase 2255 L1500 Probable galactokinase 2256 L1501 Probable galactokinase 2257 L1502 Probable galactokinase 2258 L1503 Probable galactokinase 2259 L1504 Probable galactokinase 2260 L1505 Probable glutathione S-transferase 2261 L1506 Probable GST-related protein 2262 L1507 Probable HPr(Ser) kinase/phosphatase 2263 L1508 Probable thiosulfate sulfur transferase 2264 L1509 Probable thiosulfate sulfur transferase 2265 L1510 Probable thiosulfate sulfur transferase 2266 L1511 Probable thiosulfate sulfur transferase 2267 L1512 Probable thiosulfate sulfur transferase 2268 L1513 Probable thiosulfate sulfur transferase 2269 L1514 Probable thiosulfate sulfur transferase 2270 L1515 Probable thiosulfate sulfur transferase 2271 L1516 Probable tRNA pseudouridine synthase D 2272 L1517 Probable tRNA pseudouridine synthase D 2273 L1518 Probable tRNA pseudouridine synthase D 2274 L1519 Probable tRNA pseudouridine synthase D 2275 L1520 Probable tRNA pseudoundine synthase D 2276 L1521 Probable tRNA pseudouridine synthase D 2277 L1522 Programed cell death protein 8 SKE L1523 Programed cell death protein 8 TLQ L1524 Programed cell death protein 8 2278 L1525 Programed cell death protein 8 2279 L1526 Programed cell death protein 8 2280 L1527 Programed cell death protein 8 2281 L1528 Programed cell death protein 8 2282 L1529 Programed cell death protein 8 2283 L1530 Programed cell death protein 8 2284 L1531 Programed cell death protein 8 2285 L1532 Programed cell death protein 8 2286 L1533 Programed cell death protein 8 2287 L1534 Programed cell death protein 8 2288 L1535 Programed cell death protein 8 2289 L1536 Programed cell death protein 8 2290 L1537 Programed cell death protein 8 2291 L1538 Programed cell death protein 8 2292 L1539 Programed cell death protein 8 2293 L1540 Programed cell death protein 8 2294 L1541 Programed cell death protein 8 2295 L1542 Proline oxidase 2296 L1543 Prolyl-tRNA synthetase 2297 L1544 Prostaglandin G/H synthase 1 PEI L1545 Prostaglandin G/H synthase 1 2298 L1546 Protease 2299 L1547 Protease 2300 L1548 Protease 2301 L1549 Protease DegS 2302 L1550 Protease DegS 2303 L1551 Protease DegS 2304 L1552 Protease DegS 2305 L1553 Protease III NAR L1554 Protease III RNP L1555 Protease III 2306 L1556 Protease III 2307 L1557 Protease III 2308 L1558 Protease III 2309 L1559 Protease III 2310 L1560 Protease III 2311 L1561 Protease III 2312 L1562 Protease III 2313 L1563 Protease III 2314 L1564 Protease III 2315 L1565 Protease III 2316 L1566 Protease III 2317 L1567 Protease III 2318 L1568 Protease III 2319 L1569 Protease III 2320 L1570 Protease III 2321 L1571 Protease III 2322 L1572 Protease III 2323 L1573 Protease III 2324 L1574 Protease III 2325 L1575 Protection of telomeres 1 2326 L1576 Protection of telomeres 1 2327 L1577 Protein (CD58) 2328 L1578 Protein (CRP1) 2329 L1579 Protein (DNA polymerase) 2330 L1580 Protein (DNA polymerase) 2331 L1581 Protein (DNA polymerase) 2332 L1582 Protein (electron transfer flavoprotein) 2333 L1583 Protein (electron transfer flavoprotein) 2334 L1584 Protein (Ffh) 2335 L1585 Protein (Ffh) 2336 L1586 Protein (Ffh) 2337 L1587 Protein (Ffh) 2338 L1588 Protein (Ffh) 2339 L1589 Protein (FokI restriction endonuclease) 2340 L1590 Protein (FokI restriction endonuclease) 2341 L1591 Protein (FokI restriction endonuclease) 2342 L1592 Protein (FokI restriction endonuclease) 2343 L1593 Protein (FokI restriction endonuclease) 2344 L1594 Protein (FokI restriction endonuclease) 2345 L1595 Protein (FokI restriction endonuclease) 2346 L1596 Protein (FokI restriction endonuclease) 2347 L1597 Protein (FokI restriction endonuclease) 2348 L1598 Protein (neural cell adhesion molecule) 2349 L1599 Protein (neural cell adhesion molecule) 2350 L1600 Protein (neural cell adhesion molecule) 2351 L1601 Protein (nine-haem cytochrome c) FTH L1602 Protein (nine-haem cytochrome c) 2352 L1603 Protein (nine-haem cytochrome c) 2353 L1604 Protein (nine-haem cytochrome c) 2354 L1605 Protein (nine-haem cytochrome c) 2355 L1606 Protein (nine-haem cytochrome c) 2356 L1607 Protein (nine-haem cytochrome c) 2357 L1608 Protein (nine-haem cytochrome c) 2358 L1609 Protein (nine-haem cytochrome c) 2359 L1610 Protein (protease/helicase NS3) 2360 L1611 Protein (protease/helicase NS3) 2361 L1612 Protein (protease/helicase NS3) 2362 L1613 Protein (protease/helicase NS3) 2363 L1614 Protein disulfide oxidoreductase 2364 L1615 Protein disulfide oxidoreductase 2365 L1616 Protein disulfide-isomerase A4 2366 L1617 Protein kinase PKR 2367 L1618 Protein kinase PKR 2368 L1619 Protein TolB VNK L1620 Protein TolB 2369 L1621 Protein TolB 2370 L1622 Protein TolB 2371 L1623 Protein TolB 2372 L1624 Protein TolB 2373 L1625 Protein TolB 2374 L1626 Protein translation elongation factor 1A 2375 L1627 Protein transport protein Sec24 DRN L1628 Protein transport protein Sec24 2376 L1629 Protein transport protein Sec24 2377 L1630 Protein transport protein Sec24 2378 L1631 Protein transport protein Sec24 2379 L1632 Protein transport protein Sec24 2380 L1633 Protein transport protein Sec24 2381 L1634 Protein transport protein Sec24 2382 L1635 Protein transport protein Sec24 2383 L1636 Pseudouridine synthase CBF5 AIQ L1637 Pseudouridine synthase CBF5 2384 L1638 Pseudouridine synthase CBF5 2385 L1639 Putative acetylglutamate synthase 2386 L1640 Putative acetylglutamate synthase 2387 L1641 Putative acetylglutamate synthase 2388 L1642 Putative family 31 glucosidase Yicl 2389 L1643 Putative family 31 glucosidase Yicl 2390 L1644 Putative family 31 glucosidase Yicl 2391 L1645 Putative glutathione transferase 2392 L1646 Putative glutathione transferase 2393 L1647 Putative glutathione transferase 2394 L1648 Putative GNTR-family transcriptional regulator 2395 L1649 Putative GNTR-family transcriptional regulator 2396 L1650 Putative GNTR-family transcriptional regulator 2397 L1651 Putative HTH-type transcriptional regulator PH0061 2398 L1652 Putative HTH-type transcriptional regulator PH1519 2399 L1653 Putative HTH-type transcriptional regulator PH1519 2400 L1654 Putative metallopeptidase 2401 L1655 Putative N-acetylmannosamine kinase 2402 L1656 Putative N-acetylmannosamine kinase 2403 L1657 Putative N-acetylmannosamine kinase 2404 L1658 Putative NADP oxidoreductase BF3122 2405 L1659 Putative NADP oxidoreductase BF3122 2406 L1660 Putative NADP oxidoreductase BF3122 2407 L1661 Putative NADP oxidoreductase BF3122 2408 L1662 Putative oxidoreductase 2409 L1663 Putative secreted alpha-galactosidase PLP L1664 Putative secreted alpha-galactosidase TNG L1665 Putative secreted alpha-galactosidase 2410 L1666 Putative secreted alpha-galactosidase 2411 L1667 Putative secreted alpha-galactosidase 2412 L1668 Putative tagatose-6-phosphate ketose/aldose isomerase DKA L1669 Putative tagatose-6-phosphate ketose/aldose isomerase 2413 L1670 Putative tagatose-6-phosphate ketose/aldose isomerase 2414 L1671 Putative tagatose-6-phosphate ketose/aldose isomerase 2415 L1672 Putative transcriptional regulator GntR 2416 L1673 Putative transcriptional repressor (TetR/AcrR family) KFR L1674 Putative transcriptional repressor (TetR/AcrR family) 2417 L1675 Putative uncharacterized protein 2418 L1676 Putative uncharacterized protein 2419 L1677 Putative uncharacterized protein 2420 L1678 Putative uncharacterized protein 2421 L1679 Putative uncharacterized protein 2422 L1680 Putative uncharacterized protein 2423 L1681 Putative uncharacterized protein 2424 L1682 Putative uncharacterized protein 2425 L1683 Putative uncharacterized protein 2426 L1684 Pyruvate decarboxylase CAA L1685 Pyruvate decarboxylase 2427 L1686 Pyruvate decarboxylase 2428 L1687 Pyruvate decarboxylase 2429 L1688 Pyruvate decarboxylase 2430 L1689 Pyruvate decarboxylase 2431 L1690 Pyruvate dehydrogenase [lipoamide] kinase isozyme 2, mitochondrial YVP L1691 Pyruvate dehydrogenase [lipoamide] kinase isozyme 2, mitochondrial 2432 L1692 Pyruvate dehydrogenase [lipoamide] kinase isozyme 2, mitochondrial 2433 L1693 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial 2434 L1694 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial 2435 L1695 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial 2436 L1696 Pyruvate phosphate dikinase FNP L1697 Pyruvate phosphate dikinase SAL L1698 Pyruvate phosphate dikinase 2437 L1699 Pyruvate phosphate dikinase 2438 L1700 Pyruvate phosphate dikinase 2439 L1701 Pyruvate phosphate dikinase 2440 L1702 Pyruvate phosphate dikinase 2441 L1703 Pyruvate phosphate dikinase 2442 L1704 Pyruvate phosphate dikinase 2443 L1705 Pyruvate phosphate dikinase 2444 L1706 Pyruvate phosphate dikinase 2445 L1707 Pyruvate phosphate dikinase 2446 L1708 Pyruvate-ferredoxin oxidoreductase VRL L1709 Pyruvate-ferredoxin oxidoreductase 2447 L1710 Pyruvate-ferredoxin oxidoreductase 2448 L1711 Pyruvate-ferredoxin oxidoreductase 2449 L1712 Pyruvate-ferredoxin oxidoreductase 2450 L1713 Pyruvate-ferredoxin oxidoreductase 2451 L1714 Pyruvate-ferredoxin oxidoreductase 2452 L1715 Pyruvate-ferredoxin oxidoreductase 2453 L1716 Pyruvate-ferredoxin oxidoreductase 2454 L1717 Pyruvate-ferredoxin oxidoreductase 2455 L1718 Pyruvate-ferredoxin oxidoreductase 2456 L1719 Pyruvate-ferredoxin oxidoreductase 2457 L1720 Pyruvate-ferredoxin oxidoreductase 2458 L1721 Pyruvate-ferredoxin oxidoreductase 2459 L1722 Pyruvate-ferredoxin oxidoreductase 2460 L1723 Pyruvate-ferredoxin oxidoreductase 2461 L1724 Pyruvate-ferredoxin oxidoreductase 2462 L1725 Pyruvate-ferredoxin oxidoreductase 2463 L1726 Pyruvate-ferredoxin oxidoreductase 2464 L1727 Pyruvate-ferredoxin oxidoreductase 2465 L1728 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2466 L1729 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2467 L1730 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2468 L1731 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2469 L1732 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2470 L1733 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2471 L1734 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2472 L1735 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2473 L1736 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2474 L1737 Quinohemoprotein amine dehydrogenase 60 kDa subunit 2475 L1738 Rag1 2476 L1739 Rag1 2477 L1740 Receptor-type tyrosine-protein phosphatase Mu 2478 L1741 Receptor-type tyrosine-protein phosphatase Mu 2479 L1742 RecG 2480 L1743 RecG 2481 L1744 RecG 2482 L1745 RecG 2483 L1746 RecG 2484 L1747 RecG 2485 L1748 RecG 2486 L1749 RecG 2487 L1750 RecG 2488 L1751 RecG 2489 L1752 RecG 2490 L1753 RecG 2491 L1754 Recombination endonuclease VII 2492 L1755 Recombining binding protein suppressor of hairless 2493 L1756 Restriction endonuclease ERV L1757 Restriction endonuclease 2494 L1758 Restriction endonuclease 2495 L1759 Restriction endonuclease 2496 L1760 Retinaldehyde-binding protein 1 QYP L1761 Retinaldehyde-binding protein 1 2497 L1762 Retinaldehyde-binding protein 1 2498 L1763 Retinoblastoma pocket 2499 L1764 RfcS ITD L1765 RfcS LTE L1766 RfcS 2500 L1767 RfcS 2501 L1768 RfcS 2502 L1769 RfcS 2503 L1770 RfcS 2504 L1771 Rhamnogalacturonase B 2505 L1772 Rhamnogalacturonase B 2506 L1773 Rhamnogalacturonase B 2507 L1774 Rhamnogalacturonase B 2508 L1775 Rhamnogalacturonase B 2509 L1776 Rhodniin 2510 L1777 Rhodniin 2511 L1778 Riboflavin synthase 2512 L1779 Ribonuclease D 2513 L1780 Ribonuclease D 2514 L1781 Ribonuclease D 2515 L1782 Ribonuclease TTHA0252 2516 L1783 Ribonuclease TTHA0252 2517 L1784 Ribonuclease TTHA0252 2518 L1785 Ribonuclease TTHA0252 2519 L1786 Ribonuclease TTHA0252 2520 L1787 Ribonuclease TTHA0252 2521 L1788 Ribonucleotide reductase r1 protein 2522 L1789 Ribonucleotide reductase r1 protein 2523 L1790 Ribonucleotide reductase r1 protein 2524 L1791 Ribonucleotide reductase r1 protein 2525 L1792 Ribonucleotide reductase r1 protein 2526 L1793 Ribonucleotide reductase r1 protein 2527 L1794 Ribosome maturation factor RimM 2528 L1795 Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase RHA L1796 Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase 2529 L1797 Rigid extended P-rich 2530 L1798 Rigid extended P-rich 2531 L1799 Rigid extended P-rich 2532 L1800 Rigid extended P-rich 2533 L1801 Rigid extended P-rich 2534 L1802 Rigid extended P-rich 2535 L1803 Rigid extended P-rich 2536 L1804 Rigid extended P-rich 2537 L1805 Rigid extended P-rich 2538 L1806 Rigid extended P-rich 2539 L1807 Rigid extended P-rich 2540 L1808 Rigid extended P-rich 2541 L1809 Rigid extended P-rich 2542 L1810 Rigid extended P-rich 2543 L1811 Rigid extended P-rich 2544 L1812 Rigid helical 2545 L1813 Rigid helical 2546 L1814 Rigid helical 2547 L1815 Rigid helical 2548 L1816 Rigid helical 2549 L1817 Rigid helical 2550 L1818 Rigid helical 2551 L1819 Rigid helical 2552 L1820 RNA binding domain of rho transcription termination factor 2553 L1821 RNA binding protein ZFa 2554 L1822 Rob transcription factor 2555 L1823 Rob transcription factor 2556 L1824 RP2 lipase 2557 L1825 Rubrerythrin 2558 L1826 S-adenosylmethionine synthetase 2559 L1827 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 QFD L1828 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2560 L1829 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2561 L1830 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2562 L1831 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2563 L1832 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2564 L1833 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2565 L1834 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2566 L1835 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2567 L1836 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2568 L1837 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2569 L1838 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2570 L1839 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2571 L1840 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2572 L1841 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2573 L1842 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2574 L1843 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2575 L1844 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2576 L1845 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2577 L1846 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2578 L1847 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2579 L1848 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2580 L1849 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2581 L1850 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2582 L1851 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2583 L1852 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 2584 L1853 Scavenger mRNA-decapping enzyme DcpS ETG L1854 Scavenger mRNA-decapping enzyme DcpS NIT L1855 Scavenger mRNA-decapping enzyme DcpS 2585 L1856 Scavenger mRNA-decapping enzyme DcpS 2586 L1857 Sec18p (residues 22-210) 2587 L1858 Sec18p (residues 22-210) 2588 L1859 Sensor protein 2589 L1860 Sensor protein 2590 L1861 Septum site-determining protein MinC 2591 L1862 Serine acetyltransferase 2592 L1863 Serine protease/NTPase/helicase NS3 2593 L1864 Serine protease/NTPase/helicase NS3 2594 L1865 Serine protease/NTPase/helicase NS3 2595 L1866 Serine rich linker 2596 L1867 Serine rich linker 2597 L1868 Serine rich linker 2598 L1869 Serine rich linker 2599 L1870 Serine rich linker 2600 L1871 Serine rich linker 2601 L1872 Serine rich linker 2602 L1873 Seryl-tRNA synthetase 2603 L1874 Sialidase 2604 L1875 Sialidase B SLT L1876 Sialidase B VRE L1877 Sialidase B 2605 L1878 Sialidase B 2606 L1879 Sialidase B 2607 L1880 Sialidase B 2608 L1881 Sialidase B 2609 L1882 Sialidase B 2610 L1883 SIgnal peptIdase I SRR L1884 SIgnal peptIdase I 2611 L1885 SIgnal peptIdase I 2612 L1886 SIgnal peptIdase I 2613 L1887 SIgnal peptIdase I 2614 L1888 SIgnal peptIdase I 2615 L1889 SIgnal peptIdase I 2616 L1890 SIgnal peptIdase I 2617 L1891 SIgnal peptIdase I 2618 L1892 SIgnal peptIdase I 2619 L1893 SIgnal peptIdase I 2620 L1894 Signal recognition particle protein 2621 L1895 Signal transducer and activator of transcription1-alpha/beta NDE L1896 Signal transducer and activator of transcription1-alpha/beta SSF L1897 Signal transducer and activator of transcription1-alpha/beta 2622 L1898 Signal transducer and activator of transcription1-alpha/beta 2623 L1899 Signal transducer and activator of transcription1-alpha/beta 2624 L1900 Signal transducer and activator of transcription1-alpha/beta 2625 L1901 Signal transduction protein CBL 2626 L1902 Signal transduction protein CBL 2627 L1903 Similar to RAD54-like AKP L1904 Similar to RAD54-like EYF L1905 Similar to RAD54-like RFE L1906 Similar to RAD54-like 2628 L1907 Similar to RAD54-like 2629 L1908 Similar to RAD54-like 2630 L1909 Similar to RAD54-like 2631 L1910 Similar to RAD54-like 2632 L1911 Similar to RAD54-like 2633 L1912 Similar to RAD54-like 2634 L1913 Similar to RAD54-like 2635 L1914 Similar to RAD54-like 2636 L1915 Similar to RAD54-like 2637 L1916 SKD1 protein LMQ L1917 SKD1 protein 2638 L1918 SKD1 protein 2639 L1919 SKD1 protein 2640 L1920 SKD1 protein 2641 L1921 SKD1 protein 2642 L1922 Sll1358 protein 2643 L1923 Sll1358 protein 2644 L1924 Sll1358 protein 2645 L1925 Sll1358 protein 2646 L1926 Soluble IFN alpha/beta receptor 2647 L1927 Soluble IFN alpha/beta receptor 2648 L1928 Sporozoite-specific SAG protein 2649 L1929 Staphylococcal accessory regulator a homologue 2650 L1930 Staphylococcal nuclease domain-containing protein 1 2651 L1931 Staphylococcal nuclease domain-containing protein 1 2652 L1932 Staphylococcal nuclease domain-containing protein 1 2653 L1933 Staphylococcal nuclease domain-containing protein 1 2654 L1934 Staphylococcal nuclease domain-containing protein 1 2655 L1935 Staphylococcal nuclease domain-containing protein 1 2656 L1936 Stat protein 2657 L1937 Stat protein 2658 L1938 Stat protein 2659 L1939 Stat protein 2660 L1940 Stat protein 2661 L1941 Stat protein 2662 L1942 Stat protein 2663 L1943 Stat protein 2664 L1944 Stat protein 2665 L1945 Stat protein 2666 L1946 Stat protein 2667 L1947 Stat protein 2668 L1948 Stat protein 2669 L1949 Stat protein 2670 L1950 Stat protein 2671 L1951 Subtilisin-like protease 2672 L1952 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2673 L1953 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2674 L1954 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2675 L1955 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2676 L1956 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2677 L1957 Succinyl-CoA ligase [GDP-forming] alpha-chain, mitochondrial 2678 L1958 Succinyl-CoA synthetase beta chain ADG L1959 Succinyl-CoA synthetase beta chain RQP L1960 Succinyl-CoA synthetase beta chain 2679 L1961 Succinyl-CoA synthetase beta chain 2680 L1962 Succinyl-CoA synthetase beta chain 2681 L1963 Succinyl-CoA synthetase beta chain 2682 L1964 Succinyl-CoA synthetase beta chain 2683 L1965 Succinyl-CoA synthetase beta chain 2684 L1966 Succinyl-CoA:3-ketoacid-coenzyme A transferase 2685 L1967 Sulfurtransferase 2686 L1968 Superantigen SMEZ-2 2687 L1969 Superoxide dismutase 1 copper chaperone 2688 L1970 Surface layer protein 2689 L1971 Surface layer protein 2690 L1972 Surface layer protein 2691 L1973 Surface layer protein 2692 L1974 Surface layer protein 2693 L1975 Surface layer protein 2694 L1976 Surface layer protein 2695 L1977 Surface layer protein 2696 L1978 T lymphocyte activation antigen 2697 L1979 T lymphocyte activation antigen 2698 L1980 T-cell receptor alpha chain C region 2699 L1981 Terminal oxygenase component of carbazole 2700 L1982 Tetanus neurotoxin 2701 L1983 Tetracycline repressor protein class D 2702 L1984 The GTP-binding protein Obg 2703 L1985 The GTP-binding protein Obg 2704 L1986 The GTP-binding protein Obg 2705 L1987 The GTP-binding protein Obg 2706 L1988 Thioredoxin domain-containing protein 4 2707 L1989 Thioredoxin domain-containing protein 4 2708 L1990 Thiosulfate sulfurtransferase IDP L1991 Thiosulfate sulfurtransferase 2709 L1992 Thiosulfate sulfurtransferase 2710 L1993 Thiosulfate sulfurtransferase 2711 L1994 Thiosulfate sulfurtransferase 2712 L1995 Threonyl-tRNA synthetase 2713 L1996 Threonyl-tRNA synthetase 2714 L1997 Threonyl-tRNA synthetase 2715 L1998 Threonyl-tRNA synthetase 2716 L1999 Threonyl-tRNA synthetase 2717 L2000 Threonyl-tRNA synthetase 2718 L2001 Threonyl-tRNA synthetase 2719 L2002 Threonyl-tRNA synthetase 2720 L2003 Threonyl-tRNA synthetase 2721 L2004 Threonyl-tRNA synthetase 1 2722 L2005 Threonyl-tRNA synthetase 1 2723 L2006 Threonyl-tRNA synthetase 1 2724 L2007 Threonyl-tRNA synthetase 1 2725 L2008 Threonyl-tRNA synthetase 1 2726 L2009 Threonyl-tRNA synthetase 1 2727 L2010 Threonyl-tRNA synthetase 1 2728 L2011 Threonyl-tRNA synthetase 1 2729 L2012 Thrombospondin 1 2730 L2013 Tick-borne encephalitis virus glycoprotein 2731 L2014 Titin 2732 L2015 Titin 2733 L2016 TLR1789 protein 2734 L2017 TLR1789 protein 2735 L2018 Topoisomerase I 2736 L2019 Topoisomerase I 2737 L2020 Toxic shock syndrome toxin-1 2738 L2021 Toxic shock syndrome toxin-1 2739 L2022 Toxic shock syndrome toxin-1 2740 L2023 Toxic shock syndrome toxin-1 2741 L2024 T-plasminogen activator F1-G VPV L2025 T-plasminogen activator F1-G 2742 L2026 TpsB transporter FhaC 2743 L2027 TpsB transporter FhaC 2744 L2028 TpsB transporter FhaC 2745 L2029 Transcarbamylase 2746 L2030 Transcarbamylase 2747 L2031 Transcription antiterminator LicT 2748 L2032 Transcription elongation factor GreB 2749 L2033 Transcription initiation factor IIa gamma chain 2750 L2034 Transcription initiation factor IIb 2751 L2035 Transcription initiation factor IIb 2752 L2036 Transcriptional regulator (NtrC family) 2753 L2037 Transcriptional regulator AefR 2754 L2038 Transcriptional regulator AefR 2755 L2039 Transcriptional regulator AefR 2756 L2040 Transcriptional regulator AefR 2757 L2041 Transcriptional regulator AefR 2758 L2042 Transcriptional regulator, AsnC family 2759 L2043 Transcriptional regulator, AsnC family 2760 L2044 Transcriptional regulator, AsnC family 2761 L2045 Transcriptional regulator, biotin repressor family 2762 L2046 Transcriptional regulator, Crp/Fnr family 2763 L2047 Transcriptional regulator, GntR family 2764 L2048 Transcriptional regulator, HTH_3 family 2765 L2049 Transcriptional regulator, HTH_3 family 2766 L2050 Transcriptional regulator, HTH_3 family 2767 L2051 Transcriptional regulator, HTH_3 family 2768 L2052 Transcriptional regulator, HTH_3 family 2769 L2053 Transcriptional regulator, laci family 2770 L2054 Transcriptional regulatory protein ZraR 2771 L2055 Transcriptional regulatory protein ZraR 2772 L2056 Transcriptional regulatory protein ZraR 2773 L2057 Transcriptional regulatory protein ZraR 2774 L2058 Transcriptional regulatory protein ZraR 2775 L2059 Transcriptional regulatory protein ZraR 2776 L2060 Transcriptional regulatory protein ZraR 2777 L2061 Transferrin receptor protein VSN L2062 Transferrin receptor protein 2778 L2063 Transferrin receptor protein 2779 L2064 Transferrin receptor protein 2780 L2065 Transferrin receptor protein 2781 L2066 Translation initiation factor 5A 2782 L2067 Translation initiation factor 5A 2783 L2068 Translation initiation factor 5A 2784 L2069 Translation initiation factor IF2/eIF5b 2785 L2070 Translation initiation factor IF2/eIF5b 2786 L2071 Transposable element mariner, complete CDS 2787 L2072 Tricorn protease 2788 L2073 Tricorn protease 2789 L2074 Tricorn protease 2790 L2075 Trigger factor 2791 L2076 Trigger factor 2792 L2077 Trigger factor 2793 L2078 TRNA CCA-adding enzyme RRI L2079 TRNA CCA-adding enzyme 2794 L2080 TRNA CCA-adding enzyme 2795 L2081 TRNA CCA-adding enzyme 2796 L2082 TRNA CCA-adding enzyme 2797 L2083 TRNA nucleotidyltransferase 2798 L2084 TRNA-splicing endonuclease 2799 L2085 Tt1467 protein LEA L2086 Tt1467 protein 2800 L2087 Tumor suppressor p53-binding protein 1 2801 L2088 Tumor suppressor p53-binding protein 1 2802 L2089 Tumor suppressor p53-binding protein 1 2803 L2090 Tumor suppressor p53-binding protein 1 2804 L2091 Type A flavoprotein FprA 2805 L2092 Type A flavoprotein FprA 2806 L2093 Type A flavoprotein FprA 2807 L2094 Type A flavoprotein FprA 2808 L2095 Type A flavoprotein FprA 2809 L2096 Type I restriction enzyme specificity protein MG438 QMH L2097 Type I restriction enzyme specificity protein MG438 2810 L2098 Type I restriction enzyme specificity protein MG438 2811 L2099 Type I restriction-modification enzyme, S subunit 2812 L2100 Type I restriction-modification enzyme, S subunit 2813 L2101 Type I site-specific restriction-modification system, R (restriction) subunit 2814 L2102 Type I site-specific restriction-modification system, R (restriction) subunit 2815 L2103 Type I site-specific restriction-modification system, R (restriction) subunit 2816 L2104 Type II DNA topoisomerase VI subunit B 2817 L2105 Type II DNA topoisomerase VI subunit B 2818 L2106 Type II DNA topoisomerase VI subunit B 2819 L2107 Type II DNA topoisomerase VI subunit B 2820 L2108 Type II DNA topoisomerase VI subunit B 2821 L2109 Type II DNA topoisomerase VI subunit B 2822 L2110 Type II DNA topoisomerase VI subunit B 2823 L2111 Type II DNA topoisomerase VI subunit B 2824 L2112 Type II DNA topoisomerase VI subunit B 2825 L2113 Type II DNA topoisomerase VI subunit B 2826 L2114 Type II DNA topoisomerase VI subunit B 2827 L2115 Type VI secretion system component 2828 L2116 Type VI secretion system component 2829 L2117 Type VI secretion system component 2830 L2118 Tyrosine-protein kinase receptor UFO 2831 L2119 Tyrosine-protein kinase receptor UFO 2832 L2120 Tyrosine-protein kinase ZAP-70 2833 L2121 Tyrosine-protein kinase ZAP-70 2834 L2122 Tyrosyl-DNA phosphodiesterase 2835 L2123 Tyrosyl-DNA phosphodiesterase 2836 L2124 Ubiquitin carboxyl-terminal hydrolase 7 2837 L2125 UDP-galactopyranose mutase 2838 L2126 UDP-galactopyranose mutase 2839 L2127 UDP-galactopyranose mutase 2840 L2128 UDP-galactopyranose mutase 2841 L2129 UDP-galactopyranose mutase 2842 L2130 UDP-glucose dehydrogenase 2843 L2131 UDP-N-acetylmuramate-L-alanine ligase 2844 L2132 UDP-N-acetylmuramate-L-alanine ligase 2845 L2133 UDP-N-acetylmuramoylalanine--D-glutamate ligase 2846 L2134 UDP-N-acetylmuramoylalanine--D-glntamate ligase 2847 L2135 UDP-N-acetylmuramoylalanine-D-glutamyl-lysine-D-alanyl-D-alanine ligase, MurF 2848 protein L2136 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2849 L2137 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2850 L2138 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2851 L2139 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2852 L2140 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2853 L2141 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2854 L2142 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase 2855 L2143 Uncharacterized conserved protein 2856 L2144 Uncharacterized conserved protein 2857 L2145 Uncharacterized GST-like protein yfcF 2858 L2146 Uncharacterized GST-like proteinprotein 2859 L2147 Uncharacterized GST-like proteinprotein 2860 L2148 Uncharacterized GST-like proteinprotein 2861 L2149 Uncharacterized protein 2862 L2150 Uncharacterized protein 2863 L2151 Uncharacterized protein BT_1490 2864 L2152 Uncharacterized protein ypfl TLR L2153 Uncharacterized protein ypfl VHP L2154 Uncharacterized protein ypfl 2865 L2155 Uncharacterized protein ypfl 2866 L2156 Uncharacterized protein ypfl 2867 L2157 Uncharacterized protein ypfl 2868 L2158 Uncharacterized protein ypfl 2869 L2159 Uncharacterized protein ypfl 2870 L2160 Uncharacterized protein ypfl 2871 L2161 Uncharacterized protein ypfl 2872 L2162 Uncharacterized protein ypfl 2873 L2163 Uncharacterized protein ypfl 2874 L2164 Uncharacterized protein ypfl 2875 L2165 Uncharacterized protein ypfl 2876 L2166 Uncharacterized protein ypfl 2877 L2167 Uncharacterized protein ypfl 2878 L2168 Uncharacterized protein ypfl 2879 L2169 Unknown protein 2880 L2170 Unknown protein 2881 L2171 UPF0131 protein ykqA 2882 L2172 UPF0131 protein ykqA 2883 L2173 UPF0131 protein ykqA 2884 L2174 UPF0348 protein MJ0951 2885 L2175 UPF0348 protein MJ0951 2886 L2176 UPF0348 protein MJ0951 2887 L2177 UPF0348 protein MJ0951 2888 L2178 UPF0348 protein MJ0951 2889 L2179 UPF0348 protein MJ0951 2890 L2180 UPF0348 protein MJ0951 2891 L2181 UPF0348 protein MJ0951 2892 L2182 URE2 protein 2893 L2183 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase TAK L2184 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2894 L2185 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2895 L2186 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2896 L2187 Uridine diphospho-N-acetylenolpyruvylglucosaminereductase 2897 L2188 Urokinase plasminogen activator surface receptor 2898 L2189 Urokinase plasminogen activator surface receptor 2899 L2190 Vascular cell adhesion molecule-1 2900 L2191 VCP-like ATPase 2901 L2192 VCP-like ATPase 2902 L2193 Viral CASP8 and FADD-like apoptosis regulator 2903 L2194 Vitamin K-dependent protein Z 2904 L2195 VP1 protein 2905 L2196 V-type ATP synthase alpha chain 2906 L2197 Xaa-Pro aminopeptidase 2907 L2198 Xaa-Pro aminopeptidase 2908 L2199 Xaa-Pro aminopeptidase 2909 L2200 Xaa-Pro aminopeptidase 2910 L2201 Xanthine dehydrogenase 2911 L2202 Xanthine dehydrogenase 2912 L2203 Xanthine dehydrogenase 2913 L2204 Xanthine dehydrogenase 2914 L2205 X-prolyl dipeptidyl aminopeptidase KSY L2206 X-prolyl dipeptidyl aminopeptidase LDG L2207 X-prolyl dipeptidyl aminopeptidase LLE L2208 X-prolyl dipeptidyl aminopeptidase TYS L2209 X-prolyl dipeptidyl aminopeptidase 2915 L2210 X-prolyl dipeptidyl aminopeptidase 2916 L2211 X-prolyl dipeptidyl aminopeptidase 2917 L2212 X-prolyl dipeptidyl aminopeptidase 2918 L2213 X-prolyl dipeptidyl aminopeptidase 2919 L2214 X-prolyl dipeptidyl aminopeptidase 2920 L2215 X-prolyl dipeptidyl aminopeptidase 2921 L2216 X-prolyl dipeptidyl aminopeptidase 2922 L2217 X-prolyl dipeptidyl aminopeptidase 2923 L2218 X-prolyl dipeptidyl aminopeptidase 2924 L2219 X-prolyl dipeptidyl aminopeptidase 2925 L2220 X-prolyl dipeptidyl aminopeptidase 2926 L2221 X-prolyl dipeptidyl aminopeptidase 2927 L2222 X-prolyl dipeptidyl aminopeptidase 2928 L2223 X-prolyl dipeptidyl aminopeptidase 2929 L2224 X-prolyl dipeptidyl aminopeptidase 2930 L2225 X-prolyl dipeptidyl aminopeptidase 2931 L2226 X-prolyl dipeptidyl aminopeptidase 2932 L2227 X-prolyl dipeptidyl aminopeptidase 2933 L2228 X-prolyl dipeptidyl aminopeptidase 2934 L2229 X-prolyl dipeptidyl aminopeptidase 2935 L2230 X-prolyl dipeptidyl aminopeptidase 2936 L2231 X-prolyl dipeptidyl aminopeptidase 2937 L2232 X-prolyl dipeptidyl aminopeptidase 2938 12233 Xylosidase/arabinosidase 2939 L2234 Xylosidase/arabinosidase 2940 L2235 Xylosidase/arabinosidase 2941 L2236 Xylosidase/arabinosidase 2942 L2237 Xylosidase/arabinosidase 2943 L2238 Xylosidase/arabinosidase 2944 L2239 Xylosidase/arabinosidase 2945 L2240 YkoF 2946 L2241 YkuI protein 2947

    [0161] Internal ribosomal entry site (IRES) is a nucleotide sequence (<500 nucleotides) that allows for initiation of translation in the middle of an mRNA sequence (Kim, J. H. et al., 2011. PLoS One 6(4): e18556; the contents of which are herein incorporated by reference in its entirety). Use of an IRES sequence ensures co-expression of genes before and after the IRES, though the sequence following the IRES may be transcribed and translated at lower levels than the sequence preceding the IBES sequence.

    [0162] 2A peptides are small self-cleaving peptides (18-22 amino acids) derived from viruses such as foot-and-mouth disease virus (F2A), porcine teschovirus-1 (P2A), Thoseaassigna virus (T2A), or equine rhinitis A vines (E2A). The 2A designation refers specifically to a region of picornavirus polyproteins that lead to a ribosomal skip at the glycyl-prolyl bond in the C-terminus of the 2A peptide (Kim, J. H. et al., 2011. PLoS One 6(4): e18556; the contents of which are herein incorporated by reference in its entirety). This skip results in a cleavage between the 2A peptide and its immediate downstream peptide. As opposed to IRES linkers, 2A peptides generate stoithiometric expression of proteins flanking the 2A peptide and their shorter length can be advantageous in generating viral expression vectors.

    [0163] Some payload regions encode linkers comprising furin cleavage sites. Furin is a calcium dependent serine endoprotease that cleaves proteins just downstream of a basic amino acid target sequence (Arg-X-(Arg/Lys)-Arg) (Thomas, G., 2002. Nature Reviews Molecular Cell Biology 3(10): 753-66; the contents of which are herein incorporated reference in its entirety). Furin is enriched in the trans-golgi network where it is involved in processing cellular precursor proteins. Furin also plays a role in activating a number of pathogens. This activity can be taken advantage of for expression of polypeptides of the invention.

    [0164] In some embodiments, the payload region may encode one or more linkers comprising cathepsin, matrix metalloproteinases or legumain cleavage sites. Such linkers are described e.g. by Cizeau and Macdonald in International Publication No. WO2008052322, the contents of which are herein incorporated in their entirety. Cathepsins are a family of proteases with unique mechanisms to cleave specific proteins. Cathepsin B is a cysteine protease and cathepsin D is an aspartyl protease. Matrix metalloproteinases are a family of calcium-dependent acid zinc-containing endopeptidases. Legumain is an enzyme catalyzing the hydrolysis of (-Asn-Xaa-) bonds of proteins and small molecule substrates.

    [0165] In some embodiments, payload regions may encode linkers that are not cleaved. Such linkers may include a simple amino acid sequence, such as a glycine rich sequence. In some cases, linkers may comprise flexible peptide linkers comprising glycine and serine residues. The linker may comprise flexible peptide linkers of different lengths, e.g. nxG4S, where n=1-10 and the length of the encoded linker varies between 5 and 50 amino acids (SEQ ID NO: 17940). In a non-limiting example, the linker may be 5xG4S (SEQ ID NO: 17939 encoded by SEQ ID NO: 903). These flexible linkers are small and without side chains so they tend not to influence secondary protein structure while providing a flexible linker between antibody segments (George, R. A., et al., 2002. Protein Engineering 15(11): 871-9; Huston, J. S. et al., 1988. PNAS 85:5879-83 and Shan, D. et al., 1999. Journal of Immunology. 162(11):6589-95; the contents of each of which are herein incorporated by reference in their entirety). Furthermore, the polarity of the serine residues improves solubility and prevents aggregation problems.

    [0166] In some embodiments, payload regions of the invention may encode small and unbranched serine rich peptide linkers, such as those described by Huston et al. in U.S. Pat. No. 5,525,491, the contents of which are herein incorporated in their entirety. Poly peptides encoded by the payload region of the invention, linked b serine-rich linkers, have increased solubility.

    [0167] In some embodiments, payload regions of the invention may encode artificial linkers, such as those described by Whitlow and Filpula in U.S. Pat. No. 5,856,456 and Ladner et al. in U.S. Pat. No. 4,946,778, the contents of each of which are herein incorporated by their entirety.

    Viral Genome Component: Introns

    [0168] In one embodiment, the payload region comprises at least one element to enhance the expression such as one or more introns or portions thereof. Non-limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), -globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps).

    [0169] In one embodiment, the intron or intron portion may be 100-500 nucleotides in length. The intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500. The intron may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500.

    Payloads of the Invention

    [0170] The AAV particles of the present disclosure comprise at least one payload region. As used herein, payload or payload region refers to one or more polynucleotides or polynucleotide regions encoded by or within a viral genome or an expression product of such polynucleotide or polynucleotide region, e.g., a transgene, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory nucleic acid or regulatory nucleic acid. Payloads of the present invention typically encode polypeptides (e.g., antibodies or antibody-based compositions) or fragments or variants thereof.

    [0171] The payload region may be constructed in such a way as to reflect a region similar to or mirroring the natural organization of an snRNA.

    [0172] The payload region may comprise a combination of coding and non-coding nucleic acid sequences.

    [0173] In some embodiments, the AAV payload region may encode a coding or non-coding RNA.

    [0174] In one embodiment, the AAV particle comprises a viral genome with a payload region comprising nucleic acid sequences encoding more than one polypeptide of interest (e.g., an antibody). In such an embodiment, a viral genome encoding more than one polypeptide may be replicated and packaged into a viral particle. A target cell transduced with a viral particle comprising more than one polypeptide may express each of the polypeptides in a single cell.

    [0175] In one embodiment, as shown in FIG. 1, an AAV particle comprises a viral genome with a payload region comprising a nucleic acid sequence encoding a heavy chain and a light chain of an antibody. The heavy chain and light chain are expressed and assembled to form the antibody which is secreted.

    [0176] In one embodiment, the payload region may comprise the components as shown in FIG. 2. The payload region 110 is located within the viral genome 100. At the 5 and/or the 3 end of the payload region 110 there may be at least one inverted terminal repeat (ITR) 120. Within the payload region, there is a promoter region 130, an intron region 140 and a coding region 150. When the coding region 150 comprises a heavy chain region 151 and light chain region 152 of an antibody, the two chains may be separated by a linker region 155.

    [0177] In one embodiment, the coding region may comprise a heavy and light chain sequence and a linker. As shown in FIG. 3, the payload region may comprise a heavy chain and light chain sequence separated by a linker and/or a cleavage site. In one embodiment, the heavy and light chain sequence is sequence separated by an TRES sequence (1 and 2). In one embodiment, the heavy and light chain sequence is separated by a foot and mouth virus sequence (3 and 4). In one embodiment, the heavy and light chain sequence is separated by a foot and mouth virus sequence and a thrill cleavage site (5 and 6). In one embodiment, the heavy and light chain sequence is separated by a porcine teschovirus-1 virus sequence (7 and 8). In one embodiment, the heavy and light chain sequence is separated by a porcine teschovirus-1 virus and a fur in cleavage site (9 and 10). In one embodiment, the heavy and light chain sequence is separated by a 5xG4S sequence (SEQ ID NO: 17939) (11).

    [0178] Where the AAV particle payload region encodes a polypeptide, the polypeptide may be a peptide or protein. A protein encoded by the AAV particle payload region may comprise an antibody, an antibody related composition, a secreted protein, an intracellular protein, an extracellular protein, and/or a membrane protein. The encoded proteins may be structural or functional. In addition to the antibodies or antibody-based composition, proteins encoded by the payload region may include, in combination, certain mammalian proteins involved in immune system regulation. The AAV viral genomes encoding poly peptides described herein may be useful in the fields of human disease, viruses, infections veterinary applications and a variety of in vivo and in vitro settings.

    [0179] In some embodiments, the AAV particles are useful in the field of medicine for the treatment, prophylaxis, palliation or amelioration of neurological diseases and/or disorders.

    Antibodies and Antibody-Based Compositions

    [0180] Payload regions of the AAV particles of the invention may encode polypeptides that form one or more functional antibodies or antibody-based compositions. As used herein, the term antibody is referred to in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies formed from at least two intact antibodies), and antibody fragments (e.g., diabodies) so long as they exhibit a desired biological activity (e.g., functional). Antibodies are primarily amino-acid based molecules but may also comprise one or more modifications (including, but not limited to the addition of sugar moieties, fluorescent moieties, chemical tags, etc.).

    [0181] As used herein, antibody-based or antibody-derived compositions are monomeric or multi-merit polypeptides which comprise at least one amino-acid region derived from a known or parental antibody sequence and at least one amino acid region derived from a non-antibody sequence, e.g., mammalian protein.

    [0182] Payload regions may encode polypeptides that form or function as any antibody, including antibodies that are known in the art and/or antibodies that are commercially available. The encoded antibodies may be therapeutic, diagnostic, or for research purposes. Further, polypeptides of the invention may include fragments of such antibodies or antibodies that have been developed to comprise one or more of such fragments (e.g., variable domains or complementarily determining regions (CDRs)).

    [0183] In one embodiment, the viral genonie of the AAV particles may comprise nucleic acids which have been engineered to enable expression of antibodies, antibody fragments, or components of any of those described in U.S. Pat. No. 7,041,807 related to YYX epitope; US20090175884, US20110305630, US20130330275 related to misfolded proteins in cancer; US20040175775 related to PrP in eve fluid, US20030114360 related to copolymers and methods of treating prion-related diseases; WO2009121176 insulin-induced gene peptide compositions; US20030022243; WO2003000853 related to protein aggregation assays; WO200078344 related to prion protein peptides and uses thereof. Each of these publications are incorporated by reference in their entireties.

    Antibody Generation

    [0184] In some embodiments, viral genomes of the AAV particles of the invention may encode antibodies or antibody-based compositions produced using methods known in the art. Such methods may include, but are not limited to immunization and display technologies (e.g., phage display, yeast display, and ribosomal display). Antibodies may be developed, for example, using any naturally occurring or synthetic antigen. As used herein, an antigen is an entity which induces or evokes an immune response in an organism. An immune response is Characterized by the reaction of the cells, tissues and/or organs of an organism to the presence of a foreign entity. Such an immune response typically leads to the production by the organism of one or more antibodies against the foreign entity, e.g., antigen or a portion of the antigen. As used herein, antigens also refer to binding partners for specific antibodies or binding agents in a display library.

    [0185] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be derived from antibodies produced using hybridoma technology. Host animals (e.g. mice, rabbits, goats, and llamas) may be immunized by an injection with an antigenic protein to elicit lymphocytes that specifically bind to the antigen. Lymphocytes may be collected and fused with immortalized cell lines to generate hybridomas which can be cultured in a suitable culture medium to promote growth. The antibodies produced by the cultured hybridomas may be subjected to analysis to determine binding specificity of the antibodies for the target antigen. Once antibodies with desirable characteristics are identified, corresponding hybridomas may be subcloned through limiting dilution procedures and grown by standard methods. The antibodies produced by these cells may be isolated and purified using standard immunoglobulin purification procedures.

    [0186] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be produced using heavy and light chain variable region cDNA sequences selected from hybridomas or from other sources. Sequences encoding antibody variable domains expressed by hybridomas may be determined by extracting RNA molecules from antibody-producing hybridoma cells and producing cDNA by reverse transcriptase polymerase chain reaction (PCR). PCR may be used to amplify cDNA using primers specific for heavy and light chain sequences. PCR products may then be subcloned into plasmids for sequence analysis. Antibodies may be produced by insertion of resulting variable domain sequences into expression vectors.

    [0187] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated using display technologies. Display technologies used to generate polypeptides of the invention may include any of the display techniques (e.g. display library screening techniques) disclosed in International Patent Application No. WO2014074532, the contents of which are herein incorporated by reference in their entirety. In some embodiments, synthetic antibodies may be designed, selected or optimized by screening target antigens using display technologies (e.g. phage display technologies). Phage display libraries may comprise millions to billions of phage particles, each expressing unique antibody fragments on their viral coats. Such libraries may provide richly diverse resources that may be used to select potentially hundreds of antibody fragments with diverse levels of affinity for one or more antigens of interest (McCafferty, et al., 1990. Nature, 348:552-4; Edwards, B. M. et al., 2003. JMB. 334: 103-18; Schofield, D. et al., 2007. Genome Biol. 8, R254 and Pershad, K. et al., 2010. Protein Engineering Design and Selection. 23:279-88; the contents of each of which are herein incorporated by reference in their entirety). Often, the antibody fragments present in such libraries comprise scfv antibody fragments, comprising a fusion protein of V.sub.H and V.sub.L antibody domains joined by a flexible linker. In some cases, says may contain the same sequence with the exception of unique sequences encoding variable loops of the CDRs. In some cases, scFvs are expressed as fusion proteins, linked to viral coat proteins (e.g. the N-terminus of the viral pIII coat protein). V.sub.L chains may be expressed separately for assembly with chains in the periplasm prior to complex incorporation into viral coats. Precipitated library members may be sequenced from the bound phage to obtain cDNA encoding desired scFvs. Antibody variable domains or CDRs from such sequences may be directly incorporated into antibody sequences for recombinant antibody production, or mutated and utilized for further optimization through in vitro affinity maturation.

    [0188] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be produced using yeast surface display technology, wherein antibody variable domain sequences may be expressed on the cell surface of Saccharomyces cerevisiae. Recombinant antibodies may be developed by displaying the antibody fragment of interest as a fusion to e.g. Aga2p protein on the surface of the yeast, where the protein interacts with proteins and small molecules in a solution says with affinity towards desired receptors mar be isolated from the yeast surface using magnetic separation and flow cytometry. Several cycles of yeast surface display and isolation may be done to attain scFvs with desired properties through directed evolution.

    [0189] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be designed by VERSITOPE Antibody Generation and other methods used by BIOATLA and described in United States Patent Publication No. US20130281303, the contents of which are herein incorporated by reference in their entirety. In brief, recombinant monoclonal antibodies are derived from B-cells of a host immuno-challenged with one or more target antigens. These methods of antibody generation do not rely on immortalized cell lines, such as hybridoma, thereby avoiding some of the associated challenges i.e., genetic instability and low production capacity, producing high affinity and high diversity recombinant monoclonal antibodies. In one embodiment, the method is a natural diversity approach. In another embodiment, the method is a high diversity approach.

    [0190] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated using BIOATLA natural diversity approach In the natural diversity approach of generating recombinant monoclonal antibodies described in United States Patent Publication No. US20130281303, the original pairings of variable heavy (V.sub.H) and variable light (V.sub.L) domains are retained from the host, yielding recombinant monoclonal antibodies that are naturally paired. These may be advantageous due to a higher likelihood of functionality as compared to non-natural pairings of V.sub.H and V.sub.L. To produce the recombinant monoclonal antibodies, first a non-human host (i.e., rabbit, mouse, hamster, guinea pig, camel or goat) is immuno-challenged with an antigen of interest. In some embodiments, the host may be a previously challenged human patient. In other embodiments, the host may not have been immuno-challenged. B-cells are harvested from the host and screened by fluorescence activated cell sorting (FACS), or other method, to create a library of B-cells enriched in B-cells capable of binding the target antigen. The cDNA obtained from the mRNA of a single B-cell is then amplified to generate an immunoglobulin library of V.sub.H and V.sub.L domains. This library of immunoglobulins is then cloned into expression vectors capable of expressing the V.sub.H and V.sub.L domains, wherein the V.sub.H and V.sub.L domains remain naturally paired. The library of expression vectors is then used in an expression system to express the V.sub.H and V.sub.L domains in order to create an antibody library. Screening of the antibody library yields antibodies able to bind the target antigen, and these antibodies can be further characterized. Characterization may include one or more of the following: isoelectric point, thermal stability, sedimentation rate, folding rate, neutralization or antigen activity, antagonist or agonistic activity, expression level, specific and non-specific binding, inhibition of enzymatic activity, rigidity/flexibility, shape, charge, stability across pH, in solvents, under UV radiation, in mechanical stress conditions, or in some conditions, half-life and glycosylation.

    [0191] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated using BIOATLA high diversity approach. In the high diversity approach of generating recombinant monoclonal antibodies described in United States Patent Publication No. US20130281303, additional pairings of variable heavy (V.sub.H) and variable light (V.sub.L) domains are attained. To produce the recombinant monoclonal antibodies, B-cells harvested from the host are screened by fluorescence activated cell sorting (FACS), panning, or other method, to create a library of B-cells enriched in B-cells capable of binding the target antigen. The cDNA obtained from the mRNA of the pooled B-cells is then amplified to generate an immunoglobulin library of V.sub.H and V.sub.L domains. This library of immunoglobulins is then used in a biological display system (mammalian, yeast or bacterial cell surface display systems) to generate a population of cells displaying antibodies, fragments or derivatives comprising the V.sub.H and V.sub.L domains wherein, the antibodies, fragments or derivatives comprise V.sub.H and V.sub.L domain combinations that were not present in the B-cells in vivo. Screening of the cell population by FACS, with the target antigen, yields a subset of cells capable of binding the target antigen and the antibodies displayed on these cells can be further characterized. In an alternate embodiment of the high diversity approach, the immunoglobulin library comprises only V.sub.H domains obtained from the B-cells of the immuno-challenged host, while the V.sub.L domain(s) are obtained from another source.

    [0192] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be evolved using BIOATLA comprehensive approaches. The methods of generating recombinant monoclonal antibodies as described in United States Patent Publication No. US20130281303, further comprises evolving the recombinant antibody by comprehensive positional evolution (CPE), CPE followed by comprehensive protein synthesis (CPS), PCR shuffling, or other method.

    [0193] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be derived from any of the BIOATLA protein evolution methods described in International Publication WO2012009026, the contents of which are herein incorporated by reference in their entirety. In this method, mutations are systematically performed throughout the polypeptide or molecule of interest, a map is created providing useful informatics to guide the subsequent evolutionary steps. Not wishing to be bound by theory, these evolutionary methods typically start with a template polypeptide and a mutant is derived therefrom, which has desirable properties or characteristics. Non-limiting examples of evolutionary techniques include polymerase chain reaction (PCR), error prone PCR, oligonucleotide-directed mutagenesis, cassette mutagenesis, shuffling, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis, in vitro mutagenesis, ligase chain reaction, oligonucleotide synthesis or any combination thereof.

    [0194] In one embodiment, the BIOATLA evolution method is Comprehensive Positional Evolution (CPE). CPE, naturally occurring amino acid variants are generated for each of the codons of the template polypeptide, wherein 63 different codon options exist for each amino acid variant. A set of poly peptides with single amino acid mutations are generated and the mutations are then confirmed by sequencing or other method known in the art and each amino acid change screened for improved function, neutral mutations, inhibitory mutations, expression and compatibility with the host system. An EvoMap is created that describes in detail the effects of each amino acid mutation on the properties and characteristics of that polypeptide. The data from the EvoMap may be utilized to produce polypeptides with more than one amino acid mutation, wherein the resultant multi-site mutant polypeptides can be screened for desirable characteristics.

    [0195] In one embodiment, the BIOATLA evolution method is Synergy Evolution, wherein an EvoMap is used to identify amino acid positions to introduce 2-20 mutations simultaneously to produce a combinatorial effect. The resulting multi-site mutant polypeptides may be screened on one or more pre-determined characteristics to identify upmutants wherein the function of the mutant is improved as compared to the parent polypeptide. In one embodiment, Synergy Evolution is used to enhance binding affinity of an antibody.

    [0196] In one embodiment, the BIOATLA evolution method is Flex Evolution, wherein an EvoMap is used to identify fully mutable sites within a polypeptide that may then be targeted for alteration, such as introduction of glycosylation sites or chemical conjugation.

    [0197] In one embodiment, the BIOATLA evolution method is Comprehensive Positional Insertion Evolution (CPD), wherein an amino acid is inserted after each amino acid of a template polypeptide to generate a set of lengthened polypeptides. CPI may be used to insert 1, 2, 3, 4, or 5 amino acids at each new position. The resultant lengthened polypeptides are sequenced and assayed for one or more pre-determined properties and evaluated in comparison to its template or parent molecule. In one embodiment, the binding affinity and immunogenicity of the resultant polypeptides are assayed. In one embodiment, the lengthened polypeptides are further mutated and mapped to identify polypeptides with desirable characteristics.

    [0198] In one embodiment, the BIOATLA evolution approach is Comprehensive Positional Deletion Evolution (CPD), wherein each amino acid of the template polypeptide is individually and systematically deleted one at a time. The resultant shortened polypeptides are then sequenced and evaluated by assay for at least one pre-determined feature. In one embodiment, the shortened polypeptides are further mutated and mapped to identify polypeptides with desirable characteristics.

    [0199] In one embodiment, the BIOATLA evolution approach is Combinatorial Protein Synthesis (CPS), wherein mutants identified in CPE, CPI, CPD or other evolutionary technique are combined for polypeptide synthesis. These combined mutant polypeptides are then screened for enhanced properties and characteristics. In one embodiment CPS is combined with any of the aforementioned evolutionary or polypeptide synthesis methods.

    [0200] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be derived from the BIOATLA Comprehensive integrated Antibody Optimization (CIAO!) described in U.S. Pat. No. 8,859,467 the contents of which are herein incorporated by reference in their entirety. The CIAO! method allows for simultaneous evolution of polypeptide performance and expression optimization, within a eukaryotic cell host (i.e., mammalian or yeast cell host). First, an antibody library is generated in a mammalian cell production host by antibody cell surface display, wherein the generated antibody library targets a particular antigen of interest. The antibody library is then screened by any method known in the art, for one or more properties or characteristics. One or more antibodies of the library, with desirable properties or characteristics are chosen for further polypeptide evolution by any of the methods known in the art, to produce a library of mutant antibodies by antibody cell surface display in a mammalian cell production host. The generated mutant antibodies are screened for one or more predetermined properties or characteristics, whereby an upmutant is selected, wherein the upmutant has enhanced or improved characteristics as compared to the parent template polypeptide.

    [0201] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be humanized by the methods of BIOATLA as described in United States Patent Publication US20130303399, the contents of which are herein incorporated by reference in their entirety. In this method, for generating enhanced full length humanized antibodies in mammalian cells, no back-mutations are required to retain affinity to the antigen and no CDR grafting or phage-display is necessary. The generated humanized antibody has reduced immunogenicity and equal or greater affinity for the target antigen as compared to the parent antibody. The variable regions or CDRs of the generated humanized antibody are derived from the parent or template, whereas the framework and constant regions are derived from one or more human antibodies. To start, the parent or template antibody is selected, cloned and each CDR sequence identified and synthesized into a CDR fragment library. Double stranded DNA fragment libraries for V.sub.H and V.sub.L are synthesized from the CDR fragment encoding libraries, wherein at least one CDR fragment library is derived from the template antibody and framework (FW) fragment encoding libraries, wherein the FW fragment library is derived from a pool of human frameworks obtained from natively expressed and functional human antibodies. Stepwise liquid phase ligation of FW and CDR encoding fragments is then used to generate both V.sub.H and V.sub.L fragment libraries. The V.sub.H and V.sub.L fragment libraries are then cloned into expression vectors to create a humanization library, which is further transfected into cells for expression of full length humanized antibodies, and used to create a humanized antibody library. The humanized antibody library is then screened to determine expression level of the humanized antibodies, affinity or binding ability for the antigen, and additional improved or enhanced characteristics, as compared to the template or parent antibody. Non-limiting examples of characteristics that may be screened include equilibrium dissociation constant (K.sub.D), stability, melting temperature (T.sub.m), pI, solubility, expression level, reduced immunogenicity and improved effector function.

    [0202] In one embodiment, the sequences of the polypeptides to be encoded in the viral genomes of the invention may be generated by the BIOATLA method for preparing conditionally active antibodies as described in International Publications WO2016033331 and WO2016036916, the contents of which are herein incorporated by reference in their entirely. As used herein, the term conditionally active refers to a molecule that is active at an aberrant condition. Further, the conditionally active molecule may be virtually inactive at normal physiological conditions. Aberrant conditions may result from changes in temperature, osmotic pressure, osmolality, oxidative stress, electrolyte concentration, and/or chemical or proteolytic resistance, as non-limiting examples.

    [0203] The method of preparing a conditionally active antibody is described in International Publications WO2016033331 and WO2016036916 and summarized herewithin. Briefly, a wild-type polypeptide is selected and the DNA is evolved to create mutant DNAs. Non-limiting examples of evolutionary techniques that may be used to evolve the DNA include polymerase chain reaction (PCR), error prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis, in vitro mutagenesis, ligase chain reaction, oligonucleotide synthesis or any combination thereof. Once mutant DNAs are created, they are expressed in a eukaryotic cell production host (i.e., fitngal, insect, mammalian, adenoviral, plant), wherein a mutant polypeptide is produced. The mutant polypeptide and the corresponding wild-type poly peptide are then subjected to assays under both normal physiological conditions and aberrant conditions in order to identify mutants that exhibit a decrease in activity in the assay at normal physiological conditions as compared to the wild-type polypeptide and/or an increase in activity in the assay under aberrant conditions, as compared to the corresponding wild-type polypeptide. The desired conditionally active mutant may then be produced in the aforementioned eukaryotic cell production host.

    [0204] In one embodiment, the conditionally active antibody is a mirac protein as described by BIOATLA in U.S. Pat. No 8,709,755, the contents of which are herein incorporated by reference in their entirety. As used herein mirac protein refers to a conditionally active antibody that is virtually inactive at body temperature but active at lower temperatures.

    [0205] In one embodiment, the sequence of the polypeptides to be encoded in the viral genomes of the invention (e.g., antibodies) may be derived based on any of the BIOATLA methods including, but not limited to, VERSITOPE Antibody Generation, natural diversity approaches and high diversity approaches for generating monoclonal antibodies, methods for generation of conditionally active polypeptides, humanized antibodies, mirac proteins, multi-specific antibodies or cross-species active mutant polypeptides, Comprehensive Integrated Antibody Optimization (CIAO Tim Comprehensive Positional Evolution (CPE), Synergy Evolution, Flex Evolution, Comprehensive Positional insertion Evolution (CPI). Comprehensive Positional Deletion Evolution (CPD), Combinatorial Protein Synthesis (CPS), or any combination thereof. These methods are described in U.S. Pat. Nos. 8,859,467 and 8,709,755 and United States Publication Nos. US20130281303, US20130303399, US20150065690, US20150252119, US20150086562 and US20100138945, and International Publication Nos. WO2015105888, WO2012009026, WO2011109726, WO2016036916, and WO2016033331, the contents of each of which are herein incorporated by reference in their entirety.

    Antibody Fragments and Variants

    [0206] In some embodiments, antibody fragments encoded by payloads of the invention comprise antigen binding regions from intact antibodies. Examples of antibody fragments may include, but are not limited to Fab, Fab, F(ab).sub.2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments, called Fab fragments, each with a single antigen-binding site. Also produced is a residual Fc fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab).sub.2 fragment that has two antigen-binding sites and is still capable of cross-linking antigen. Compounds and/or compositions of the present invention may comprise one or more of these fragments. For the purposes herein, an antibody may comprise a heavy and light variable domain as well as an Fc region.

    [0207] In one embodiment, the Fc region may be a modified Fc region, as described in US Patent Publication US20150065690, wherein the Fc region may have a single amino acid substitution as compared to the corresponding sequence for the wild-type Fc region, wherein the single amino acid substitution yields an Fc region with preferred properties to those of the wild-type Fc region. Non-limiting examples of Fc properties that may be altered by the single amino acid substitution include bind properties or response to pH conditions.

    [0208] As used herein, the term native antibody refers to an usually heterotetrameric glycoprotein of about 150,000 Daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Genes encoding antibody heavy and light chains are known and segments making up each have been well characterized and described (Matsuda, F. et al., 1998. The Journal of Experimental Medicine. 188(11); 2151-62 and Li, A. et al., 2004. Blood. 103(12: 4602-9, the content of each of which are herein incorporated by reference in their entirety). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V.sub.H) followed by a number of constant domains. Each light chain has a variable domain at one end (V.sub.L) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.

    [0209] As used herein, the term variable domain refers to specific antibody domains found on both the antibody heavy and light chains that differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Variable domains comprise hypervariable regions. As used herein, the term hypervariable region refers to a region within a variable domain comprising amino acid residues responsible for antigen binding. The amino acids present within the hypervariable regions determine the structure of the complementarily determining regions (CDRs) that become part of the antigen-binding site of the antibody. As used herein, the term CDR refers to a region of an antibody comprising a structure that is complimentary to its target antigen or epitope. Other portions of the variable domain, not interacting with the antigen, are referred to as framework (FW) regions. The antigen-binding site (also known as the antigen combining site or paratope) comprises the amino acid residues necessary to interact with a particular antigen. The exact residues making up the antigen-binding site are typically elucidated by co-crystallography with bound antigen, however computational assessments can also be used based on comparisons with other antibodies (Strohl, W. R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia Pa. 2012. Ch. 3, p47-54, the contents of which are herein incorporated by reference in their entirety). Determining residues making up CDRs may include the use of numbering schemes including, but not limited to, those taught by Kabat [Wu, T. T. et al., 1970, JEM, 132(2):211-50 and Johnson, G. et al., 2000, Nucleic Acids Res. 28(1): 214-8, the contents of each of which are herein incorporated by reference in their entirety], Chothia [Chothia and Lesk, J. Mol. Biol. 196, 901 (1987). Chothia et al., Nature 342, 877 (1989) and Al-Lazikani, B. et al., 1997, J. Mol. Biol. 273(4):927-48, the contents of each of which are herein incorporated by reference in their entirety], Lefranc (Lefranc, M. P. et al., 2003, Immuno Res. 1:3) and Honegger (Honegger, A. and Pluckthun, A. 2001. J. W. Biol. 309(3):657-70, the contents of which are herein incorporated by reference in their entirety).

    [0210] V.sub.H and V.sub.L domains have three CDRs each. V.sub.L CDRs are referred to herein as CDR-L1, CDR-L2 and CDR-L3, in order of occurrence when moving from N- to C-terminus along the variable domain polypeptide. CDRs are referred to herein as CDR-H1, CDR-H2 and CDR-H3, in order of occurrence when moving from N- to C-terminus along the variable domain polypeptide. Each of CDRs have favored canonical structures with the exception of the CDR-H3, which comprises amino acid sequences that may he highly variable in sequence and length between antibodies resulting in a variety of three-dimensional structures in antigen-binding domains (Nikoloudis, D. et al., 2014. Peer J. 2:e456: the contents of which are herein incorporated by reference in their entirety). In some cases, CDR-H3s may be analyzed among a panel of related antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strobl W. R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia Pa. 2012. Ch. 3, p47-54, the contents of which are herein incorporated by reference in their entirety).

    [0211] As used herein, the term Fv refers to an antibody fragment comprising the minimum fragment on an antibody needed to form a complete antigen-binding site. These regions consist of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. Fv fragments can be generated by proteolytic cleavage, but are largely unstable. Recombinant methods are known in the art for generating stable Fv fragments, typically through insertion of a flexible linker between the light chain variable domain and the heavy chain variable domain [to form a single chain F (scFv) or through the introduction of a disulfide bridge between heavy and light chain variable domains (Strohl, W. R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia Pa. 2012. Ch. 3, p46-47, the contents of which are herein incorporated by reference in their entirety).

    [0212] As used herein, the term light chain refers to a component of an antibody from any vertebrate species assigned to one of two clearly distinct types, called kappa and lambda based on amino acid sequences of constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), IgG2, IgG3, IgG4, IgA, and IgA2.

    [0213] As used herein, the term single chain Fv or scFv refers to a fusion protein of V.sub.H and V.sub.L antibody domains, wherein these domains are linked together into a single polypeptide chain by a flexible peptide linker. In some embodiments, the Fv polypeptide linker enables the say to form the desired structure for antigen binding. In some embodiments, scFvs are utilized in conjunction with phage display, yeast display or other display methods where they may be expressed in association with a surface member (e.g. phage coat protein) and used in the identification of high affinity peptides for a raven antigen.

    [0214] As used herein, the term bispecific antibody refers to an antibody capable of binding two different antigens. Such antibodies typically comprise regions from at least two different antibodies. Bispecific antibodies may include any of those described in Riethmulier, G. 2012. Cancer Immunity. 12:12-18, Marvin, J. S. et al., 2005. Acta Pharmacologica Sinica. 26(6):649-58 and Schaefer, W. et al., 2011. PNAS. 108(27):11187-92, the contents of each of which are herein incorporated by reference in their entirety.

    [0215] As used herein, the term diabody refers to a small antibody fragment with two antigen-binding sites. Diabodies comprise a heavy chain variable domain V.sub.H connected to a light chain variable domain V.sub.L in the same polypeptide chain. By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al. (Hollinger, P. et al., Diabodies Small bivalent and bispecific antibody fragments. PNAS. 1993. 90:6444-8) the contents of each of which are incorporated herein by reference in their entirety.

    [0216] The term intrabody refers to a form of antibody that is not secreted from a cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division. In some embodiments, methods of the present invention may include intrabody-based therapies. In some such embodiments, variable domain sequences and/or CDR sequences disclosed herein may be incorporated into one or more constructs for intrabody-based therapy.

    [0217] As used herein, the term monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variants that may arise during production of the monoclonal antibodies, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen

    [0218] The modifier monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. The monoclonal antibodies herein include chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.

    [0219] As used herein, the term humanized antibody refers to a chimeric antibody comprising a minimal portion from one or more non-human (e.g., murine) antibody source(s) with the remainder derived from one or more human immunoglobulin sources. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the hypervariable region from an antibody of the recipient are replaced by residues from the hypervariable region from an antibody of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and/or capacity.

    [0220] In some embodiments, viral genomes of the present invention may encode antibody mimetics. As used herein, the term antibody mimetic refers to ally molecule which mimics the function or effect of an antibody and which hinds specifically and with high affinity to their molecular targets. In some embodiments, antibody mimetics may be monobodies, designed to incorporate the fibronectin type III domain (Fn3) as a protein scaffold (U.S. Pat. Nos. 6,673,901; 6.348,5841). In some embodiments, antibody mimetics may be those known in the art including, but are not limited to affibody molecules, affilins, affitins, anticalins, avimers, Centyrins, DARPINS, Fynomers and Kunitz and domain peptides. In other embodiments, antibody rnimetics may include one or more non-peptide regions.

    [0221] As used herein, the term antibody variant refers to a modified antibody (in relation to a native or starting antibody) or a biomolecule resembling a native or starting antibody in structure and/or function (e.g., an antibody mimetic). Antibody variants may be altered in their amino acid sequence, composition or structure as compared to a native antibody. Antibody variants may include, but are not limited to, antibodies with altered isotypes (e.g., IgA, IgD, IgB, IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4, or IgM), humanized variants, optimized variants, multispecific antibody variants (e.g., bispecific variants), and antibody fragments.

    [0222] The preparation of antibodies, whether monoclonal or polyclonal, is known in the art. Techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane Using Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, 1999 and Therapeutic Antibody Engineering: Current and Future Advances Driving the Strongest Growth Area in the Pharmaceutical Industry Woodhead Publishing, 2012.

    Multispecific Antibodies

    [0223] In some embodiments, payloads of the invention may encode antibodies that bind more than one epitope. As used herein, the terms multibody or multispecific antibody refer to an antibody wherein two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets. In certain embodiments, a multi-specific antibody is a bispecific antibody, which recognizes two different epitopes on the same or different antigens.

    [0224] In one embodiment, multi-specific antibodies may be prepared by the methods used. by BIOATLA and described in international Patent publication WO201109726, the contents of which are herein incorporated by reference in their entirety. First a library of homologous, naturally occurring antibodies is generated by any method known in the art (i.e., mammalian cell surface display), then screened by FACS Aria or other screening method, for multi-specific antibodies that specifically bind to two or more target antigens. In one embodiment, the identified multi-specific antibodies are further evolved by any method known in the art, to produce a set of modified multi-specific antibodies. These modified multi-specific antibodies are screened for binding to the target antigens. In one embodiment, the multi-specific antibody may be further optimized by screening the evolved modified multi-specific antibodies for optimized or desired characteristics.

    [0225] In one embodiment, multi-specific antibodies may be prepared by the methods used by BIOATLA and described in Unites States Publication No. US20150252119, the contents of which are herein incorporated by reference in their entirety. In one approach, the variable domains of two parent antibodies, wherein the parent antibodies are monoclonal antibodies are evolved using any method known in the art in a manner that allows a single light chain to functionally complement heavy chains of two different parent antibodies. Another approach requires evolving the heavy chain of a single parent antibody to recognize a second target antigen. A third approach involves evolving the light chain of a parent antibody so as to recognize a second target antigen. Methods for polypeptide evolution are described in International Publication WO2012009026, the contents of which are herein incorporated by reference in their entirety, and include as non-limiting examples, Comprehensive Positional Evolution (CPE), Combinatorial Protein Synthesis (CPS), Comprehensive Positional Insertion (CPI), Comprehensive Positional Deletion (CPD), or any combination thereof. The Fc region of the multi-specific antibodies described in United States Publication No. US20150252119 may be created using a knob-in-hole approach, or any other method that allows the Fc domain to form heterodimers. The resultant multi-specific antibodies may he further evolved for improved characteristics or properties such as binding affinity for the target antigen.

    Bispecific Antibodies

    [0226] In some embodiments, payloads of the invention may encode bispecific antibodies. Bispecific antibodies are capable of binding two different antigens. Such antibodies typically comprise antigen-binding regions from at least two different antibodies. For example, a bispecific monoclonal antibody (BsMAb, BsAb) is an artificial protein composed of fragments of two different monoclonal antibodies, thus allowing the BsAb to bind to two different types of antigen.

    [0227] In some cases, payloads encode bispecific antibodies comprising antigen-binding regions from two different anti-mu antibodies. For example, such bispecific antibodies may comprise binding regions from two different antibodies selected from Table 3.

    [0228] Bispecific antibody :frameworks may include any of those described in Riethmuller, G., 2012. Cancer Immunity. 12:12-18; Marvin, J. S. et al., 2005. Acta Pharmacologica Sinica. 26(6):649-58, and Schaefer, W. et al., 2011. PNAS. 108(27):11187-92, the contents of each of which are herein incorporated by reference in their entirety.

    [0229] New generations of BsMAb, called trifunctional hispecific antibodies, have been developed. These consist of two heavy and two light chains, one each from two different antibodies, where the two Fab regions (the arms) are directed against two antigens, and the Fc region (the foot) comprises the two heavy chains and forms the third binding site.

    [0230] Of the two paratopes that form the tops of the variable domains of a bispecific antibody, one can be directed against a target antigen and the other against a T-lymphocyte antigen like CD3. in the case of trifunctional antibodies, the Fc region may additionally hind to a cell that expresses Fe receptors, like a macrophage, a natural killer (NK) cell or a dendritic cell. In sum, the targeted cell is connected to one or two cells of the immune system, which subsequently destroy it.

    [0231] Other types of bispecific antibodies have been designed to overcome certain problems, such as short half-life, immunogenicity and side-effects caused by cytokine liberation. They include chemically linked Fabs, consisting only of the Fab regions, and various types of bivalent and trivalent single-chain variable fragments (scFvs), fusion proteins mimicking the variable domains of two antibodies. The furthest developed of these newer formats are the bi-specific T-cell engagers (BiTEs) and mAb2's, antibodies engineered to contain an Fcab antigen-binding fragment instead of the Fc constant region.

    [0232] Using molecular genetics, two scFvs can be engineered in tandem into a single polypeptide, separated by a linker domain, called a tandem scFv (tascFv). TascFvs have been found to be poorly soluble and require refolding when produced in bacteria, or they may be manufactured in mammalian cell culture systems, which avoids refolding requirements but may result in poor yields. Construction of a tascFv with genes for two different scFvs yields a bispecific single-chain variable fragments (bis-scFvs). Only two tascFvs have been developed clinically by commercial firms; both are bispecific agents in active early phase development by Micromet for oncologic indications, and are described as Bispecific T-cell Engagers (BiTE). Blinatumomab is an anti-CD19/anti-CD3 bispecific tascFv that potentiates T-cell responses to B-cell non-Hodgkin lymphoma in Phase 2. MT110 is an anti-EP-CAM/anti-CD3 bispecific tascFv that potentiates T-cell responses to solid tumors in Phase T. Bispecific, tetravalent TandAbs are also being researched by Affimed (Nelson, A. L., MAbs. 2010. January-February; 2(1):77-83).

    [0233] In some embodiments, payloads may encode antibodies comprising a single antigen-binding domain. These molecules are extremely small, with molecular weights approximately one-tenth of those observed for full-sized mAbs. Further antibodies may include nanobodies derived from the antigen-binding variable heavy chain regions (V.sub.HHS) of heavy chain antibodies found in camels and llamas, which lack light chains (Nelson, A. L., MAbs. 2010. January-February; 2(1):77-83).

    [0234] Disclosed and claimed in PCT Publication WO2014144573 to Memorial Sloan-Kettering Cancer Center are multimexization technologies for making dimeric multispecific binding agents (e.g., fusion proteins comprising antibody components) with improved properties over multispecific binding agents without the capability of dimerization.

    [0235] In some cases, payloads of the invention may encode tetravalent bispecific antibodies (TetBiAbs as disclosed and claimed in PCT Publication WO2014144357). TetBiAbs feature a second pair of Fab fragments with a second antigen specificity attached to the C-terminus of an antibody, thus providing a molecule that is bivalent for each of the two antigen specificities. The tetravalent antibody is produced by genetic engineering methods, by linking an antibody heavy chain covalently to a Fab light chain, which associates with its cognate, co-expressed Fab heavy chain.

    [0236] In some aspects, payloads of the invention may encode biosynthetic antibodies as described in U.S. Pat. No. 5,091,513, the contents of which are herein incorporated by reference in their entirety. Such antibody may include one or more sequences of amino acids constituting a region which behaves as a biosynthetic antibody binding site (BABS). The sites comprise 1) non-covalently associated or disulfide bonded synthetic V.sub.H and V.sub.L dimers. 2) V.sub.H-V.sub.L or V.sub.L-V.sub.H single chains wherein the V.sub.H and V.sub.L are attached by a polypeptide linker, or 3) individuals V.sub.H or V.sub.L domains. The binding domains comprise linked CDR and FR regions, which may be derived from separate immunoglobulins. The biosynthetic antibodies may also include other polypeptide sequences which function, e.g., as an enzyme, toxin, binding site, or site of attachment to an immobilization media or radioactive atom. Methods are disclosed for producing the biosynthetic antibodies, for designing BABS having any specificity that can he elicited by in vivo generation of antibody, and for producing analogs thereof.

    [0237] In some embodiments, payloads may encode antibodies with antibody acceptor frameworks taught in U.S. Pat. No. 8,399,625. Such antibody acceptor frameworks may be particularly well suited accepting CDRs from an antibody of interest. In some cases, CDRs from anti-tau antibodies known in the art or developed according to the methods presented herein may be used.

    Miniaturized Antibody

    [0238] In one embodiment, the antibody encoded by the payloads of the invention may be a miniaturized antibody. Among the best examples of mAb miniaturization are the small modular immunopharmaceuticals (SMIPs) from Trubion Pharmaceuticals. These molecules, which can be monovalent or bivalent, are recombinant single-chain molecules containing one V.sub.L, one V.sub.H antigen-binding domain, and one or two constant effector domains, all connected by linker domains. Presumably, such a molecule might offer the advantages of increased tissue or tumor penetration claimed by fragments while retaining the immune effector functions conferred by constant domains. At least three miniaturized SMIPs have entered clinical development. TRU-015, an anti-CD20 SMIP developed in collaboration with Wyeth, is the most advanced project, having progressed to Phase 2 for rheumatoid arthritis (RA). Earlier attempts in systemic lupus erythrematosus (SLE) and B cell lymphomas were ultimately discontinued. Trubion and Facet Biotechnology are collaborating in the development of TRU-016, an anti-CD37 SMIP, for the treatment of CLL and other lymphoid neoplasias, a project that has reached Phase 2. Wyeth has licensed the anti-CD20 SMIP SBI-087 for the treatment of autoimmune diseases, including RA, SLE and possibly multiple sclerosis, although these projects remain in the earliest stages of clinical testing. (Nelson, A. L., MAbs.2010. January-February; 2(1):77-83).

    Diabodies

    [0239] In some embodiments, payloads of the invention may encode diabodies. Diabodies are functional hispecific single-chain antibodies (bscAb). These bivalent antigen-binding molecules are composed of non-covalent dimers of scFvs, and can be produced in mammalian cells using recombinant methods. (See, e.g., Mack et al, Proc. Natl. Acad. Sci., 92: 7021-7025, 1995). Few diabodies have entered clinical development. An iodine-123-labeled diabody version of the anti-CEA chimeric antibody cT84.66 has been evaluated for pre-surgical immunoscintigraphic detection of colorectal cancer in a study sponsored by the Beckman Research Institute of the City of Hope (Clinicaltrials.gov NCT00647153) (Nelson, A. L., MAbs.2010. January-February; 2(1):77-83).

    Unibody

    [0240] In some embodiments, payloads may encode a unibody, in which the hinge region has been removed from IgG4 molecules. While IgG4 molecules are unstable and can exchange light-heavy chain heterodimers with one another, deletion of the hinge region prevents heavy chain-heavy chain pairing entirely, leaving highly specific monovalent light/heavy heterodimers, while retaining the Fc region to ensure stability and half-life, in vivo. This configuration may minimize the risk of immune activation or oncogenic growth, as IgG4 interacts poorly with FcRs and monovalent unibodies fail to promote intracellular signaling complex formation. These contentions are, however, largely supported by laboratory, rather than clinical, evidence. Other antibodies may be miniaturized antibodies, which are compacted 100 kDa antibodies (see, e.g., Nelson, A. L., MAbs.2010. January-February; 2(1):77-83).

    Intrabodies

    [0241] In some embodiments, payloads of the invention may encode intrabodies. Intrabodies are a form of antibody that is not secreted from a cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies are expressed and function intracellularly, and may be used to affect a multitude of cellular processes including, but not limited to intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division. In some embodiments, methods described herein include intrabody-based therapies. In some such embodiments, variable domain sequences and/or CDR sequences disclosed herein are incorporated into one or more constructs for intrabody-based therapy. For example, intrabodies may target one or more glycated intracellular proteins or may modulate the interaction between one or more glycated intracellular proteins and an alternative protein.

    [0242] More than two decades ago, intracellular antibodies against intracellular targets were first described (Biocca, Neuberger and Cattaneo EMBO J. 9: 101-108, 1990). The intracellular expression of intrabodies in different compartments of mammalian cells allows blocking or modulation of the function of endogenous molecules (Biocca, et al., EMBO J. 9: 101-108, 1990; Colby et al., Proc. Natl. Acad. Sci. U.S.A. 101: 17616-21, 2004). Intrabodies can alter protein folding, protein-protein, protein DNA, protein-RNA interactions and protein modification. They can induce a phenotypic knockout and work as neutralizing agents by direct binding to the target antigen, by diverting its intracellular trafficking or by inhibiting its association with binding partners. They have been largely employed as research tools and are emerging as therapeutic molecules for the treatment of human diseases such as viral pathologies, cancer and misfolding diseases. The fast growing bio-market of recombinant antibodies provides intrabodies with enhanced binding specificity, stability and solubility, together with lower immunogenicity, for their use in therapy (Biocca, abstract in Antibody Expression and Production Cell Engineering Volume 7, 2011, pp. 179-195).

    [0243] In some embodiments, intrabodies have advantages over interfering RNA (iRNA); for example, iRNA has been shown to exert multiple non-specific effects, whereas intrabodies have been shown to have high specificity and affinity to target antigens. Furthermore, as proteins, intrabodies possess a much longer active half-life than iRNA. Thus, when the active half-life of the intracellular target molecule is long, gene silencing through iRNA may he slow to yield an effect, whereas the effects of intrabody expression can be almost instantaneous. Lastly, it is possible to design intrabodies to block certain binding interactions of a particular target molecule, while sparing others.

    [0244] Intrabodies are often single chain variable fragments (scFvs) expressed from a recombinant nucleic acid molecule and engineered to be retained intracellularly (e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm). Intrabodies may he used, for example, to ablate the function of a protein to which the intrabody binds. The expression of intrabodies may also be regulated through the use of inducible promoters in the nucleic acid expression vector comprising the intrabody. Intrabodies may be produced for use in the viral genomes of the invention using methods known in the art, such as those disclosed and reviewed in: (Marasco et al., 1993 Proc. Natl. Acad. Sci. USA, 90: 7889-7893; Chen et of, 1994 Hum. Gene Ther. 5:595-601; Chen et al., 1994, Proc. Natl. Acad. Sci. USA, 91: 5932-5936; Maciejewski. et al., 1995, Nature Med 1: 667-673; Marasco, 1995, Immunotech, 1:1-19; Mhashilkar, et al., 1995, EMBO J. 14: 1542-51; Chen et al., 1996, Hum. Gene Therap., 7: 1515-1525; Marasco, Gene Ther. 4:11-15, 1997; Rondon and Marasco, 1997, Annu. Rev. Microbiol. 51:257-283; Cohen, et al., 1998, Oncogene 17:2445-56; Proba et al., 1998, J. Mol. Biol. 275:245-253; Cohen et al., 1998, Oncogene 17:2445-2456; Hassanzadeh, et al., 1998, FEBS Lett. 437:81-6; Richardson et al., 1998, Gene Ther. 5:635-44; Ohage and Steipe, 1999, J. Mol. Biol. 291:1119-1128; Ohage et al., 1999, J. Mol. Biol. 291:1129-1134; Wirtz and Steine, 1999, Protein Sci. 8:2245-2250; Zhu et al., 1999, J. Immunol. Methods 231:207-222; Arafat et al., 2000, Cancer Gene Ther. 7:1250-6; der Maur et al., 2002, J. Biol. Chem. 277:45075-85, Mhashilkar et al., 2002, Gene Thar. 9:307-19, and Wheeler et al., 2003, FASEB J. 17: 1733-5; and references cited therein). In particular, a CCR5 intrabody has been produced by Steinberger et al., 2000, Proc. Natl. Acad Sci. USA 97:805-810). See generally Marasco, Wash., 1998, Intrabodies: Basic Research and Clinical Gene Therapy Applications Springer: N.Y.; and for a review of says, see Pluckthun in The Pharmacology of Monoclonal Antibodies, 1994, vol. 113. Rosenberg and Moore eds. Springer-Verlag, N.Y., pp. 269-315.

    [0245] Sequences from donor antibodies may be used to develop intrabodies. Intrabodies are often recombinantly expressed as single domain fragments such as isolated VH and VL domains or as a single chain variable fragment (scFv) antibody within the cell. For example, intrabodies are often expressed as a single polypeptide to form a single chain antibody comprising, the variable domains of the heavy and light chains joined by a flexible linker polypeptide. Intrabodies typically lack disulfide bonds and are capable of modulating the expression or activity of target genes through their specific binding activity. Single chain antibodies can also be expressed as a single chain variable region fragment joined to the light chain constant region.

    [0246] As is known in the art, an intrabody can be engineered into recombinant polynucleotide vectors to encode sub-cellular trafficking signals at its N or C terminus to allow expression at high concentrations in the sub-cellular compartments where a target protein is located. For example, intrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL amino acid motif (SEQ ID NO: 17941). Intrabodies intended to exert activity in the nucleus are engineered to include a nuclear localization signal. Lipid moieties are joined to intrabodies in order to tether the intrabody to the cytosolic side of the plasma membrane. Intrabodies can also be targeted to exert function in the cytosol. For example, cytosolic intrabodies are used to sequester factors within the cytosol, thereby preventing them from being transported to their natural cellular destination.

    [0247] There are certain technical challenges with intrabody expression. In particular, protein conformational folding and structural stability of the newly-synthesized intrabody within the cell is affected by reducing conditions of the intracellular environment.

    [0248] Intrabodies of the invention may be promising therapeutic agents for the treatment of misfolding diseases, including Alzheimer's, Parkinson's, Huntington's and prion diseases, because of their virtually infinite ability to specifically recognize the different conformations of a protein, including pathological isoforms, and because they can be targeted to the potential sites of aggregation (both intra- and extracellular sites). These molecules can work as neutralizing agents against amyloidogenic proteins by preventing their aggregation, and/or as molecular shunters of intracellular traffic by rerouting the protein from its potential aggregation site (Cardinale, and Biocca, Curr. Mol. Med. 2008, 8:2-11).

    Maxibodies

    [0249] In one embodiment, the payloads of the invention encode a maxibody (bivalent say fused to the amino terminus of the Fc (CH2-CH:3 domains) of IgG.

    Chimeric Antigen Receptors

    [0250] In some embodiments, the polypeptides encoded by the viral genomes of the invention (e.g., antibodies) may be used to generate chimeric antigen receptors (CARs) as described by BIOATLA in International Publications WO2016033331 and WO2016036916, the contents of which are herein incorporated by reference in their entirety. As used herein, a chimeric antigen receptor (CAR) refers to an artificial chimeric protein comprising at least one antigen specific targeting region (ASTR), wherein the antigen specific targeting region comprises a full-length antibody or a fragment thereof that specifically binds to a target antigen. The ASTR may comprise any of the following; a full length heavy or light chain, an Fab fragment, a single chain Fv fragment, a divalent single chain antibody, or a diabody. As a non-limiting example the ASTR of a CAR may be any of the antibodies listed in Tables 3-12, antibody-based compositions or fragments thereof. Any molecule that is capable of binding a target antigen with high affinity can be used in the ASTR of a CAR. In one embodiment, the CAR may have more than one ASTR. These ASTRs may target two or more antigens or two or more epitopes of the same antigen. In one embodiment, the CAR is conditionally active. In one embodiment, the CAR is used to produce a genetically engineered cytotoxic cell carrying the CAR and capable of targeting the antigen bound by the ASTR.

    [0251] Chimeric antigen receptors (CARs) are particularly useful in the treatment of cancers, though also therapeutically effective in treatment of a wide variety of other diseases and disorders. Non-limiting examples of disease categories that may be treated with CARs or CAR-based therapeutics include autoimmune disorders. B-cell mediated diseases, inflammatory diseases, neuronal disorders, cardiovascular disease and circulatory disorders, or infectious diseases. Not wishing to be bound by theory, CARs traditionally work by targeting antigens presented on the surface of or on the inside of cells to be destroyed e.g., cancer tumor cells, by the cytotoxic cell of the CAR.

    Senescent Cell Surface Protein Antibodies

    [0252] In some embodiments, the AAV particles may comprise nucleic acids which have been engineered to express of antibodies that selectively bind to surface marker proteins of senescent cells. For example, the antibodies may selectively bind to proteins that are in misfolded conformation. The binding antibodies may reduce the number of senescent cells and be used to treat age-related conditions, such as, but not limited to, Alzheimer's disease, cardiovascular disease, emphysema, sarcopenia, and tumorigenesis as well as conditions more cosmetic in nature such as signs of skin aging including wrinkling, sagging, discoloration, age-related tissue dysfunction, tumor formation, and other age-related conditions.

    [0253] In one embodiment, the expressed antibodies binding to epitopes of senescent cell surface proteins may be, but are not limited to, such as prion epitopes presented by SEQ ID NOs: 1-14 of international Publication No. WO2014186878; CD44 epitopes presented by SEQ ID NOs: 47-51 of International Publication No. WO2014186878; TNFR epitopes presented by SEQ ID NOs: 52-36 of International Publication No. WO2014186878; NOTCH1 epitope presented by SEQ ID NOs: 57-61 of International Publication No. WO2014186878; FasR epitopes presented by SEQ ID NOs: 62-66 of International Publication No. WO2014186878; epidermal growth factor epitopes presented by SEQ ID NOs: 67-81 of international Publication No. WO2014186878; CD 3S epitopes presented by SEQ ID NOs: 82-86 of International Publication No. WO2014186878, the contents of each of which are herein incorporated by reference in their entirety.

    [0254] In one embodiment, the expressed antibodies may comprise peptides binding to senescent cell surface prion proteins, such as, but not limited to, those presented by SEQ ID NOs: 15-36 of International Publication No. WO2014186878, the contents of which are herein incorporated by reference in their entirety.

    [0255] In one embodiment, the expressed antibody may be AMF-3a-118 or SMF 3d-19 (SEQ ID NO: 89-92 and 103-106 of International publication WO2014186878, respectively, the contents of which are herein incorporated by reference in their entirety) tanteting senescent cell surface protein FasR. In one embodiment, the expressed antibody may be Ab c-120 (SEQ ID NO: 37-40 of International publication WO2014186878, the contents of which are herein incorporated by reference in their entirety) targeting senescent cell surface protein PrP.

    Payload Antibodies of the Invention

    [0256] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the payload antibody polypeptides listed in Tables 3-12.

    [0257] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences listed in Table 3-12.

    [0258] In some embodiments, the payload region of the AAV particle comprises a nucleic acid sequence encoding a payload antibody with at least 50% identity to one or more payload antibody polypeptides listed in Tables 3-12. The encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload antibody polypeptides listed in Tables 3-12.

    [0259] In one embodiment, the full sequence of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload antibody polypeptides listed in Tables 3-12.

    [0260] In one embodiment, the variable region .sequence(s) of the encoded antibody polypeptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload antibody polypeptides listed in Tables 3-12.

    [0261] In one embodiment, the heavy chain of the encoded antibody polypeptide may have 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload heavy chain antibody polypeptides listed in Tables 3-12.

    [0262] In one embodiment, the light chain of the encoded antibody polypeptide may have 50% 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more of the payload light chain antibody polypeptides listed in Tables 3-12.

    [0263] In one embodiment, the CDR region of the encoded antibody holy peptide may have 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 630o, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the CDRs of one or more of the payload antibody polypeptides listed in Tables 3-12.

    [0264] In one embodiment, the payload antibody has 90% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0265] In one embodiment, the payload antibody has 91% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0266] In one embodiment, the payload antibody has 92% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0267] In one embodiment, the payload antibody has 93% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0268] In one embodiment, the payload antibod has 94% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0269] In one embodiment, the payload antibody has 95% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0270] In one embodiment, the payload antibody has 96% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0271] In one embodiment, the payload antibody has 97% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0272] In one embodiment, the payload antibody has 98% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0273] In one embodiment, the payload antibody has 99% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0274] In one embodiment, the payload antibody has 100% identity to one or more of the antibody polypeptides listed in Tables 3-12.

    [0275] In some embodiments, the payload region of the AAV particle comprises a nucleic acid sequence with at least 50% identity to one or more nucleic acid sequences listed in Tables 3-12. The payload nucleic acid sequence may have 50%, 51%, 52%, 53%, 54%, 55%, 50%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to one or more nucleic acid sequences listed in Tables 3-12.

    [0276] In one embodiment, the payload nucleic acid sequence has 90% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0277] In one embodiment, the payload nucleic acid sequence has 91% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0278] In one embodiment, the payload nucleic acid sequence has 92% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0279] In one embodiment, the payload nucleic acid sequence has 93% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0280] In one embodiment, the payload nucleic acid sequence has 94% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0281] In one embodiment, the payload nucleic acid sequence has 95% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0282] In one embodiment, the payload nucleic acid sequence has 96% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0283] In one embodiment, the payload nucleic acid sequence has 97% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0284] In one embodiment, the payload nucleic acid sequence has 98% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0285] In one embodiment, the payload nucleic acid sequence has 99% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    [0286] In one embodiment, the payload nucleic acid sequence has 100% identity to one or more of the nucleic acid sequences listed in Tables 3-12.

    Parkinson's Disease and Dementia with Lewy Bodies Antibodies

    [0287] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the Parkinson's Disease and dementia with Lewy Bodies payload antibody polypeptides listed in Table 3 (PDLB1-PDLB437; SEQ ID NO: 2948-3384).

    TABLE-US-00003 TABLE 3 Parkinson's Disease and Dementia with Lewy Bodies Antibodies SEQ Antibody Reference ID No. Target Description Antibody Name Information NO PDLB1 amyloid proteins consensus sequence M13 g3p, fd g3p, f1 g3p US20150376239 2948 SEQ ID NO: 4 PDLB2 amyloid proteins consensus sequence I2-2 g3p, Ike g3p US20150376239 2949 SEQ ID NO: 7 PDLB3 118-126 of - constant region IgG1 US20150259404 2950 synuclein SEQ ID NO: 38 PDLB4 amyloid proteins Fusion protein M13 g3p US20150376239 2951 SEQ ID NO: 1 PDLB5 amyloid proteins Fusion protein Construct 5 US20150376239 2952 SEQ ID NO: 11 PDLB6 amyloid proteins Fusion protein Construct 6 US20150376239 2953 SEQ ID NO: 13 PDLB7 amyloid proteins Fusion protein fd N2 US20150376239 2954 SEQ ID NO: 14 PDLB8 amyloid proteins Fusion protein f1 N2 US20150376239 2955 SEQ ID NO: 15 PDLB9 amyloid proteins Fusion protein M13 N2 US20150376239 2956 SEQ ID NO: 16 PDLB10 amyloid proteins Fusion protein Ike N2 US20150376239 2957 SEQ ID NO: 17 PDLB11 amyloid proteins Fusion protein 12-2 N2 US20150376239 2958 SEQ ID NO: 18 PDLB12 amyloid proteins Fusion protein If1 N2 US20150376239 2959 SEQ ID NO: 19 PDLB13 amyloid proteins Fusion protein fd g3p US20150376239 2960 SEQ ID NO: 2 PDLB14 amyloid proteins Fusion protein Construct 3 US20150376239 2961 SEQ ID NO: 20 PDLB15 amyloid proteins Fusion protein Construct 3m g3p portion US20150376239 2962 SEQ ID NO: 24 PDLB16 amyloid proteins Fusion protein If1 g3p US20150376239 2963 SEQ ID NO: 29 PDLB17 amyloid proteins Fusion protein f1 g3p US20150376239 2964 SEQ ID NO: 3 PDLB18 amyloid proteins Fusion protein fd g3p US20150376239 2965 SEQ ID NO: 30 PDLB19 amyloid proteins Fusion protein Construct 8, rs-g3p (If1- US20150376239 2966 N1N2)-hIgG1-Fc SEQ ID NO: 31 PDLB20 amyloid proteins Fusion protein I2-2 g3p US20150376239 2967 SEQ ID NO: 5 PDLB21 amyloid proteins Fusion protein Ike g3p US20150376239 2968 SEQ ID NO: 6 PDLB22 amyloid proteins Fusion protein If1 g3p US20150376239 2969 SEQ ID NO: 8 PDLB23 amyloid proteins Fusion protein Construct 4 US20150376239 2970 SEQ ID NO: 9 PDLB24 118-126 of - Heavy chain 5ClH1 US20150259404 2971 synuclein SEQ ID NO: 14 PDLB25 118-126 of - Heavy chain 5ClH2 US20150259404 2972 synuclein SEQ ID NO: 15 PDLB26 118-126 of - Heavy chain 5ClH3 US20150259404 2973 synuclein SEQ ID NO: 16 PDLB27 118-126 of - Heavy chain 5ClH4 US20150259404 2974 synuclein SEQ ID NO: 17 PDLB28 118-126 of - Heavy chain 5ClH5 US20150259404 2975 synuclein SEQ ID NO: 18 PDLB29 118-126 of - Heavy chain 5Cl US20150259404 2976 synuclein SEQ ID NO: 6 PDLB30 ACTH Heavy chain Ab7 WO2015127288 2977 SEQ ID NO: 241 PDLB31 ACTH Heavy chain Ab9 WO2015127288 2978 SEQ ID NO: 281 PDLB32 ACTH Heavy chain Ab10 WO2015127288 2979 SEQ ID NO: 321 PDLB33 ACTH Heavy chain Ab11 WO2015127288 2980 SEQ ID NO: 361 PDLB34 ACTH Heavy chain Ab12 WO2015127288 2981 SEQ ID NO: 401 PDLB35 ACTH Heavy chain Ab2 WO2015127288 2982 SEQ ID NO: 41 PDLB36 ACTH Heavy chain Ab1.H WO2015127288 2983 SEQ ID NO: 441 PDLB37 ACTH Heavy chain Ab2.H WO2015127288 2984 SEQ ID NO: 481 PDLB38 ACTH Heavy chain Ab3.H WO2015127288 2985 SEQ ID NO: 521 PDLB39 ACTH Heavy chain Ab4.H WO2015127288 2986 SEQ ID NO: 561 PDLB40 ACTH Heavy chain Ab6.H WO2015127288 2987 SEQ ID NO: 601 PDLB41 ACTH Heavy chain Ab7.H WO2015127288 2988 SEQ ID NO: 641 PDLB42 ACTH Heavy chain Ab7A.H WO2015127288 2989 SEQ ID NO: 681 PDLB43 ACTH Heavy chain Ab10.H WO2015127288 2990 SEQ ID NO: 721 PDLB44 ACTH Heavy chain Ab11.H WO2015127288 2991 SEQ ID NO: 761 PDLB45 ACTH Heavy chain Ab11A.H WO2015127288 2992 SEQ ID NO: 801 PDLB46 ACTH Heavy chain Ab3 WO2015127288 2993 SEQ ID NO: 81 PDLB47 ACTH Heavy chain Ab12.H WO2015127288 2994 SEQ ID NO: 841 PDLB48 ACTH Heavy chain Ab4 WO2015127288 2995 SEQ ID NO: 121 PDLB49 ACTH Heavy chain Ab5 WO2015127288 2996 SEQ ID NO: 161 PDLB50 ACTH Heavy chain Ab6 WO2015127288 2997 SEQ ID NO: 201 PDLB51 ACTH (Cushing's, Heavy chain Ab1 WO2015127288 2998 PD, AD, anxiety SEQ ID NO: 1 disorders) PDLB52 alpha synuclein Heavy chain Hu1H7VHv1 U.S. Pat. No. 8,790,644 SEQ 2999 ID NO: 19 PDLB53 alpha synuclein Heavy chain Hu1H7VHv2 U.S. Pat. No. 8,790,644 SEQ 3000 ID NO: 21 PDLB54 alpha synuclein Heavy chain Hu1H7VHv3 U.S. Pat. No. 8,790,644 SEQ 3001 ID NO: 23 PDLB55 alpha synuclein Heavy chain Hu1H7VHv4 U.S. Pat. No. 8,790,644 SEQ 3002 ID NO: 25 PDLB56 alpha synuclein Heavy chain Hu1H7VHv5 U.S. Pat. No. 8,790,644 SEQ 3003 ID NO: 27 PDLB57 alpha synuclein Heavy chain Hu1H7VHv alternative U.S. Pat. No. 8,790,644 SEQ 3004 ID NO: 44 PDLB58 alpha synuclein Heavy chain Hu1H7VHv alternatives U.S. Pat. No. 8,790,644 SEQ 3005 ID NO: 46 PDLB59 alpha synuclein Heavy chain Humanized 5C 1H2 WO2015075635 3006 SEQ ID NO: 59 PDLB60 alpha synuclein Heavy chain Humanized 5C 1H5 WO2015075635 3007 SEQ ID NO: 62 PDLB61 alpha synuclein Heavy chain HulH7VH alternative WO2015075635 3008 SEQ ID NO: 121 PDLB62 alpha synuclein Heavy chain Humanized 1 H7 heavy WO2015075635 3009 chain version 3 (variable SEQ ID NO: 126 region + constant region) PDLB63 alpha synuclein Heavy chain Humanized 1H7 heavy WO2015075635 3010 chain version 3 (variable SEQ ID NO: 127 region + constant region G 1 m3 allotype) PDLB64 alpha synuclein Heavy chain Hu9E4VH alternative WO2015075635 3011 SEQ ID NO: 29 PDLB65 alpha synuclein Heavy chain Humanized 9E4 heavy WO2015075635 3012 chain version 3 (variable SEQ ID NO: 34 region + constant region) PDLB66 alpha synuclein Heavy chain Humanized 9E4 heavy WO2015075635 3013 chain version 3 (variable SEQ ID NO: 36 region + constant region) PDLB67 alpha synuclein Heavy chain Humanized 9E4 heavy WO2015075635 3014 chain version 3 (variable SEQ ID NO: 37 region + alternative constant region Glm3 allotype) PDLB68 alpha synuclein Heavy chain Humanized 5C 1 H1 WO2015075635 3015 SEQ ID NO: 58 PDLB69 alpha synuclein Heavy chain Humanized 5C 1H3 WO2015075635 3016 SEQ ID NO: 60 PDLB70 alpha synuclein Heavy chain Humanized 5C 1H4 WO2015075635 3017 SEQ ID NO: 61 PDLB71 amyloids Heavy chain #118 WO2010012004 3018 SEQ ID NO: 11 PDLB72 amyloids Heavy chain #121 WO2010012004 3019 SEQ ID NO: 13 PDLB73 amyloids Heavy chain #204 WO2010012004 3020 SEQ ID NO: 16 PDLB74 amyloids Heavy chain 4205 WO2010012004 3021 SEQ ID NO: 18 PDLB75 EAG1 Heavy chain chimeric ImAb3 WO2006037604 3022 SEQ ID NO: 12 PDLB76 EAG1 Heavy chain chimeric ImAb4 WO2006037604 3023 SEQ ID NO: 16 PDLB77 EAG1 Heavy chain HC-lmAb3-humVH3-72 WO2006037604 3024 SEQ ID NO: 20 PDLB78 EAG1 Heavy chain HC-lmAb4-humVH4-59 WO2006037604 3025 SEQ ID NO: 24 PDLB79 EAG1 Heavy chain HC-lmAb3-humVH3 23 WO2006037604 3026 SEQ ID NO: 28 PDLB80 EAG1 Heavy chain HC-lmAb3-humVH2 26 WO2006037604 3027 SEQ ID NO: 32 PDLB81 EAG1 Heavy chain HC-lmAb4-humVH1-3 WO2006037604 3028 SEQ ID NO: 36 PDLB82 EAG1 Heavy chain ImAb4 WO2006037604 3029 SEQ ID NO: 4 PDLB83 EAG1 Heavy chain ImAb3 WO2006037604 3030 SEQ ID NO: 8 PDLB84 NOGO Heavy chain H6L13 FL US20140147435 3031 SEQ ID NO: 27 PDLB85 NOGO Heavy chain H16L16 FL, H16L18 FL US20140147435 3032 SEQ ID NO: 31 PDLB86 NOGO Heavy chain H18L16 FL US20140147435 3033 SEQ ID NO: 33 PDLB87 NOGO Heavy chain H19L13 FL, H19L16 FL, US20140147435 3034 H19L18 FL SEQ ID NO: 92 PDLB88 NOGO Heavy chain H20L13 FL, H20L16 FL, US20140147435 3035 H20L18 FL SEQ ID NO: 93 PDLB89 NOGO Heavy chain H21L13 FL, H21L16 FL, US20140147435 3036 H21L18 FL SEQ ID NO: 94 PDLB90 NOGO Heavy chain H25L13 FL, H25L16 FL, US20140147435 3037 H25L18 FL SEQ ID NO: 98 PDLB91 Nogo receptor-1 Heavy chain 5B10 US20090215691 3038 SEQ ID NO: 16 PDLB92 Nogo receptor-1 Heavy chain 5B10 US20090215691 3039 SEQ ID NO: 18 PDLB93 trk-C (NT-3 trkC Heavy chain 2250 U.S. Pat. No. 7,615,383 SEQ 3040 ligand) ID NO: 42 PDLB94 trk-C (NT-3 trkC Heavy chain 2253 U.S. Pat. No. 7,615,383 SEQ 3041 ligand) ID NO: 43 PDLB95 trk-C (NT-3 trkC Heavy chain 2256 U.S. Pat. No. 7,615,383 SEQ 3042 ligand) ID NO: 44 PDLB96 trk-C (NT-3 trkC Heavy chain 6.1.2 U.S. Pat. No. 7,615,383 SEQ 3043 ligand) ID NO: 45 PDLB97 trk-C (NT-3 trkC Heavy chain 6.4.1 U.S. Pat. No. 7,615,383 SEQ 3044 ligand) ID NO: 46 PDLB98 trk-C (NT-3 trkC Heavy chain 2345 U.S. Pat. No. 7,615,383 SEQ 3045 ligand) ID NO: 47 PDLB99 trk-C (NT-3 trkC Heavy chain 2349 U.S. Pat. No. 7,615,383 SEQ 3046 ligand) ID NO: 48 PDLB100 alpha synuclein Heavy chain Hu9E4VH consensus U.S. Pat. No. 8,609,820 SEQ 3047 consensus chain amino acid sequence ID NO: 27 PDLB101 alpha synuclein Heavy chain m9E4VH WO2015075635 3048 consensus chain SEQ ID NO: 6 PDLB102 alpha synuclein Heavy chain Humanized 1H7 heavy WO2015075635 3049 constant region chain constant region SEQ ID NO: 128 (IgG2) PDLB103 alpha synuclein Heavy chain Humanized 1H7 heavy WO2015075635 3050 constant region chain constant region SEQ ID NO: 129 (Glm1 allotype) PDLB104 alpha synuclein Heavy chain Humanized 9E4 heavy WO2015075635 3051 constant region chain constant region SEQ ID NO: 35 (Glm3 allotype: BIP version) PDLB105 alpha synuclein Heavy chain Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3052 constant region ID NO: 58 (G1m1 allotype) PDLB106 alpha syrinclein Heavy chain Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3053 constant region ID NO: 52 G1m3 allotype) PDLB107 alpha synuclein Heavy chain Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3054 constant region ID NO: 50 (IgG1; common for v1-v5) PDLB108 alpha synuclein Heavy chain Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3055 constant region ID NO: 57 (IgG2) PDLB109 many - growth Heavy chain fusion H19L13, H19L16, U.S. Pat. No. 8,053,569 SEQ 3056 factors (to protein H19L18, H19L14, ID NO: 25 increase transport H19L15, H19L17, H19L6, across BBB) H19L11 PDLB110 many - growth Heavy chain fusion H20L13, H20L16, U.S. Pat. No. 8,053,569 SEQ 3057 factors (to protein H20L18, H20L14, ID NO: 28 increase transport H20L15, H20L17, H2016, across BBB) H20L11 PDLB111 many - growth Heavy chain fusion H22L13, H22L16, U.S. Pat. No. 8,053,569 SEQ 3058 factors (to protein H22L18, H22L14, ID NO: 34 increase transport H22L15, H22L17, H22L6, across BBB) H22L11 PDLB112 many - growth Heavy chain fusion H5L11, H6L11, H14L11, U.S. Pat. No. 8,053,569 SEQ 3059 factors (to protein H15L11, H16L11, ID NO: 24 increase transport H17L11, H18L11, across BRB) H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 PDLB113 NOGO Heavy chain 2A10 construct WO2007003421 3060 humanized construct SEQ ID NO: 79 H1 PDLB114 NOGO Heavy chain 2A10 construct WO2007003421 3061 humanized construct SEQ ID NO: 29 H14 PDLB115 NOGO Heavy chain 2A10 construct WO2007003421 3062 humanized construct SEQ ID NO: 30 H15 PDLB116 NOGO Heavy chain 2A10 construct WO2007003421 3063 humanized construct SEQ ID NO: 31 H16 PDLB117 NOGO Heavy chain 2A10 construct WO2007003421 3064 humanized construct SEQ ID NO: 32 H17 PDLB118 NOGO Heavy chain 2A10 construct WO2007003421 3065 humanized construct SEQ ID NO: 33 H18 PDLB119 NOGO Heavy chain 2A10 construct WO2007003421 3066 humanized construct SEQ ID NO: 92 H19 PDLB120 NOGO Heavy chain 2A10 construct WO2007003421 3067 humanized construct SEQ ID NO: 93 H20 PDLB121 NOGO Heavy chain 2A10 construct WO2007003421 3068 humanized construct SEQ ID NO: 94 H21 PDLB122 NOGO Heavy chain 2A10 construct WO2007003421 3069 humanized construct SEQ ID NO: 95 H22 PDLB123 NOGO Heavy chain 2A10 construct WO2007003421 3070 humanized construct SEQ ID NO: 96 H23 PDLB124 NOGO Heavy chain 2A10 construct WO2007003421 3071 humanized construct SEQ ID NO: 97 H24 PDLB125 NOGO Heavy chain 2A10 construct WO2007003421 3072 humanized construct SEQ ID NO: 98 H25 PDLB126 NOGO Heavy chain 2A10 construct WO2007003421 3073 humanized construct SEQ ID NO: 26 H5 PDLB127 NOGO Heavy chain 2A10 construct WO2007003421 3074 humanized construct SEQ ID NO: 27 H6 PDLB128 NOGO Heavy chain 2A10 construct WO2007003421 3075 humanized construct SEQ ID NO: 28 H700 PDLB129 RTN4 (NOGO) Heavy chain IgG4, Atinumab U.S. Pat. No. 8,163,285 SEQ 3076 immunomodulator ID NO: 24 PDLB130 alpha synuclein Heavy chain NI-202.12F4-VHA1b-GL US20150232542 3077 variable region SEQ ID NO: 10 PDLB131 alpha synuclein Heavy chain NI-202.3D8-VHE1 US20150232542 3078 variable region SEQ ID NO: 15 PDLB132 alpha synuclein Heavy chain NI-202.3D8-VHE1-GL US20150232542 3079 variable region SEQ ID NO: 16 PDLB133 alpha synuclein Heavy chain NI-202.3G12-VHB1 US20150232542 3080 variable region SEQ ID NO: 3 PDLB134 alpha synuclein Heavy chain NI-202.3G12-VHB1-GL US20150232542 3081 variable region SEQ ID NO: 4 PDLB135 alpha synuclein Heavy chain NI-202.12F4-VHA1b US20150232542 3082 variable region SEQ ID NO: 9 PDLB136 alpha synuclein Heavy chain Hu9E4VHv3 variable U.S. Pat. No. 8,609,820 SEQ 3083 variable region region ID NO: 10 PDLB137 alpha synuclein Heavy chain Hu9E4VHv4 variable U.S. Pat. No. 8,609,820 SEQ 3084 variable region region ID NO: 11 PDLB138 alpha synuclein Heavy chain Hu9E4VLv3 variable U.S. Pat. No. 8,609,820 SEQ 3085 variable region region ID NO: 5 PDLB139 alpha synuclein Heavy chain m9E4VH variable region U.S. Pat. No. 8,609,820 SEQ 3086 variable region ID NO: 6 PDLB140 alpha synuclein Heavy chain I791009Hu9E4VHFr U.S. Pat. No. 8,609,820 SEQ 3087 variable region variable region ID NO: 7 PDLB141 alpha synuclein Heavy chain Hu9E4VHv1 variable U.S. Pat. No. 8,609,820 SEQ 3088 variable region region ID NO: 8 PDLB142 alpha synuclein Heavy chain Hu9E4VHv2 variable U.S. Pat. No. 8,609,820 SEQ 3089 variable region region ID NO: 9 PDLB143 alpha synuclein Heavy chain m1H7 U.S. Pat. No. 8,790,644 SEQ 3090 variable region ID NO: 5 PDLB144 alpha synuclein Heavy chain mature m1H7 U.S. Pat. No. 8,790,644 SEQ 3091 variable region ID NO: 9 PDLB145 alpha synuclein Heavy chain Hu9E4VHv 3 WO2015075635 3092 variable region SEQ ID NO: 10 PDLB146 alpha synuclein Heavy chain HulH7VHv4 WO2015075635 3093 variable region SEQ ID NO: 101 PDLB147 alpha synuclein Heavy chain Hu9E4VHv4 (no back WO2015075635 3094 variable region mutation) SEQ ID NO: 11 PDLB148 alpha synuclein Heavy chain HulH7VHv5 WO2015075635 3095 variable region SEQ ID NO: 103 PDLB149 alpha synuclein Heavy chain 63 102889Hu9E4VLFr WO2015075635 3096 variable region SEQ ID NO: 2 PDLB150 alpha synuclein Heavy chain m5C1 antibody heavy WO2015075635 3097 variable region chain variable region SEQ ID NO: 39 amino acid sequence PDLB151 alpha synuclein Heavy chain i 791009Hu9E4VHFr WO2015075635 3098 variable region SEQ ID NO: 7 PDLB152 alpha synuclein Heavy chain Hu9E4VHv 1 WO2015075635 3099 variable region SEQ ID NO: 8 PDLB153 alpha synuclein Heavy chain mlH7 WO2015075635 3100 variable region SEQ ID NO: 81 PDLB154 alpha synuclein Heavy chain mature mlH7 WO2015075635 3101 variable region SEQ ID NO: 85 PDLB155 alpha synuclein Heavy chain Hu9E4VHv2 WO2015075635 3102 variable region SEQ ID NO: 9 PDLB156 alpha synuclein Heavy chain Hu lH7VHv1 WO2015075635 3103 variable region SEQ ID NO: 95 PDLB157 alpha synuclein Heavy chain HulH7VHv2 WO2015075635 3104 variable region SEQ ID NO: 97 PDLB158 alpha synuclein Heavy chain HuIH7VHv3 WO2015075635 3105 variable region SEQ ID NO: 99 PDLB159 alpha synuclein Heavy chain BA1: 49/G WO2011104696 3106 protofibrils variable region SEQ ID NO: 56 PDLB160 alpha synuclein Heavy chain BA1: 49/G WO2011104696 3107 protofibrils variable region SEQ ID NO: 57 PDLB161 alpha synuclein Heavy chain BA2: 38E2/7 WO2011104696 3108 protofibrils variable region SEQ ID NO: 58 PDLB162 alpha synuclein Heavy chain BA2: 38E2/7 WO2011104696 3109 protofibrils variable region SEQ ID NO: 59 PDLB163 amyloid Heavy chain F11G3 U.S. Pat. No. 9,125,846 SEQ 3110 oligomers variable region ID NO: 11 PDLB164 DR6 and P75 Heavy chain M66-B03 WO2010062904 3111 variable region SEQ ID NO: 67 PDLB165 DR6 and P75 Heavy chain M50-H01 WO2010062904 3112 variable region SEQ ID NO: 7 PDLB166 DR6 and P75 Heavy chain M67-G02 WO2010062904 3113 variable region SEQ ID NO: 77 PDLB167 DR6 and P75 Heavy chain M72-F03 WO2010062904 3114 variable region SEQ ID NO: 87 PDLB168 DR6 and P75 Heavy chain M73-C04 WO2010062904 3115 variable region SEQ ID NO: 97 PDLB169 DR6 and P75 Heavy chain 1P1D6.3 WO2010062904 3116 variable region SEQ ID NO: 107 PDLB170 DR6 and P75 Heavy chain 1P2F2.1 WO2010062904 3117 variable region SEQ ID NO: 117 PDLB171 DR6 and P75 Heavy chain 1P5D10.2 WO2010062904 3118 variable region SEQ ID NO: 127 PDLB172 DR6 and P75 Heavy chain M51-H09 WO2010062904 3119 variable region SEQ ID NO: 17 PDLB173 DR6 and P75 Heavy chain M53-E04 WO2010062904 3120 variable region SEQ ID NO: 27 PDLB174 DR6 and P75 Heavy chain M53-F04 WO2010062904 3121 variable region SEQ ID NO: 37 PDLB175 DR6 and P75 Heavy chain M62-B02 WO2010062904 3122 variable region SEQ ID NO: 47 PDLB176 DR6 and P75 Heavy chain M63-E10 WO2010062904 3123 variable region SEQ ID NO: 57 PDLB177 LPG Heavy chain #7 U.S. Pat. No. 8,591,902 SEQ 3124 (lysophosphatidyl variable region ID NO: 18 glucoside) PDLB178 LPG Heavy chain #15 U.S. Pat. No. 8,591,902 SEQ 3125 (lysophosphatidyl variable region ID NO: 8 glucoside) PDLB179 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ 3126 variable region ID NO: 13 PDLB180 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ 3127 variable region ID NO: 14 PDLB181 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ 3128 variable region ID NO: 15 PDLB182 MAI (myelin Heavy chain WO2013158748 3129 associated variable region SEQ ID NO: 1 inhibitor) PDLB183 MAI (myelin Heavy chain WO2013158748 3130 associated variable region SEQ ID NO: 17 inhibitor) PDLB184 NMDA Heavy chain EP2805972 SEQ 3131 variable region ID NO: 43 PDLB185 NOGO Heavy chain H5L13, H5L16, H5L18, US20140147435 3132 variable region H5L14, H5L15, H5L17, SEQ ID NO: 11 H5L6, H5L11 PDLB186 NOGO Heavy chain H6L13, H6L16, H6L18, US20140147435 3133 variable region H6L14, H6L15, H6L17, SEQ ID NO: 12 H6L6 PDLB187 NOGO Heavy chain H700L13, H700L16, US20140147435 3134 variable region H700L18, H700L14, SEQ ID NO: 13 H700L15, H700L17, H700L6, H700L11 PDLB188 NOGO Heavy chain H14L13, H14L16, US20140147435 3135 variable region H14L18, H14L14, SEQ ID NO: 14 H14L15, H14L17, H14L6, H14L11 PDLB189 NOGO Heavy chain H15L13, H15L16, US20140147435 3136 variable region H15L18, H15L14, SEQ ID NO: 15 H15L15, H15L17, H15L6, H15L11 PDLB190 NOGO Heavy chain H16L13, H16L16, US20140147435 3137 variable region H16L18, H16L14, SEQ ID NO: 16 H16L15, H16L17, H16L6, H16L11 PDLB191 NOGO Heavy chain H17L13, H17L16, US20140147435 3138 variable region H17L18, H17L14, SEQ ID NO: 17 H17L15, H17L17, H17L6, H17L11 PDLB192 NOGO Heavy chain H18L13, H18L16, US20140147435 3139 variable region H18L18, H18L14, SEQ ID NO: 18 H18L15, H18L17, H18L6, H18L11 PDLB193 NOGO Heavy chain H1L13, H1L16, H1L18, US20140147435 3140 variable region H1L14, H1L15, H1L17, SEQ ID NO: 77 H1L6 PDLB194 NOGO Heavy chain H19L13, H19L16, US20140147435 3141 variable region H19L18, H19L4, SEQ ID NO: 85 H19L15, H19L17, H19L6, H19L11 PDLB195 NOGO Heavy chain H20L13, H20L16, US20140147435 3142 variable region H20L18, H20L14, SEQ ID NO: 86 H20L15, H20L17, H20L6, H20L11 PDLB196 NOGO Heavy chain H21L13, H21L16, US20140147435 3143 variable region H21L18, H21L14, SEQ ID NO: 87 H21L15, H21L17, H21L6, H21L11 PDLB197 NOGO Heavy chain H22L13, H22L16, US20140147435 3144 variable region H22L18, H22L14, SEQ ID NO: 88 H22L15, H22L17, H22L6, H22L11 PDLB198 NOGO Heavy chain H23L13, H23L16, US20140147435 3145 variable region H23L18, H23L14, SEQ ID NO: 89 H23L15, H23L17, H23L6, H23L11 PDLB199 NOGO Heavy chain H24L13, H24L16, US20140147435 3146 variable region H24L18, H24L14, SEQ ID NO: 90 H24L15, H24L17, H24L6, H24L11 PDLB200 NOGO Heavy chain H25L13, H25L16, US20140147435 3147 variable region H25L18, H25L14, SEQ ID NO: 91 H25L15, H25L17, H25L6, H25L11 PDLB201 Nogo-66 Heavy chain Antibody clone 50 US20140065155 3148 variable region SEQ ID NO: 3 PDLB202 Nogo-66 Heavy chain Antibody clone 51 US20140065155 3149 variable region SEQ ID NO: 5 PDLB203 NogoA/NiG Heavy chain 6A3-Ig4 WO2009056509 3150 variable region SEQ ID NO: 24 PDLB204 NogoA/NiG Heavy chain 6A3-IgG1 WO2009056509 3151 variable region SEQ ID NO: 4 PDLB205 RGM A Heavy chain 5F9.1-GL US20150183871 3152 variable region SEQ ID NO: 35 PDLB206 RGM A Heavy chain 5F9.2-GL US20150183871 3153 variable region SEQ ID NO: 36 PDLB207 RGM A Heavy chain 5F9.3-GL US20150183871 3154 variable region SEQ ID NO: 37 PDLB208 RGM A Heavy chain 5F9.4-GL US20150183871 3155 variable region SEQ ID NO: 38 PDLB209 RGM A Heavy chain 5F9.5-GL US20150183871 3156 variable region SEQ ID NO: 39 PDLB210 RGM A Heavy chain 5F9.6-GL US20150183871 3157 variable region SEQ ID NO: 40 PDLB211 RGM A Heavy chain 5F9.7-GL US20150183871 3158 variable region SEQ ID NO: 41 PDLB212 RGM A Heavy chain 5F9.8-GL US20150183871 3159 variable region SEQ ID NO: 42 PDLB213 RGM A Heavy chain 5F9.9-GL US20150183871 3160 variable region SEQ ID NO: 43 PDLB214 RGM A Heavy chain h5F9.1, h5F9.1, h5F9.1, US20150183871 3161 variable region h5F9.1, h5F9.1, h5F9.2, SEQ ID NO: 47 h5F9.3 PDLB215 RGM A Heavy chain h5F9.3, h5F9.9, h5F9.25 US20150183871 3162 variable region SEQ ID NO: 53 PDLB216 RGM A Heavy chain h5F9.4, h5F9.10, h5F9.26 US20150183871 3163 variable region SEQ ID NO: 54 PDLB217 RGMa Heavy chain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 PDLB218 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 PDLB219 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 PDLB220 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 PDLB221 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 PDLB222 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 PDLB223 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 PDLB224 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 PDLB225 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 PDLB226 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 PDLB227 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 PDLB228 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 PDLB229 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 PDLB230 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 PDLB231 -synuclein Heavy chain Syn-01 WO2014132210 3178 aggregates variable region SEQ ID NO: 10 PDLB232 -synuclein Heavy chain Syn-F1 WO2014132210 3179 aggregates variable region SEQ ID NO: 2 PDLB233 -synuclein Heavy chain Syn-F2 WO2014132210 3180 aggregates variable region SEQ ID NO: 6 PDLB234 NOGO Heavy chain 2A10 construct WO2007003421 3181 variable region SEQ ID NO: 77 humanized construct H1 PDLB235 NOGO Heavy chain 2A10 construct WO2007003421 3182 variable region SEQ ID NO: 14 humanized construct H14 PDLB236 NOGO Heavy chain 2A10 construct WO2007003421 3183 variable region SEQ ID NO: 15 humanized construct H15 PDLB237 NOGO Heavy chain 2A10 construct WO2007003421 3184 variable region SEQ ID NO: 16 humanized construct H16 PDLB238 NOGO Heavy chain 2A10 construct WO2007003421 3185 variable region SEQ ID NO: 17 humanized construct H17 PDLB239 NOGO Heavy chain 2A10 construct WO2007003421 3186 variable region SEQ ID NO: 18 humanized construct H18 PDLB240 NOGO Heavy chain 2A10 construct WO2007003421 3187 variable region SEQ ID NO: 85 humanized construct H19 PDLB241 NOGO Heavy chain 2A10 construct WO2007003421 3188 variable region SEQ ID NO: 86 humanized construct H20 PDLB242 NOGO Heavy chain 2A10 construct WO2007003421 3189 variable region SEQ ID NO: 87 humanized construct H21 PDLB243 NOGO Heavy chain 2A10 construct WO2007003421 3190 variable region SEQ ID NO: 88 humanized construct H22 PDLB244 NOGO Heavy chain 2A10 construct WO2007003421 3191 variable region SEQ ID NO: 89 humanized construct H23 PDLB245 NOGO Heavy chain 2A10 construct WO2007003421 3192 variable region SEQ ID NO: 90 humanized construct H24 PDLB246 NOGO Heavy chain 2A10 construct WO2007003421 3193 variable region SEQ ID NO: 91 humanized construct H25 PDLB247 NOGO Heavy chain 2A10 construct WO2007003421 3194 variable region SEQ ID NO: 11 humanized construct H5 PDLB248 NOGO Heavy chain 2A10 construct WO2007003421 3195 variable region SEQ ID NO: 12 humanized construct H6 PDLB249 NOGO Heavy chain 2A10 construct WO2007003421 3196 variable region SEQ ID NO: 13 humanized construct H700 PDLB250 alpha synuclein Heavy chain version Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3197 3 (variable ID NO: 55 region + constant region) PDLB251 alpha synuclein Heavy chain version Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3198 3 (variable ID NO: 56 region + constant region; G1m3 allotype) PDLB252 118-126 of - Light chain 5CIL1 US20150259404 3199 synuclein SEQ ID NO: 29 PDLB253 118-126 of - Light chain 5CIL2 US20150259404 3200 synuclein SEQ ID NO: 30 PDLB254 118-126 of - Light chain 5CIL3 US20150259404 3201 synuclein SEQ ID NO: 31 PDLB255 118-126 of - Light chain 5CIL4 US20150259404 3202 synuclein SEQ ID NO: 32 PDLB256 118-126 of - Light chain IgG1 US20150259404 3203 synuclein SEQ ID NO: 40 PDLB257 118-126 of - Light chain 5Cl US20150259404 3204 synuclein SEQ ID NO: 8 PDLB258 ACTH Light chain Ab3 WO2015127288 3205 SEQ ID NO: 101 PDLB259 ACTH Light chain Ab4 WO2015127288 3206 SEQ ID NO: 141 PDLB260 ACTH Light chain Ab5 WO2015127288 3207 SEQ ID NO: 181 PDLB261 ACTH Light chain Ab1 WO2015127288 3208 SEQ ID NO: 21 PDLB262 ACTH Light chain Ab6 WO2015127288 3209 SEQ ID NO: 221 PDLB263 ACTH Light chain Ab7 WO2015127288 3210 SEQ ID NO: 261 PDLB264 ACTH Light chain Ab9 WO2015127288 3211 SEQ ID NO: 301 PDLB265 ACTH Light chain Ab10 WO2015127288 3212 SEQ ID NO: 341 PDLB266 ACTH Light chain Ab11 WO2015127288 3213 SEQ ID NO: 381 PDLB267 ACTH Light chain Ab12 WO2015127288 3214 SEQ ID NO: 421 PDLB268 ACTH Light chain Ab1.H WO2015127288 3215 SEQ ID NO: 461 PDLB269 ACTH Light chain Ab2.H WO2015127288 3216 SEQ ID NO: 501 PDLB270 ACTH Light chain Ab3.H WO2015127288 3217 SEQ ID NO: 541 PDLB271 ACTH Light chain Ab4.H WO2015127288 3218 SEQ ID NO: 581 PDLB272 ACTH Light chain Ab2 WO2015127288 3219 SEQ ID NO: 61 PDLB273 ACTH Light chain Ab6.H WO2015127288 3220 SEQ ID NO: 621 PDLB274 ACTH Light chain Ab7.H WO2015127288 3221 SEQ ID NO: 661 PDLB275 ACTH Light chain Ab7A.H WO2015127288 3222 SEQ ID NO: 701 PDLB276 ACTH Light chain Ab10.H WO2015127288 3223 SEQ ID NO: 741 PDLB277 ACTH Light chain Ab11.H WO2015127288 3224 SEQ ID NO: 781 PDLB278 ACTH Light chain Ab11A.H WO2015127288 3225 SEQ ID NO: 821 PDLB279 ACTH Light chain Ab12.H WO2015127288 3226 SEQ ID NO: 861 PDLB280 alpha synuclein Light chain Hu1H7VLv1 U.S. Pat. No. 8,790,644 SEQ 3227 ID NO: 33 PDLB281 alpha synuclein Light chain Hu1H7VLv2 U.S. Pat. No. 8,790,644 SEQ 3228 ID NO: 35 PDLB282 alpha synuclein Light chain Hu1H7VLv3 U.S. Pat. No. 8,790,644 SEQ 3229 ID NO: 37 PDLB283 alpha synuclein Light chain Hu1H7VLv4 U.S. Pat. No. 8,790,644 SEQ 3230 ID NO: 39 PDLB284 alpha synuclein Light chain Hu1H7VL alternative U.S. Pat. No. 8,790,644 SEQ 3231 ID NO: 45 PDLB285 alpha synuclein Light chain sequence for Hu1H7VL U.S. Pat. No. 8,790,644 SEQ 3232 alternatives ID NO: 47 PDLB286 alpha synuclein Light chain humanized 5C 1L1 WO2015075635 3233 SEQ ID NO: 69 PDLB287 alpha synuclein Light chain humanized 5C 1L2 WO2015075635 3234 SEQ ID NO: 70 PDLB288 alpha synuclein Light chain Hu1H7VL alternative WO2015075635 3235 SEQ ID NO: 122 PDLB289 alpha synuclein Light chain humanized 1H7 light chain WO2015075635 3236 version 3 (variable region + SEQ ID NO: 124 constant region with Arginine) PDLB290 alpha synuclein Light chain humanized 1H7 light chain WO2015075635 3237 version 3 (variable region + SEQ ID NO: 125 constant region without Arginine) PDLB291 alpha synuclein Light chain Hu9E4VL alternative WO2015075635 3238 SEQ ID NO: 28 PDLB292 alpha synuclein Light chain humanized 9E4 light chain WO2015075635 3239 version 3 (variable region + SEQ ID NO: 32 constant region with Arginine) PDLB293 alpha synuclein Light chain humanized 9E4 light chain WO2015075635 3240 version 3 (variable region + SEQ ID NO: 33 constant region without Arginine) PDLB294 alpha synuclein Light chain humanized 5C L3 WO2015075635 3241 SEQ ID NO: 71 PDLB295 amyloids Light chain #118 WO2010012004 3242 SEQ ID NO: 10 PDLB296 amyloids Light chain #121 WO2010012004 3243 SEQ ID NO: 12 PDLB297 amyloids Light chain #201 WO2010012004 3244 SEQ ID NO: 14 PDLB298 amyloids Light chain #204 WO2010012004 3245 SEQ ID NO: 15 PDLB299 amyloids Light chain #205 WO2010012004 3246 SEQ ID NO: 17 PDLB300 EAG1 Light chain chimeric ImAb3 WO2006037604 3247 SEQ ID NO: 10 PDLB301 EAG1 Light chain chimeric ImAb4 WO2006037604 3248 SEQ ID NO: 14 PDLB302 EAG1 Light chain LC-lmAb3-humB3 WO2006037604 3249 SEQ ID NO: 18 PDLB303 EAG1 Light chain ImAb4 WO2006037604 3250 SEQ ID NO: 2 PDLB304 EAG1 Light chain LC-lmAb4-humA17 WO2006037604 3251 SEQ ID NO: 22 PDLB305 EAG1 Light chain LC-lmAb3-humA3 WO2006037604 3252 SEQ ID NO: 26 PDLB306 EAG1 Light chain LC-lmAb3-humA17 WO2006037604 3253 SEQ ID NO: 30 PDLB307 EAG1 Light chain LC-lmAb4-humA5-1 WO2006037604 3254 SEQ ID NO: 34 PDLB308 EAG1 Light chain LC-lmAh4-humO1 WO2006037604 3255 SEQ ID NO: 38 PDLB309 EAG1 Light chain ImAb3 WO2006037604 3256 SEQ ID NO: 6 PDLB310 NOGO Light chain H6L13 FL, H19L13 FL, US20140147435 3257 H20L13 FL, H21L13 FL, SEQ ID NO: 35 H25L13 FL PDLB311 NOGO Light chain H16L16 FL, H19L16 FL, US20140147435 3258 H20L16 FL, H21L16 FL, SEQ ID NO: 38 H25L16 FL, H18L16 FL PDLB312 NOGO Light chain H16L18 FL, H19L18 FL, US20140147435 3259 H20L18 FL, H21L18 FL, SEQ ID NO: 40 H25L18 FL PDLB313 Nogo receptor-1 Light chain 7E11 US20090215691 3260 SEQ ID NO: 15 PDLB314 Nogo receptor-1 Light chain 7E11 US20090215691 3261 SEQ ID NO: 17 PDLB315 trk-C (NT-3 trkC Light chain 2250 U.S. Pat. No. 7,615,383 SEQ 3262 ligand) ID NO: 49 PDLB316 trk-C (NT-3 trkC Light chain 2253 U.S. Pat. No. 7,615,383 SEQ 3263 ligand) ID NO: 50 PDLB317 trk-C (NT-3 trkC Light chain 2256 U.S. Pat. No. 7,615,383 SEQ 3264 ligand) ID NO: 51 PDLB318 trk-C (NT-3 trkC Light chain 6.1.2 U.S. Pat. No. 7,615,383 SEQ 3265 ligand) ID NO: 52 PDLB319 trk-C (NT-3 trkC Light chain 6.4.1 U.S. Pat. No. 7,615,383 SEQ 3266 ligand) ID NO: 53 PDLB320 trk-C (NT-3 trkC Light chain 2345 U.S. Pat. No. 7,615,383 SEQ 3267 ligand) ID NO: 54 PDLB321 trk-C (NT-3 trkC Light chain 2349 U.S. Pat. No. 7,615,383 SEQ 3268 ligand) ID NO: 55 PDLB322 alpha synuclein Light chain Hu9E4VL consensus U.S. Pat. No. 8,609,820 SEQ 3269 consensus chain amino acid sequence ID NO: 26 PDLB323 alpha synuclein Light chain constant humanized 9E4 light chain U.S. Pat. No. 8,609,820 SEQ 3270 region constant region ID NO: 13 PDLB324 alpha synuclein Light chain constant humanized 9E4 heavy U.S. Pat. No. 8,609,820 SEQ 3271 region chain constant region ID NO: 14 PDLB325 alpha synuclein Light chain constant humanized 9E4 WO2015075635 3272 region SEQ ID NO: 13 PDLB326 alpha synuclein Light chain constant Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3273 region (with ID NO: 49 arginine) (common for v1-v4) PDLB327 alpha synuclein Light chain constant Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3274 region (without ID NO: 51 arginine) (common for v1-v4) PDLB328 many - growth Light chain fusion H21L13, H21L16, U.S. Pat. No. 8,053,569 SEQ 3275 factors (to protein H21L18, H21L14, ID NO: 31 increase transport H21L15, H21L17, H21L6, across BBB) H21L11 PDLB329 many - growth Light chain fusion H23L13, H23L16, U.S. Pat. No. 8,053,569 SEQ 3276 factors (to protein H23L18, H23L14, ID NO: 36 increase transport H23L15, H23L17, H23L6, across BBB) H23L11 PDLB330 NOGO Light chain 2A10 construct WO2007003421 3277 humanized construct SEQ ID NO: 80 L11 PDLB331 NOGO Light chain 2A10 construct WO2007003421 3278 humanized construct SEQ ID NO: 35 L13 PDLB332 NOGO Light chain 2A10 construct WO2007003421 3279 humanized construct SEQ ID NO: 36 L14 PDLB333 NOGO Light chain 2A10 construct WO2007003421 3280 humanized construct SEQ ID NO: 37 L15 PDLB334 NOGO Light chain 2A10 construct WO2007003421 3281 humanized construct SEQ ID NO: 38 L16 PDLB335 NOGO Light chain 2A10 construct WO2007003421 3282 humanized construct SEQ ID NO: 39 L17 PDLB336 NOGO Light chain 2A10 construct WO2007003421 3283 humanized construct SEQ ID NO: 40 L18 PDLB337 NOGO Light chain 2A10 construct WO2007003421 3284 humanized construct SEQ ID NO: 34 L6 PDLB338 RTN4 Light chain IgG4, Atinumab U.S. Pat. No. 8,163,285 SEQ 3285 immunomodulator ID NO: 25 PDLB339 alpha synuclein Light chain variable NI-202.12F4-VLa1 US20150232542 3286 region SEQ ID NO: 12 PDLB340 alpha synuclein Light chain variable NI-202.12F4-VLa1-GL US20150232542 3287 region SEQ ID NO: 13 PDLB341 alpha synuclein Light chain variable NI-202.3D8-VKa1 US20150232542 3288 region SEQ ID NO: 18 PDLB342 alpha synuclein Light chain variable NI-202.3D8-VKa1-GL US20150232542 3289 region SEQ ID NO: 19 PDLB343 alpha synuclein Light chain variable NI-202.3D8-VKc1 US20150232542 3290 region SEQ ID NO: 21 PDLB344 alpha synuclein Light chain variable NI-202.3D8-VKc1-GL US20150232542 3291 region SEQ ID NO: 22 PDLB345 alpha synuclein Light chain variable NI-202.3G12-VLc1 US20150232542 3292 region SEQ ID NO: 6 PDLB346 alpha synuclein Light chain variable NI-202.3G12-VLc1-GL US20150232542 3293 region SEQ ID NO: 7 PDLB347 alpha synuclein Light chain variable m9E4VL variable region U.S. Pat. No. 8,609,820 SEQ 3294 region ID NO: 1 PDLB348 alpha synuclein Light chain variable 63102889Hu9E4VLFr U.S. Pat. No. 8,609,820 SEQ 3295 region region variable ID NO: 2 PDLB349 alpha synuclein Light chain variable Hu9E4VLv1 variable U.S. Pat. No. 8,609,820 SEQ 3296 region region ID NO: 3 PDLB350 alpha synuclein Light chain variable Hu9E4VLv2 variable U.S. Pat. No. 8,609,820 SEQ 3297 region region ID NO: 4 PDLB351 alpha synuclein Light chain variable mature m1H7 light chain U.S. Pat. No. 8,790,644 SEQ 3298 region variable ID NO: 11 PDLB352 alpha synuclein Light chain variable m1H7 light chain variable U.S. Pat. No. 8,790,644 SEQ 3299 region ID NO: 7 PDLB353 alpha synuclein Light chain variable m9E4VL WO2015075635 3300 region SEQ ID NO: 1 PDLB354 alpha synuclein Light chain variable Hu1H7VLv2 WO2015075635 3301 region SEQ ID NO: 111 PDLB355 alpha synuclein Light chain variable Hu1H7VLv3 WO2015075635 3302 region SEQ ID NO: 113 PDLB356 alpha synuclein Light chain variable Hu1H7VLv1 WO2015075635 3303 region SEQ ID NO: 109 PDLB357 alpha synuclein Light chain variable Hu1H7VLv4 WO2015075635 3304 region SEQ ID NO: 115 PDLB358 alpha synuclein Light chain variable Hu9E4VLv1 WO2015075635 3305 region SEQ ID NO: 3 PDLB359 alpha synuclein Light chain variable Hu9E4VLv2 (No back WO2015075635 3306 region mutation) SEQ ID NO: 4 PDLB360 alpha synuclein Light chain variable m5C 1 antibody light chain WO2015075635 3307 region variable region amino acid SEQ ID NO: 43 sequence PDLB361 alpha synuclein Light chain variable Hu9E4VLv3 WO2015075635 3308 region SEQ ID NO: 5 PDLB362 alpha synuclein Light chain variable mlH7 WO2015075635 3309 region SEQ ID NO: 83 PDLB363 alpha synuclein Light chain variable mature mlH7 WO2015075635 3310 region SEQ ID NO: 87 PDLB364 alpha synuclein Light chain variable BA3: 38F11/2_8 WO2011104696 3311 protofibrils region SEQ ID NO: 60 PDLB365 alpha synuclein Light chain variable BA3: 38F11/2_8 WO2011104696 3312 protofibrils region SEQ ID NO: 61 PDLB366 alpha synuclein Light chain variable BA4: 48B11/8 WO2011104696 3313 protofibrils region SEQ ID NO: 62 PDLB367 alpha synuclein Light chain variable BA4: 48B11/8 WO2011104696 3314 protofibrils region SEQ ID NO: 63 PDLB368 amyloid Light chain variable F11G3 U.S. Pat. No. 9,125,846 SEQ 3315 oligomers region ID NO: 12 PDLB369 DR6 and P75 Light chain variable M73-C04 WO2010062904 3316 region SEQ ID NO: 102 PDLB370 DR6 and P75 Light chain variable 1P1D6.3 WO2010062904 3317 region SEQ ID NO: 112 PDLB371 DR6 and P75 Light chain variable M50-H02 WO2010062904 3318 region SEQ ID NO: 12 PDLB372 DR6 and P75 Light chain variable 1P2F2.1 WO2010062904 3319 region SEQ ID NO: 122 PDLB373 DR6 and P75 Light chain variable 1P5D10.2 WO2010062904 3320 region SEQ ID NO: 132 PDLB374 DR6 and P75 Light chain variable M51-H09 WO2010062904 3321 region SEQ ID NO: 22 PDLB375 DR6 and P75 Light chain variable M53-E04 WO2010062904 3322 region SEQ ID NO: 32 PDLB376 DR6 and P75 Light chain variable M53-F04 WO2010062904 3323 region SEQ ID NO: 42 PDLB377 DR6 and P75 Light chain variable M62-B02 WO2010062904 3324 region SEQ ID NO: 52 PDLB378 DR6 and P75 Light chain variable M63-E10 WO2010062904 3325 region SEQ ID NO: 62 PDLB379 DR6 and P75 Light chain variable M66-B03 WO2010062904 3326 region SEQ ID NO: 72 PDLB380 DR6 and P75 Light chain variable M67-G02 WO2010062904 3327 region SEQ ID NO: 82 PDLB381 DR6 and P75 Light chain variable M72-F03 WO2010062904 3328 region SEQ ID NO: 92 PDLB382 LPG (lysophosphatidyl Light chain variable #7 U.S. Pat. No. 8,591,902 SEQ 3329 glucoside) region ID NO: 17 PDLB383 LPG Light chain variable #15 U.S. Pat. No. 8,591,902 SEQ 3330 (lysophosphatidyl region ID NO: 7 glucoside) PDLB384 MAG Light chain variable U.S. Pat. No. 8,071,731 SEQ 3331 region ID NO: 16 PDLB385 MAG Light chain variable U.S. Pat. No. 8,071,731 SEQ 3332 region ID NO: 17 PDLB386 MAG Light chain variable U.S. Pat. No. 8,071,731 SEQ 3333 region ID NO: 18 PDLB387 MAG Light chain variable U.S. Pat. No. 8,071,731 SEQ 3334 region ID NO: 19 PDLB388 MAI (myelin Light chain variable WO2013158748 3335 associated region SEQ ID NO: 11 inhibitor) PDLB389 MAI (myelin Light chain variable WO2013158748 3336 associated region SEQ ID NO: 27 inhibitor) PDLB390 NMDA Light chain variable EP2805972 SEQ 3337 region ID NO: 44 PDLB391 NOGO Light chain variable H1L6, H5L6, H6L6, US20140147435 3338 region H14L6, H15L6, H16L6, SEQ ID NO: 19 H17L6, H18L6, H19L6, H20L6, H21L6, H22L6, H23L6, H24L6, H25L6, H700L6 PDLB392 NOGO Light chain variable H1L13, H5L13, H6L13, US20140147435 3339 region H14L13, H15L13, SEQ ID NO: 20 H16L13, H17L13, H18L13, H19L13, H20L13, H21L13, H22L13, H23L13, H24L13, H25L13, H700L13 PDLB393 NOGO Light chain variable H1L14, H5L14, H6L14, US20140147435 3340 region H14L14, H15L14, SEQ ID NO: 21 H16L14, H17L14, H18L14, H19L14, H20L14, H21L14, H22L14, H23L14, H24L14, H25L14, H700L14 PDLB394 NOGO Light chain variable H1L15, H5L15, H6L15, US20140147435 3341 region H14L15, H15L15, SEQ ID NO: 22 H16L15, H17L15, H18L15, H19L15, H20L15, H21L15, H22L15, H23L15, H24L15, H25L15, H700L15 PDLB395 NOGO Light chain variable H1L16, H5L16, H6L16, US20140147435 3342 region H14L16, H15L16, SEQ ID NO: 23 H16L16, H17L16, H18L16, H19L16, H20L16, H21L16, H22L16, H23L16, H24L16, H25L16, H700L16 PDLB396 NOGO Light chain variable H1L17, H5L17, H6L17, US20140147435 3343 region H14L17, H15L17, SEQ ID NO: 24 H16L17, H17L17, H18L17, H19L17, H20L17, H21L17, H22L17, H23L17, H24L17, H25L17, H700L17 PDLB397 NOGO Light chain variable H1L18, H5L18, H6L18, US20140147435 3344 region H14L18, H15L18, SEQ ID NO: 25 H16L18, H17L18, H18L18, H19L18, H20L18, H21L18, H22L18, H23L18, H24L18, H25L18, H700L18 PDLB398 NOGO Light chain variable H5L11, H6L11, H14L11, US20140147435 3345 region H15L11, H16L11, SEQ ID NO: 78 H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 PDLB399 Nogo-66 Light chain variable Antibody clone 50 US20140065155 3346 region SEQ ID NO: 4 PDLB400 Nogo-66 Light chain variable Antibody clone 51 US20140065155 3347 region SEQ ID NO: 6 PDLB401 NogoA/NiG Light chain variable 6A3-Ig4 WO2009056509 3348 region SEQ ID NO: 25 PDLB402 NogoA/NiG Light chain variable 6A3-IgG1 WO2009056509 3349 region SEQ ID NO: 5 PDLB403 RGM A Light chain variable 5F9.1-GL, 5F9.1-GL, US20150183871 3350 region 5F9.1-GL, 5F9.1-GL, SEQ ID NO: 44 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, h5F9.4, h5F9.11, h5F9.12 PDLB404 RGM A Light chain variable 5F9.2-GL, 5F9.2-GL, US20150183871 3351 region 5F9.2-GL, 5F9.2-GL, SEQ ID NO: 45 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, h5F9.5, h5F9.19, h5F9.20 PDLB405 RGM A Light chain variable 5F9.3-GL, 5F9.3-GL, US20150183871 3352 region 5F9.3-GL, 5F9.3-GL, SEQ ID NO: 46 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, h5F9.6, h5F9.21, h5F9.22 PDLB406 RGM A Light chain variable h5F9.5, h5F9.6, h5F9.7, US20150183871 3353 region h5F9.8, h5F9.9, h5F9.10 SEQ ID NO: 48 PDLB407 RGM A Light chain variable h5F9.11, h5F9.19, h5F9.21 US20150183871 3354 region SEQ ID NO: 49 PDLB408 RGM A Light chain variable h5F9.12, h5F9.20, US20150183871 3355 region h5F9.22, h5F9.23, SEQ ID NO: 50 h5F9.25, h5F9.25, h5F9.26 PDLB409 RGM A Light chain variable h5F9.1, h5F9.7, h5F9.23 US20150183871, 3356 region SEQ ID NO: 51 PDLB410 RGM A Light chain variable h5F9.2, h5F9.8, h5F9.25 US20150183871 3357 region SEQ ID NO: 52 PDLB411 RGMa Light chain variable AE12-15 US20140023659 3358 region SEQ ID NO: 103 PDLB412 RGMa Light chain variable AE12-20 US20140023659 3359 region SEQ ID NO: 111 PDLB413 RGMa Light chain variable AE12-21 US20140023659 3360 region SEQ ID NO: 119 PDLB414 RGMa Light chain variable AE12-23 US20140023659 3361 region SEQ ID NO: 127 PDLB415 RGMa Light chain variable AE12-2 US20140023659 3362 region SEQ ID NO: 13 PDLB416 RGMa Light chain variable AE12-24 US20140023659 3363 region SEQ ID NO: 135 PDLB417 RGMa Light chain variable AE12-3 US20140023659 3364 region SEQ ID NO: 21 PDLB418 RGMa Light chain variable AE12-4 US20140023659 3365 region SEQ ID NO: 29 PDLB419 RGMa Light chain variable AE12-5 US20140023659 3366 region SEQ ID NO: 37 PDLB420 RGMa Light chain variable AE12-6 US20140023659 3367 region SEQ ID NO: 45 PDLB421 RGMa Light chain variable AE12-1 US20140023659 3368 region SEQ ID NO: 5 PDLB422 RGMa Light chain variable AE12-7 US20140023659 3369 region SEQ ID NO: 53 PDLB423 RGMa Light chain variable AE12-8 US20140023659 3370 region SEQ ID NO: 61 PDLB424 RGMa Light chain variable AE12-13 US20140023659 3371 region SEQ ID NO: 95 PDLB425 -synuclein Light chain variable Syn-01 WO2014132210 3372 aggregates region SEQ ID NO: 12 PDLB426 -synuclein Light chain variable Syn-F1 WO2014132210 3373 aggregates region SEQ ID NO: 4 PDLB427 -synuclein Light chain variable Syn-F2 WO2014132210 3374 aggregates region SEQ ID NO: 8 PDLB428 NOGO Light chain variable 2A10 construct WO2007003421 3375 region humanized SEQ ID NO: 78 construct L11 PDLB429 NOGO Light chain variable 2A10 construct WO2007003421 3376 region humanized SEQ ID NO: 20 construct L13 PDLB430 NOGO Light chain variable 2A10 construct WO2007003421 3377 region humanized SEQ ID NO: 21 construct L14 PDLB431 NOGO Light chain variable 2A10 construct WO2007003421 3378 region humanized SEQ ID NO: 22 construct L15 PDLB432 NOGO Light chain variable 2A10 construct WO2007003421 3379 region humanized SEQ ID NO: 23 construct L16 PDLB433 NOGO Light chain variable 2A10 construct WO2007003421 3380 region humanized SEQ ID NO: 24 construct L17 PDLB434 NOGO Light chain variable 2A10 construct WO2007003421 3381 region humanized SEQ ID NO: 25 construct L18 PDLB435 NOGO Light chain variable 2A10 construct WO2007003421 3382 region humanized SEQ ID NO: 19 construct L16 PDLB436 alpha synuclein Light chain version Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3383 3 (variable ID NO: 53 region + constant region with arginine) PDLB437 alpha synuclein Light chain version Hu1H7 U.S. Pat. No. 8,790,644 SEQ 3384 3 (variable ID NO: 54 region + constant region without arginine)

    [0288] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the polypeptides that comprise a portion of filamentous bacteriophage gene 3 protein (g3p) sufficient to bind to and/or disaggregate amyloid described in International Publication No. WO2014193935, the contents of which are herein incorporated by reference in their entirety. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the polypeptides described in WO2014193935 may be used to treat, prevent and/or reduce the effects of Parkinson's Disease and/or dementia. As another non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the polypeptides described in WO2014193935 may be used to treat, prevent and/or reduce the effects of Alzheimer's Disease. As another non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the polypeptides described in WO2014193935 may be used to treat, prevent and/or reduce the effects of Huntington's Disease. As another non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the poly peptides described in WO2014193935 may be used to treat, prevent and/or reduce the effects of muscle disease such as, but not limited to, Multiple System Atrophy (MSA), Amyotrophic Lateral Sclerosis (ALS) and Duchenne Muscular Dystrophy (DMD).

    Alzheimer's Disease Antibodies

    [0289] In one embodiment, the payload region ofthe AAV particle comprises one or more nucleic acid sequences encoding one or more of the Alzheimer's Disease payload antibody polypeptides listed in Table 4 (AD1-AD1178; SEQ ID NO: 2948-2970, 2977-2998, 3018-3046, 3056-3076, 3110-3177, 3181-3196, 3205-3226, 3242-3268, 3275-3285, 3315-3371, 3375-3382, 3385-4258).

    TABLE-US-00004 TABLE 4 Alzheimer's Disease Antibodies Antibody Reference SEQ ID No. Target Description Antibody Name Information NO AD1 amyloid consensus M13 g3p, fd g3p, ft US20150376239 2948 proteins sequence g3p SEQ ID NO: 4 AD2 amyloid consensus 12-2 g3p, Ike g3p US20150376239 2949 proteins sequence SEQ ID NO: 7 AD3 A amyloid Consensus WO2006066049 3385 sequence for kappa SEQ ID NO: 14 chain AD4 A amyloid Consensus WO2006066049 3386 sequence for kappa SEQ ID NO: 15 chain AD5 A amyloid Consensus WO2006066049 3387 sequence for kappa SEQ ID NO: 16 chain AD6 A amyloid Consensus WO2006066049 3388 sequence for kappa SEQ ID NO: 17 chain AD7 A amyloid Consensus WO2006066049 3389 sequence for SEQ ID NO: 18 lambda chain AD8 A amyloid Consensus WO2006066049 3390 sequence for SEQ ID NO: 19 lambda chain AD9 A amyloid Consensus WO2006066049 3391 sequence for SEQ ID NO: 20 lambda chain AD10 118-126 of - constant region IgG1 US20150259404 2950 synuclein SEQ ID NO: 38 AD11 beta A4 Fc region Antibody A WO2007068429 3392 peptide/Alpha SEQ ID NO: 6 beta 5 AD12 amyloid Fusion protein M13 g3p US20150376239 2951 proteins SEQ ID NO: 1 AD13 amyloid Fusion protein Construct 5 US20150376239 2952 proteins SEQ ID NO: 11 AD14 amyloid Fusion protein Construct 6 US20150376239 2953 proteins SEQ ID NO: 13 AD15 amyloid Fusion protein fd N2 US20150376239 2954 proteins SEQ ID NO: 14 AD16 amyloid Fusion protein f1 N2 US20150376239 2955 proteins SEQ ID NO: 15 AD17 amyloid Fusion protein M13 N2 US20150376239 2956 proteins SEQ ID NO: 16 AD18 amyloid Fusion protein Ike N2 US20150376239 2957 proteins SEQ ID NO: 17 AD19 amyloid Fusion protein 12-2 N2 US20150376239 2958 proteins SEQ ID NO: 18 AD20 amyloid Fusion protein If1 N2 US20150376239 2959 proteins SEQ ID NO: 19 AD21 amyloid Fusion protein fd g3p US20150376239 2960 proteins SEQ ID NO: 2 AD22 amyloid Fusion protein Construct 3 US20150376239 2961 proteins SEQ ID NO: 20 AD23 amyloid Fusion protein Construct 3m g3p US20150376239 2962 proteins portion SEQ ID NO: 24 AD24 amyloid Fusion protein If1 g3p US20150376239 2963 proteins SEQ ID NO: 29 AD25 amyloid Fusion protein f1 g3p US20150376239 2964 proteins SEQ ID NO: 3 AD26 amyloid Fusion protein fd g3p US20150376239 2965 proteins SEQ ID NO: 30 AD27 amyloid Fusion protein Construct 8, rs-g3p US20150376239 2966 proteins (If1-N1N2)-hlgG1-Fc SEQ ID NO: 31 AD28 amyloid Fusion protein I2-2 g3p US20150376239 2967 proteins SEQ ID NO: 5 AD29 amyloid Fusion protein Ike g3p US20150376239 2968 proteins SEQ ID NO: 6 AD30 amyloid Fusion protein If1 g3p US20150376239 2969 proteins SEQ ID NO: 8 AD31 amyloid Fusion protein Construct 4 US20150376239 2970 proteins SEQ ID NO: 9 AD32 ACTH Heavy chain Ab4 WO2015127288 2995 SEQ ID NO: 121 AD33 ACTH Heavy chain Ab5 WO2015127288 2996 SEQ ID NO: 161 AD34 ACTH Heavy chain Ab6 WO2015127288 2997 SEQ ID NO: 201 AD35 ACTH Heavy chain Ab7 WO2015127288 2977 SEQ ID NO: 241 AD36 ACTH Heavy chain Ab9 WO2015127288 2978 SEQ ID NO: 281 AD37 ACTH Heavy chain Ab10 WO2015127288 2979 SEQ ID NO: 321 AD38 ACTH Heavy chain Ab11 WO2015127288 2980 SEQ ID NO: 361 AD39 ACTH Heavy chain Ab12 WO2015127288 2981 SEQ ID NO: 401 AD40 ACTH Heavy chain Ab2 WO2015127288 2982 SEQ ID NO: 41 AD41 ACTH Heavy chain Ab1.H WO2015127288 2983 SEQ ID NO: 441 AD42 ACTH Heavy chain Ab2.H WO2015127288 2984 SEQ ID NO: 481 AD43 ACTH Heavy chain Ab3.H WO2015127288 2985 SEQ ID NO: 521 AD44 ACTH Heavy chain Ab4.H WO2015127288 2986 SEQ ID NO: 561 AD45 ACTH Heavy chain Ab6.H WO2015127288 2987 SEQ ID NO: 601 AD46 ACTH Heavy chain Ab7.H WO2015127288 2988 SEQ ID NO: 641 AD47 ACTH Heavy chain Ab7A.H WO2015127288 2989 SEQ ID NO: 681 AD48 ACTH Heavy chain Ab10.H WO2015127288 2990 SEQ ID NO: 721 AD49 ACTH Heavy chain Ab11.H WO2015127288 2991 SEQ ID NO: 761 AD50 ACTH Heavy chain Ab11A.H WO2015127288 2992 SEQ ID NO: 801 AD51 ACTH Heavy chain Ab3 WO2015127288 2993 SEQ ID NO: 81 AD52 ACTH Heavy chain Ab12.H WO2015127288 2994 SEQ ID NO: 841 AD53 ACTH Heavy chain Ab1 WO2015127288 2998 SEQ ID NO: 1 AD54 Alpha beta Heavy chain Gantenerumab Immunogenetics 3393 fibril Information System; CHAIN ID NO: 8894_H. AD55 amyloid beta Heavy chain U.S. Pat. No. 719,576 SEQ ID 3394 peptide A NO: 12 AD56 Amyloid Heavy chain 2 Fab of Yw412.8.31 Wang, W. et al A 3395 beta/BACE1 Therapeutic Antibody Targeting BACE1 Inhibits Amyloid. NO:- {beta}Production in Vivo Sci Transl Med 3 (84), 84RA43 (2011), NCBI Accession # 3RIG_H (222aa) AD57 amyloid or Heavy chain Humanized C2 WO2008061796 3396 amyloid-like SEQ ID NO: 4 proteins AD58 amyloid protein Heavy chain C2 US20100150906 3397 SEQ ID NO: 16 AD59 amyloids Heavy chain #118 WO2010012004 3018 SEQ ID NO: 11 AD60 amyloids Heavy chain #121 WO2010012004 3019 SEQ ID NO: 13 AD61 amyloids Heavy chain #204 WO2010012004 3020 SEQ ID NO: 16 AD62 amyloids Heavy chain #205 WO2010012004 3021 SEQ ID NO: 18 AD63 APP Heavy chain F5.100 WO2014151747 3398 SEQ ID NO: 2 AD64 APP Heavy chain BBS1 MAb WO2014151747 3399 SEQ ID NO: 24 AD65 APP Heavy chain F5.87 WO2014151747 3400 SEQ ID NO: 26 AD66 APP Heavy chain F5.87 WO2014151747 3401 SEQ ID NO: 52 AD67 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3402 version 3 ID NO: 11 AD68 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3403 version 4.1 ID NO: 12 AD69 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3404 version 4.2 ID NO: 13 AD70 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3405 version 4.3 ID NO: 14 AD71 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3406 version 4.4 ID NO: 15 AD72 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3407 version 5.1 ID NO: 16 AD73 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3408 version 5.2 ID NO: 17 AD74 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3409 version 5.3 ID NO: 18 AD75 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3410 version 5.4 ID NO: 19 AD76 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3411 version 5.5 ID NO: 20 AD77 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3412 version 5.6 ID NO: 21 AD78 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3413 version 6.1 ID NO: 22 AD79 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3414 version 6.2 ID NO: 23 AD80 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3415 version 6.3 ID NO: 24 AD81 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3416 version 6.4 ID NO: 25 AD82 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3417 version 7 ID NO: 26 AD83 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3418 version 8 ID NO: 27 AD84 A amyloids Heavy chain Humanized 3D6 U.S. Pat. No. 8,784,810 SEQ 3419 (Bapineuzumab), ID NO: 5 version 3 AD85 A amyloids Heavy chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3420 version 2 ID NO: 9 AD86 beta amyloid Heavy chain U.S. Pat. No. 10/476,265 SEQ 3421 ID NO: 20 AD87 beta amyloid Heavy chain (13C3) U.S. Pat. No. 13/319,710 SEQ 3422 ID NO: 2 AD88 beta amyloid Heavy chain U.S. Pat. No. 13/319,710 SEQ 3423 ID NO: 26 AD89 beta amyloid Heavy chain C2 US20070166311 3424 SEQ ID NO: 22 AD90 beta amyloid Heavy chain Solanezumab Immunogenetics 3425 peptide Information System; CHAIN ID NO: 9097_H. AD91 beta amyloid Heavy chain Mature H1 WO2007113172 3426 peptide SEQ ID NO: 34 AD92 beta amyloid Heavy chain Mature H3 WO2007113172 3427 peptide SEQ ID NO: 38 AD93 beta-amyloid Heavy chain Aducanumab, 3428 BIIB0307 AD94 EAG1 Heavy chain chimeric ImAb3 WO2006037604 3022 SEQ ID NO: 12 AD95 EAG1 Heavy chain chimeric ImAb4 WO2006037604 3023 SEQ ID NO: 16 AD96 EAG1 Heavy chain HC-lmAb3-humVH3- WO2006037604 3024 72 SEQ ID NO: 20 AD97 EAG1 Heavy chain HC-lmAb4-humVH4- WO2006037604 3025 59 SEQ ID NO: 24 AD98 EAG1 Heavy chain HC-lmAb3-humVH3 WO2006037604 3026 23 SEQ ID NO: 28 AD99 EAG1 Heavy chain HC-lmAb3-humVH2 WO2006037604 3027 26 SEQ ID NO: 32 AD100 EAG1 Heavy chain HC-lmAb4-humVH1-3 WO2006037604 3028 SEQ ID NO: 36 AD101 EAG1 Heavy chain ImAb4 WO2006037604 3029 SEQ ID NO: 4 AD102 EAG1 Heavy chain ImAb3 WO2006037604 3030 SEQ ID NO: 8 AD103 human beta- Heavy chain Ponezumab, PF- U.S. Pat. No. 7,807,165 SEQ 3429 amyloid 04360365, RN-1219, ID NO: 11 clone 9TL AD104 IGG1 Abeta Heavy chain Humanized C2 US20090155249 3430 SEQ ID NO: 16 AD105 NOGO Heavy chain H6L13 FL US20140147435 3031 SEQ ID NO: 27 AD106 NOGO Heavy chain H16L16 FL, H16L18 US20140147435 3032 FL SEQ ID NO: 31 AD107 NOGO Heavy chain H18L16 FL US20140147435 3033 SEQ ID NO: 33 AD108 NOGO Heavy chain H19L13 FL, H19L16 US20140147435 3034 FL, H19L18 FL SEQ ID NO: 92 AD109 NOGO Heavy chain H20L13 FL, H20L16 US20140147435 3035 FL, H20L18 FL SEQ ID NO: 93 AD110 NOGO Heavy chain H21L13 EL, H21L16 US20140147435 3036 FL, H21L18 FL SEQ ID NO: 94 AD111 NOGO Heavy chain H25L13 FL, H25L16 US20140147435 3037 FL, H25L18 FL SEQ ID NO: 98 AD112 Nogo receptor-1 Heavy chain 5B10 US20090215691 3038 SEQ ID NO: 16 AD113 Nogo receptor-1 Heavy chain 5B10 US20090215691 3039 SEQ ID NO: 18 AD114 PrPC and/or Heavy chain US20150166668 3431 PrPSc SEQ ID NO: 10 AD115 PrPC and/or Heavy chain U.S. Pat. No. 8,852,587 SEQ 3432 PrPSc ID NO: 4 AD116 tau Heavy chain VH antibody US20150252102 3433 SEQ ID NO: 93 AD117 tau Heavy chain hACl-36-3A8 Ab1 WO2013151762 3434 SEQ ID NO: 24 AD118 tau Heavy chain hACl-36-3B8 Ab1 WO2013151762 3435 SEQ ID NO: 25 AD119 tau Heavy chain hACl-36-3A8 Ab1.v2 WO2013151762 3436 SEQ ID NO: 26 AD120 tau Heavy chain hACl-36-3A8 Ab1.v3 WO2013151762 3437 SEQ ID NO: 27 AD121 tau Heavy chain hACl-36-3A8 Ab1.v4 WO2013151762 3438 SEQ ID NO: 28 AD122 tau Heavy chain hACl-36-3B8 Ab1.v2 WO2013151762 3439 SEQ ID NO: 29 AD123 tau Heavy chain hACl-36-3B8 Ab1.v3 WO2013151762 3440 SEQ ID NO: 30 AD124 tau Heavy chain hACl-36-3B8 Ab1.v4 WO2013151762 3441 SEQ ID NO: 31 AD125 tau Heavy chain IPN001 U.S. Pat. No. 8,980,271 SEQ 3442 ID NO: 14 AD126 tau Heavy chain IPN002 U.S. Pat. No. 8,980,271 SEQ 3443 ID NO: 16 AD127 tau Heavy chain ACl-36-3A8-Ab1 and US20150175682 3444 hACl-36-2B6-Ab1 SEQ ID NO: 16 AD128 tau Heavy chain hACl-36-3A8-Ab1 US20150175682 3445 and hACl-36-2B6-Ab1 SEQ ID NO: 17 AD129 tau Heavy chain hACl-36-2B6-Ab1 US20150175682 3446 (IgG4) SEQ ID NO: 25 AD130 tau Heavy chain hACl-36-3A8-Ab1.v2 US20150175682 3447 (IgG4) SEQ ID NO: 26 AD131 tau Heavy chain hACl-36-3A8-Ab1.v3 US20150175682 3448 (IgG1) SEQ ID NO: 27 AD132 tau Heavy chain hACl-36-3A8-Ab1.v4 US20150175682 3449 (IgG1 N297G) SEQ ID NO: 28 AD133 tau Heavy chain hACl-36-2B6-Ab1.v2 US20150175682 3450 (IgG4) SEQ ID NO: 29 AD134 tau Heavy chain hACl-36-2B6-Ab1.v3 US20150175682 3451 (IgG1) SEQ ID NO: 30 AD135 tau Heavy chain hACl-36-2B6-Ab1.v4 US20150175682 3452 (IgG1 N297G) SEQ ID NO: 31 AD136 TrkA Heavy chain BXhVH1 WO2009098238 3453 SEQ ID NO: 1 AD137 TrkA Heavy chain mVHEP WO2009098238 3454 SEQ ID NO: 15 AD138 TrkA Heavy chain BXhVH2 WO2009098238 3455 SEQ ID NO: 2 AD139 TrkA Heavy chain BXhVH3 WO2009098238 3456 SEQ ID NO: 3 AD140 TrkA Heavy chain BXhVH4 WO2009098238 3457 SEQ ID NO: 4 AD141 TrkA Heavy chain BXhVH5 WO2009098238 3458 SEQ ID NO: 5 AD142 TrkA Heavy chain HUVHWOV WO2009098238 3459 SEQ ID NO: 6 AD143 trk-C (NT-3 Heavy chain 2250 U.S. Pat. No. 7,615,383 SEQ 3040 trkC ligand) ID NO: 42 AD144 trk-C (NT-3 Heavy chain 2253 U.S. Pat. No. 7,615,383 SEQ 3041 trkC ligand) ID NO: 43 AD145 trk-C (NT-3 Heavy chain 2256 U.S. Pat. No. 7,615,383 SEQ 3042 trkC ligand) ID NO: 44 AD146 trk-C (NT-3 Heavy chain 6.1.2 U.S. Pat. No. 7,615,383 SEQ 3043 trkC ligand) ID NO: 45 AD147 trk-C (NT-3 Heavy chain 6.4.1 U.S. Pat. No. 7,615,383 SEQ 3044 trkC ligand) ID NO: 46 AD148 trk-C (NT-3 Heavy chain 2345 U.S. Pat. No. 7,615,383 SEQ 3045 trkC ligand) ID NO: 47 AD149 trk-C (NT-3 Heavy chain 2349 U.S. Pat. No. 7,615,383 SEQ 3046 trkC ligand) ID NO: 48 AD150 Heavy chain Crenezuma heavy 3460 CHAIN AD151 Heavy chain Gantenerumab heavy 3461 chain AD152 Heavy chain Ponezumab heavy 3462 CHAIN AD153 Heavy chain Solanezumab heavy 3463 CHAIN AD154 A amyloid Heavy chain WO2006066049 3464 consensus SEQ ID NO: 21 sequence AD155 A amyloid Heavy chain WO2006066049 3465 consensus SEQ ID NO: 22 sequence AD156 A amyloid Heavy chain WO2006066049 3466 consensus SEQ ID NO: 23 sequence AD157 A amyloid Heavy chain WO2006066049 3467 consensus SEQ ID NO: 24 sequence AD158 A amyloid Heavy chain WO2006066049 3468 consensus SEQ ID NO: 25 sequence AD159 A amyloid Heavy chain WO2006066049 3469 consensus SEQ ID NO: 26 sequence AD160 A amyloid Heavy chain WO2006066049 3470 consensus SEQ ID NO: 27 sequence AD161 BACE1 Heavy chain Nanobody B1 WO2009121948 3471 variable SEQ ID NO: 1 (nanobody) AD162 BACE10 Heavy chain Nanobody B15 WO2009121948 3472 variable SEQ ID NO: 10 (nanobody) AD163 BACE11 Heavy chain Nanobody B16 WO2009121948 3473 variable SEQ ID NO: 11 (nanobody) AD164 BACE12 Heavy chain Nanobody B21 WO2009121948 3474 variable SEQ ID NO: 12 (nanobody) AD165 BACE13 Heavy chain Nanobody B25 WO2009121948 3475 variable SEQ ID NO: 13 (nanobody) AD166 BACE14 Heavy chain Nanobody B26 WO2009121948 3476 variable SEQ ID NO: 14 (nanobody) AD167 BACE15 Heavy chain Nanobody 1B3 WO2009121948 3477 variable SEQ ID NO: 15 (nanobody) AD168 BACE16 Heavy chain Nanobody 10C2 WO2009121948 3478 variable SEQ ID NO: 16 (nanobody) AD169 BACE17 Heavy chain Nanobody 12B6 WO2009121948 3479 variable SEQ ID NO: 17 (nanobody) AD170 BACE18 Heavy chain Nanobody 10B5 WO2009121948 3480 variable SEQ ID NO: 18 (nanobody) AD171 BACE19 Heavy chain Nanobody 13A5 WO2009121948 3481 variable SEQ ID NO: 19 (nanobody) AD172 BACE2 Heavy chain Nanobody B2 WO2009121948 3482 variable SEQ ID NO: 2 (nanobody) AD173 BACE20 Heavy chain Nanobody 2C6 WO2009121948 3483 variable SEQ ID NO: 20 (nanobody) AD174 BACE21 Heavy chain Nanobody 6A4 WO2009121948 3484 variable SEQ ID NO: 21 (nanobody) AD175 BACE22 Heavy chain Nanobody 10C4 WO2009121948 3485 variable SEQ ID NO: 22 (nanobody) AD176 BACE23 Heavy chain Nanobody 13B6 WO2009121948 3486 variable SEQ ID NO: 23 (nanobody) AD177 BACE24 Heavy chain Nanobody 1A4 WO2009121948 3487 variable SEQ ID NO: 24 (nanobody) AD178 BACE25 Heavy chain Nanobody 2B6 WO2009121948 3488 variable SEQ ID NO: 25 (nanobody) AD179 BACE26 Heavy chain Nanobody 4A2 WO2009121948 3489 variable SEQ ID NO: 26 (nanobody) AD180 BACE27 Heavy chain Nanobody 1 D4 WO2009121948 3490 variable SEQ ID NO: 27 (nanobody) AD181 BACE28 Heavy chain Nanobody 9D3 WO2009121948 3491 variable SEQ ID NO: 28 (nanobody) AD182 BACE3 Heavy chain Nanobody B3 WO2009121948 3492 variable SEQ ID NO: 3 (nanobody) AD183 BACE4 Heavy chain Nanobody B5 WO2009121948 3493 variable SEQ ID NO: 4 (nanobody) AD184 BACE5 Heavy chain Nanobody B8 WO2009121948 3494 variable SEQ ID NO: 5 (nanobody) AD185 BACE6 Heavy chain Nanobody B9 WO2009121948 3495 variable SEQ ID NO: 6 (nanobody) AD186 BACE7 Heavy chain Nanobody B10 WO2009121948 3496 variable SEQ ID NO: 7 (nanobody) AD187 BACE8 Heavy chain Nanobody B11 WO2009121948 3497 variable SEQ ID NO: 8 (nanobody) AD188 BACE9 Heavy chain Nanobody B12 WO2009121948 3498 variable SEQ ID NO: 9 (nanobody) AD189 amyloid protein Heavy chain IG GAMMA-4 US20100150906 3499 constant region CHAIN C REGION SEQ ID NO: 17 modified AD190 tau Heavy chain hACl-36-3A8-Ab1 US20150175682 3500 constant region and hACl-36-2B6-Ab1 SEQ ID NO: 14 AD191 ApoE Heavy chain 2e8 Fab Trakhanov, S. et al. 3501 fragment Structure of a monoclonal 2E8 Fab antibody fragment specific for the low-density lipoprotein- receptor binding region of apolipoprotein E refined at 1.9 A, Acta Crystallogr. D Biol. Crystallogr. 55 (PT 1), 122-128 (1999), NCBI Accession # 12E8 P AD192 many-growth Heavy chain fusion H19L13, H19L16, U.S. Pat. No. 8,053,569 SEQ 3056 factors protein H19L18, H19L14, ID NO: 25 H19L15, H19L17, H19L6, H19L11 AD193 many-growth Heavy chain fusion H20L13, H20L16, U.S. Pat. No. 8,053,569 SEQ 3057 factors protein H20L18, H20L14, ID NO: 28 H20L15, H20L17, H20L6, H20L11 AD194 many-growth Heavy chain fusion H22L13, H22L16, U.S. Pat. No. 8,053,569 SEQ 3058 factors protein H22L18, H22L14, ID NO: 34 H22L15, H22L17, H22L6, H22L11 AD195 many-growth Heavy chain fusion H5L11, H6L11, U.S. Pat. No. 8,053,569 SEQ 3059 factors protein H14L11, H15L11, ID NO: 24 H16L11, H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 AD196 NOGO Heavy chain 2A10 construct WO2007003421 3060 humanized SEQ ID NO: 79 construct H1 AD197 NOGO Heavy chain 2A10 construct WO2007003421 3061 humanized SEQ ID NO: 29 construct H14 AD198 NOGO Heavy chain 2A10 construct WO2007003421 3062 humanized SEQ ID NO: 30 construct H15 AD199 NOGO Heavy chain 2A10 construct WO2007003421 3063 humanized SEQ ID NO: 31 construct H16 AD200 NOGO Heavy chain 2A10 construct WO2007003421 3064 humanized SEQ ID NO: 32 construct H17 AD201 NOGO Heavy chain 2A10 construct WO2007003421 3065 humanized SEQ ID NO: 33 construct H18 AD202 NOGO Heavy chain 2A10 construct WO2007003421 3066 humanized SEQ ID NO: 92 construct H19 AD203 NOGO Heavy chain 2A10 construct WO2007003421 3067 humanized SEQ ID NO: 93 construct H20 AD204 NOGO Heavy chain 2A10 construct WO2007003421 3068 humanized SEQ ID NO: 94 construct H21 AD205 NOGO Heavy chain 2A10 construct WO2007003421 3069 humanized SEQ ID NO: 95 construct H22 AD206 NOGO Heavy chain 2A10 construct WO2007003421 3070 humanized SEQ ID NO: 96 construct H23 AD207 NOGO Heavy chain 2A10 construct WO2007003421 3071 humanized SEQ ID NO: 97 construct H24 AD208 NOGO Heavy chain 2A10 construct WO2007003421 3072 humanized SEQ ID NO: 98 construct H25 AD209 NOGO Heavy chain 2A10 construct WO2007003421 3073 humanized SEQ ID NO: 26 construct H5 AD210 NOGO Heavy chain 2A10 construct WO2007003421 3074 humanized SEQ ID NO: 27 construct H6 AD211 NOGO Heavy chain 2A10 construct WO2007003421 3075 humanized SEQ ID NO: 28 construct H700 AD212 RTN4 (NOGO) Heavy chain IgG4, Atinumab U.S. Pat. No. 8,163,285 SEQ 3076 immunomodultator ID NO: 24 AD213 tau Heavy chain ch4E4 US20150252102 3502 mature SEQ ID NO: 20 AD214 tau Heavy chain ch4E4(N30Q) US20150252102 3503 mature SEQ ID NO: 22 AD215 A beta Heavy chain IR-072 U.S. Pat. No. 8,858,949 SEQ 3504 oligomers variable region ID NO: 1010 AD216 A beta Heavy chain IR-011 U.S. Pat. No. 8,858,949 SEQ 3505 oligomers variable region ID NO: 114 AD217 A beta Heavy chain IR-030 U.S. Pat. No. 8,858,949 SEQ 3506 oligomers variable region ID NO: 370 AD218 A beta Heavy chain IR-031 U.S. Pat. No. 8,858,949 SEQ 3507 oligomers variable region ID NO: 386 AD219 A beta Heavy chain IR-032 U.S. Pat. No. 8,858,949 SEQ 3508 oligomers variable region ID NO: 402 AD220 A beta Heavy chain IR-033 U.S. Pat. No. 8,858,949 SEQ 3509 oligomers variable region ID NO: 418 AD221 A beta Heavy chain IR-034 U.S. Pat. No. 8,858,949 SEQ 3510 oligomers variable region ID NO: 434 AD222 A beta Heavy chain IR-035 U.S. Pat. No. 8,858,949 SEQ 3511 oligomers variable region ID NO: 450 AD223 A beta Heavy chain IR-036 U.S. Pat. No. 8,858,949 SEQ 3512 oligomers variable region ID NO: 466 AD224 A beta Heavy chain IR-037 U.S. Pat. No. 8,858,949 SEQ 3513 oligomers variable region ID NO: 482 AD225 A beta Heavy chain IR-038 U.S. Pat. No. 8,858,949 SEQ 3514 oligomers variable region ID NO: 498 AD226 A beta Heavy chain IR-005 U.S. Pat. No. 8,858,949 SEQ 3515 oligomers variable region ID NO: 50 AD227 A beta Heavy chain IR-081 U.S. Pat. No. 8,858,949 SEQ 3516 oligomers variable region ID NO: 1154 AD228 A beta Heavy chain IR-039 U.S. Pat. No. 8,858,949 SEQ 3517 oligomers variable region ID NO: 514 AD229 A beta Heavy chain IR-040 U.S. Pat. No. 8,858,949 SEQ 3518 oligomers variable region ID NO: 530 AD230 A beta Heavy chain IR-041 U.S. Pat. No. 8,858,949 SEQ 3519 oligomers variable region ID NO: 546 AD231 A beta Heavy chain IR-043 U.S. Pat. No. 8,858,949 SEQ 3520 oligomers variable region ID NO: 562 AD232 A beta Heavy chain IR-044 U.S. Pat. No. 8,858,949 SEQ 3521 oligomers variable region ID NO: 578 AD233 A beta Heavy chain IR-045 U.S. Pat. No. 8,858,949 SEQ 3522 oligomers variable region ID NO: 594 AD234 A beta Heavy chain IR-046 U.S. Pat. No. 8,858,949 SEQ 3523 oligomers variable region ID NO: 610 AD235 A beta Heavy chain IR-048 U.S. Pat. No. 8,858,949 SEQ 3524 oligomers variable region ID NO: 626 AD236 A beta Heavy chain IR-049 U.S. Pat. No. 8,858,949 SEQ 3525 oligomers variable region ID NO: 642 AD237 A beta Heavy chain IR-050 U.S. Pat. No. 8,858,949 SEQ 3526 oligomers variable region ID NO: 658 AD238 A beta Heavy chain IR-082 U.S. Pat. No. 8,858,949 SEQ 3527 oligomers variable region ID NO: 1170 AD239 A beta Heavy chain IR-006 U.S. Pat. No. 8,858,949 SEQ 3528 oligomers variable region ID NO: 66 AD240 A beta Heavy chain IR-051 U.S. Pat. No. 8,858,949 SEQ 3529 oligomers variable region ID NO: 674 AD241 A beta Heavy chain IR-052 U.S. Pat. No. 8,858,949 SEQ 3530 oligomers variable region ID NO: 690 AD242 A beta Heavy chain IR-053 U.S. Pat. No. 8,858,949 SEQ 3531 oligomers variable region ID NO: 706 AD243 A beta Heavy chain IR-054 U.S. Pat. No. 8,858,949 SEQ 3532 oligomers variable region ID NO: 722 AD244 A beta Heavy chain IR-055 U.S. Pat. No. 8,858,949 SEQ 3533 oligomers variable region ID NO: 738 AD245 A beta Heavy chain IR-056 U.S. Pat. No. 8,858,949 SEQ 3534 oligomers variable region ID NO: 754 AD246 A beta Heavy chain IR-057 U.S. Pat. No. 8,858,949 SEQ 3535 oligomers variable region ID NO: 770 AD247 A beta Heavy chain IR-058 U.S. Pat. No. 8,858,949 SEQ 3536 oligomers variable region ID NO: 786 AD248 A beta Heavy chain IR-059 U.S. Pat. No. 8,858,949 SEQ 3537 oligomers variable region ID NO: 802 AD249 A beta Heavy chain IR-083 U.S. Pat. No. 8,858,949 SEQ 3538 oligomers variable region ID NO: 1186 AD250 A beta Heavy chain IR-060 U.S. Pat. No. 8,858,949 SEQ 3539 oligomers variable region ID NO: 818 AD251 A beta Heavy chain IR-007 U.S. Pat. No. 8,858,949 SEQ 3540 oligomers variable region ID NO: 82 AD252 A beta Heavy chain IR-061 U.S. Pat. No. 8,858,949 SEQ 3541 oligomers variable region ID NO: 834 AD253 A beta Heavy chain IR-062 U.S. Pat. No. 8,858,949 SEQ 3542 oligomers variable region ID NO: 850 AD254 A beta Heavy chain IR-063 U.S. Pat. No. 8,858,949 SEQ 3543 oligomers variable region ID NO: 866 AD255 A beta Heavy chain IR-064 U.S. Pat. No. 8,858,949 SEQ 3544 oligomers variable region ID NO: 882 AD256 A beta Heavy chain IR-065 U.S. Pat. No. 8,858,949 SEQ 3545 oligomers variable region ID NO: 898 AD257 A beta Heavy chain IR-066 U.S. Pat. No. 8,858,949 SEQ 3546 oligomers variable region ID NO: 914 AD258 A beta Heavy chain IR-067 U.S. Pat. No. 8,858,949 SEQ 3547 oligomers variable region ID NO: 930 AD259 A beta Heavy chain IR-068 U.S. Pat. No. 8,858,949 SEQ 3548 oligomers variable region ID NO: 946 AD260 A beta Heavy chain IR-084 U.S. Pat. No. 8,858,949 SEQ 3549 oligomers variable region ID NO: 1202 AD261 A beta Heavy chain IR-069 U.S. Pat. No. 8,858,949 SEQ 3550 oligomers variable region ID NO: 962 AD262 A beta Heavy chain IR-070 U.S. Pat. No. 8,858,949 SEQ 3551 oligomers variable region ID NO: 978 AD263 A beta Heavy chain IR-008 U.S. Pat. No. 8,858,949 SEQ 3552 oligomers variable region ID NO: 98 AD264 A beta Heavy chain IR-071 U.S. Pat. No. 8,858,949 SEQ 3553 oligomers variable region ID NO: 994 AD265 A beta Heavy chain IR-001 U.S. Pat. No. 8,858,949 SEQ 3554 oligomers variable region ID NO: 2 AD266 A beta Heavy chain IR-161 U.S. Pat. No. 8,858,949 SEQ 3555 oligomers variable region ID NO: 2878 AD267 A beta Heavy chain IR-085 U.S. Pat. No. 8,858,949 SEQ 3556 oligomers variable region ID NO: 1218 AD268 A beta Heavy chain IR-086 U.S. Pat. No. 8,858,949 SEQ 3557 oligomers variable region ID NO: 1234 AD269 A beta Heavy chain IR-087 U.S. Pat. No. 8,858,949 SEQ 3558 oligomers variable region ID NO: 1250 AD270 A beta Heavy chain IR-088 U.S. Pat. No. 8,858,949 SEQ 3559 oligomers variable region ID NO: 1266 AD271 A beta Heavy chain IR-089 U.S. Pat. No. 8,858,949 SEQ 3560 oligomers variable region ID NO: 1282 AD272 A beta Heavy chain IR-073 U.S. Pat. No. 8,858,949 SEQ 3561 oligomers variable region ID NO: 1026 AD273 A beta Heavy chain IR-090 U.S. Pat. No. 8,858,949 SEQ 3562 oligomers variable region ID NO: 1298 AD274 A beta Heavy chain IR-012 U.S. Pat. No. 8,858,949 SEQ 3563 oligomers variable region ID NO: 130 AD275 A beta Heavy chain IR-092 U.S. Pat. No. 8,858,949 SEQ 3564 oligomers variable region ID NO: 1314 AD276 A beta Heavy chain IR-093 U.S. Pat. No. 8,858,949 SEQ 3565 oligomers variable region ID NO: 1330 AD277 A beta Heavy chain IR-094 U.S. Pat. No. 8,858,949 SEQ 3566 oligomers variable region ID NO: 1346 AD278 A beta Heavy chain IR-095 U.S. Pat. No. 8,858,949 SEQ 3567 oligomers variable region ID NO: 1362 AD279 A beta Heavy chain IR-097 U.S. Pat. No. 8,858,949 SEQ 3568 oligomers variable region ID NO: 1378 AD280 A beta Heavy chain IR-098 U.S. Pat. No. 8,858,949 SEQ 3569 oligomers variable region ID NO: 1394 AD281 A beta Heavy chain IR-100 U.S. Pat. No. 8,858,949 SEQ 3570 oligomers variable region ID NO: 1410 AD282 A beta Heavy chain IR-101 U.S. Pat. No. 8,858,949 SEQ 3571 oligomers variable region ID NO: 1426 AD283 A beta Heavy chain IR-074 U.S. Pat. No. 8,858,949 SEQ 3572 oligomers variable region ID NO: 1042 AD284 A beta Heavy chain IR-102 U.S. Pat. No. 8,858,949 SEQ 3573 oligomers variable region ID NO: 1442 AD285 A beta Heavy chain IR-104 U.S. Pat. No. 8,858,949 SEQ 3574 oligomers variable region ID NO: 1458 AD286 A beta Heavy chain IR-013 U.S. Pat. No. 8,858,949 SEQ 3575 oligomers variable region ID NO: 146 AD287 A beta Heavy chain IR-105 U.S. Pat. No. 8,858,949 SEQ 3576 oligomers variable region ID NO: 1474 AD288 A beta Heavy chain IR-106 U.S. Pat. No. 8,858,949 SEQ 3577 oligomers variable region ID NO: 1490 AD289 A beta Heavy chain IR-107 U.S. Pat. No. 8,858,949 SEQ 3578 oligomers variable region ID NO: 1506 AD290 A beta Heavy chain IR-108 U.S. Pat. No. 8,858,949 SEQ 3579 oligomers variable region ID NO: 1522 AD291 A beta Heavy chain IR-109 U.S. Pat. No. 8,858,949 SEQ 3580 oligomers variable region ID NO: 1538 AD292 A beta Heavy chain IR-110 U.S. Pat. No. 8,858,949 SEQ 3581 oligomers variable region ID NO: 1554 AD293 A beta Heavy chain IR-112 U.S. Pat. No. 8,858,949 SEQ 3582 oligomers variable region ID NO: 1570 AD294 A beta Heavy chain IR-075 U.S. Pat. No. 8,858,949 SEQ 3583 oligomers variable region ID NO: 1058 AD295 A beta Heavy chain IR-114 U.S. Pat. No. 8,858,949 SEQ 3584 oligomers variable region ID NO: 1586 AD296 A beta Heavy chain IR-115 U.S. Pat. No. 8,858,949 SEQ 3585 oligomers variable region ID NO: 1602 AD297 A beta Heavy chain IR-116 U.S. Pat. No. 8,858,949 SEQ 3586 oligomers variable region ID NO: 1618 AD298 A beta Heavy chain IR-014 U.S. Pat. No. 8,858,949 SEQ 3587 oligomers variable region ID NO: 162 AD299 A beta Heavy chain IR-117 U.S. Pat. No. 8,858,949 SEQ 3588 oligomers variable region ID NO: 1634 AD300 A beta Heavy chain IR-118 U.S. Pat. No. 8,858,949 SEQ 3589 oligomers variable region ID NO: 1650 AD301 A beta Heavy chain IR-119 U.S. Pat. No. 8,858,949 SEQ 3590 oligomers variable region ID NO: 1666 AD302 A beta Heavy chain IR-120 U.S. Pat. No. 8,858,949 SEQ 3591 oligomers variable region ID NO: 1682 AD303 A beta Heavy chain IR-121 U.S. Pat. No. 8,858,949 SEQ 3592 oligomers variable region ID NO: 1698 AD304 A beta Heavy chain IR-122 U.S. Pat. No. 8,858,949 SEQ 3593 oligomers variable region ID NO: 1714 AD305 A beta Heavy chain IR-076 U.S. Pat. No. 8,858,949 SEQ 3594 oligomers variable region ID NO: 1074 AD306 A beta Heavy chain IR-123 U.S. Pat. No. 8,858,949 SEQ 3595 oligomers variable region ID NO: 1730 AD307 A beta Heavy chain IR-124 U.S. Pat. No. 8,858,949 SEQ 3596 oligomers variable region ID NO: 1746 AD308 A beta Heavy chain IR-125 U.S. Pat. No. 8,858,949 SEQ 3597 oligomers variable region ID NO: 1762 AD309 A beta Heavy chain IR-126 U.S. Pat. No. 8,858,949 SEQ 3598 oligomers variable region ID NO: 1778 AD310 A beta Heavy chain IR-015 U.S. Pat. No. 8,858,949 SEQ 3599 oligomers variable region ID NO: 178 AD311 A beta Heavy chain IR-127 U.S. Pat. No. 8,858,949 SEQ 3600 oligomers variable region ID NO: 1794 AD312 A beta Heavy chain IR-002 U.S. Pat. No. 8,858,949 SEQ 3601 oligomers variable region ID NO: 18 AD313 A beta Heavy chain IR-128 U.S. Pat. No. 8,858,949 SEQ 3602 oligomers variable region ID NO: 1810 AD314 A beta Heavy chain IR-129 U.S. Pat. No. 8,858,949 SEQ 3603 oligomers variable region ID NO: 1826 AD315 A beta Heavy chain IR-131 U.S. Pat. No. 8,858,949 SEQ 3604 oligomers variable region ID NO: 1842 AD316 A beta Heavy chain IR-077 U.S. Pat. No. 8,858,949 SEQ 3605 oligomers variable region ID NO: 1090 AD317 A beta Heavy chain IR-132 U.S. Pat. No. 8,858,949 SEQ 3606 oligomers variable region ID NO: 1858 AD318 A beta Heavy chain IR-133 U.S. Pat. No. 8,858,949 SEQ 3607 oligomers variable region ID NO: 1874 AD319 A beta Heavy chain IR-134 U.S. Pat. No. 8,858,949 SEQ 3608 oligomers variable region ID NO: 1890 AD320 A beta Heavy chain IR-135 U.S. Pat. No. 8,858,949 SEQ 3609 oligomers variable region ID NO: 1906 AD321 A beta Heavy chain IR-136 U.S. Pat. No. 8,858,949 SEQ 3610 oligomers variable region ID NO: 1922 AD322 A beta Heavy chain IR-137 U.S. Pat. No. 8,858,949 SEQ 3611 oligomers variable region ID NO: 1938 AD323 A beta Heavy chain IR-017 U.S. Pat. No. 8,858,949 SEQ 3612 oligomers variable region ID NO: 194 AD324 A beta Heavy chain IR-138 U.S. Pat. No. 8,858,949 SEQ 3613 oligomers variable region ID NO: 1954 AD325 A beta Heavy chain IR-139 U.S. Pat. No. 8,858,949 SEQ 3614 oligomers variable region ID NO: 1970 AD326 A beta Heavy chain IR-140 U.S. Pat. No. 8,858,949 SEQ 3615 oligomers variable region ID NO: 1986 AD327 A beta Heavy chain IR-078 U.S. Pat. No. 8,858,949 SEQ 3616 oligomers variable region ID NO: 1106 AD328 A beta Heavy chain IR-141 U.S. Pat. No. 8,858,949 SEQ 3617 oligomers variable region ID NO: 2002 AD329 A beta Heavy chain IR-142 U.S. Pat. No. 8,858,949 SEQ 3618 oligomers variable region ID NO: 2018 AD330 A beta Heavy chain IR-143 U.S. Pat. No. 8,858,949 SEQ 3619 oligomers variable region ID NO: 2034 AD331 A beta Heavy chain IR-144 U.S. Pat. No. 8,858,949 SEQ 3620 oligomers variable region ID NO: 2050 AD332 A beta Heavy chain IR-145 U.S. Pat. No. 8,858,949 SEQ 3621 oligomers variable region ID NO: 2066 AD333 A beta Heavy chain IR-146 U.S. Pat. No. 8,858,949 SEQ 3622 oligomers variable region ID NO: 2082 AD334 A beta Heavy chain IR-147 U.S. Pat. No. 8,858,949 SEQ 3623 oligomers variable region ID NO: 2098 AD335 A beta Heavy chain IR-020 U.S. Pat. No. 8,858,949 SEQ 3624 oligomers variable region ID NO: 210 AD336 A beta Heavy chain IR-149 U.S. Pat. No. 8,858,949 SEQ 3625 oligomers variable region ID NO: 2114 AD337 A beta Heavy chain IR-150 U.S. Pat. No. 8,858,949 SEQ 3626 oligomers variable region NO: 2130 AD338 A beta Heavy chain IR-079 U.S. Pat. No. 8,858,949 SEQ 3627 oligomers variable region ID NO: 1122 AD339 A beta Heavy chain IR-151 U.S. Pat. No. 8,858,949 SEQ 3628 oligomers variable region ID NO: 2146 AD340 A beta Heavy chain IR-152 U.S. Pat. No. 8,858,949 SEQ 3629 oligomers variable region ID NO: 2162 AD341 A beta Heavy chain IR-153 U.S. Pat. No. 8,858,949 SEQ 3630 oligomers variable region ID NO: 2178 AD342 A beta Heavy chain IR-154 U.S. Pat. No. 8,858,949 SEQ 3631 oligomers variable region ID NO: 2194 AD343 A beta Heavy chain IR-155 U.S. Pat. No. 8,858,949 SEQ 3632 oligomers variable region ID NO: 2210 AD344 A beta Heavy chain IR-156 U.S. Pat. No. 8,858,949 SEQ 3633 oligomers variable region ID NO: 2226 AD345 A beta Heavy chain IR-157 U.S. Pat. No. 8,858,949 SEQ 3634 oligomers variable region ID NO: 2242 AD346 A beta Heavy chain IR-158 U.S. Pat. No. 8,858,949 SEQ 3635 oligomers variable region ID NO: 2258 AD347 A beta Heavy chain IR-021 U.S. Pat. No. 8,858,949 SEQ 3636 oligomers variable region ID NO: 226 AD348 A beta Heavy chain IR-159 U.S. Pat. No. 8,858,949 SEQ 3637 oligomers variable region ID NO: 2274 AD349 A beta Heavy chain IR-080 U.S. Pat. No. 8,858,949 SEQ 3638 oligomers variable region ID NO: 1138 AD350 A beta Heavy chain IR-022 U.S. Pat. No. 8,858,949 SEQ 3639 oligomers variable region ID NO: 242 AD351 A beta Heavy chain IR-023 U.S. Pat. No. 8,858,949 SEQ 3640 oligomers variable region ID NO: 258 AD352 A beta Heavy chain IR-024 U.S. Pat. No. 8,858,949 SEQ 3641 oligomers variable region ID NO: 274 AD353 A beta Heavy chain IR-160 U.S. Pat. No. 8,858,949 SEQ 3642 oligomers variable region ID NO: 2862 AD354 A beta Heavy chain IR-025 U.S. Pat. No. 8,858,949 SEQ 3643 oligomers variable region ID NO: 290 AD355 A beta Heavy chain IR-026 U.S. Pat. No. 8,858,949 SEQ 3644 oligomers variable region ID NO: 306 AD356 A beta Heavy chain IR-027 U.S. Pat. No. 8,858,949 SEQ 3645 oligomers variable region ID NO: 322 AD357 A beta Heavy chain IR-028 U.S. Pat. No. 8,858,949 SEQ 3646 oligomers variable region ID NO: 338 AD358 A beta Heavy chain IR-004 U.S. Pat. No. 8,858,949 SEQ 3647 oligomers variable region ID NO: 34 AD359 A beta Heavy chain IR-029 U.S. Pat. No. 8,858,949 SEQ 3648 oligomers variable region ID NO: 354 AD360 AB (1-42) Heavy chain 8F5 hum8 VL US20090232801 3649 Globulomer variable region SEQ ID NO: 1 AD361 AB (1-42) Heavy chain Hu8F5VHv1 US20090232801 3650 Globulomer variable region SEQ ID NO: 101 AD362 AB (1-42) Heavy chain Hu8F5VHv2 US20090232801 3651 Globulomer variable region SEQ ID NO: 102 AD363 AB (1-42) Heavy chain Hu8F5VHv1 US20090232801 3652 Globulomer variable region SEQ ID NO: 108 AD364 AB (1-42) Heavy chain Hu8F5VHv2 US20090232801 3653 Globulomer variable region SEQ ID NO: 110 AD365 AB (20-42) Heavy chain VH 5F7hum8 US20090175847 3654 Globulomer variable region SEQ ID NO: 1 AD366 AB (20-42) Heavy chain VH 7C6hum7 US20090175847 3655 Globulomer variable region SEQ ID NO: 3 AD367 ADDL Heavy chain WO2007050359 3656 variable region SEQ ID NO: 108 AD368 ADDL Heavy chain WO2007050359 3657 variable region SEQ ID NO: 138 AD369 amyloid beta Heavy chain U.S. Pat. No. 719,576 SEQ ID 3658 peptide A variable region NO: 10 AD370 amyloid beta Heavy chain U.S. Pat. No. 719,576 SEQ ID 3659 peptide A variable region NO: 8 AD371 amyloid Heavy chain F11G3 U.S. Pat. No. 9,125,846 SEQ 3110 oligomers variable region ID NO: 11 AD372 amyloid or Heavy chain Humanized C2 HIV WO2008061796 3660 amyloid-like variable region AF 4 SEQ ID NO: 3 proteins AD373 amyloid protein Heavy chain C2 HIV AF 4 US20100150906 3661 (IGG1 Abeta) variable region SEQ ID NO: 15 AD374 amyloid Heavy chain Fv1E1 U.S. Pat. No. 8,222,002 SEQ 3662 peptide variable region ID NO: 1 AD375 amyloid Heavy chain VLA2 U.S. Pat. No. 8,222,002 SEQ 3663 peptide variable region ID NO: 101 AD376 amyloid Heavy chain Fv1E4 U.S. Pat. No. 8,222,002 SEQ 3664 peptide variable region ID NO: 11 AD377 amyloid Heavy chain Fv1E7 U.S. Pat. No. 8,222,002 SEQ 3665 peptide variable region ID NO: 21 AD378 amyloid Heavy chain Fv2A7 U.S. Pat. No. 8,222,002 SEQ 3666 peptide variable region ID NO: 31 AD379 amyloid Heavy chain Fv2A8 U.S. Pat. No. 8,222,002 SEQ 3667 peptide variable region ID NO: 41 AD380 amyloid Heavy chain Fv2B6 U.S. Pat. No. 8,222,002 SEQ 3668 peptide variable region ID NO: 51 AD381 amyloid Heavy chain B7 U.S. Pat. No. 8,222,002 SEQ 3669 peptide variable region ID NO: 61 AD382 amyloid Heavy chain B6 U.S. Pat. No. 8,222,002 SEQ 3670 peptide variable region ID NO: 71 AD383 amyloid Heavy chain F10 U.S. Pat. No. 8,222,002 SEQ 3671 peptide variable region ID NO: 81 AD384 amyloid Heavy chain D1 U.S. Pat. No. 8,222,002 SEQ 3672 peptide variable region ID NO: 91 AD385 ApoE-CTD Heavy chain 807B-M0001-B07 WO2005051998 3673 variable region SEQ ID NO: 135 AD386 ApoE-CTD Heavy chain 807B-M0004-A03 WO2005051998 3674 variable region SEQ ID NO: 136 AD387 ApoE-CTD Heavy chain 807B-M0004-A05 WO2005051998 3675 variable region SEQ ID NO: 137 AD388 ApoE-CTD Heavy chain 807B-M0004-C04 WO2005051998 3676 variable region SEQ ID NO: 138 AD389 ApoE-CTD Heavy chain 807B-M0004-C05 WO2005051998 3677 variable region SEQ ID NO: 139 AD390 ApoE-CTD Heavy chain 807B-M0004-F06 WO2005051998 3678 variable region SEQ ID NO: 140 AD391 ApoE-CTD Heavy chain 807B-M0004-F10 WO2005051998 3679 variable region SEQ ID NO: 141 AD392 ApoE-CTD Heavy chain 807B-M0004-H03 WO2005051998 3680 variable region SEQ ID NO: 142 AD393 ApoE-CTD Heavy chain 807B-M0009-C03 WO2005051998 3681 variable region SEQ ID NO: 143 AD394 ApoE-CTD Heavy chain 807B-M0009-F06 WO2005051998 3682 variable region SEQ ID NO: 144 AD395 ApoE-CTD Heavy chain 807B-M0013-A12 WO2005051998 3683 variable region SEQ ID NO: 145 AD396 ApoE-CTD Heavy chain 807B-M0079-D10 WO2005051998 3684 variable region SEQ ID NO: 146 AD397 ApoE-CTD Heavy chain 807B-M0081-F12 WO2005051998 3685 variable region SEQ ID NO: 147 AD398 ApoE-CTD Heavy chain 807B-M0081-H03 WO2005051998 3686 variable region SEQ ID NO: 148 AD399 ApoE-CTD Heavy chain 807B-M0083-E11 WO2005051998 3687 variable region SEQ ID NO: 149 AD400 ApoE-CTD Heavy chain 807A-M0027-E11 WO2005051998 3688 variable region SEQ ID NO: 39 AD401 ApoE-CTD Heavy chain 807A-M0028-B02 WO2005051998 3689 variable region SEQ ID NO: 40 AD402 ApoE-CTD Heavy chain 807A-M0026-F05 WO2005051998 3690 variable region SEQ ID NO: 41 AD403 APP Heavy chain WO2014151747 3691 variable region SEQ NO 35 AD404 App Heavy chain WO2014151747 3692 variable region SEQ NO 37 AD405 APP Heavy chain WO2014151747 3693 variable region SEQ NO 39 AD406 APP Heavy chain WO2014151747 3694 variable region SEQ NO 41 AD407 APP Heavy chain WO2014151747 3695 variable region SEQ NO 43 AD408 A amyloid Heavy chain 15C11 WO2006066049 3696 variable region SEQ ID NO: 4 AD409 A amyloid Heavy chain 9G8 WO2006066049 3697 variable region SEQ ID NO: 5 AD410 A amyloid Heavy chain 266 WO2006066049 3698 variable region SEQ ID NO: 6 AD411 A amyloid Heavy chain 12Al 1 v1 WO2006066089 3699 variable region SEQ ID NO: 10 AD412 A amyloid Heavy chain v2 WO2006066089 3700 variable region SEQ ID NO: 13 AD413 A amyloid Heavy chain v2.1 WO2006066089 3701 variable region SEQ ID NO: 14 AD414 A amyloid Heavy chain v3 WO2006066089 3702 variable region SEQ ID NO: 15 AD415 A amyloid Heavy chain v4.1 WO2006066089 3703 variable region SEQ ID NO: 16 AD416 A amyloid Heavy chain v4.2 WO2006066089 3704 variable region SEQ ID NO: 17 AD417 A amyloid Heavy chain v4.3 WO2006066089 3705 variable region SEQ ID NO: 18 AD418 A amyloid Heavy chain v4.4 WO2006066089 3706 variable region SEQ ID NO: 19 AD419 A amyloid Heavy chain v5.1 WO2006066089 3707 variable region SEQ ID NO: 20 AD420 A amyloid Heavy chain v5.2 WO2006066089 3708 variable region SEQ ID NO: 21 AD421 A amyloid Heavy chain v5.3 WO2006066089 3709 variable region SEQ ID NO: 22 AD422 A amyloid Heavy chain v5.4 WO2006066089 3710 variable region SEQ ID NO: 23 AD423 A amyloid Heavy chain v5.5 WO2006066089 3711 variable region SEQ ID NO: 24 AD424 A amyloid Heavy chain v5.5 WO2006066089 3712 variable region SEQ ID NO: 25 AD425 A amyloid Heavy chain v6.1 WO2006066089 3713 variable region SEQ ID NO: 26 AD426 A amyloid Heavy chain v6.2 WO2006066089 3714 variable region SEQ ID NO: 27 AD427 A amyloid Heavy chain v6.1 WO2006066089 3715 variable region SEQ ID NO: 28 AD428 A amyloid Heavy chain v6.2 WO2006066089 3716 variable region SEQ ID NO: 29 AD429 A amyloid Heavy chain v7 WO2006066089 3717 variable region SEQ ID NO: 30 AD430 A amyloid Heavy chain v8 WO2006066089 3718 variable region SEQ ID NO: 31 AD431 A amyloid Heavy chain v3.1 WO2006066089 3719 variable region SEQ ID NO: 36 AD432 A amyloid Heavy chain GenBank BAC01733 WO2006066089 3720 variable region SEQ ID NO: 8 AD433 A amyloid Heavy chain A19 WO2006066089 3721 variable region SEQ ID NO: 9 AD434 A amyloids Heavy chain Humanized 3D6 U.S. Pat. No. 8,784,810 SEQ 3722 variable region (Bapineuzumab) ID NO: 2 AD435 A amyloids Heavy chain Humanized 10D5 U.S. Pat. No. 8,784,810 SEQ 3723 variable region ID NO: 29 AD436 A amyloids Heavy chain Humanized 3D6 U.S. Pat. No. 8,784,810 SEQ 3724 variable region (Bapineuzumab), ID NO: 4 version 2 AD437 A amyloids Heavy chain Humanized 12A11 U.S. Pat. No. 8,784,810 SEQ 3725 variable region ID NO: 8 AD438 A peptide Heavy chain U.S. Pat. No. 8,066,999 SEQ 3726 variable region ID NO: 2 AD439 A peptide Heavy chain U.S. Pat. No. 8,066,999 SEQ 3727 variable region ID NO: 3 AD440 A polypeptide Heavy chain preferred embodiment WO2008084402 3728 variable region 6, 11, 12 SEQ ID NO: 148 AD441 A polypeptide Heavy chain WO2008084402 3729 variable region SEQ ID NO: 57 AD442 A polypeptide Heavy chain WO2008084402 3730 variable region SEQ ID NO: 58 AD443 A polypeptide Heavy chain WO2008084402 3731 variable region SEQ ID NO: 59 AD444 A polypeptide Heavy chain preferred embodiment WO2008084402 3732 variable region 1, 2, 3, 4, 5, 9 SEQ ID NO: 60 AD445 A polypeptide Heavy chain preferred embodiment WO2008084402 3733 variable region 7, 10, 13 SEQ ID NO: 61 AD446 A polypeptide Heavy chain preferred embodiment 8 WO2008084402 3734 variable region SEQ ID NO: 62 AD447 A polypeptide Heavy chain WO2008084402 3735 variable region SEQ ID NO: 63 AD448 A polypeptide Heavy chain WO2008084402 3736 variable region SEQ ID NO: 64 AD449 A polypeptide Heavy chain WO2008084402 3737 variable region SEQ ID NO: 65 AD450 A polypeptide Heavy chain WO2008084402 3738 variable region SEQ ID NO: 66 AD451 A polypeptide Heavy chain WO2008084402 3739 variable region SEQ ID NO: 67 AD452 A polypeptide Heavy chain WO2008084402 3740 variable region SEQ ID NO: 68 AD453 A polypeptide Heavy chain WO2008084402 3741 variable region SEQ ID NO: 69 AD454 A polypeptide Heavy chain WO2008084402 3742 variable region SEQ ID NO: 70 AD455 A polypeptide Heavy chain WO2008084402 3743 variable region SEQ ID NO: 71 AD456 beta A4 Heavy chain Antibody A WO2007068429 3744 peptide/Alpha variable region SEQ ID NO: 2 beta 4 AD457 beta amyloid Heavy chain Kabat ID 000333 U.S. Pat. No. 7,256,273 SEQ 3745 variable region ID NO: 34 AD458 beta amyloid Heavy chain Germline VH4-6 U.S. Pat. No. 7,256,273 SEQ 3746 variable region ID NO: 36 AD459 beta amyloid Heavy chain Germline VH4-6 U.S. Pat. No. 7,256,273 SEQ 3747 variable region ID NO: 38 AD460 beta amyloid Heavy chain 12B4 U.S. Pat. No. 7,256,273 SEQ 3748 variable region ID NO: 4 AD461 beta amyloid Heavy chain humanized 12B4 U.S. Pat. No. 7,256,273 SEQ 3749 variable region ID NO: 8 AD462 beta amyloid Heavy chain ESBA212 U.S. Pat. No. 8,323,647 SEQ 3750 variable region ID NO: 17 AD463 beta amyloid Heavy chain Framework 2.3 U.S. Pat. No. 8,323,647 SEQ 3751 variable region ID NO: 18 AD464 beta amyloid Heavy chain 22C4 U.S. Pat. No. 8,323,647 SEQ 3752 variable region ID NO: 19 AD465 beta amyloid Heavy chain VH H U.S. Pat. No. 8,323,647 SEQ 3753 variable region ID NO: 20 AD466 beta amyloid Heavy chain VH I U.S. Pat. No. 8,323,647 SEQ 3754 variable region ID NO: 21 AD467 beta amyloid Heavy chain VH J U.S. Pat. No. 8,323,647 SEQ 3755 variable region ID NO: 22 AD468 beta amyloid Heavy chain VH K U.S. Pat. No. 8,323,647 SEQ 3756 variable region ID NO: 23 AD469 beta amyloid Heavy chain U.S. Pat. No. 10/476,265 SEQ 3757 variable region ID NO: 10 AD470 beta amyloid Heavy chain U.S. Pat. No. 10/476,265 SEQ 3758 variable region ID NO: 11 AD471 beta amyloid Heavy chain U.S. Pat. No. 10/476,265 SEQ 3759 variable region ID NO: 12 AD472 beta amyloid Heavy chain ACI-12-Ab-11 US20140199323 3760 variable region SEQ ID NO: 10 AD473 beta amyloid Heavy chain ACI-11-Ab-9 US20140199323 3761 variable region SEQ ID NO: 8 AD474 beta amyloid Heavy chain 8C5 US20150071915 3762 variable region SEQ ID NO: 19 AD475 beta amyloid Heavy chain 8F5 US20150071915 3763 variable region SEQ ID NO: 3 AD476 beta amyloid Heavy chain germline VH3-23 U.S. Pat. No. 7,189,819 SEQ 3764 variable region ID NO: 10 AD477 beta amyloid Heavy chain U.S. Pat. No. 7,189,819 SEQ 3765 variable region ID NO: 12 AD478 beta amyloid Heavy chain 10D5 U.S. Pat. No. 7,189,819 SEQ 3766 variable region ID NO: 16 AD479 beta amyloid Heavy chain m3D6 U.S. Pat. No. 7,189,819 SEQ 3767 variable region ID NO: 4 AD480 beta amyloid Heavy chain humanized 3D6 U.S. Pat. No. 7,189,819 SEQ 3768 variable region ID NO: 8 AD481 beta amyloid Heavy chain Kabat ID 109230 U.S. Pat. No. 7,189,819 SEQ 3769 variable region ID NO: 9 AD482 beta amyloid Heavy chain Bapineuzumab, AAB- U.S. Pat. No. 8,613,920 SEQ 3770 variable region 001 ID NO: 2 AD483 beta amyloid Heavy chain M99675 WO2007113172 3771 peptide variable region SEQ ID NO: 21 AD484 beta amyloid Heavy chain Humanized H1 WO2007113172 3772 peptide variable region SEQ ID NO: 26 AD485 beta amyloid Heavy chain Humanized H2 WO2007113172 3773 peptide variable region SEQ ID NO: 28 AD486 beta amyloid Heavy chain Humanized H3 WO2007113172 3774 peptide variable region SEQ ID NO: 30 AD487 BETA- Heavy chain NI-101.12 WO2008081008 3775 AMYLOID variable region SEQ ID NO: 10 AD488 BETA- Heavy chain NI-101.13 WO2008081008 3776 AMYLOID variable region SEQ ID NO: 14 AD489 BETA- Heavy chain NI-101.12F6A WO2008081008 3777 AMYLOID variable region SEQ ID NO: 39 AD490 BETA- Heavy chain NI-101.10 WO2008081008 3778 AMYLOID variable region SEQ ID NO: 4 AD491 BETA- Heavy chain NI-101.13A WO2008081008 3779 AMYLOID variable region SEQ ID NO: 42 AD492 BETA- Heavy chain NI-101.13A WO2008081008 3780 AMYLOID variable region SEQ ID NO: 44 AD493 BETA- Heavy chain NI-101.11 WO2008081008 3781 AMYLOID variable region SEQ ID NO: 6 AD494 DR6 and P75 Heavy chain IP1D6.3 WO2010062904 3116 variable region SEQ ID NO: 107 AD495 DR6 and P75 Heavy chain IP2F2.1 WO2010062904 3117 variable region SEQ ID NO: 117 AD496 DR6 and P75 Heavy chain IP5D10.2 WO2010062904 3118 variable region SEQ ID NO: 127 AD497 DR6 and P75 Heavy chain M51-H09 WO2010062904 3119 variable region SEQ ID NO: 17 AD498 DR6 and P75 Heavy chain M53-E04 WO2010062904 3120 variable region SEQ ID NO: 27 AD499 DR6 and P75 Heavy chain M53-F04 WO2010062904 3121 variable region SEQ ID NO: 37 AD500 DR6 and P75 Heavy chain M62-B02 WO2010062904 3122 variable region SEQ ID NO: 47 AD501 DR6 and P75 Heavy chain M63-E10 WO2010062904 3123 variable region SEQ ID NO: 57 AD502 DR6 and P75 Heavy chain M66-B03 WO2010062904 3111 variable region SEQ ID NO: 67 AD503 DR6 and P75 Heavy chain M50-H01 WO2010062904 3112 variable region SEQ ID NO: 7 AD504 DR6 and P75 Heavy chain M67-G02 WO2010062904 3113 variable region SEQ ID NO: 77 AD505 DR6 and P75 Heavy chain M77-F03 WO2010062904 3114 variable region SEQ ID NO: 87 AD506 DR6 and P75 Heavy chain M73-C04 WO2010062904 3115 variable region SEQ ID NO: 97 AD507 IOD5 Heavy chain WO2002088307 3782 variable region SEQ ID NO: 10 AD508 IOD5 Heavy chain WO2002088307 3783 variable region SEQ ID NO: 12 AD509 IOD5 Heavy chain WO2002088307 3784 variable region SEQ ID NO: 8 AD510 LPG Heavy chain #7 U.S. Pat. No. 8,591,902 SEQ 3124 (lysophosphatidylglucoside) variable region ID NO: 18 AD511 LPG Heavy chain #15 U.S. Pat. No. 8,591,902 SEQ 3125 (lysophosphatidylglucoside) variable region ID NO: 8 AD512 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ 3126 variable region ID NO: 13 AD513 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ 3127 variable region ID NO: 14 AD514 MAG Heavy chain U.S. Pat. No. 8,071,731 SEQ 3128 variable region ID NO: 15 AD515 MAI (myelin Heavy chain WO2013158748 3129 associated variable region SEQ ID NO: 1 inhibitor) AD516 MAI (myelin Heavy chain WO2013158748 3130 associated variable region SEQ ID NO: 17 inhibitor) AD517 NMDA Heavy chain EP2805972 SEQ 3131 variable region ID NO: 43 AD518 NOGO Heavy chain H5L13, H5L16, US20140147435 3132 variable region H5L18, H5L14, SEQ ID NO: 11 H5L15, H5L17, H5L6, H5L11 AD519 NOGO Heavy chain H6L13, H6L16, US20140147435 3133 variable region H6L18, H6L14, SEQ ID NO: 12 H6L15, H6L17, H6L6 AD520 NOGO Heavy chain H700L13, H700L16, US20140147435 3134 variable region H700L18, H700L14, SEQ ID NO: 13 H700L15, H700L17, H700L6, H700L11 AD521 NOGO Heavy chain H14L13, H14L16, US20140147435 3135 variable region H14L18, H14L14, SEQ ID NO: 14 H14L15, H14L17, H14L6, H14L11 AD522 NOGO Heavy chain H15L13, H15L16, US20140147435 3136 variable region H15L18, H15L14, SEQ ID NO: 15 H15L15, H15L17, H15L6, H15L11 AD523 NOGO Heavy chain H16L13, H16L16, US20140147435 3137 variable region H16L18, H16L14, SEQ ID NO: 16 H16L15, H16L17, H16L6, H16L11 AD524 NOGO Heavy chain H17L13, H17L16, US20140147435 3138 variable region H17L18, H17L14, SEQ ID NO: 17 H17L15, H17L17, H17L6, H17L11 AD525 NOGO Heavy chain H18L13, H18L16, US20140147435 3139 variable region H18L18, H18L14, SEQ ID NO: 18 H18L15, H18L17, H18L6, H18L11 AD526 NOGO Heavy chain H1L13, H1L16, US20140147435 3140 variable region H1L18, H1L14, SEQ ID NO: 77 H1L15, H1L17, H1L6 AD527 NOGO Heavy chain H19L13, H19L16, US20140147435 3141 variable region H19L18, H19L14, SEQ ID NO: 85 H19L15, H19L17, H19L6, H19L11 AD528 NOGO Heavy chain H20L13, H20L16, US20140147435 3142 variable region H20L18, H20L14, SEQ ID NO: 86 H20L15, H20L17, H20L6, H20L11 AD529 NOGO Heavy chain H21L13, H21L16, US20140147435 3143 variable region H21L18, H21L14, SEQ ID NO: 87 H21L15, H21L17, H21L6, H21L11 AD530 NOGO Heavy chain H22L13, H22L16, US20140147435 3144 variable region H22L18, H22L14, SEQ ID NO: 88 H22L15, H22L17, H22L6, H22L11 AD531 NOGO Heavy chain H23L13, H23L16, US20140147435 3145 variable region H23L18, H23L14, SEQ ID NO: 89 H23L15, H23L17, H23L6, H23L11 AD532 NOGO Heavy chain H24L13, H24L16, US20140147435 3146 variable region H24L18, H24L14, SEQ ID NO: 90 H24L15, H24L17, H24L6, H24L11 AD533 NOGO Heavy chain H25L13, H25L16, US20140147435 3147 variable region H25L18, H25L14, SEQ ID NO: 91 H25L15, H25L17, H25L6, H25L11 AD534 Nogo-66 Heavy chain Antibody clone 50 US20140065155 3148 variable region SEQ ID NO: 3 AD535 Nogo-66 Heavy chain Antibody clone 51 US20140065155 3149 variable region SEQ ID NO: 5 AD536 NogoA/NiG Heavy chain 6A3-Ig4 WO2009056509 3150 variable region SEQ ID NO: 24 AD537 NogoA/NiG Heavy chain 6A3-IgG1 WO2009056509 3151 variable region SEQ ID NO: 4 AD538 N-terminal Heavy chain Antibody Tea 1.1 US20110059092 3785 region of A8- variable region (Secreted by SEQ ID NO: 10 x peptide Hybridoma IGH525) AD539 N-terminal Heavy chain Antibody TeiA 1.6 US20110059092 3786 region of A8- variable region (Secreted by SEQ ID NO: 2 x peptide Hybridoma IGH521) AD540 N-terminal Heavy chain Antibody TeiA 1.7 US20110059092 3787 region of A8- variable region (Secreted by SEQ ID NO: 4 x peptide Hybridoma IGH522) AD541 N-terminal Heavy chain Antibody TeiA 1.8 US20110059092 3788 region of A8- variable region (Secreted by SEQ ID NO: 6 x peptide Hybridoma IGH523) AD542 N-terminal Heavy chain Antibody TeiA 2b.6 US20110059092 3789 region of A8- variable region (Secreted by SEQ ID NO: 8 x peptide Hybridoma IGH524) AD543 oligomers of N- Heavy chain 9D5 U.S. Pat. No. 8,795,664 SEQ 3790 terminal variable region ID NO: 26 truncated A AD544 oligomers of N- Heavy chain 8C4 U.S. Pat. No. 8,795,664 SEQ 3791 terminal variable region ID NO: 30 truncated A AD545 PrP Heavy chain ICSM18VH US20140294844 3792 variable region SEQ ID NO: 4 AD546 PrPC and/or Heavy chain US20150166668 3793 PrPSc variable region SEQ ID NO: 8 AD547 pyroglutamated Heavy chain WO2012136552 3794 A variable region SEQ ID NO: 25 AD548 pyroglutamated Heavy chain WO2012136552 3795 A variable region SEQ ID NO: 29 AD549 pyroglutamated Heavy chain WO2012136552 3796 A variable region SEQ ID NO: 5 AD550 pyroglutamated Heavy chain WO2012136552 3797 A variable region SEQ ID NO: 9 AD551 RGM A Heavy chain 5F9.1-GL US20150183871 3152 variable region SEQ ID NO: 35 AD552 RGM A Heavy chain 5F9.2-GL US20150183871 3153 variable region SEQ ID NO: 36 AD553 RGM A Heavy chain 5F9.3-GL US20150183871 3154 variable region SEQ ID NO: 37 AD554 RGM A Heavy chain 5F9.4-GL US20150183871 3155 variable region SEQ ID NO: 38 AD555 RGM A Heavy chain 5F9.5-GL US20150183871 3156 variable region SEQ ID NO: 39 AD556 RGM A Heavy chain 5F9.6-GL US20150183871 3157 variable region SEQ ID NO: 40 AD557 RGM A Heavy chain 5F9.7-GL US20150183871 3158 variable region SEQ ID NO: 41 AD558 RGM A Heavy chain 5F9.8-GL US20150183871 3159 variable region SEQ ID NO: 42 AD559 RGM A Heavy chain 5F9.9-GL US20150183871 3160 variable region SEQ ID NO: 43 AD560 RGM A Heavy chain h5F9.1, h5F9.1, US20150183871 3161 variable region h5F9.1, h5F9.1, SEQ ID NO: 47 h5F9.1, h5F9.2, h5F9.3 AD561 RGM A Heavy chain h5F9.3, h5F9.9, US20150183871 3162 variable region h5F9.25 SEQ ID NO: 53 AD562 RGM A Heavy chain h5F9.4, h5F9.10, US20150183871 3163 variable region h5F9.26 SEQ ID NO: 54 AD563 RGMa Heavy chain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 AD564 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 AD565 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 AD566 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 AD567 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 AD568 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 AD569 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 AD570 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 AD571 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 AD572 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 AD573 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 AD574 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 AD575 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 AD576 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 AD577 tau Heavy chain WO2014100600 3798 variable region SEQ ID NO: 45 AD578 tau Heavy chain NI-105.24B2 US20150252102 3799 variable region SEQ ID NO: 13 AD579 tau Heavy chain NI-105.4A3 US20150252102 3800 variable region SEQ ID NO: 17 AD580 tau Heavy chain NI-105.4E4 US20150252102 3801 variable region SEQ ID NO: 9 AD581 tau Heavy chain WO2013041962 3802 variable region SEQ ID NO: 138 AD582 tau Heavy chain WO2013041962 3803 variable region SEQ ID NO: 139 AD583 tau Heavy chain WO2013041962 3804 variable region SEQ ID NO: 140 AD584 tau Heavy chain WO2013041962 3805 variable region SEQ ID NO: 145 AD585 tau Heavy chain WO2013041962 3806 variable region SEQ ID NO: 147 AD586 tau Heavy chain WO2013041962 3807 variable region SEQ ID NO: 148 AD587 tau Heavy chain WO2014100600 3808 variable region SEQ ID NO: 220 AD588 tau Heavy chain NI-105.17C1 WO2014100600 3809 variable region SEQ ID NO: 44 AD589 tau Heavy chain WO2014100600 3810 variable region SEQ ID NO: 47 AD590 tau Heavy chain NI-105.6C5 WO2014100600 3811 variable region SEQ ID NO: 48 AD591 tau Heavy chain NI-105.29G10 WO2014100600 3812 variable region SEQ ID NO: 50 AD592 tau Heavy chain NI-105.6L9 WO2014100600 3813 variable region SEQ ID NO: 52 AD593 tau Heavy chain NI-105.40E8 WO2014100600 3814 variable region SEQ ID NO: 54 AD594 tau Heavy chain NI-105.48E5 WO2014100600 3815 variable region SEQ ID NO: 56 AD595 tau Heavy chain NI-105.6E3 WO2014100600 3816 variable region SEQ ID NO: 58 AD596 tau Heavy chain NI-105.22E1 WO2014100600 3817 variable region SEQ ID NO: 60 AD597 tau Heavy chain NI-105.26B12 WO2014100600 3818 variable region SEQ ID NO: 62 AD598 tau Heavy chain NI-105.12E12 WO2014100600 3819 variable region SEQ ID NO: 65 AD599 tau Heavy chain NI-105.60E7 WO2014100600 3820 variable region SEQ ID NO: 67 AD600 tau Heavy chain NI-105.14E2 WO2014100600 3821 variable region SEQ ID NO: 69 AD601 tau Heavy chain NI-105.39E2 WO2014100600 3822 variable region SEQ ID NO: 71 AD602 tau Heavy chain NI-105.19C6 WO2014100600 3823 variable region SEQ ID NO: 73 AD603 tau Heavy chain WO2014100600 3824 variable region SEQ ID NO: 75 AD604 tau Heavy chain NI-105.9C4 WO2014100600 3825 variable region SEQ ID NO: 76 AD605 tau Heavy chain IPN002 variant 1 U.S. Pat. No. 8,926,974 SEQ 3826 variable region ID NO: 36 AD606 tau Heavy chain IPN002 variant 2 U.S. Pat. No. 8,926,974 SEQ 3827 variable region ID NO: 37 AD607 tau Heavy chain IPN002 variant 3 U.S. Pat. No. 8,926,974 SEQ 3828 variable region ID NO: 38 AD608 tau Heavy chain IPN002 variant 4 U.S. Pat. No. 8,926,974 SEQ 3829 variable region ID NO: 39 AD609 tau Heavy chain PT1 US20150307600 3830 variable region SEQ ID NO: 35 AD610 tau Heavy chain PT3 US20150307600 3831 variable region SEQ ID NO: 37 AD611 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3832 variable region ID NO: 1 AD612 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3833 variable region ID NO: 2 AD613 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3834 variable region ID NO: 3 AD614 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3835 variable region ID NO: 4 AD615 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3836 variable region ID NO: 5 AD616 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3837 variable region ID NO: 68 AD617 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3838 variable region ID NO: 76 AD618 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3839 variable region ID NO: 88 AD619 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3840 variable region ID NO: 96 AD620 tau Heavy chain U.S. Pat. No. 9,304,138 SEQ 3841 variable region ID NO: 104 AD621 tau Heavy chain hAC1-36-3A8-Ab1 US20150175682 3842 variable region and hAC1-36-2B6-Ab1 SEQ ID NO: 7 AD622 tau Heavy chain hAC1-36-3A8-Ab1.v2. US20150175682 3843 variable region SEQ ID NO: 20 AD623 tau Heavy chain hAC1-36-2B6-Ab1.v2 US20150175682 3844 variable region SEQ ID NO: 21 AD624 tau Heavy chain ADx210 US20140161875 3845 variable region SEQ ID NO: 15 AD625 tau Heavy chain ADx210 subpart US20140161875 3846 variable region SEQ ID NO: 17 AD626 tau Heavy chain ADx215 US20140161875 3847 variable region SEQ ID NO: 25 AD627 tau antigen Heavy chain ADx202 WO2015004163 3848 variable region SEQ ID NO: 14 AD628 tau ps 422 Heavy chain antibody Mab2.10.3 US20110059093 3849 variable region SEQ ID NO: 2 AD629 tau ps 422 Heavy chain Mab 005 US20110059093 3850 variable region SEQ ID NO: 22 AD630 tau ps 422 Heavy chain Mab 019 US20110059093 3851 variable region SEQ ID NO: 30 AD631 tau ps 422 Heavy chain Mab 020 US20110059093 3852 variable region SEQ ID NO: 38 AD632 tau ps 422 Heavy chain Mab 085 US20110059093 3853 variable region SEQ ID NO: 46 AD633 tau ps 422 Heavy chain Mab 086 US20110059093 3854 variable region SEQ ID NO: 54 AD634 tau ps 422 Heavy chain Mab 097 US20110059093 3855 variable region SEQ ID NO: 62 AD635 TrkA Heavy chain HuVHWO WO2009098238 3856 variable region SEQ ID NO: 17 AD636 NOGO Heavy chain 2A10 construct WO2007003421 3181 variable region SEQ ID NO: 77 humanized construct H1 AD637 NOGO Heavy chain 2A10 construct WO2007003421 3182 variable region SEQ ID NO: 14 humanized construct H14 AD638 NOGO Heavy chain 2A10 construct WO2007003421 3183 variable region SEQ ID NO: 15 humanized construct H15 AD639 NOGO Heavy chain 2A10 construct WO2007003421 3184 variable region SEQ ID NO: 16 humanized construct H16 AD640 NOGO Heavy chain 2A10 construct WO2007003421 3185 variable region SEQ ID NO: 17 humanized construct H17 AD641 NOGO Heavy chain 2A10 construct WO2007003421 3186 variable region SEQ ID NO: 18 humanized construct H18 AD642 NOGO Heavy chain 2A10 construct WO2007003421 3187 variable region SEQ ID NO: 85 humanized construct H19 AD643 NOGO Heavy chain 2A10 construct WO2007003421 3188 variable region SEQ ID NO: 86 humanized construct H20 AD644 NOGO Heavy chain 2A10 construct WO2007003421 3189 variable region SEQ ID NO: 87 humanized construct H21 AD645 NOGO Heavy chain 2A10 construct WO2007003421 3190 variable region SEQ ID NO: 88 humanized construct H22 AD646 NOGO Heavy chain 2A10 construct WO2007003421 3191 variable region SEQ ID NO: 89 humanized construct H23 AD647 NOGO Heavy chain 2A10 construct WO2007003421 3192 variable region SEQ ID NO: 90 humanized construct H24 AD648 NOGO Heavy chain 2A10 construct WO2007003421 3193 variable region SEQ ID NO: 91 humanized construct H25 AD649 NOGO Heavy chain 2A10 construct WO2007003421 3194 variable region SEQ ID NO: 11 humanized construct H5 AD650 NOGO Heavy chain 2A10 construct WO2007003421 3195 variable region SEQ ID NO: 12 humanized construct H6 AD651 NOGO Heavy chain 2A10 construct WO2007003421 3196 variable region SEQ ID NO: 13 humanized construct H700 AD652 beta A4 Heavy chain with Antibody A WO2007068429 3857 peptide/Alpha Fc region SEQ ID NO: 26 beta 8 AD653 ACTH Light chain Ab3 WO2015127288 3205 SEQ ID NO: 101 AD654 ACTH Light chain Ab4 WO2015127288 3206 SEQ ID NO: 141 AD655 ACTH Light chain Ab5 WO2015127288 3207 SEQ ID NO: 181 AD656 ACTH Light chain Ab1 WO2015127288 3208 SEQ ID NO: 21 AD657 ACTH Light chain Ab6 WO2015127288 3209 SEQ ID NO: 221 AD658 ACTH Light chain Ab7 WO2015127288 3210 SEQ ID NO: 261 AD659 ACTH Light chain Ab9 WO2015127288 3211 SEQ ID NO: 301 AD660 ACTH Light chain Ab10 WO2015127288 3212 SEQ ID NO: 341 AD661 ACTH Light chain Ab11 WO2015127288 3213 SEQ ID NO: 381 AD662 ACTH Light chain Ab12 WO2015127288 3214 SEQ ID NO: 421 AD663 ACTH Light chain Ab1.H WO2015127288 3215 SEQ ID NO: 461 AD664 ACTH Light chain Ab2.H WO2015127288 3216 SEQ ID NO: 501 AD665 ACTH Light chain Ab3.H WO2015127288 3217 SEQ ID NO: 541 AD666 ACTH Light chain Ab4.H WO2015127288 3218 SEQ ID NO: 581 AD667 ACTH Light chain Ab2 WO2015127288 3219 SEQ ID NO: 61 AD668 ACTH Light chain Ab6.H WO2015127288 3220 SEQ ID NO: 621 AD669 ACTH Light chain Ab7.H WO2015127288 3221 SEQ ID NO: 661 AD670 ACTH Light chain Ab7A.H WO2015127288 3222 SEQ ID NO: 701 AD671 ACTH Light chain Ab10.H WO2015127288 3223 SEQ ID NO: 741 AD672 ACTH Light chain Ab11.H WO2015127288 3224 SEQ ID NO: 781 AD673 ACTH Light chain Ab11A.H WO2015127288 3225 SEQ ID NO: 821 AD674 ACTH Light chain Ab12.H WO20151.27288 3226 SEQ ID NO: 861 AD675 Alpha beta Light chain Gantenerumab Immunogenetics 3858 fibril Informition System; CHAIN ID NO: 8894_L. AD676 amyloid beta Light chain U.S. Pat. No. 719,576 SEQ ID 3859 peptide A NO: 11 AD677 Amyloid Light chain 3 Fab of Yw412.8.31 Wang, W. et al. A 3860 beta/BACE1 Therapeutic Antibody Targeting BACE1 Inhibits Amyloid NO:- {beta}Production in Vivo Sci Transl Med 3 (84), 84RA43 (2011), NCBI Accession # 3RIG_L (222aa) AD678 amyloid or Light chain Humanized C2 WO2008061796 3861 amyloid-like SEQ ID NO: 2 proteins AD679 amyloid protein Light chain C2 US20100150906 3862 SEQ ID NO: 13 AD680 amyloids Light chain #118 WO2010012004 3242 SEQ ID NO: 10 AD681 amyloids Light chain #121 WO2010012004 3243 SEQ ID NO: 12 AD682 amyloids Light chain #201 WO2010012004 3244 SEQ ID NO: 14 AD683 amyloids Light chain #204 WO2010012004 3245 SEQ ID NO: 15 AD684 amyloids Light chain #205 WO2010012004 3246 SEQ ID NO: 17 AD685 APP Light chain F5.100 WO2014151747 3863 SEQ ID NO: AD686 APP Light chain BBS1 MAb WO2014151747 3864 SEQ ID NO: 25 AD687 APP Light chain F5.87 WO2014151747 3865 SEQ ID NO: 27 AD688 APP Light chain F5.87 WO2014151747 3866 SEQ ID NO: 54 AD689 A amyloids Light chain Humanized 12A11, U.S. Pat. No. 8,784,810 SEQ 3867 version 2 ID NO: 10 AD690 A amyloids Light chain Humanized 3D6 U.S. Pat. No. 8,784,810 SEQ 3868 (Bapineuzumab), ID NO: 6 version 3 AD691 beta A4 Light chain Antibody A WO2007068429 3869 peptide/Alpha SEQ ID NO: 8 beta 6 AD692 beta A4 Light chain Antibody A WO2007068429 3870 peptide/Alpha SEQ ID NO: 22 beta 7 AD693 beta amyloid Light chain U.S. Pat. No. 10/476,265 SEQ 3871 ID NO: 19 AD694 beta amyloid Light chain U.S. Pat. No. 13/319,710 SEQ 3872 ID NO: 22 AD695 beta amyloid Light chain U.S. Pat. No. 13/319,710 SEQ 3873 ID NO: 28 AD696 beta amyloid Light chain (13C3) U.S. Pat. No. 13/319,710 SEQ 3874 ID NO: 4 AD697 beta amyloid Light chain C2 US20070166311 3875 SEQ ID NO: 21 AD698 beta amyloid Light chain Solanezumab Immunogenetics 3876 peptide Information System; CHAIN ID NO: 9097_L. AD699 beta amyloid Light chain Mature L1 WO2007113172 3877 peptide SEQ ID NO: 40 AD700 beta-amyloid Light chain Aducanumab, 3878 BIIB0307 AD701 EAG1 Light chain chimeric ImAb3 WO2006037604 3247 SEQ ID NO: 10 AD702 EAG1 Light chain chimeric ImAb4 WO2006037604 3248 SEQ ID NO: 14 AD703 EAG1 Light chain LC-ImAb3-humB3 WO2006037604 3249 SEQ ID NO: 18 AD704 EAG1 Light chain ImAb4 WO2006037604 3250 SEQ ID NO: 2 AD705 EAG1 Light chain LC-ImAb4-humA17 WO2006037604 3251 SEQ ID NO: 22 AD706 EAG1 Light chain LC-ImAb3-humA3 WO2006037604 3252 SEQ ID NO: 26 AD707 EAG1 Light chain LC-ImAb3-humA17 WO2006037604 3253 SEQ ID NO: 30 AD708 EAG1 Light chain LC-ImAb4-humA5-1 WO2006037604 3254 SEQ ID NO: 34 AD709 EAG1 Light chain LC-ImAb4-humO1 WO2006037604 3255 SEQ ID NO: 38 AD710 EAG1 Light chain ImAb3 WO2006037604 3256 SEQ ID NO: 6 AD711 IGG1 Abeta Light chain Humanized C2 US20090155249 3879 SEQ ID NO: 13 AD712 NOGO Light chain H6L13 FL, H19L13 US20140147435 3257 FL, H20L13 FL, SEQ ID NO: 35 H21L13 FL, H25L13 FL AD713 NOGO Light chain H16L16 FL, H19L16 US20140147435 3258 FL, H20L16 FL, SEQ ID NO: 38 H21L16 FL, H25L16 FL, H18L16 FL AD714 NOGO Light chain H16L18 FL, H19L18 US20140147435 3259 FL, H20L18 FL, SEQ ID NO: 40 H21L18 FL, H25L18 FL AD715 Nogo receptor-1 Light chain 7E11 US20090215691 3260 SEQ ID NO: 15 AD716 Nogo receptor-2 Light chain 7E11 US20090215691 3261 SEQ ID NO: 17 AD717 PrPC and/or Light chain US20150166668 3880 PrPSc SEQ ID NO: 9 AD718 PrPC and/or Light chain U.S. Pat. No. 8,852,587 SEQ 3881 PrPSc ID NO: 5 AD719 tau Light chain hACl-36-3A8 Ab1, WO2013151762 3882 hACl-36-3A8 Ab1.v2, SEQ ID NO: 22 hACl-36-3A8 Ab1.v3, hACl-36-3A8 Ab1.v4 AD720 tau Light chain hACl-36-3B8 Ab1, WO2013151762 3883 hACl-36-3B8 Ab1.v2, SEQ ID NO: 23 hACl-36-3B8 Ab1.v3, hACl-36-3B8 Ab1.v4 AD721 tau Light chain IPN001 U.S. Pat. No. 8,980,271 SEQ 3884 ID NO: 13 AD722 tau Light chain IPN002 U.S. Pat. No. 8,980,271 SEQ 3885 ID NO: 15 AD723 tau Light chain hACl-36-3A8- US20150175682 3886 Ab1 and hACl-36- SEQ ID NO: 18 2B6-Ab1 AD724 tau Light chain hACl-36-3A8-Ab1 US20150175682 3887 (IgG4), hACl-36-3A8- SEQ ID NO: 22 Ab1.v2 (IgG4), hACl- 36-3A8-Ab1.v3 (IgG1), and hACl-36- 3A8-Ab1.v4 (IgG1 N297G) AD725 tau Light chain hACl-36-2B6-Ab1 US20150175682 3888 (IgG4), hACl-36-2B6- SEQ ID NO: 23 Ab1.v2 (IgG4), hACl- 36-2B6-Ab1.v3 (IgG1), and hACl-36- 2B6-Ab1.v4 (IgG1 N297G) AD726 tau Light chain hACl-36-3A8-Ab1 US20150175682 3889 (IgG4) SEQ ID NO: 24 AD727 TrkA Light chain BXhVL4 WO2009098238 3890 SEQ ID NO: 10 AD728 TrkA Light chain BXhVL5 WO2009098238 3891 SEQ ID NO: 11 AD729 TrkA Light chain BXhVL WO2009098238 3892 SEQ ID NO: 12 AD730 TrkA Light chain BXhVL7 WO2009098238 3893 SEQ ID NO: 13 AD731 TrkA Light chain BXhVL8 WO2009098238 3894 SEQ ID NO: 14 AD732 TrkA Light chain mVLEP WO2009098238 3895 SEQ ID NO: 16 AD733 TrkA Light chain BXhVL1 WO2009098238 3896 SEQ ID NO: 7 AD734 TrkA Light chain BXhVL2 WO2009098238 3897 SEQ ID NO: 8 AD735 TrkA Light chain BXhVL3 WO2009098238 3898 SEQ ID NO: 9 AD736 trk-C (NT-3 Light chain 2250 U.S. Pat. No. 7,615,383 SEQ 3262 trkC ligand) ID NO: 49 AD737 trk-C (NT-3 Light chain 2253 U.S. Pat. No. 7,615,383 SEQ 3263 trkC ligand) ID NO: 50 AD738 trk-C (NT-3 Light chain 2256 U.S. Pat. No. 7,615,383 SEQ 3264 trkC ligand) ID NO: 51 AD739 trk-C (NT-3 Light chain 6.1.2 U.S. Pat. No. 7,615,383 SEQ 3265 trkC ligand) ID NO: 52 AD740 trk-C (NT-3 Light chain 6.4.1 U.S. Pat. No. 7,615,383 SEQ 3266 trkC ligand) ID NO: 53 AD741 trk-C (NT-3 Light chain 2345 U.S. Pat. No. 7,615,383 SEQ 3267 trkC ligand) ID NO: 54 AD742 trk-C (NT-3 Light chain 2349 U.S. Pat. No. 7,615,383 SEQ 3268 trkC ligand) ID NO: 55 AD743 Light chain Crenezumab light 3899 CHAIN AD744 Light chain Gantenerumab light 3900 chain AD745 Light chain Ponezumab light 3901 CHAIN AD746 Light chain Solanezumab light 3902 CHAIN AD747 amyloid protein Light chain C2 US20100150906 3903 constant region SEQ ID NO: 14 AD748 IGG1 Abeta Light Chain Humanized C2 US20090155249 3904 constant region SEQ ID NO: 14 AD749 ApoE Light chain 2e8 Fab Trakhanov, S. et al. 3905 fragment Structure of a monoclonal 2E8 Fab antibody fragment specific for the low-density lipoprotein- receptor binding region of apolipoprotein E refined at 1.9 A, Acta Crystallogr. D Biol. Crystallogr. 55 (PT 1), 122-128 (1999), NCBI Accession # 12E8 M AD750 many - growth Light chain fusion H21L13, H21L16, U.S. Pat. No. 8,053,569 SEQ 3275 factors protein H21L18, H21L14, ID NO: 31 H21L15, H21L17, H21L6, H21L11 AD751 many - growth Light chain fusion H23L13, H23L16, U.S. Pat. No. 8,053,569 SEQ 3276 factors protein H23L18, H23L14, ID NO: 36 H23L15, H23L17, H23L6, H23L11 AD752 NOGO Light chain 2A10 construct WO2007003421 3277 humanized SEQ ID NO: 80 construct L11 AD753 NOGO Light chain 2A10 construct WO2007003421 3278 humanized SEQ ID NO: 35 construct L13 AD754 NOGO Light chain 2A10 construct WO2007003421 3279 humanized SEQ ID NO: 36 construct L14 AD755 NOGO Light chain 2A10 construct WO2007003421 3280 humanized SEQ ID NO: 37 construct L15 AD756 NOGO Light chain 2A10 construct WO2007003421 3281 humanized SEQ ID NO: 38 construct L16 AD757 NOGO Light chain 2A10 construct WO2007003421 3282 humanized SEQ ID NO: 39 construct L17 AD758 NOGO Light chain 2A10 construct WO2007003421 3283 humanized SEQ ID NO: 40 construct L18 AD759 NOGO Light chain 2A10 construct WO2007003421 3284 humanized SEQ ID NO: 34 construct L6 AD760 RTN4 Light chain IgG4, Atinumab U.S. Pat. No. 8,163,285 SEQ 3285 immunomodulator ID NO: 25 AD761 tau Light chain mature ch4E4 US20150252102 3906 SEQ ID NO: 21 AD762 A beta Light chain IR-008 U.S. Pat. No. 8,858,949 SEQ 3907 oligomers variable region ID NO: 100 AD763 A beta Light chain IR-072 U.S. Pat. No. 8,858,949 SEQ 3908 oligomers variable region ID NO: 1012 AD764 A beta Light chain IR-073 U.S. Pat. No. 8,858,949 SEQ 3909 oligomers variable region ID NO: 1028 AD765 A beta Light chain IR-074 U.S. Pat. No. 8,858,949 SEQ 3910 oligomers variable region ID NO: 1044 AD766 A beta Light chain IR-075 U.S. Pat. No. 8,858,949 SEQ 3911 oligomers variable region ID NO: 1060 AD767 A beta Light chain IR-076 U.S. Pat. No. 8,858,949 SEQ 3912 oligomers variable region ID NO: 1076 AD768 A beta Light chain IR-077 U.S. Pat. No. 8,858,949 SEQ 3913 oligomers variable region ID NO: 1092 AD769 A beta Light chain IR-078 U.S. Pat. No. 8,858,949 SEQ 3914 oligomers variable region ID NO: 1108 AD770 A beta Light chain IR-079 U.S. Pat. No. 8,858,949 SEQ 3915 oligomers variable region ID NO: 1124 AD771 A beta Light chain IR-080 U.S. Pat. No. 8,858,949 SEQ 3916 oligomers variable region ID NO: 1140 AD772 A beta Light chain IR-081 U.S. Pat. No. 8,858,949 SEQ 3917 oligomers variable region ID NO: 1156 AD773 A beta Light chain IR-011 U.S. Pat. No. 8,858,949 SEQ 3918 oligomers variable region ID NO: 116 AD774 A beta Light chain IR-082 U.S. Pat. No. 8,858,949 SEQ 3919 oligomers variable region ID NO: 1172 AD775 A beta Light chain IR-083 U.S. Pat. No. 8,858,949 SEQ 3920 oligomers variable region ID NO: 1188 AD776 A beta Light chain IR-084 U.S. Pat. No. 8,858,949 SEQ 3921 oligomers variable region ID NO: 1204 AD777 A beta Light chain IR-085 U.S. Pat. No. 8,858,949 SEQ 3922 oligomers variable region ID NO: 1220 AD778 A beta Light chain IR-086 U.S. Pat. No. 8,858,949 SEQ 3923 oligomers variable region ID NO: 1236 AD779 A beta Light chain IR-087 U.S. Pat. No. 8,858,949 SEQ 3924 oligomers variable region ID NO: 1252 AD780 A beta Light chain IR-088 U.S. Pat. No. 8,858,949 SEQ 3925 oligomers variable region ID NO: 1268 AD781 A beta Light chain IR-089 U.S. Pat. No. 8,858,949 SEQ 3926 oligomers variable region ID NO: 1284 AD782 A beta Light chain IR-090 U.S. Pat. No. 8,858,949 SEQ 3927 oligomers variable region ID NO: 1300 AD783 A beta Light chain IR-092 U.S. Pat. No. 8,858,949 SEQ 3928 oligomers variable region ID NO: 1316 AD784 A beta Light chain IR-012 U.S. Pat. No. 8,858,949 SEQ 3929 oligomers variable region ID NO: 132 AD785 A beta Light chain IR-093 U.S. Pat. No. 8,858,949 SEQ 3930 oligomers variable region ID NO: 1332 AD786 A beta Light chain IR-094 U.S. Pat. No. 8,858,949 SEQ 3931 oligomers variable region ID NO: 1348 AD787 A beta Light chain IR-095 U.S. Pat. No. 8,858,949 SEQ 3932 oligomers variable region ID NO: 1364 AD788 A beta Light chain IR-097 U.S. Pat. No. 8,858,949 SEQ 3933 oligomers variable region ID NO: 1380 AD789 A beta Light chain IR-098 U.S. Pat. No. 8,858,949 SEQ 3934 oligomers variable region ID NO: 1396 AD790 A beta Light chain IR-100 U.S. Pat. No. 8,858,949 SEQ 3935 oligomers variable region ID NO: 1412 AD791 A beta Light chain IR-101 U.S. Pat. No. 8,858,949 SEQ 3936 oligomers variable region ID NO: 1428 AD792 A beta Light chain IR-102 U.S. Pat. No. 8,858,949 SEQ 3937 oligomers variable region ID NO: 1444 AD793 A beta Light chain IR-104 U.S. Pat. No. 8,858,949 SEQ 3938 oligomers variable region ID NO: 1460 AD794 A beta Light chain IR-105 U.S. Pat. No. 8,858,949 SEQ 3939 oligomers variable region ID NO: 1476 AD795 A beta Light chain IR-013 U.S. Pat. No. 8,858,949 SEQ 3940 oligomers variable region ID NO: 148 AD796 A beta Light chain IR-106 U.S. Pat. No. 8,858,949 SEQ 3941 oligomers variable region ID NO: 1492 AD797 A beta Light chain IR-107 U.S. Pat. No. 8,858,949 SEQ 3942 oligomers variable region ID NO: 1508 AD798 A beta Light chain IR-108 U.S. Pat. No. 8,858,949 SEQ 3943 oligomers variable region ID NO: 1524 AD799 A beta Light chain IR-109 U.S. Pat. No. 8,858,949 SEQ 3944 oligomers variable region ID NO: 1540 AD800 A beta Light chain IR-110 U.S. Pat. No. 8,858,949 SEQ 3945 oligomers variable region ID NO: 1556 AD801 A beta Light chain IR-112 U.S. Pat. No. 8,858,949 SEQ 3946 oligomers variable region ID NO: 1572 AD802 A beta Light chain IR-114 U.S. Pat. No. 8,858,949 SEQ 3947 oligomers variable region ID NO: 1588 AD803 A beta Light chain IR-115 U.S. Pat. No. 8,858,949 SEQ 3948 oligomers variable region ID NO: 1604 AD804 A beta Light chain IR-116 U.S. Pat. No. 8,858,949 SEQ 3949 oligomers variable region ID NO: 1620 AD805 A beta Light chain IR-117 U.S. Pat. No. 8,858,949 SEQ 3950 oligomers variable region ID NO: 1636 AD806 A beta Light chain IR-014 U.S. Pat. No. 8,858,949 SEQ 3951 oligomers variable region ID NO: 164 AD807 A beta Light chain IR-118 U.S. Pat. No. 8,858,949 SEQ 3952 oligomers variable region ID NO: 1652 AD808 A beta Light chain IR-119 U.S. Pat. No. 8,858,949 SEQ 3953 oligomers variable region ID NO: 1668 AD809 A beta Light chain IR-120 U.S. Pat. No. 8,858,949 SEQ 3954 oligomers variable region ID NO: 1684 AD810 A beta Light chain IR-121 U.S. Pat. No. 8,858,949 SEQ 3955 oligomers variable region ID NO: 1700 AD811 A beta Light chain IR-122 U.S. Pat. No. 8,858,949 SEQ 3956 oligomers variable region ID NO: 1716 AD812 A beta Light chain IR-123 U.S. Pat. No. 8,858,949 SEQ 3957 oligomers variable region ID NO: 1732 AD813 A beta Light chain IR-124 U.S. Pat. No. 8,858,949 SEQ 3958 oligomers variable region ID NO: 1748 AD814 A beta Light chain IR-125 U.S. Pat. No. 8,858,949 SEQ 3959 oligomers variable region ID NO: 1764 AD815 A beta Light chain IR-126 U.S. Pat. No. 8,858,949 SEQ 3960 oligomers variable region ID NO: 1780 AD816 A beta Light chain IR-127 U.S. Pat. No. 8,858,949 SEQ 3961 oligomers variable region ID NO: 1796 AD817 A beta Light chain IR-015 U.S. Pat. No. 8,858,949 SEQ 3962 oligomers variable region ID NO: 180 AD818 A beta Light chain IR-128 U.S. Pat. No. 8,858,949 SEQ 3963 oligomers variable region ID NO: 1812 AD819 A beta Light chain IR-129 U.S. Pat. No. 8,858,949 SEQ 3964 oligomers variable region ID NO: 1828 AD820 A beta Light chain IR-131 U.S. Pat. No. 8,858,949 SEQ 3965 oligomers variable region ID NO: 1844 AD821 A beta Light chain IR-132 U.S. Pat. No. 8,858,949 SEQ 3966 oligomers variable region ID NO: 1860 AD822 A beta Light chain IR-133 U.S. Pat. No. 8,858,949 SEQ 3967 oligomers variable region ID NO: 1876 AD823 A beta Light chain IR-134 U.S. Pat. No. 8,858,949 SEQ 3968 oligomers variable region ID NO: 1892 AD824 A beta Light chain IR-135 U.S. Pat. No. 8,858,949 SEQ 3969 oligomers variable region ID NO: 1908 AD825 A beta Light chain IR-136 U.S. Pat. No. 8,858,949 SEQ 3970 oligomers variable region ID NO: 1924 AD826 A beta Light chain IR-137 U.S. Pat. No. 8,858,949 SEQ 3971 oligomers variable region ID NO: 1940 AD827 A beta Light chain IR-138 U.S. Pat. No. 8,858,949 SEQ 3972 oligomers variable region ID NO: 1956 AD828 A beta Light chain IR-017 U.S. Pat. No. 8,858,949 SEQ 3973 oligomers variable region ID NO: 196 AD829 A beta Light chain IR-139 U.S. Pat. No. 8,858,949 SEQ 3974 oligomers variable region ID NO: 1972 AD830 A beta Light chain IR-140 U.S. Pat. No. 8,858,949 SEQ 3975 oligomers variable region ID NO: 1988 AD831 A beta Light chain IR-002 U.S. Pat. No. 8,858,949 SEQ 3976 oligomers variable region ID NO: 20 AD832 A beta Light chain IR-141 U.S. Pat. No. 8,858,949 SEQ 3977 oligomers variable region ID NO: 2004 AD833 A beta Light chain IR-142 U.S. Pat. No. 8,858,949 SEQ 3978 oligomers variable region ID NO: 2020 AD834 A beta Light chain IR-143 U.S. Pat. No. 8,858,949 SEQ 3979 oligomers variable region ID NO: 2036 AD835 A beta Light chain IR-144 U.S. Pat. No. 8,858,949 SEQ 3980 oligomers variable region ID NO: 2052 AD836 A beta Light chain IR-145 U.S. Pat. No. 8,858,949 SEQ 3981 oligomers variable region ID NO: 2068 AD837 A beta Light chain IR-146 U.S. Pat. No. 8,858,949 SEQ 3982 oligomers variable region ID NO: 2084 AD838 A beta Light chain IR-147 U.S. Pat. No. 8,858,949 SEQ 3983 oligomers variable region ID NO: 2100 AD839 A beta Light chain IR-149 U.S. Pat. No. 8,858,949 SEQ 3984 oligomers variable region ID NO: 2116 AD840 A beta Light chain IR-020 U.S. Pat. No. 8,858,949 SEQ 3985 oligomers variable region ID NO: 212 AD841 A beta Light chain IR-150 U.S. Pat. No. 8,858,949 SEQ 3986 oligomers variable region ID NO: 2132 AD842 A beta Light chain IR-151 U.S. Pat. No. 8,858,949 SEQ 3987 oligomers variable region ID NO: 2148 AD843 A beta Light chain IR-152 U.S. Pat. No. 8,858,949 SEQ 3988 oligomers variable region ID NO: 2164 AD844 A beta Light chain IR-153 U.S. Pat. No. 8,858,949 SEQ 3989 oligomers variable region ID NO: 2180 AD845 A beta Light chain IR-154 U.S. Pat. No. 8,858,949 SEQ 3990 oligomers variable region ID NO: 2196 AD846 A beta Light chain IR-155 U.S. Pat. No. 8,858,949 SEQ 3991 oligomers variable region ID NO: 2212 AD847 A beta Light chain IR-156 U.S. Pat. No. 8,858,949 SEQ 3992 oligomers variable region ID NO: 2228 AD848 A beta Light chain IR-157 U.S. Pat. No. 8,858,949 SEQ 3993 oligomers variable region ID NO: 2244 AD849 A beta Light chain IR-158 U.S. Pat. No. 8,858,949 SEQ 3994 oligomers variable region ID NO: 2260 AD850 A beta Light chain IR-159 U.S. Pat. No. 8,858,949 SEQ 3995 oligomers variable region ID NO: 2276 AD851 A beta Light chain IR-021 U.S. Pat. No. 8,858,949 SEQ 3996 oligomers variable region ID NO: 228 AD852 A beta Light chain IR-022 U.S. Pat. No. 8,858,949 SEQ 3997 oligomers variable region ID NO: 244 AD853 A beta Light chain IR-023 U.S. Pat. No. 8,858,949 SEQ 3998 oligomers variable region ID NO: 260 AD854 A beta Light chain IR-024 U.S. Pat. No. 8,858,949 SEQ 3999 oligomers variable region ID NO: 276 AD855 A beta Light chain IR-160 U.S. Pat. No. 8,858,949 SEQ 4000 oligomers variable region ID NO: 2864 AD856 A beta Light chain IR-161 U.S. Pat. No. 8,858,949 SEQ 4001 oligomers variable region ID NO: 2880 AD857 A beta Light chain IR-025 U.S. Pat. No. 8,858,949 SEQ 4002 oligomers variable region ID NO: 292 AD858 A beta Light chain IR-026 U.S. Pat. No. 8,858,949 SEQ 4003 oligomers variable region ID NO: 308 AD859 A beta Light chain IR-027 U.S. Pat. No. 8,858,949 SEQ 4004 oligomers variable region ID NO: 324 AD860 A beta Light chain IR-028 U.S. Pat. No. 8,858,949 SEQ 4005 oligomers variable region ID NO: 340 AD861 A beta Light chain IR-029 U.S. Pat. No. 8.858,949 SEQ 4006 oligomers variable region ID NO: 356 AD862 A beta Light chain IR-004 U.S. Pat. No. 8,858,949 SEQ 4007 oligomers variable region ID NO: 36 AD863 A beta Light chain IR-030 U.S. Pat. No. 8,858,949 SEQ 4008 oligomers variable region ID NO: 372 AD864 A beta Light chain IR-031 U.S. Pat. No. 8,858,949 SEQ 4009 oligomers variable region ID NO: 388 AD865 A beta Light chain IR-001 U.S. Pat. No. 8,858,949 SEQ 4010 oligomers variable region ID NO: 4 AD866 A beta Light chain IR-032 U.S. Pat. No. 8,858,949 SEQ 4011 oligomers variable region ID NO: 404 AD867 A beta Light chain IR-033 U.S. Pat. No. 8,858,949 SEQ 4012 oligomers variable region ID NO: 420 AD868 A beta Light chain IR-034 U.S. Pat. No. 8,858,949 SEQ 4013 oligomers variable region ID NO: 436 AD869 A beta Light chain IR-035 U.S. Pat. No. 8,858,949 SEQ 4014 oligomers variable region ID NO: 452 AD870 A beta Light chain IR-036 U.S. Pat. No. 8,858,949 SEQ 4015 oligomers variable region ID NO: 468 AD871 A beta Light chain IR-037 U.S. Pat. No. 8,858,949 SEQ 4016 oligomers variable region ID NO: 484 AD872 A beta Light chain IR-038 U.S. Pat. No. 8,858,949 SEQ 4017 oligomers variable region ID NO: 500 AD873 A beta Light chain IR-039 U.S. Pat. No. 8,858,949 SEQ 4018 oligomers variable region ID NO: 516 AD874 A beta Light chain IR-005 U.S. Pat. No. 8,858,949 SEQ 4019 oligomers variable region ID NO: 52 AD875 A beta Light chain IR-040 U.S. Pat. No. 8,858,949 SEQ 4020 oligomers variable region ID NO: 532 AD876 A beta Light chain IR-041 U.S. Pat. No. 8,858,949 SEQ 4021 oligomers variable region ID NO: 548 AD877 A beta Light chain IR-043 U.S. Pat. No. 8,858,949 SEQ 4022 oligomers variable region ID NO: 564 AD878 A beta Light chain IR-044 U.S. Pat. No. 8,858,949 SEQ 4023 oligomers variable region ID NO: 580 AD879 A beta Light chain IR-045 U.S. Pat. No. 8,858,949 SEQ 4024 oligomers variable region ID NO: 596 AD880 A beta Light chain IR-046 U.S. Pat. No. 8,858,949 SEQ 4025 oligomers variable region ID NO: 612 AD881 A beta Light chain IR-048 U.S. Pat. No. 8,858,949 SEQ 4026 oligomers variable region ID NO: 628 AD882 A beta Light chain IR-049 U.S. Pat. No. 8,858,949 SEQ 4027 oligomers variable region ID NO: 644 AD883 A beta Light chain IR-050 U.S. Pat. No. 8,858,949 SEQ 4028 oligomers variable region ID NO: 660 AD884 A beta Light chain IR-051 U.S. Pat. No. 8,858,949 SEQ 4029 oligomers variable region ID NO: 676 AD885 A beta Light chain IR-006 U.S. Pat. No. 8,858,949 SEQ 4030 oligomers variable region ID NO: 68 AD886 A beta Light chain IR-052 U.S. Pat. No. 8,858,949 SEQ 4031 oligomers variable region ID NO: 692 AD887 A beta Light chain IR-053 U.S. Pat. No. 8,858,949 SEQ 4032 oligomers variable region ID NO: 708 AD888 A beta Light chain IR-054 U.S. Pat. No. 8,858,949 SEQ 4033 oligomers variable region ID NO: 724 AD889 A beta Light chain IR-055 U.S. Pat. No. 8,858,949 SEQ 4034 oligomers variable region ID NO: 740 AD890 A beta Light chain IR-056 U.S. Pat. No. 8,858,949 SEQ 4035 oligomers variable region ID NO: 756 AD891 A beta Light chain IR-057 U.S. Pat. No. 8,858,949 SEQ 4036 oligomers variable region ID NO: 772 AD892 A beta Light chain IR-058 U.S. Pat. No. 8,858,949 SEQ 4037 oligomers variable region ID NO: 788 AD893 A beta Light chain IR-059 U.S. Pat. No. 8,858,949 SEQ 4038 oligomers variable region ID NO: 804 AD894 A beta Light chain IR-060 U.S. Pat. No. 8,858,949 SEQ 4039 oligomers variable region ID NO: 820 AD895 A beta Light chain IR-061 U.S. Pat. No. 8,858,949 SEQ 4040 oligomers variable region ID NO: 836 AD896 A beta Light chain IR-007 U.S. Pat. No. 8,858,949 SEQ 4041 oligomers variable region ID NO: 84 AD897 A beta Light chain IR-062 U.S. Pat. No. 8,858,949 SEQ 4042 oligomers variable region ID NO: 852 AD898 A beta Light chain IR-063 U.S. Pat. No. 8,858,949 SEQ 4043 oligomers variable region ID NO: 868 AD899 A beta Light chain IR-064 U.S. Pat. No. 8,858,949 SEQ 4044 oligomers variable region ID NO: 884 AD900 A beta Light chain IR-065 U.S. Pat. No. 8,858,949 SEQ 4045 oligomers variable region ID NO: 900 AD901 A beta Light chain IR-066 U.S. Pat. No. 8,858,949 SEQ 4046 oligomers variable region ID NO: 916 AD902 A beta Light chain IR-067 U.S. Pat. No. 8,858,949 SEQ 4047 oligomers variable region ID NO: 932 AD903 A beta Light chain IR-068 U.S. Pat. No. 8,858,949 SEQ 4048 oligomers variable region ID NO: 948 AD904 A beta Light chain IR-069 U.S. Pat. No. 8,858,949 SEQ 4049 oligomers variable region ID NO: 964 AD905 A beta Light chain IR-070 U.S. Pat. No. 8,858,949 SEQ 4050 oligomers variable region ID NO: 980 AD906 A beta Light chain IR-071 U.S. Pat. No. 8,858,949 SEQ 4051 oligomers variable region ID NO: 996 AD907 AB (1-42) Light chain Hu8F5VL US20090232801 4052 Globulomer variable region SEQ ID NO: 105 AD908 AB (1-42) Light chain TR1.37CL US20090232801 4053 Globulomer variable region SEQ ID NO: 106 AD909 AB (1-42) Light chain Hu8F5VL US20090232801 4054 Globulomer variable region SEQ ID NO: 112 AD910 AB (1-42) Light chain 8F5 hum7 VH US20090232801 4055 Globulomer variable region SEQ ID NO: 2 AD911 AB (20-42) Light chain VL 5F7hum8 US20090175847 4056 Globulomer variable region SEQ ID NO: 2 AD912 AB (20-42) Light chain VL 7C6hum7 US20090175847 4057 Globulomer variable region SEQ ID NO: 4 AD913 ADDL Light chain WO2007050359 4058 variable region SEQ ID NO: 112 AD914 ADDL Light chain WO2007050359 4059 variable region SEQ ID NO: 140 AD915 amyloid beta Light chain U.S. Pat. No. 719,576 SEQ ID 4060 peptide A variable region NO: 7 AD916 amyloid beta Light chain U.S. Pat. No. 719,576 SEQ ID 4061 peptide A variable region NO: 9 AD917 amyloid Light chain F11G3 U.S. Pat. No. 9,125,846 SEQ 3315 oligomers variable region ID NO: 12 AD918 amyloid or Light chain Humanized C2 HIV 1 WO2008061796 4062 amyloid-like variable region SEQ ID NO: 1 proteins AD919 amyloid protein Light chain C2 HuVK US20100150906 4063 (IGG1 Abeta) variable region SEQ ID NO: 12 AD920 amyloid Light chain Fv1E4 U.S. Pat. No. 8,222,002 SEQ 4064 peptide variable region ID NO: 16 AD921 amyloid Light chain Fv1E7 U.S. Pat. No. 8,222,002 SEQ 4065 peptide variable region ID NO: 26 AD922 amyloid Light chain Fv2A7 U.S. Pat. No. 8,222,002 SEQ 4066 peptide variable region ID NO: 36 AD923 amyloid Light chain Fv2A8 U.S. Pat. No. 8,222,002 SEQ 4067 peptide variable region ID NO: 46 AD924 amyloid Light chain Fv2B6 U.S. Pat. No. 8,222,002 SEQ 4068 peptide variable region ID NO: 56 AD925 amyloid Light chain Fv1E1 U.S. Pat. No. 8,222,002 SEQ 4069 peptide variable region ID NO: 6 AD926 amyloid Light chain B7 U.S. Pat. No. 8,222,002 SEQ 4070 peptide variable region ID NO: 66 AD927 amyloid Light chain B6 U.S. Pat. No. 8,222,002 SEQ 4071 peptide variable region ID NO: 76 AD928 amyloid Light chain F10 U.S. Pat. No. 8,222,002 SEQ 4072 peptide variable region ID NO: 86 AD929 amyloid Light chain D1 U.S. Pat. No. 8,222,002 SEQ 4073 peptide variable region ID NO: 96 AD930 ApoE-CTD Light chain 807B-M0001-B07 WO2005051998 4074 variable region SEQ ID NO: 150 AD931 ApoE-CTD Light chain 807B-M0004-A03 WO2005051998 4075 variable region SEQ ID NO: 151 AD932 ApoE-CTD Light chain 807B-M0004-A05 WO2005051998 4076 variable region SEQ ID NO: 152 AD933 ApoE-CTD Light chain 807B-M0004-C04 WO2005051998 4077 variable region SEQ ID NO: 153 AD934 ApoE-CTD Light chain 807B-M0004-C05 WO2005051998 4078 variable region SEQ ID NO: 154 AD935 ApoE-CTD Light chain 807B-M0004-F06 WO2005051998 4079 variable region SEQ ID NO: 155 AD936 ApoE-CTD Light chain 807B-M0004-F10 WO2005051998 4080 variable region SEQ ID NO: 156 AD937 ApoE-CTD Light chain 807B-M0004-H03 WO2005051998 4081 variable region SEQ ID NO: 157 AD938 ApoE-CTD Light chain 807B-M0009-C03 WO2005051998 4082 variable region SEQ ID NO: 158 AD939 ApoE-CTD Light chain 807B-M0009-F06 WO2005051998 4083 variable region SEQ ID NO: 159 AD940 ApoE-CTD Light chain 807B-M0013-A12 WO2005051998 4084 variable region SEQ ID NO: 160 AD941 ApoE-CTD Light chain 807B-M0079-D10 WO2005051998 4085 variable region SEQ ID NO: 161 AD942 ApoE-CTD Light chain 807B-M0081-F12 WO2005051998 4086 variable region SEQ ID NO: 162 AD943 ApoE-CTD Light chain 807B-M0081-H03 WO2005051998 4087 variable region SEQ ID NO: 163 AD944 ApoE-CTD Light chain 807B-M0083-E11 WO2005051998 4088 variable region SEQ ID NO: 164 AD945 ApoE-CTD Light chain 807A-M0027-E11 WO2005051998 4089 variable region SEQ ID NO: 42 AD946 ApoE-CTD Light chain 807A-M0028-B02 WO2005051998 4090 variable region SEQ ID NO: 43 AD947 ApoE-CTD Light chain 807A-M0026-F05 WO2005051998 4091 variable region SEQ ID NO: 44 AD948 APP Light chain WO2014151747 4092 variable region SEQ NO 47 AD949 APP Light chain WO2014151747 4093 variable region SEQ NO 45 AD950 APP Light chain WO2014151747 4094 variable region SEQ NO 49 AD951 APP Light chain WO2014151747 4095 variable region SEQ NO 51 AD952 A amyloid Light chain 15C11 WO2006066049 4096 variable region SEQ ID NO: 2 AD953 A amyloid Light chain 9G8 WO2006066049 4097 variable region SEQ ID NO: 8 AD954 A amyloid Light chain 266 WO2006066049 4098 variable region SEQ ID NO: 9 AD955 A amyloid Light chain 12A1 WO2006066089 4099 variable region SEQ ID NO: 2 AD956 A amyloid Light chain 12A1 WO2006066089 4100 variable region SEQ ID NO: 4 AD957 A amyloid Light chain humanized 12Al 1 WO2006066089 4101 variable region SEQ ID NO: 7 AD958 A amyloids Light chain Humanized 3D6 U.S. Pat. No. 8,784,810 SEQ 4102 variable region (Bapineuzumb) ID NO: 1 AD959 A amyloids Light chain Humanized 10D5 U.S. Pat. No. 8,784,810 SEQ 4103 variable region ID NO: 28 AD960 A amyloids Light chain Humanized 3D6 U.S. Pat. No. 8,784,810 SEQ 4104 variable region (Bapineuzumb), ID NO: 3 version 2 AD961 A amyloids Light chain Humanized 12A11 U.S. Pat. No. 8,784,810 SEQ 4105 variable region ID NO: 7 AD962 A peptide Light chain U.S. Pat. No. 8,066,999 SEQ 4106 variable region ID NO: 1 AD963 A polypeptide Light chain preferred embodiment WO2008084402 4107 variable region 1, 8, 12 SEQ ID NO: 145 AD964 A polypeptide Light chain preferred embodiment WO2008084402 4108 variable region 5, 13 SEQ ID NO: 146 AD965 A polypeptide Light chain WO2008084402 4109 variable region SEQ ID NO: 147 AD966 A polypeptide Light chain WO2008084402 4110 variable region SEQ ID NO: 47 AD967 A polypeptide Light chain WO2008084402 4111 variable region SEQ ID NO: 48 AD968 A polypeptide Light chain WO2008084402 4112 variable region SEQ ID NO: 49 AD969 A polypeptide Light chain WO2008084402 4113 variable region SEQ ID NO: 50 AD970 A polypeptide Light chain preferred embodiment 3 WO2008084402 4114 variable region SEQ ID NO: 51 AD971 A polypeptide Light chain preferred embodiment 4 WO2008084402 4115 variable region SEQ ID NO: 52 AD972 A polypeptide Light chain preferred embodiment WO2008084402 4116 variable region 2, 6 SEQ ID NO: 53 AD973 A polypeptide Light chain preferred embodiment WO2008084402 4117 variable region 9, 10, 11 SEQ ID NO: 54 AD974 A polypeptide Light chain preferred embodiment 7 WO2008084402 4118 variable region SEQ ID NO: 55 AD975 A polypeptide Light chain WO2008084402 4119 variable region SEQ ID NO: 56 AD976 beta amyloid Light chain 12B4 U.S. Pat. No. 7,256,273 SEQ 4120 variable region ID NO: 2 AD977 beta amyloid Light chain Germline A19 U.S. Pat. No. 7,256,273 SEQ 4121 variable region ID NO: 30 AD978 beta amyloid Light chain Kabat ID 000333 U.S. Pat. No. 7,256,273 SEQ 4122 variable region ID NO: 32 AD979 beta amyloid Light chain humanized 12B4 U.S. Pat. No. 7,256,273 SEQ 4123 variable region ID NO: 6 AD980 beta amyloid Light chain VL A U.S. Pat. No. 8,323,647 SEQ 4124 variable region ID NO: 10 AD981 beta amyloid Light chain VL B U.S. Pat. No. 8,323,647 SEQ 4125 variable region ID NO: 11 AD982 beta amyloid Light chain VL C U.S. Pat. No. 8,323,647 SEQ 4126 variable region ID NO: 12 AD983 beta amyloid Light chain VL D U.S. Pat. No. 8,323,647 SEQ 4127 variable region ID NO: 13 AD984 beta amyloid Light chain VL E U.S. Pat. No. 8,323,647 SEQ 4128 variable region ID NO: 14 AD985 beta amyloid Light chain VL F U.S. Pat. No. 8,323,647 SEQ 4129 variable region ID NO: 15 AD986 beta amyloid Light chain VL G U.S. Pat. No. 8,323,647 SEQ 4130 variable region ID NO: 16 AD987 beta amyloid Light chain ESBA212 U.S. Pat. No. 8,323,647 SEQ 4131 variable region ID NO: 7 AD988 beta amyloid Light chain Framework 2.3 U.S. Pat. No. 8,323,647 SEQ 4132 variable region ID NO: 8 AD989 beta amyloid Light chain 22C4 U.S. Pat. No. 8,323,647 SEQ 4133 variable region ID NO: 9 AD990 beta amyloid Light chain U.S. Pat. No. 10/476,265 SEQ 4134 variable region ID NO: 7 AD991 beta amyloid Light chain U.S. Pat. No. 10/476,265 SEQ 4135 variable region ID NO: 8 AD992 beta amyloid Light chain U.S. Pat. No. 10/476,265 SEQ 4136 variable region ID NO: 9 AD993 beta amyloid Light chain ACI-11-Ab-9 US20140199323 4137 variable region SEQ ID NO: 7 AD994 beta amyloid Light chain ACI-12-Ab-11 US20140199323 4138 variable region SEQ ID NO: 9 AD995 beta amyloid Light chain 8C5 US20150071915 4139 variable region SEQ ID NO: 20 AD996 beta amyloid Light chain 8F5 US20150071915 4140 variable region SEQ ID NO: 4 AD997 beta amyloid Light chain U.S. Pat. No. 7,189,819 SEQ 4141 variable region ID NO: 11 AD998 beta amyloid Light chain 10D5 U.S. Pat. No. 7,189,819 SEQ 4142 variable region ID NO: 14 AD999 beta amyloid Light chain m3D6 U.S. Pat. No. 7,189,819 SEQ 4143 variable region ID NO: 2 AD1000 beta amyloid Light chain humanized 3D6 U.S. Pat. No. 7,189,819 SEQ 4144 variable region ID NO: 5 AD1001 beta amyloid Light chain Kabal ID 109230 U.S. Pat. No. 7,189,819 SEQ 4145 variable region ID NO: 6 AD1002 beta amyloid Light chain germline A19 U.S. Pat. No. 7,189,819 SEQ 4146 variable region antibody ID NO: 7 AD1003 beta amyloid Light chain Bapineuzumab, AAB- U.S. Pat. No. 8,613,920 SEQ 4147 variable region 001 ID NO: 1 AD1004 beta amyloid Light chain CAA51135 WO2007113172 4148 peptide variable region SEQ ID NO: 24 AD1005 beta amyloid Light chain Humanized L1 WO2007113172 4149 peptide variable region SEQ ID NO: 32 AD1006 beta amyloid Light chain Mature H2 WO2007113172 4150 peptide variable region SEQ ID NO: 36 AD1007 BETA- Light chain NI-101.12 WO2008081008 4151 AMYLOID variable region SEQ ID NO: 12 AD1008 BETA- Light Chain NI-101.13 WO2008081008 4152 AMYLOID variable region SEQ ID NO: 16 AD1009 BETA- Light chain NI-101.12F6A WO2008081008 4153 AMYLOID variable region SEQ ID NO: 41 AD1010 BETA- Light chain NI-101.13A WO2008081008 4154 AMYLOID variable region SEQ ID NO: 43 AD1011 BETA- Light chain NI-101.13B WO2008081008 4155 AMYLOID variable region SEQ ID NO: 45 AD1012 BETA- Light chain NI-101.10, NI-101.11 WO2008081008 4156 AMYLOID variable region SEQ ID NO: 8 AD1013 DR6 and P75 Light chain M73-C04 WO2010062904 3316 variable region SEQ ID NO: 102 AD1014 DR6 and P75 Light chain 1P1D6.3 WO2010062904 3317 variable region SEQ ID NO: 112 AD1015 DR6 and P75 Light chain M50-H02 WO2010062904 3318 variable region SEQ ID NO: 12 AD1016 DR6 and P75 Light chain 1P2F2.1 WO2010062904 3319 variable region SEQ ID NO: 122 AD1017 DR6 and P75 Light chain 1P5D10.2 WO2010062904 3320 variable region SEQ ID NO: 132 AD1018 DR6 and P75 Light chain M51-H09 WO2010062904 3321 variable region SEQ ID NO: 22 AD1019 DR6 and P75 Light chain M53-E04 WO2010062904 3322 variable region SEQ ID NO: 32 AD1020 DR6 and P75 Light chain M53-F04 WO2010062904 3323 variable region SEQ ID NO: 42 AD1021 DR6 and P75 Light chain M62-B02 WO2010062904 3324 variable region SEQ ID NO: 52 AD1022 DR6 and P75 Light chain M63-E10 WO2010062904 3325 variable region SEQ ID NO: 62 AD1023 DR6 and P75 Light chain M66-B03 WO2010062904 3326 variable region SEQ ID NO: 72 AD1024 DR6 and P75 Light chain M67-G02 WO2010062904 3327 variable region SEQ ID NO: 82 AD1025 DR6 and P75 Light chain M72-F03 WO2010062904 3328 variable region SEQ ID NO: 92 AD1026 IOD5 Light chain WO2002088307 4157 variable region SEQ ID NO: 11 AD1027 IOD5 Light chain WO2002088307 4158 variable region SEQ ID NO: 7 AD1028 IOD5 Light chain WO2002088307 4159 variable region SEQ ID NO: 9 AD1029 LPG Light chain #7 U.S. Pat. No. 8,591,902 SEQ 3329 (lysophosphatidylglucoside) variable region ID NO: 17 AD1030 LPG Light chain #15 U.S. Pat. No. 8,591,902 SEQ 3330 (lysophosphatidylglucoside) variable region ID NO: 7 AD1031 MAG Light chain U.S. Pat. No. 8,071,731 SEQ 3331 variable region ID NO: 16 AD1032 MAG Light chain U.S. Pat. No. 8,071,731 SEQ 3332 variable region ID NO: 17 AD1033 MAG Light chain U.S. Pat. No. 8,071,731 SEQ 3333 variable region ID NO: 18 AD1034 MAG Light chain U.S. Pat. No. 8,071,731 SEQ 3334 variable region ID NO: 19 AD1035 MAI (myelin Light chain WO2013158748 3335 associated variable region SEQ ID NO: 11 inhibitor) AD1036 MAI (myelin Light chain WO2013158748 3336 associated variable region SEQ ID NO: 27 inhibitor) AD1037 NMDA Light chain EP2805972 SEQ 3337 variable region ID NO: 44 AD1038 NOGO Light chain H1L6, H5L6, H6L6, US20140147435 3338 variable region H14L6, H15L6, SEQ ID NO: 19 H16L6, H17L6, H18L6, H19L6, H20L6, H21L6, H22L6, H23L6, H24L6, H25L6, H700L6 AD1039 NOGO Light chain H1L13, H5L13, US20140147435 3339 variable region H6L13, H14L13, SEQ ID NO: 20 H15L13, H16L13, H17L13, H18L13, H19L13, H20L13, H21L13, H22L13, H23L13, H24L13, H25L13, H700L13 AD1040 NOGO Light chain H1L14, H5L14, US20140147435 3340 variable region H6L14, H14L14, SEQ ID NO: 21 H15L14, H16L14, H17L14, H18L14, H19L14, H20L14, H21L14, H22L14, H23L14, H24L14, H25L14, H700L14 AD1041 NOGO Light chain H1L15, H5L15, US20140147435 3341 variable region H6L15, H14L15, SEQ ID NO: 22 H15L15, H16115, H17L15, H18L15, H19L15, H20L15, H21L15, H22L15, H23L15, H24L15, H25L15, H700L15 AD1042 NOGO Light chain H1L16, H5L16, US20140147435 3342 variable region H6L16, H14L16, SEQ ID NO: 23 H15L16, H16L16, H17L16, H18L16, H19L16, H20L16, H21L16, H22L16, H23L16, H24L16, H25L16, H700L16 AD1043 NOGO Light chain H1L17, H5L17, US20140147435 3343 variable region H6L17, H14L17, SEQ ID NO: 24 H15L17, H16L17, H17L17, H18L17, H19L17, H20L17, H21L17, H22L17, H23L17, H24L17, H25L17, H700L17 AD1044 NOGO Light chain H1L18, H5L18, US20140147435 3344 variable region H6L18, H14L18, SEQ ID NO: 25 H15L18, H16L18, H17L18, H18L18, H19L18, H20L18, H21L18, H22L18, H23L18, H24L18, H25L18, H700L18 AD1045 NOGO Light chain H5L11, H6L11, US20140147435 3345 variable region H14L11, H15L11, SEQ ID NO: 78 H16L11, H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 AD1046 Nogo-66 Light chain Antibody clone 50 US20140065155 3346 variable region SEQ ID NO: 4 AD1047 Nogo-66 Light chain Antibody clone 51 US20140065155 3347 variable region SEQ ID NO: 6 AD1048 NogoA/NiG Light chain 6A3-Ig4 WO2009056509 3348 variable region SEQ ID NO: 25 AD1049 NogoA/NiG Light chain 6A3-IgG1 WO2009056509 3349 variable region SEQ ID NO: 5 AD1050 N-terminal Light chain Antibody TeiA 1.6 US20110059092 4160 region of A8- variable region (Secreted by SEQ ID NO: 1 x peptide Hybridoma IGH521) AD1051 N-terminal Light chain Antibody TeiA 1.7 US20110059092 4161 region of A8- variable region (Secreted by SEQ ID NO: 3 x peptide Hybridoma IGH522) AD1052 N-terminal Light chain Antibody TeiA 1.8 US20110059092 4162 region of A8- variable region (Secreted by SEQ ID NO: 5 x peptide Hybridoma IGH523) AD1053 N-terminal Light chain Antibody TeiA 2b.6 US20110059092 4163 region of A8- variable region (Secreted by SEQ ID NO: 7 x peptide Hybridoma IGH524) AD1054 N-terminal Light chain Antibody TeiA 1.1 US20110059092 4164 region of A8- variable region (Secreted by SEQ ID NO: 9 x peptide Hybridoma IGH525) AD1055 oligomers of N- Light chain 9D5 U.S. Pat. No. 8,795,664 SEQ 4165 terminal variable region ID NO: 28 truncated A AD1056 oligomers of N- Light chain 8C4 U.S. Pat. No. 8,795,664 SEQ 4166 terminal variable region ID NO: 32 truncated A AD1057 PrPC and/or Light chain US20150166668 4167 PrPSc variable region SEQ ID NO: 7 AD1058 pyroglutamated Light chain WO2012136552 4168 A variable region SEQ ID NO: 11 AD1059 pyroglutamated Light chain WO2012136552 4169 A variable region SEQ ID NO: 27 AD1060 pyroglutamated Light chain WO2012136552 4170 A variable region SEQ ID NO: 31 AD1061 pyroglutamated Light chain WO2012136552 4171 A variable region SEQ ID NO: 7 AD1062 RGM A Light chain 5F9.1-GL, 5F9.1-GL, US20150183871 3350 variable region 5F9.1-GL, 5F9.1-GL, SEQ ID NO: 44 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, h5F9.4, h5F9.11, h5F9.12 AD1063 RGM A Light chain 5F9.2-GL, 5F9.2-GL, US20150183871 3351 variable region 5F9.2-GL, 5F9.2-GL, SEQ ID NO: 45 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, h5F9.5, h5F9.19, h5F9.20 AD1064 RGM A Light chain 5F9.3-GL, 5F9.3-GL, US20150183871 3352 variable region 5F9.3-GL, 5F9.3-GL, SEQ ID NO: 46 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, h5F9.6, h5F9.21, h5F9.22 AD1065 RGM A Light chain h5F9.5, h5F9.6, US20150183871 3353 variable region h5F9,7, h5F9,8, SEQ ID NO: 48 h5F9.9, h5F9.10 AD1066 RGM A Light chain h5F9.11, US20150183871 3354 variable region h5F9.19, h5F9.21 SEQ ID NO: 49 AD1067 RGM A Light chain h5F9.1.2, h5F9.20, US20150183871 3355 variable region h5F9.22, h5F9.23, SEQ ID NO. 50 h5F9.25, h5F9.25, h5F9.26 AD1068 RGM A Light chain h5F9.1, h5F9.7, US20150183871 3356 variable region h5F9.23 SEQ ID NO: 51 AD1069 RGM A Light chain h5F9.2, h5F9.8, US20150183871 3357 variable region h5F9.25 SEQ ID NO: 52 AD1070 RGMa Light chain AE12-1 US20140023659 3368 variable region SEQ ID NO: 5 AD1071 RGMa Light chain AE12-7 US20140023659 3369 variable region SEQ ID NO: 53 AD1072 RGMa Light chain AE12-8 US20140023659 3370 variable region SEQ ID NO: 61 AD1073 RGMa Light chain AE12-13 US20140023659 3371 variable region SEQ ID NO: 95 AD1074 RGMa Light chain AE12-15 US20140023659 3358 variable region SEQ ID NO: 103 AD1075 RGMa Light chain AE12-20 US20140023659 3359 variable region SEQ ID NO: 111 AD1076 RGMa Light chain AE12-21 US20140023659 3360 variable region SEQ ID NO: 119 AD1077 RGMa Light chain AE12-23 US20140023659 3361 variable region SEQ ID NO: 127 AD1078 RGMa Light chain AE12-2 US20140023659 3362 variable region SEQ ID ID: 13 AD1079 RGMa Light chain AE12-24 US20140023659 3363 variable region SEQ ID NO: 135 AD1080 RGMa Light chain AE12-3 US20140023659 3364 variable region SEQ ID NO: 21 AD1081 RGMa Light chain AE12-4 US20140023659 3365 variable region SEQ ID NO: 29 AD1082 RGMa Light chain AE12-5 US20140023659 3366 variable region SEQ ID NO: 37 AD1083 RGMa Light chain AE12-6 US20140023659 3367 variable region SEQ ID NO: 45 AD1084 tau Light chain NI-105.4E4 US20150252102 4172 variable region SEQ ID NO: 11 AD1085 tau Light chain NI-105.4B2 US20150252102 4173 variable region SEQ ID NO: 15 AD1086 tau Light chain NI-105.4A3 US20150252102 4174 variable region SEQ ID NO: 19 AD1087 tau Light chain WO2013041962 4175 variable region SEQ ID NO: 141 AD1088 tau Light chain WO2013041962 4176 variable region SEQ ID NO: 142 AD1089 tau Light chain WO2013041962 4177 variable region SEQ ID NO: 143 AD1090 tau Light chain WO2013041962 4178 variable region SEQ ID NO: 150 AD1091 tau Light chain WO2013041962 4179 variable region SEQ ID NO: 152 AD1092 tau Light chain WO2013041962 4180 variable region SEQ ID NO: 153 AD1093 tau Light chain WO2014100600 4181 variable region SEQID NO: 221 AD1094 tau Light chain WO2014100600 4182 variable region SEQID NO: 222 AD1095 tau Light chain NI-105.17C1 WO2014100600 4183 variable region SEQID NO: 46 AD1096 tau Light chain NI-105.6C5 WO2014100600 4184 variable region SEQID NO: 49 AD1097 tau Light chain NI-105.29G10 WO2014100600 4185 variable region SEQID NO: 51 AD1098 tau Light chain NI-105.6L9 WO2014100600 4186 variable region SEQID NO: 53 AD1099 tau Light chain NI-105.40E8 WO2014100600 4187 variable region SEQID NO: 55 AD1100 tau Light chain NI-105.48E5 WO2014100600 4188 variable region SEQID NO: 57 AD1101 tau Light chain NI-105.6E3 WO2014100600 4189 variable region SEQID NO: 59 AD1102 tau Light chain NI-105.22E1 WO2014100600 4190 variable region SEQID NO: 61 AD1103 tau Light chain WO2014100600 4191 variable region SEQID NO: 63 AD1104 tau Light chain NI-105.26B12 WO2014100600 4192 variable region SEQID NO: 64 AD1105 tau Light chain NI-105.12E12 WO2014100600 4193 variable region SEQID NO: 66 AD1106 tau Light chain NI-105.60E7 WO2014100600 4194 variable region SEQID NO: 68 AD1107 tau Light chain NI-105,14E2 WO2014100600 4195 variable region SEQID NO: 70 AD1108 tau Light chain NI-105.39E2 WO2014100600 4196 variable region SEQID NO: 72 AD1109 tau Light chain NI-105.19C6 WO2014100600 4197 variable region SEQID NO: 74 AD1110 tau Light chain WO2014100600 4198 variable region SEQID NO: 77 AD1111 tau Light chain NI-105.9C4 WO2014100600 4199 variable region SEQID NO: 78 AD1112 tau Light chain IPN002 variant 1 U.S. Pat. No. 8,926,974 SEQ 4200 variable region ID NO: 40 AD1113 tau Light chain IPN002 variant 2 U.S. Pat. No. 8,926,974 SEQ 4201 variable region ID NO: 41 AD1114 tau Light chain IPN002 variant 3 U.S. Pat. No. 8,926,974 SEQ 4202 variable region ID NO: 42 AD1115 tau Light chain IPIN002 variant 4 U.S. Pat. No. 8,926,974 SEQ 4203 variable region ID NO: 43 AD1116 tau Light chain PT1 US20150307600 4204 variable region SEQ ID NO: 36 AD1117 tau Light chain PT3 US20150307600 4205 variable region SEQ ID NO: 38 AD1118 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4206 variable region ID NO: 6 AD1119 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4207 variable region ID NO: 7 AD1120 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4208 variable region ID NO: 8 AD1121 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4209 variable region ID NO: 9 AD1122 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4210 variable region ID NO: 10 AD1123 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4211 variable region ID NO: 11 AD1124 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4212 variable region ID NO: 69 AD1125 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4213 variable region ID NO: 77 AD1126 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4214 variable region ID NO: 92 AD1127 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4215 variable region ID NO: 97 AD1128 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4216 variable region ID NO: 105 AD1129 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4217 variable region ID NO: 116 AD1130 tau Light chain U.S. Pat. No. 9,304,138 SEQ 4218 variable region ID NO: 118 AD1131 tau Light chain hACl-36-3A8-Ab1 US20150175682 4219 variable region SEQ ID NO: 8 AD1132 tau Light chain hACl-36-2B6-Ab1 US20150175682 4220 variable region SEQ ID NO: 9 AD1133 tau Light chain ADx210 US20140161875 4221 variable region SEQ ID NO: 16 AD1134 tau Light chain ADx210 isoform US20140161875 4222 variable region SEQ ID NO: 18 AD1135 tau Light chain ADx215 US20140161875 4223 variable region SEQ ID NO: 26 AD1136 tau antigen Light chain ADx202 WO2015004163 4224 variable region SEQ ID NO: 9 AD1137 tau ps 422 Light chain antibody Mab2.10.3 US20110059093 4225 variable region SEQ ID NO: 1 AD1138 tau ps 422 Light chain Mab 005 US20110059093 4226 variable region SEQ ID NO: 26 AD1139 tau ps 422 Light chain Mab 019 US20110059093 4227 variable region SEQ ID NO: 34 AD1140 tau ps 422 Light chain Mab 020 US20110059093 4228 variable region SEQ ID NO: 42 AD1141 tau ps 422 Light chain Mab 085 US20110059093 4229 variable region SEQ ID NO: 50 AD1142 tau ps 422 Light chain Mab 086 US20110059093 4230 variable region SEQ ID NO: 58 AD1143 tau ps 422 Light chain Mab 097 US20110059093 4231 variable region SEQ ID NO: 66 AD1144 TrkA Light chain Hullo WO2009098238 4232 variable region SEQ ID NO: 18 AD1145 TrkA Light chain 3-23*01 WO2009098238 4233 variable region SEQ ID NO: 19 AD1146 TrkA Light chain JH4 WO2009098238 4234 variable region SEQ ID NO: 20 AD1147 TrkA Light chain L6*01 WO2009098238 4235 variable region SEQ ID NO: 21 AD1148 TrkA Light chain JK1 WO2009098238 4236 variable region SEQ ID NO: 22 AD1149 TrkA Light chain BXhVH5VL1 N297A i WO2009098238 4237 variable region SEQ ID NO: 23 AD1150 NOGO Light chain 2A10 construct WO2007003421 3375 variable region SEQ ID NO: 78 humanized construct L11 AD1151 NOGO Light chain 2A10 construct WO2007003421 3376 variable region SEQ ID NO: 20 humanized construct L13 AD1152 NOGO Light chain 2A10 construct WO2007003421 3377 variable region SEQ ID NO: 21 humanized construct L14 AD1153 NOGO Light chain 2A10 construct WO2007003421 3378 variable region SEQ ID NO: 22 humanized construct L15 AD1154 NOGO Light chain 2A10 construct WO2007003421 3379 variable region SEQ ID NO: 23 humanized construct L16 AD1155 NOGO Light chain 2A10 construct WO2007003421 3380 variable region SEQ ID NO: 24 humanized construct L17 AD1156 NOGO Light chain 2A10 construct WO2007003421 3381 variable region SEQ ID NO: 25 humanized construct L18 AD1157 NOGO Light chain 2A10 construct WO2007003421 3382 variable region SEQ ID NO: 19 humanized construct L6 AD1158 beta A4 Light chain with Antibody A WO2007068429 4238 peptide/Alpha leader sequence SEQ ID NO: 28 beta 9 AD1159 A amyloid Light chain, WO2006066089 4239 consensus SEQ ID NO: 38 AD1160 A amyloid Light chain, WO2006066089 4240 consensus SEQ ID NO: 39 AD1161 A amyloid Light chain, WO2006066089 4241 consensus SEQ ID NO: 40 AD1162 A amyloid Light chain, WO2006066089 4242 consensus SEQ ID NO: 41 AD1163 A amyloid Light chain, WO2006066089 4243 consensus SEQ ID NO: 42 AD1164 A amyloid Light chain, WO2006066089 4244 consensus SEQ ID NO: 43 AD1165 A amyloid Light chain, WO2006066089 4245 consensus SEQ ID NO: 44 AD1166 A amyloid Light chain, WO2006066089 4246 consensus SEQ ID NO: 45 AD1167 A amyloid Light chain, WO2006066089 4247 consensus SEQ ID NO: 46 AD1168 A amyloid Light chain, WO2006066089 4248 consensus SEQ ID NO: 47 AD1169 A amyloid Light chain, WO2006066089 4249 consensus SEQ ID NO: 48 AD1170 A amyloid Light chain, WO2006066089 4250 consensus SEQ ID NO: 49 AD1171 A amyloid Light chain, WO2006066089 4251 consensus SEQ ID NO: 50 AD1172 A amyloid Light chain, WO2006066089 4252 consensus SEQ ID NO: 51 AD1173 PrPC and/or scFv U.S. Pat. No. 8,852,587 SEQ 4253 PrPSc ID NO: 6 AD1174 beta amyloid scFv RCK37 U.S. Pat. No. 8,221,750 SEQ 4254 ID NO: 6 AD1175 beta amyloid scFv RCK22 U.S. Pat. No. 8,221,750 SEQ 4255 ID NO: 8 AD1176 PrP ICSM181c US20140294844 4256 SEQ ID NO: 6 AD1177 PrPC and/or U.S. Pat. No. 8,852,587 SEQ 4257 PrPSc ID NO: 3 AD1178 tau US20140302046 4258 SEQ ID NO: 103

    Huntington's Disease Antibodies

    [0290] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the Huntington's Disease payload antibody nolypentides listed in Table 5 (HD1-HD245; SEQ ID NO: 29418-2970, 3018-3021, 3031-3046, 3056-3076, 3110-3130, 3132-3160, 3164-3177, 3181-3196, 3242-3246, 3257-3268, 3275-3285, 3315-3336, 3338-3371, 3375-3382, 4259-4267).

    TABLE-US-00005 TABLE 5 Huntington's Disease Antibodies Antibody SEQ ID No. Target Description Antibody Name Reference Information NO HD1 amyloid consensus M13 g3p, fd g3p, fl US20150376239 2948 proteins sequence g3p SEQ ID NO: 4 HD2 amyloid consensus I2-2 g3p, Ike g3p US20150376239 2949 proteins sequence SEQ ID NO: 7 HD3 118-126 of - constant region IgG1 US20150259404 2950 synuclein SEQ ID NO: 38 HD4 amyloid Fusion protein M13 g3p US20150376239 2951 proteins SEQ ID NO: 1 HD5 amyloid Fusion protein Construct 5 US20150376239 2952 proteins SEQ ID NO: 11 HD6 amyloid Fusion protein Construct 6 US20150376239 2953 proteins SEQ ID NO: 13 HD7 amyloid Fusion protein fd N2 US20150376239 2954 proteins SEQ ID NO: 14 HD8 amyloid Fusion protein fl N2 US20150376239 2955 proteins SEQ ID NO: 15 HD9 amyloid Fusion protein M13 N2 US20150376239 2956 proteins SEQ ID NO: 16 HD10 amyloid Fusion protein Ike N2 US20150376239 2957 proteins SEQ ID NO: 17 HD11 amyloid Fusion protein 12-2 N2 US20150376239 2958 proteins SEQ ID NO: 18 HD12 amyloid Fusion protein Ifl N2 US20150376239 2959 proteins SEQ ID NO: 19 HD13 amyloid Fusion protein fd g3p US20150376239 2960 proteins SEQ ID NO: 2 HD14 amyloid Fusion protein Construct 3 US20150376239 2961 proteins SEQ ID NO: 20 HD15 amyloid Fusion protein Construct 3m g3p US20150376239 2962 proteins portion SEQ ID NO: 24 HD16 amyloid Fusion protein Ifl g3p US20150376239 2963 proteins SEQ ID NO: 29 HD17 amyloid Fusion protein fl g3p US20150376239 2964 proteins SEQ ID NO: 3 HD18 amyloid Fusion protein fd g3p US20150376239 2965 proteins SEQ ID NO: 30 HD19 amyloid Fusion protein Construct 8, rs-g3p US20150376239 2966 proteins (Ifl-N1N2)-hlgG1- SEQ ID NO: 31 Fc HD20 amyloid Fusion protein I2-2 g3p US20150376239 2967 proteins SEQ ID NO: 5 HD21 amyloid Fusion protein Ike g3p US20150376239 2968 proteins SEQ ID NO: 6 HD22 amyloid Fusion protein Ifl g3p US20150376239 2969 proteins SEQ ID NO: 8 HD23 amyloid Fusion protein Construct 4 US20150376239 2970 proteins SEQ ID NO: 9 HD24 amyloids Heavy chain #118 WO2010012004 3018 SEQ ID NO: 11 HD25 amyloids Heavy chain #121 WO2010012004 3019 SEQ ID NO: 13 HD26 amyloids Heavy chain #204 WO2010012004 3020 SEQ ID NO: 16 HD27 amyloids Heavy chain #205 WO2010012004 3021 SEQ ID NO: 18 HD28 NOGO Heavy chain H6L13 FL US20140147435 3031 SEQ ID NO: 27 HD29 NOGO Heavy chain H16L16 FL, H16L18 US20140147435 3032 FL SEQ ID NO: 31 HD30 NOGO Heavy chain H18L16 FL US20140147435 3033 SEQ ID NO: 33 HD31 NOGO Heavy chain H19L13 FL, H19L16 US20140147435 3034 FL, H19L18 FL SEQ ID NO: 92 HD32 NOGO Heavy chain H20L13 FL, H20L16 US20140147435 3035 FL, H20L18 FL SEQ ID NO: 93 HD33 NOGO Heavy chain H21L13 FL, H21L16 US20140147435 3036 FL, H21L18 FL SEQ ID NO: 94 HD34 NOGO Heavy chain H25L13 FL, H25L16 US20140147435 3037 FL, H25L18 FL SEQ ID NO: 98 HD35 Nogo receptor- Heavy chain 5B10 US20090215691 3038 1 SEQ ID NO: 16 HD36 Nogo receptor Heavy chain 5B10 US20090215691 3039 1 SEQ ID NO: 18 HD37 trk-C (NT-3 Heavy chain 2250 U.S. Pat. No. 7,615,383 3040 trkC ligand) SEQ ID NO: 42 HD38 trk-C (NT-3 Heavy chain 2253 U.S. Pat. No. 7,615,383 3041 trkC ligand) SEQ ID NO: 43 HD39 trk-C (NT-3 Heavy chain 2256 U.S. Pat. No. 7,615,383 3042 trkC ligand) SEQ ID NO: 44 HD40 trk-C (NT-3 Heavy chain 6.1.2 U.S. Pat. No. 7,615,383 3043 trkC ligand) SEQ ID NO: 45 HD41 trk-C (NT-3 Heavy chain 6.4.1 U.S. Pat. No. 7,615,383 3044 trkC ligand) SEQ ID NO: 46 HD42 trk-C (NT-3 Heavy chain 2345 U.S. Pat. No. 7,615,383 3045 trkC ligand) SEQ ID NO: 47 HD43 trk-C (NT-3 Heavy chain 2349 U.S. Pat. No. 7,615,383 3046 trkC ligand) SEQ ID NO: 48 HD44 many Heavy chain fusion H19L13, H19L16, U.S. Pat. No. 8,053,569 3056 protein H19L18, H19L14, SEQ ID NO: 25 H19L15, H19L17, H19L6, H19L11 HD45 many Heavy chain fusion H20L13, H20L16, U.S. Pat. No. 8,053,569 3057 protein H20L18, H20L14, SEQ ID NO: 28 H20L15, H20L17, H20L6, H20L11 HD46 many Heavy chain fusion H22L13, H22L16, U.S. Pat. No. 8,053,569 3058 protein H22L18, H22L14, SEQ ID NO: 34 H22L15, H22L17, H22L6, H22L11 HD47 many - growth Heavy chain fusion H5L11, H6L11, U.S. Pat. No. 8,053,569 3059 factors protein H14L11, H15L11, SEQ ID NO: 24 H16L11, H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 HD48 NOGO Heavy chain 2A10 construct WO2007003421 3060 humanized SEQ ID NO: 79 construct H1 HD49 NOGO Heavy chain 2A10 construct WO2007003421 3061 humanized SEQ ID NO: 29 construct H14 HD50 NOGO Heavy chain 2A10 construct WO2007003421 3062 humanized SEQ ID NO: 30 construct H15 HD51 NOGO Heavy chain 2A10 construct WO2007003421 3063 humanized SEQ ID NO: 31 construct H16 HD52 NOGO Heavy chain 2A10 construct WO2007003421 3064 humanized SEQ ID NO: 32 construct H17 HD53 NOGO Heavy chain 2A10 construct WO2007003421 3065 humanized SEQ ID NO: 33 construct H18 HD54 NOGO Heavy chain 2A10 construct WO2007003421 3066 humanized SEQ ID NO: 92 construct H19 HD55 NOGO Heavy chain 2A10 construct WO2007003421 3067 humanized SEQ ID NO: 93 construct H20 HD56 NOGO Heavy chain 2A10 construct WO2007003421 3068 humanized SEQ ID NO: 94 construct H21 HD57 NOGO Heavy chain 2A10 construct WO2007003421 3069 humanized SEQ ID NO: 95 construct H22 HD58 NOGO Heavy chain 2A10 construct WO2007003421 3070 humanized SEQ ID NO: 96 construct H23 HD59 NOGO Heavy chain 2A10 construct WO2007003421 3071 humanized SEQ ID NO: 97 construct H24 HD60 NOGO Heavy chain 2A10 construct WO2007003421 3072 humanized SEQ ID NO: 98 construct H25 HD61 NOGO Heavy chain 2A10 construct WO2007003421 3073 humanized SEQ ID NO: 26 construct H5 HD62 NOGO Heavy chain 2A10 construct WO2007003421 3074 humanized SEQ ID NO: 27 construct H6 HD63 NOGO Heavy chain 2A10 construct WO2007003421 3075 humanized SEQ ID NO: 28 construct H700 HD64 RTN4 (NOGO) Heavy chain IgG4, Atinumab U.S. Pat. No. 8,163,285 3076 immunomodulator SEQ ID NO: 24 HD65 amyloid Heavy chain F11G3 U.S. Pat. No. 9,125,846 3110 oligomers variable region SEQ ID NO: 11 HD66 DR6 and P75 Heavy chain 1P1D6.3 WO2010062904 3116 variable region SEQ ID NO: 107 HD67 DR6 and P75 Heavy chain M50-H01 WO2010062904 3112 variable region SEQ ID NO: 7 HD68 DR6 and P75 Heavy chain M67-G02 WO2010062904 3113 variable region SEQ ID NO: 77 HD69 DR6 and P75 Heavy chain M72-F03 WO2010062904 3114 variable region SEQ ID NO: 87 HD70 DR6 and P75 Heavy chain M73-C04 WO2010062904 3115 variable region SEQ ID NO: 97 HD71 DR6 and P75 Heavy chain 1P2F2.1 WO2010062904 3117 variable region SEQ ID NO: 117 HD72 DR6 and P75 Heavy chain 1P5D10.2 WO2010062904 3118 variable region SEQ ID NO: 127 HD73 DR6 and P75 Heavy chain M51-H09 WO2010062904 3119 variable region SEQ ID NO: 17 HD74 DR6 and P75 Heavy chain M53-E04 WO2010062904 3120 variable region SEQ ID NO: 27 HD75 DR6 and P75 Heavy chain M53-F04 WO2010062904 3121 variable region SEQ ID NO: 37 HD76 DR6 and P75 Heavy chain M62-B02 WO2010062904 3122 variable region SEQ ID NO: 47 HD77 DR6 and P75 Heavy chain M63-E10 WO2010062904 3123 variable region SEQ ID NO: 57 HD78 DR6 and P75 Heavy chain M66-B03 WO2010062904 3111 variable region SEQ ID NO: 67 HD79 LPG (lyso- Heavy chain #7 U.S. Pat. No. 8,591,902 3124 phosphatidyl- variable region SEQ ID NO: 18 glucoside) HD80 LPG (lyso- Heavy chain #15 U.S. Pat. No. 8,591,902 3125 phosphatidyl- variable region SEQ ID NO: 8 glucoside) HD81 MAG Heavy chain U.S. Pat. No. 8,071,731 3126 variable region SEQ ID NO: 13 HD82 MAG Heavy chain U.S. Pat. No. 8,071,731 3127 variable region SEQ ID NO: 14 HD83 MAG Heavy chain U.S. Pat. No. 8,071,731 3128 variable region SEQ ID NO: 15 HD84 MAI (myelin Heavy chain WO2013158748 3129 associated variable region SEQ ID NO: 1 inhibitor) HD85 MAI (myelin Heavy chain WO2013158748 3130 associated variable region SEQ ID NO: 17 inhibitor) HD86 NOGO Heavy chain H5L13, H5L16, US20140147435 3132 variable region H5L18, H5L14, SEQ ID NO: 11 H5L15, H5L17, H5L6, H5L11 HD87 NOGO Heavy chain H6L13, H6L16, US20140147435 3133 variable region H6L18, H6L14, SEQ ID NO: 12 H6L15, H6L17, H6L6 HD88 NOGO Heavy chain H700L13, H700L16, US20140147435 3134 variable region H700L18, H700L14, SEQ ID NO: 13 H700L15, H700L17, H700L6, H700L11 HD89 NOGO Heavy chain H14L13, H14L16, US20140147435 3135 variable region H14L18, H14L14, SEQ ID NO: 14 H14L15, H14L17, H14L6, H14L11 HD90 NOGO Heavy chain H15L13, H15L16, US20140147435 3136 variable region H15L18, H15L14, SEQ ID NO: 15 H15L15, H15L17, H15L6, H15L11 HD91 NOGO Heavy chain H16L13, H16L16, US20140147435 3137 variable region H16L18, H16L14, SEQ ID NO: 16 H16L15, H16L17, H16L6, H16L11 HD92 NOGO Heavy chain H17L13, H17L16, US20140147435 3138 variable region H17L18, H17L14, SEQ ID NO: 17 H17L15, H17L17, H17L6, H17L11 HD93 NOGO Heavy chain H18L13, H18L16, US20140147435 3139 variable region H18L18, H18L14, SEQ ID NO: 18 H18L15, H18L17, H18L6, H18L11 HD94 NOGO Heavy chain H1L13, H1L16, US20140147435 3140 variable region H1L18, H1L14, SEQ ID NO: 77 H1L15, H1L17, H1L6 HD95 NOGO Heavy chain H19L13, H19L16, US20140147435 3141 variable region H19L18, H19L14, SEQ ID NO: 85 H19L15, H19L17, H19L6, H19L11 HD96 NOGO Heavy chain H20L13, H20L16, US20140147435 3142 variable region H20L18, H20L14, SEQ ID NO: 86 H20L15, H20L17, H20L6, H20L11 HD97 NOGO Heavy chain H21L13, H21L16, US20140147435 3143 variable region H21L18, H21L14, SEQ ID NO: 87 H21L15, H21L17, H21L6, H21L11 HD98 NOGO Heavy chain H22L13, H22L16, US20140147435 3144 variable region H22L18, H22L14, SEQ ID NO: 88 H22L15, H22L17, H22L6, H22L11 HD99 NOGO Heavy chain H23L13, H23L16, US20140147435 3145 variable region H23L18, H23L14, SEQ ID NO: 89 H23L15, H23L17, H23L6, H23L11 HD100 NOGO Heavy chain H24L13, H24L16, US20140147435 3146 variable region H24L18, H24L14, SEQ ID NO: 90 H24L15, H24L17, H24L6, H24L11 HD101 NOGO Heavy chain H25L13, H25L16, US20140147435 3147 variable region H25L18, H25L14, SEQ ID NO: 91 H25L15, H25L17, H25L6, H25L11 HD102 Nogo-66 Heavy chain Antibody clone 50 US20140065155 3148 variable region SEQ ID NO: 3 HD103 Nogo-66 Heavy chain Antibody clone 51 US20140065155 3149 variable region SEQ ID NO: 5 HD104 NogoA/NiG Heavy chain 6A3-Ig4 WO2009056509 3150 variable region SEQ ID NO: 24 HD105 NogoA/NiG Heavy chain 6A3-IgG1 WO2009056509 3151 variable region SEQ ID NO: 4 HD106 RGM A Heavy chain 5F9.1-GL US20150183871 3152 variable region SEQ ID NO: 35 HD107 RGM A Heavy chain 5F9.2-GL US20150183871 3153 variable region SEQ ID NO: 36 HD108 RGM A Heavy chain 5F9.3-GL US20150183871 3154 variable region SEQ ID NO: 37 HD109 RGM A Heavy chain 5F9.4-GL US20150183871 3155 variable region SEQ ID NO: 38 HD110 RGM A Heavy chain 5F9.5-GL US20150183871 3156 variable region SEQ ID NO: 39 HD111 RGM A Heavy chain 5F9.6-GL US20150183871 3157 variable region SEQ ID NO: 40 HD112 RGM A Heavy chain 5F9.7-GL US20150183871 3158 variable region SEQ ID NO: 41 HD113 RGM A Heavy chain 5F9.8-GL US20150183871 3159 variable region SEQ ID NO: 42 HD114 RGM A Heavy chain 5F9.9-GL US20150183871 3160 variable region SEQ ID NO: 43 HD115 RGM A Heavy chain h5F9.1, h5F9.1, US2015/0183871 4259 variable region h5F9.1, h5F9.1, SEQ ID NO: 47 h5F9.1, h5F9.2, h5F9.3 HD116 RGM A Heavy chain h5F9.3, h5F9.9, US2015/0183871 4260 variable region h5F9.25 SEQ ID NO: 53 HD117 RGM A Heavy chain h5F9.4, h5F9.10, US2015/0183871 4261 variable region h5F9.26 SEQ ID NO: 54 HD118 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 HD119 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 HD120 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 HD121 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 HD122 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 HD123 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 HD124 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 HD125 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 HD126 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 HD127 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 HD128 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 HD129 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 HD130 RGMa Heavy chain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 HD131 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 HD132 NOGO Heavy chain 2A10 construct WO2007003421 3181 variable region SEQ ID NO: 77 humanized construct H1 HD133 NOGO Heavy chain 2A10 construct WO2007003421 3182 variable region SEQ ID NO: 14 humanized construct H14 HD134 NOGO Heavy chain 2A10 construct WO2007003421 3183 variable region SEQ ID NO: 15 humanized construct H15 HD135 NOGO Heavy chain 2A10 construct WO2007003421 3184 variable region SEQ ID NO: 16 humanized construct H16 HD136 NOGO Heavy chain 2A10 construct WO2007003421 3185 variable region SEQ ID NO: 17 humanized construct H17 HD137 NOGO Heavy chain 2A10 construct WO2007003421 3186 variable region SEQ ID NO: 18 humanized construct H18 HD138 NOGO Heavy chain 2A10 construct WO2007003421 3187 variable region SEQ ID NO: 85 humanized construct H19 HD139 NOGO Heavy chain 2A10 construct WO2007003421 3188 variable region SEQ ID NO: 86 humanized construct H20 HD140 NOGO Heavy chain 2A10 construct WO2007003421 3189 variable region SEQ ID NO: 87 humanized construct H21 HD141 NOGO Heavy chain 2A10 construct WO2007003421 3190 variable region SEQ ID NO: 88 humanized construct H22 HD142 NOGO Heavy chain 2A10 construct WO2007003421 3191 variable region SEQ ID NO: 89 humanized construct H23 HD143 NOGO Heavy chain 2A10 construct WO2007003421 3192 variable region SEQ ID NO: 90 humanized construct H24 HD144 NOGO Heavy chain 2A10 construct WO2007003421 3193 variable region SEQ ID NO: 91 humanized construct H25 HD145 NOGO Heavy chain 2A10 construct WO2007003421 3194 variable region SEQ ID NO: 11 humanized construct H5 HD146 NOGO Heavy chain 2A10 construct WO2007003421 3195 variable region SEQ ID NO: 12 humanized construct H6 HD147 NOGO Heavy chain 2A10 construct WO2007003421 3196 variable region SEQ ID NO: 13 humanized construct H700 HD148 amyloids Light chain #118 WO2010012004 3242 SEQ ID NO: 10 HD149 amyloids Light chain #121 WO2010012004 3243 SEQ ID NO: 12 HD150 amyloids Light chain #201 WO2010012004 3244 SEQ ID NO: 14 HD151 amyloids Light chain #204 WO2010012004 3245 SEQ ID NO: 15 HD152 amyloids Light chain #205 WO2010012004 3246 SEQ ID NO: 17 HD153 NOGO Light chain H6L13 FL, H19L13 US20140147435 3257 FL, H20L13 FL, SEQ ID NO: 35 H21L13 FL, H25L13 FL HD154 NOGO Light chain H16L16 FL, H19L16 US20140147435 3258 FL, H20L16 FL, SEQ ID NO: 38 H21L16 FL, H25L16 FL, H18L16 FL HD155 NOGO Light chain H16L18 FL, H19L18 US20140147435 3259 FL, H20L18 FL, SEQ ID NO: 40 H21L18 FL, H25L18 FL HD156 Nogo receptor- Light chain 7E11 US20090215691 3260 1 SEQ ID NO: 15 HD157 Nogo receptor- Light chain 7E11 US20090215691 3261 1 SEQ ID NO: 17 HD158 trk-C (NT-3 Light chain 2250 U.S. Pat. No. 7,615,383 3262 trkC ligand) SEQ ID NO: 49 HD159 trk-C (NT-3 Light chain 2253 U.S. Pat. No. 7,615,383 3263 trkC ligand) SEQ ID NO: 50 HD160 trk-C (NT-3 Light chain 2256 U.S. Pat. No. 7,615,383 3264 trkC ligand) SEQ ID NO: 51 HD161 trk-C (NT-3 Light chain 6.1.2 U.S. Pat. No. 7,615,383 3265 trkC ligand) SEQ ID NO: 52 HD162 trk-C (NT-3 Light chain 6.4.1 U.S. Pat. No. 7,615,383 3266 trkC ligand) SEQ ID NO: 53 HD163 trk-C (NT-3 Light chain 2345 U.S. Pat. No. 7,615,383 3267 trkC ligand) SEQ ID NO: 54 HD164 trk-C (NT-3 Light chain 2349 U.S. Pat. No. 7,615,383 3268 trkC ligand) SEQ ID NO: 55 HD165 many Light chain fusion H21L13, H21L16, U.S. Pat. No. 8,053,569 3275 protein H21L18, H21L14, SEQ ID NO: 31 H21L15, H21L17, H21L6, H21L11 HD166 many Light chain fusion H23L13, H23L16, U.S. Pat. No. 8,053,569 3276 protein H23L18, H23L14, SEQ ID NO: 36 H23L15, H23L17, H23L6, H23L11 HD167 NOGO Light chain 2A10 construct WO2007003421 3277 humanized SEQ ID NO: 80 construct L11 HD168 NOGO Light chain 2A10 construct WO2007003421 3278 humanized SEQ ID NO: 35 construct L13 HD169 NOGO Light chain 2A10 construct WO2007003421 3279 humanized SEQ ID NO: 36 construct L14 HD170 NOGO Light chain 2A10 construct WO2007003421 3280 humanized SEQ ID NO: 37 construct L15 HD171 NOGO Light chain 2A10 construct WO2007003421 3281 humanized SEQ ID NO: 38 construct L16 HD172 NOGO Light chain 2A10 construct WO2007003421 3282 humanized SEQ ID NO: 39 construct L17 HD173 NOGO Light chain 2A10 construct WO2007003421 3283 humanized SEQ ID NO: 40 construct L18 HD174 NOGO Light chain 2A10 construct WO2007003421 3284 humanized SEQ ID NO: 34 construct L6 HD175 RTN4 Light chain IgG4, Atinumab U.S. Pat. No. 8,163,285 3285 immunomodulator SEQ ID NO: 25 HD176 huntingtin Light chain single US20050226863 4262 protein domain SEQ ID NO: 1 HD177 huntingtin Light chain single VL12.3 US20050226863 4263 protein domain SEQ ID NO: 10 HD178 huntingtin Light chain single US20050226863 4264 protein domain SEQ ID NO: 2 HD179 huntingtin Light chain single US20050226863 4265 protein domain SEQ ID NO: 3 HD180 huntingtin Light chain single US20050226863 4266 protein domain SEQ ID NO: 4 HD181 amyloid Light chain F11G3 U.S. Pat. No. 9,125,846 3315 oligomers variable region SEQ ID NO: 12 HD182 DR6 and P75 Light chain M73-C04 WO2010062904 3316 variable region SEQ ID NO: 102 HD183 DR6 and P75 Light chain 1P1D6.3 WO2010062904 3317 variable region SEQ ID NO: 112 HD184 DR6 and P75 Light chain M50-H02 WO2010062904 3318 variable region SEQ ID NO: 12 HD185 DR6 and P75 Light chain 1P2F2.1 WO2010062904 3319 variable region SEQ ID NO: 122 HD186 DR6 and P75 Light chain 1P5D10.2 WO2010062904 3320 variable region SEQ ID NO: 132 HD187 DR6 and P75 Light chain M51-H09 WO2010062904 3321 variable region SEQ ID NO: 22 HD188 DR6 and P75 Light chain M53-E04 WO2010062904 3322 variable region SEQ ID NO: 32 HD189 DR6 and P75 Light chain M53-F04 WO2010062904 3323 variable region SEQ ID NO: 42 HD190 DR6 and P75 Light chain M62-B02 WO2010062904 3324 variable region SEQ ID NO: 52 HD191 DR6 and P75 Light chain M63-E10 WO2010062904 3325 variable region SEQ ID NO: 62 HD192 DR6 and P75 Light chain M66-B03 WO2010062904 3326 variable region SEQ ID NO: 72 HD193 DR6 and P75 Light chain M67-G02 WO2010062904 3327 variable region SEQ ID NO: 82 HD194 DR6 and P75 Light chain M72-F03 WO2010062904 3328 variable region SEQ ID NO: 92 HD195 LPG (lyso- Light chain #7 U.S. Pat. No. 8,591,902 3329 phosphatidyl- variable region SEQ ID NO: 17 glucoside) HD196 LPG (lyso- Light chain #15 U.S. Pat. No. 8,591,902 3330 phosphatidyl- variable region SEQ ID NO: 7 glucoside) HD197 MAG Light chain U.S. Pat. No. 8,071,731 3331 variable region SEQ ID NO: 16 HD198 MAG Light chain U.S. Pat. No. 8,071,731 3332 variable region SEQ ID NO: 17 HD199 MAG Light chain U.S. Pat. No. 8,071,731 3333 variable region SEQ ID NO: 18 HD200 MAG Light chain U.S. Pat. No. 8,071,731 3334 variable region SEQ ID NO: 19 HD201 MAI (myelin Light chain WO2013158748 3335 associated variable region SEQ ID NO: 11 inhibitor) HD202 MAI (myelin Light chain WO2013158748 3336 associated variable region SEQ ID NO: 27 inhibitor) HD203 NOGO Light chain H1L6, H5L6, H6L6, US20140147435 3338 variable region H14L6, H15L6, SEQ ID NO: 19 H16L6, H17L6, H18L6, H19L6, H20L6, H21L6, H22L6, H23L6, H24L6, H25L6, H700L6 HD204 NOGO Light chain H1L13, H5L13, US20140147435 3339 variable region H6L13, H14L13, SEQ ID NO: 20 H15L13, H16L13, H17L13, H18L13, H19L13, H20L13, H21L13, H22L13, H23L13, H24L13, H25L13, H700L13 HD205 NOGO Light chain H1L14, H5L14, US20140147435 3340 variable region H6L14, H14L14, SEQ ID NO: 21 H15L14, H16L14, H17L14, H18L14, H19L14, H20L14, H21L14, H22L14, H23L14, H24L14, H25L14, H700L14 HD206 NOGO Light chain H1L15, H5L15, US20140147435 3341 variable region H6L15, H14L15, SEQ ID NO: 22 H15L15, H16L15, H17L15, H18L15, H19L15, H20L15, H21L15, H22L15, H23L15, H24L15, H25L15, H700L15 HD207 NOGO Light chain H1L16, H5L16, US20140147435 3342 variable region H6L16, H14L16, SEQ ID NO: 23 H15L16, H16L16, H17L16, H18L16, H19L16, H20L16, H21L16, H22L16, H23L16, H24L16, H25L16, H700L16 HD208 NOGO Light chain H1L17, H5L17, US20140147435 3343 variable region H6L17, H14L17, SEQ ID NO: 24 H15L17, H16L17, H17L17, H18L17, H19L17, H20L17, H21L17, H22L17, H23L17, H24L17, H25L17, H700L17 HD209 NOGO Light chain H1L18, H5L18, US20140147435 3344 variable region H6L18, H14L18, SEQ ID NO: 25 H15L18, H16L18, H17L18, H18L18, H19L18, H20L18, H21L18 H22L18, H23L18, H24L18, H25L18, H700L18 HD210 NOGO Light chain H5L11, H6L11, US20140147435 3345 variable region H14L11, H15L11, SEQ ID NO: 78 H16L11, H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 HD211 Nogo-66 Light chain Antibody clone 50 US20140065155 3346 variable region SEQ ID NO: 4 HD212 Nogo-66 Light chain Antibody clone 51 US20140065155 3347 variable region SEQ ID NO: 6 HD213 NogoA/NiG Light chain 6A3-Ig4 WO2009056509 3348 variable region SEQ ID NO: 25 HD214 NogoA/NiG Light chain 6A3-IgG1 WO2009056509 3349 variable region SEQ ID NO: 5 HD215 RGM A Light chain 5F9.1-GL, 5F9.1-GL, US20150183871 3350 variable region 5F9.1-GL, 5F9.1-GL, SEQ ID NO: 44 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, h5F9.4, h5F9.11, h5F9.12 HD216 RGM A Light chain 5F9.2-GL, 5F9.2-GL, US20150183871 3351 variable region 5F9.2-GL, 5F9.2-GL, SEQ ID NO: 45 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, h5F9.5, h5F9.19, h5F9.20 HD217 RGM A Light chain 5F9.3-GL, 5F9.3-GL, US20150183871 3352 variable region 5F9.3-GL, 5F9.3-GL, SEQ ID NO: 46 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, h5F9.6, h5F9.21, h5F9.22 HD218 RGM A Light chain h5F9.5, h5F9.6, US20150183871 3353 variable region h5F9.7, h5F9.8, SEQ ID NO: 48 h5F9.9, h5F9.10 HD219 RGM A Light chain h5F9.11, h5F9.19, US20150183871 3354 variable region h5F9.21 SEQ ID NO: 49 HD220 RGM A Light chain h5F9.12, h5F9.20, US20150183871 3355 variable region h5F9.22, h5F9.23, SEQ ID NO: 50 h5F9.25, h5F9.25, h5F9.26 HD221 RGM A Light chain h5F9.1, h5F9.7, US20150183871 3356 variable region h5F9.23 SEQ ID NO: 51 HD222 RGM A Light chain h5F9.2, h5F9.8, US20150183871 3357 variable region h5F9.25 SEQ ID NO: 52 HD223 RGMa Light chain AE12-15 US20140023659 3358 variable region SEQ ID NO: 103 HD224 RGMa Light chain AE12-20 US20140023659 3359 variable region SEQ ID NO: 111 HD225 RGMa Light chain AE12-21 US20140023659 3360 variable region SEQ ID NO: 119 HD226 RGMa Light chain AE12-23 US20140023659 3361 variable region SEQ ID NO: 127 HD227 RGMa Light chain AE12-2 US20140023659 3362 variable region SEQ ID NO: 13 HD228 RGMa Light chain AE12-24 US20140023659 3363 variable region SEQ ID NO: 135 HD229 RGMa Light chain AE12-3 US20140023659 3364 variable region SEQ ID NO: 21 HD230 RGMa Light chain AE12-4 US20140023659 3365 variable region SEQ ID NO: 29 HD231 RGMa Light chain AE12-5 US20140023659 3366 variable region SEQ ID NO: 37 HD232 RGMa Light chain AE12-6 US20140023659 3367 variable region SEQ ID NO: 45 HD233 RGMa Light chain AE12-1 US20140023659 3368 variable region SEQ ID NO: 5 HD234 RGMa Light chain AE12-7 US20140023659 3369 variable region SEQ ID NO: 53 HD235 RGMa Light chain AE12-8 US20140023659 3370 variable region SEQ ID NO: 61 HD236 RGMa Light chain AE12-13 US20140023659 3371 variable region SEQ ID NO: 95 HD237 NOGO Light chain 2A10 construct WO2007003421 3375 variable region SEQ ID NO: 78 humanized construct L11 HD238 NOGO Light chain 2A10 construct WO2007003421 3376 variable region SEQ ID NO: 20 humanized construct L13 HD239 NOGO Light chain 2A10 construct WO2007003421 3377 variable region SEQ ID NO: 21 humanized construct L14 HD240 NOGO Light chain 2A10 construct WO2007003421 3378 variable region SEQ ID NO: 22 humanized construct L15 HD241 NOGO Light chain 2A10 construct WO2007003421 3379 variable region SEQ ID NO: 23 humanized construct L16 HD242 NOGO Light chain 2A10 construct WO2007003421 3380 variable region SEQ ID NO: 24 humanized construct L17 HD243 NOGO Light chain 2A10 construct WO2007003421 3381 variable region SEQ ID NO: 25 humanized construct L18 HD244 NOGO Light chain 2A10 construct WO2007003421 3382 variable region SEQ ID NO: 19 humanized construct L6 HD245 HTT Leccrf, J. M. et al., 4267 Human single-chain Fv intrabodies counteract in situ huntingtin aggregation in cellular models of Huntington's disease, Proc. Natl. Acad. Sci. U.S.A. 98 (8), 4764-4769 (2001), NCBI Accession # ACA53373.1

    Muscle Disease Antibodies

    [0291] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the muscle disease payload antibody polypeptides listed in Table 6 (MUS1-MUS485; SEQ ID NO: 2948-2970, 3018-3046, 3056-3076, 3110-3130, 3132-3177, 3181-3196, 3242-3268, 327.5-3285, 3315-3336, 3338-3371, 3375-3382, 4268-4494). A non-exhaustive listing of muscle diseases includes Multiple System Atrophy (MSA), Amyotrophic Lateral Sclerosis (ALS) and Duchenne Muscular Dystrophy (DMD).

    TABLE-US-00006 TABLE 6 Muscle Disease Antibodies Antibody SEQ ID No. Target Description Antibody Name Reference Information NO MUS1 amyloid consensus M13 g3p, fd g3p, fl US20150376239 2948 proteins sequence g3p SEQ ID NO: 4 MUS2 amyloid consensus I2-2 g3p, Ike g3p US20150376239 2949 proteins sequence SEQ ID NO: 7 MUS3 118-126 of - constant region IgG1 US20150259404 2950 synuclein SEQ ID NO: 38 MUS4 amyloid Fusion protein M13 g3p US20150376239 2951 proteins SEQ ID NO: 1 MUS5 amyloid Fusion protein Construct 5 US20150376239 2952 proteins SEQ ID NO: 11 MUS6 amyloid Fusion protein Construct 6 US20150376239 2953 proteins SEQ ID NO: 13 MUS7 amyloid Fusion protein fd N2 US20150376239 2954 proteins SEQ ID NO: 14 MUS8 amyloid Fusion protein fl N2 US20150376239 2955 proteins SEQ ID NO: 15 MUS9 amyloid Fusion protein M13 N2 US20150376239 2956 proteins SEQ ID NO: 16 MUS10 amyloid Fusion protein Ike N2 US20150376239 2957 proteins SEQ ID NO: 17 MUS11 amyloid Fusion protein 12-2 N2 US20150376239 2958 proteins SEQ ID NO: 18 MUS12 amyloid Fusion protein Ifl N2 US20150376239 2959 proteins SEQ ID NO: 19 MUS13 amyloid Fusion protein fd g3p US20150376239 2960 proteins SEQ ID NO: 2 MUS14 amyloid Fusion protein Construct 3 US20150376239 2961 proteins SEQ ID NO: 20 MUS15 amyloid Fusion protein Construct 3m g3p US20150376239 2962 proteins portion SEQ ID NO: 24 MUS16 amyloid Fusion protein Ifl g3p US20150376239 2963 proteins SEQ ID NO: 29 MUS17 amyloid Fusion protein fl g3p US20150376239 2964 proteins SEQ ID NO: 3 MUS18 amyloid Fusion protein fd g3p US20150376239 2965 proteins SEQ ID NO: 30 MUS19 amyloid Fusion protein Construct 8, rs-g3p US20150376239 2966 proteins (Ifl-N1N2)-hlgG1- SEQ ID NO: 31 Fc MUS20 amyloid Fusion protein I2-2 g3p US20150376239 2967 proteins SEQ ID NO: 5 MUS21 amyloid Fusion protein Ike g3p US20150376239 2968 proteins SEQ ID NO: 6 MUS22 amyloid Fusion protein Ifl g3p US20150376239 2969 proteins SEQ ID NO: 8 MUS23 amyloid Fusion protein Construct 4 US20150376239 2970 proteins SEQ ID NO: 9 MUS24 ACVR2B Heavy chain H6L4. H6L5, H6L6 U.S. Pat. No. 8,388,968 4268 (SMA - muscle SEQ ID NO: 146 growth) MUS25 ACVR2B Heavy chain U.S. Pat. No. 8,388,968 4269 (SMA - muscle SEQ ID NO: 146 growth) MUS26 amyloids Heavy chain #118 WO2010012004 3018 SEQ ID NO: 11 MUS27 amyloids Heavy chain #121 WO2010012004 3019 SEQ ID NO: 13 MUS28 amyloids Heavy chain #204 WO2010012004 3020 SEQ ID NO: 16 MUS29 amyloids Heavy chain #205 WO2010012004 3021 SEQ ID NO: 18 MUS30 EAG1 Heavy chain chimeric ImAb3 WO2006037604 3022 SEQ ID NO: 12 MUS31 EAG1 Heavy chain chimeric ImAb4 WO2006037604 3023 SEQ ID NO: 16 MUS32 EAG1 Heavy chain HC-lmAb3-humVH3- WO2006037604 3024 72 SEQ ID NO: 20 MUS33 EAG1 Heavy chain HC-lmAb4-humVH4- WO2006037604 3025 59 SEQ ID NO: 24 MUS34 EAG1 Heavy chain HC-lmAb3-humVH3 WO2006037604 3026 23 SEQ ID NO: 28 MUS35 EAG1 Heavy chain HC-lmAb3-humVH2 WO2006037604 3027 26 SEQ ID NO: 32 MUS36 EAG1 Heavy chain HC-lmAb4-humVH1- WO2006037604 3028 3 SEQ ID NO: 36 MUS37 EAG1 Heavy chain ImAb4 WO2006037604 3029 SEQ ID NO: 4 MUS38 EAG1 Heavy chain ImAb3 WO2006037604 3030 SEQ ID NO: 8 MUS39 GDF-8 Heavy chain 358-22 US20130287762 4270 SEQ ID NO: 10 MUS40 GDF-8 Heavy chain 358-11-M1 US20130287762 4271 SEQ ID NO: 16 MUS41 GDF-8 Heavy chain 358-22-M1 US20130287762 4272 SEQ ID NO: 4 MUS42 growth Heavy chain 4273 differentiation factor 8 MUS43 growth Heavy chain Domagrozumab 4274 differentiation factor 8 MUS44 MAG Heavy chain 4275 MUS45 MSTN Heavy chain H24L13, H24L16, 4276 H24L18, H24L14, H24L15, H24L17, H24L6, H24L11 MUS46 myostatin Heavy chain NI-204.11F11 US20110256132 4277 SEQ ID NO: 26 MUS47 myostatin Heavy chain NI-204.67E12 US20110256132 4278 SEQ ID NO: 28 MUS48 myostatin Heavy chain NI-204.6H1 US20110256132 4279 SEQ ID NO: 29 MUS49 myostatin Heavy chain NI-204.6H1 US20110256132 4280 SEQ ID NO: 30 MUS50 Myostatin Heavy chain 312-19, 312-19-M1 US20130142788 4281 SEQ ID NO: 123 MUS51 Myostatin Heavy chain 591-33, 591-33-M1 US20130142788 4282 SEQ ID NO: 125 MUS52 Myostatin Heavy chain 114-41, 114-41-M1 US20130142788 4283 SEQ ID NO: 127 MUS53 Myostatin Heavy chain 595-16, 595-16-M1 US20130142788 4284 SEQ ID NO: 138 MUS54 Myostatin Heavy chain 591-37, 591-37-M1 US20130142788 4285 SEQ ID NO: 139 MUS55 Myostatin Heavy chain 358-11, 358-11-M1 US20130142788 4286 SEQ ID NO: 140 MUS56 Myostatin Heavy chain 358-22, 358-22-M1 US20130142788 4287 SEQ ID NO: 141 MUS57 Myostatin Heavy chain 597-120, 597-120-M1 US20130142788 4288 SEQ ID NO: 142 MUS58 Myostatin Heavy chain 311-3 US20130142788 4289 SEQ ID NO: 143 MUS59 Myostatin Heavy chain 311-3-M1 US20130142788 4290 SEQ ID NO: 144 MUS60 Myostatin Heavy chain 312-19-M1 US20130142788 4291 SEQ ID NO: 26 MUS61 Myostatin Heavy chain 114-41 US20130142788 4292 SEQ ID NO: 30 MUS62 Myostatin Heavy chain 311-3-M1 US20130142788 4293 SEQ ID NO: 35 MUS63 Myostatin Heavy chain 312-19 US20130142788 4294 SEQ ID NO: 36 MUS64 Myostatin Heavy chain 591-33 US20130142788 4295 SEQ ID NO: 38 MUS65 Myostatin Heavy chain 591-33-M1 US20130142788 4296 SEQ ID NO: 39 MUS66 Myostatin Heavy chain 312-56 US20130142788 4297 SEQ ID NO: 98 MUS67 myostatin Heavy chain NI-205.21G2 US20130209489 4298 antagonists SEQ ID NO: 11 MUS68 myostatin Heavy chain NI-205.8A2 US20130209489 4299 antagonists SEQ ID NO: 12 MUS69 myostatin Heavy chain NI-205.8A2 US20130209489 4300 antagonists SEQ ID NO: 13 MUS70 myostatin Heavy chain NI-205.15F12 US20130209489 4301 antagonists SEQ ID NO: 14 MUS71 myostatin Heavy chain NI-205.15F12 US20130209489 4302 antagonists SEQ ID NO: 15 MUS72 myostatin Heavy chain NI-205.113C4 US20130209489 4303 antagonists SEQ ID NO: 16 MUS73 myostatin Heavy chain NI-205.113C4 US20130209489 4304 antagonists SEQ ID NO: 17 MUS74 myostatin Heavy chain NI-205.25F3 US20130209489 4305 antagonists SEQ ID NO: 18 MUS75 myostatin Heavy chain NT-205.25F3 US20130209489 4306 antagonists SEQ ID NO: 19 MUS76 NOGO Heavy chain HI9L13 FL, H19L16 US20140147435 3034 FL, H19L18 FL SEQ ID NO: 92 MUS77 NOGO Heavy chain H20L13 FL, H20L16 US20140147435 3035 FL, H20L18 FL SEQ ID NO: 93 MUS78 NOGO Heavy chain H21L13 FL, H21L16 US20140147435 3036 FL, H21L18 FL SEQ ID NO: 94 MUS79 NOGO Heavy chain H25L13 FL, H25L16 US20140147435 3037 FL, H25L18 FL SEQ ID NO: 98 MUS80 NOGO Heavy chain H6L13 FL US20140147435 3031 SEQ ID NO: 27 MUS81 NOGO Heavy chain H16L16 FL, H16L18 US20140147435 3032 FL SEQ ID NO: 31 MUS82 NOGO Heavy chain H18L16 FL US20140147435 3033 SEQ ID NO: 33 MUS83 Nogo receptor- Heavy chain 5B10 US20090215691 3038 1 SEQ ID NO: 16 MUS84 Nogo receptor- Heavy chain 5B10 US20090215691 3039 1 SEQ ID NO: 18 MUS85 RTN4 Heavy chain SEQ ID NO: 38 4307 U.S. Pat. No. 7,780,964 MUS86 S1P4 Heavy chain WO2015057939 4308 SEQ ID NO: 39 MUS87 trk-C (NT-3 Heavy chain 2250 U.S. Pat. No. 7,615,383 3040 trkC ligand) SEQ ID NO: 42 MUS88 trk-C (NT-3 Heavy chain 2253 U.S. Pat. No. 7,615,383 3041 trkC ligand) SEQ ID NO: 43 MUS89 trk-C (NT-3 Heavy chain 2256 U.S. Pat. No. 7,615,383 3042 trkC ligand) SEQ ID NO: 44 MUS90 trk-C (NT-3 Heavy chain 6.1.2 U.S. Pat. No. 7,615,383 3043 trkC ligand) SEQ ID NO: 45 MUS91 trk-C (NT-3 Heavy chain 6.4.1 U.S. Pat. No. 7,615,383 3044 trkC ligand) SEQ ID NO: 46 MUS92 trk-C (NT-3 Heavy chain 2345 U.S. Pat. No. 7,615,383 3045 trkC ligand) SEQ ID NO: 47 MUS93 trk-C (NT-3 Heavy chain 2349 U.S. Pat. No. 7,615,383 3046 trkC ligand) SEQ ID NO: 48 MUS94 myostatin Heavy chain NI-205.87E7 US20130209489 4309 antagonists consensus SEQ ID NO: 20 MUS95 GDF-8 Heavy chain U.S. Pat. No. 8,956,608 4310 constant region SEQ ID NO: 19 MUS96 many - growth Heavy chain fusion H19L13, H19L16, U.S. Pat. No. 8,053,569 3056 factors (to protein H19L18, H19L14, SEQ ID NO: 25 increase H19L15, H19L17, transport across H19L6, H19L11 BBB) MUS97 many - growth Heavy chain fusion H20L13, H20L16, U.S. Pat. No. 8,053,569 3057 factors (to protein H20L18, H20L14, SEQ ID NO: 28 increase H20L15, H20L17, transport across H20L6, H20L11 BBB) MUS98 many - growth Heavy chain fusion H22L13, H22L16, U.S. Pat. No. 8,053,569 3058 factors (to protein H22L18, H22L14, SEQ ID NO: 34 increase H22L15, H22L17, transport across H22L6, H22L11 BBB) MUS99 many - growth Heavy chain fusion H5L11, H6L11, U.S. Pat. No. 8,053,569 3059 factors (to protein H14L11, H15L11, SEQ ID NO: 24 increase H16L11, H17L11, transport across H18L11, H19L11, BBB) H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 MUS100 NOGO Heavy chain 2A10 construct WO2007003421 3060 humanized SEQ ID NO: 79 construct H1 MUS101 NOGO Heavy chain 2A10 construct WO2007003421 3061 humanized SEQ ID NO: 29 construct H14 MUS102 NOGO Heavy chain 2A10 construct WO2007003421 3062 construct H15 SEQ ID NO: 30 MUS103 NOGO Heavy chain 2A10 construct WO2007003421 3063 humanized SEQ ID NO: 31 construct H16 MUS104 NOGO Heavy chain 2A10 construct WO2007003421 3064 humanized SEQ ID NO: 32 construct H17 MUS105 NOGO Heavy chain 2A10 construct WO2007003421 3065 humanized SEQ ID NO: 33 construct H18 MUS106 NOGO Heavy chain 2A10 construct WO2007003421 3066 construct H19 SEQ ID NO: 92 MUS107 NOGO Heavy chain 2A10 construct WO2007003421 3067 humanized SEQ ID NO: 93 construct H20 MUS108 NOGO Heavy chain 2A10 construct WO2007003421 3068 humanized SEQ ID NO: 94 construct H21 MUS109 NOGO Heavy chain 2A10 construct WO2007003421 3069 humanized SEQ ID NO: 95 construct H22 MUS110 NOGO Heavy chain 2A10 construct WO2007003421 3070 humanized SEQ ID NO: 96 construct H23 MUS111 NOGO Heavy chain 2A10 construct WO2007003421 3071 humanized SEQ ID NO: 97 construct H24 MUS112 NOGO Heavy chain 2A10 construct WO2007003421 3072 humanized SEQ ID NO: 98 construct H25 MUS113 NOGO Heavy chain 2A10 construct WO2007003421 3073 humanized SEQ ID NO: 26 construct H5 MUS114 NOGO Heavy chain 2A10 construct WO2007003421 3074 humanized SEQ ID NO: 27 construct H6 MUS115 NOGO Heavy chain 2A10 construct WO2007003421 3075 construct H700 SEQ ID NO: 28 MUS116 RTN4 (NOGO) Heavy chain IgG4, Atinumab U.S. Pat. No. 8,163,285 3076 immunomodulator SEQ ID NO: 24 MUS117 amyloid Heavy chain F11G3 U.S. Pat. No. 9,125,846 3110 oligomers variable region SEQ ID NO: 11 MUS118 differentiation Heavy chain H8L4. H8L5, H8L6 US20140023638 4311 factor 8 variable region SEQ ID NO: 17 (GDF8) MUS119 DR6 and P75 Heavy chain M62-B02 WO2010062904 3122 variable region SEQ ID NO: 47 MUS120 DR6 and P75 Heavy chain M63-E10 WO2010062904 3123 variable region SEQ ID NO: 57 MUS121 DR6 and P75 Heavy chain M66-B03 WO2010062904 3111 variable region SEQ ID NO: 67 MUS122 DR6 and P75 Heavy chain M50-H01 WO2010062904 3112 variable region SEQ ID NO: 7 MUS123 DR6 and P75 Heavy chain M67-G02 WO2010062904 3113 variable region SEQ ID NO: 77 MUS124 DR6 and P75 Heavy chain M72-F03 WO2010062904 3114 variable region SEQ ID NO: 87 MUS125 DR6 and P75 Heavy chain M73-C04 WO2010062904 3115 variable region SEQ ID NO: 97 MUS126 DR6 and P75 Heavy chain 1P1D6.3 WO2010062904 3116 variable region SEQ ID NO: 107 MUS127 DR6 and P75 Heavy chain 1P2F2.1 WO2010062904 3117 variable region SEQ ID NO: 117 MUS128 DR6 and P75 Heavy chain 1P5D10.2 WO2010062904 3118 variable region SEQ ID NO: 127 MUS129 DR6 and P75 Heavy chain M51-H09 WO2010062904 3119 variable region SEQ ID NO: 17 MUS130 DR6 and P75 Heavy chain M53-E04 WO2010062904 3120 variable region SEQ ID NO: 27 MUS131 DR6 and P75 Heavy chain M53-F04 WO2010062904 3121 variable region SEQ ID NO: 37 MUS132 GDF-8 Heavy chain 595-16 U.S. Pat. No. 8,956,608 4312 variable region SEQ ID NO: 26 MUS133 GDF-8 Heavy chain 12A5-10HC U.S. Pat. No. 8,956,608 4313 variable region SEQ ID NO: 7 MUS134 growth Heavy chain U.S. Pat. No. 8,840,894 4314 differentiation variable region SEQ ID NO: 360 factor 8 MUS135 LPG (lyso- Heavy chain #7 U.S. Pat. No. 8,591,902 3124 phosphatidyl- variable region SEQ ID NO: 18 glucoside) MUS136 LPG (lyso- Heavy chain #15 U.S. Pat. No. 8,591,902 3125 phosphatidyl- variable region SEQ ID NO: 8 glucoside) MUS137 MAG Heavy chain U.S. Pat. No. 8,071,731 3126 variable region SEQ ID NO: 13 MUS138 MAG Heavy chain U.S. Pat. No. 8,071,731 3127 variable region SEQ ID NO: 14 MUS139 MAG Heavy chain U.S. Pat. No. 8,071,731 3128 variable region SEQ ID NO: 15 MUS140 MAI (myelin Heavy chain WO2013158748 3129 associated variable region SEQ ID NO: 1 inhibitor) MUS141 MAI (myelin Heavy chain WO2013158748 3130 associated variable region SEQ ID NO: 17 inhibitor) MUS142 myostatin Heavy chain NI-204.7B3 SEQ ID 6 WO 4315 variable region 2006107611 MUS143 myostatin Heavy chain NI-204.10A8 US20110256132 4316 variable region SEQ ID NO: 14 MUS144 myostatin Heavy chain NI-204.10D12 US20110256132 4317 variable region SEQ ID NO: 19 MUS145 myostatin Heavy chain NI-204.10D12 US20110256132 4318 variable region SEQ ID NO: 20 MUS146 myostatin Heavy chain NI-104.12G7 US20110256132 4319 variable region SEQ ID NO: 22 MUS147 myostatin Heavy chain NI-204.10A8 US20110256132 4320 variable region SEQ ID NO: 23 MUS148 myostatin Heavy chain NI-104.12G7 US20110256132 4321 variable region SEQ ID NO: 25 MUS149 myostatin Heavy chain 312-56 US20110256132 4322 variable region SEQ ID NO: 8 MUS150 NOGO Heavy chain H20L13, H20L16, US20140147435 3142 variable region H20L18, H20L14, SEQ ID NO: 86 H20L15, H20L17, H20L6, H20L11 MUS151 NOGO Heavy chain H21L13, H21L16, US20140147435 3143 variable region H21L18, H21L14, SEQ ID NO: 87 H21L15, H21L17, H21L6, H21L11 MUS152 NOGO Heavy chain H22L13, H22L16, US20140147435 3144 variable region H22L18, H22L14, SEQ ID NO: 88 H22L15, H22L17, H22L6, H22L11 MUS153 NOGO Heavy chain H23L13, H23L16, US20140147435 3145 variable region H23L18, H23L14, SEQ ID NO: 89 H23L15, H23L17, H23L6, H23L11 MUS154 NOGO Heavy chain H24L13, H24L16, US20140147435 3146 variable region H24L18, H24L14, SEQ ID NO: 90 H24L15, H24L17, H24L6, H24L11 MUS155 NOGO Heavy chain H25L13, H25L16, US20140147435 3147 variable region H25L18, H25L14, SEQ ID NO: 91 H25L15, H25L17, H25L6, H25L11 MUS156 NOGO Heavy chain H5L13, H5L16, US20140147435 3132 variable region H5L18, H5L14, SEQ ID NO: 11 H5L15, H5L17, H5L6, H5L11 MUS157 NOGO Heavy chain H6L13, H6L16, US20140147435 3133 variable region H6L18, H6L14, SEQ ID NO: 12 H6L15, H6L17, H6L6 MUS158 NOGO Heavy chain H700L13, H700L16, US20140147435 3134 variable region H700L18, H700L14, SEQ ID NO: 13 H700L15, H700L17, H700L6, H700L11 MUS159 NOGO Heavy chain H14L13, H14L16, US20140147435 3135 variable region H14L18, H14L14, SEQ ID NO: 14 H14L15, H14L17, H14L6, H14L11 MUS160 NOGO Heavy chain H15L13, H15L16, US20140147435 3136 variable region H15L18, H15L14, SEQ ID NO: 15 H15L15, H15L17, H15L6, H15L11 MUS161 NOGO Heavy chain H16L13, H16L16, US20140147435 3137 variable region H16L18, H16L14, SEQ ID NO: 16 H16L15, H16L17, H16L6, H16L11 MUS162 NOGO Heavy chain H17L13, H17L16, US20140147435 3138 variable region H17L18, H17L14, SEQ ID NO: 17 H17L15, H17L17, H17L6, H17L11 MUS163 NOGO Heavy chain H18L13, H18L16, US20140147435 3139 variable region H18L18, H18L14, SEQ ID NO: 18 H18L15, H18L17, H18L6, H18L11 MUS164 NOGO Heavy chain H1L13, H1L16, US20140147435 3140 variable region H1L18, H1L14, SEQ ID NO: 77 H1L15, H1L17, H1L6 MUS165 NOGO Heavy chain H19L13, H19L16, US20140147435 3141 variable region H19L18, H19L14, SEQ ID NO: 85 H19L15, H19L17, H19L6, H19L11 MUS166 Nogo-66 Heavy chain Antibody clone 50 US20140065155 3148 variable region SEQ ID NO: 3 MUS167 Nogo-66 Heavy chain Antibody clone 51 US20140065155 3149 variable region SEQ ID NO: 5 MUS168 NogoA/NiG Heavy chain 6A3-Ig4 WO2009056509 3150 variable region SEQ ID NO: 24 MUS169 NogoA/NiG Heavy chain 6A3-IgG1 WO2009056509 3151 variable region SEQ ID NO: 4 MUS170 RGM A Heavy chain 5F9.1-GL US20150183871 3152 variable region SEQ ID NO: 35 MUS171 RGM A Heavy chain 5F9.2-GL US20150183871 3153 variable region SEQ ID NO: 36 MUS172 RGM A Heavy chain 5F9.3-GL US20150183871 3154 variable region SEQ ID NO: 37 MUS173 RGM A Heavy chain 5F9.4-GL US20150183871 3155 variable region SEQ ID NO: 38 MUS174 RGM A Heavy chain 5F9.5-GL US20150183871 3156 variable region SEQ ID NO: 39 MUS175 RGM A Heavy chain 5F9.6-GL US20150183871 3157 variable region SEQ ID NO: 40 MUS176 RGM A Heavy chain 5F9.7-GL US20150183871 3158 variable region SEQ ID NO: 41 MUS177 RGM A Heavy chain 5F9.8-GL US20150183871 3159 variable region SEQ ID NO: 42 MUS178 RGM A Heavy chain 5F9.9-GL US20150183871 3160 variable region SEQ ID NO: 43 MUS179 RGM A Heavy chain h5F9.1, h5F9.1, US20150183871 3161 variable region h5F9.1, h5F9.1, SEQ ID NO: 47 h5F9.1, h5F9.2, h5F9.3 MUS180 RGM A Heavy chain h5F9.3, h5F9.9, US20150183871 3162 variable region h5F9.25 SEQ ID NO: 53 MUS181 RGM A Heavy chain h5F9.4, h5F9.10, US20150183871 3163 variable region h5F9.26 SEQ ID NO: 54 MUS182 RGMa Heavy chain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 MUS183 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 MUS184 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 MUS185 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 MUS186 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 MUS187 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 MUS188 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 MUS189 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 MUS190 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 MUS191 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 MUS192 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 MUS193 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 MUS194 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 MUS195 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 MUS196 S1P4 Heavy chain WO2015057939 4323 variable region SEQ ID NO: 7 MUS197 SOD1 Heavy chain NI205.19G5 US20140301945 4324 variable region SEQ ID NO: 12 MUS198 SOD1 Heavy chain US20140301945 4325 variable region SEQ ID NO: 16 MUS199 SOD1 Heavy chain US20140301945 4326 variable region SEQ ID NO: 20 MUS200 SOD1 Heavy chain US20140301945 4327 variable region SEQ ID NO: 24 MUS201 SOD1 Heavy chain Landogrozumab, US20140301945 4328 variable region LY2495655, LY- SEQ ID NO: 28 2495655 MUS202 SOD1 Heavy chain 2A10 construct US20140301945 4329 variable region SEQ ID NO: 32 MUS203 SOD1 Heavy chain 2A10 construct US20140301945 4330 variable region SEQ ID NO: 36 MUS204 SOD1 Heavy chain NI205.1A9 US20140301945 4331 variable region SEQ ID NO: 4 MUS205 SOD1 Heavy chain 2A10 construct US20140301945 4332 variable region SEQ ID NO: 40 MUS206 SOD1 Heavy chain 2A10 construct US20140301945 4333 variable region SEQ ID NO: 44 MUS207 SOD1 Heavy chain 2A10 construct US20140301945 4334 variable region SEQ ID NO: 48 MUS208 SOD1 Heavy chain NI205.14W3 US20140301945 4335 variable region SEQ ID NO: 8 MUS209 SOD1 Heavy chain NI-205.87E7 U.S. Pat. No. 9,109,037 4336 variable region SEQ ID NO: 1 MUS210 SOD1 Heavy chain NI205.9E12 U.S. Pat. No. 9,109,037 4337 variable region SEQ ID NO: 107 MUS211 SOD1 Heavy chain NI205.9E12 U.S. Pat. No. 9,109,037 4338 variable region SEQ ID NO: 113 MUS212 SOD1 Heavy chain NI205.98H6 U.S. Pat. No. 9,109,037 4339 variable region SEQ ID NO: 129 MUS213 SOD1 Heavy chain NI205.98H6 U.S. Pat. No. 9,109,037 4340 variable region SEQ ID NO: 131 MUS214 SOD1 Heavy chain NI205.10D3 U.S. Pat. No. 9,109,037 4341 variable region SEQ ID NO: 147 MUS215 SOD1 Heavy chain NI205.10D3 U.S. Pat. No. 9,109,037 4342 variable region SEQ ID NO: 149 MUS216 SOD1 Heavy chain NI205.44B22 U.S. Pat. No. 9,109,037 4343 variable region SEQ ID NO: 165 MUS217 SOD1 Heavy chain NI205.44B22 U.S. Pat. No. 9,109,037 4344 variable region SEQ ID NO: 167 MUS218 SOD1 Heavy chain NI-205.21G1 U.S. Pat. No. 9,109,037 4345 variable region SEQ ID NO: 17 MUS219 SOD1 Heavy chain NI205.38H2 U.S. Pat. No. 9,109,037 4346 variable region SEQ ID NO: 183 MUS220 SOD1 Heavy chain NI-205.21G1 U.S. Pat. No. 9,109,037 4347 variable region SEQ ID NO: 19 MUS221 SOD1 Heavy chain NI205.38H2 U.S. Pat. No. 9,109,037 4348 variable region SEQ ID NO: 201 MUS222 SOD1 Heavy chain NI205.36D5 U.S. Pat. No. 9,109,037 4349 variable region SEQ ID NO: 217 MUS223 SOD1 Heavy chain NI-205.68G5 U.S. Pat. No. 9,109,037 4350 variable region SEQ ID NO: 35 MUS224 SOD1 Heavy chain NI-205.68G5 U.S. Pat. No. 9,109,037 4351 variable region SEQ ID NO: 37 MUS225 SOD1 Heavy chain NI-205.20A1 U.S. Pat. No. 9,109,037 4352 variable region SEQ ID NO: 53 MUS226 SOD1 Heavy chain NI-205.20A1 U.S. Pat. No. 9,109,037 4353 variable region SEQ ID NO: 55 MUS227 SOD1 Heavy chain NI205.41D1 U.S. Pat. No. 9,109,037 4354 variable region SEQ ID NO: 71 MUS228 SOD1 Heavy chain NI205.41D1 U.S. Pat. No. 9,109,037 4355 variable region SEQ ID NO: 73 MUS229 SOD1 Heavy chain NI205.29E11 U.S. Pat. No. 9,109,037 4356 variable region SEQ ID NO: 89 MUS230 SOD1 Heavy chain NI205.29E11 U.S. Pat. No. 9,109,037 4357 variable region SEQ ID NO: 91 MUS231 TDP-43 Heavy chain 2A10 construct US20140255304 4358 variable region SEQ ID NO: 1 MUS232 TDP-43 Heavy chain 2A10 construct US20140255304 4359 variable region SEQ ID NO: 10 MUS233 TDP-43 Heavy chain 2A10 construct US20140255304 4360 variable region SEQ ID NO: 130 MUS234 TDP-43 Heavy chain 2A10 construct US20140255304 4361 variable region SEQ ID NO: 138 MUS235 TDP-43 Heavy chain 2A10 construct US20140255304 4362 variable region SEQ ID NO: 146 MUS236 TDP-43 Heavy chain 2A10 construct US20140255304 4363 variable region SEQ ID NO: 151 MUS237 TDP-43 Heavy chain 2A10 construct US20140255304 4364 variable region SEQ ID NO: 159 MUS238 TDP-43 Heavy chain 2A10 construct US20140255304 4365 variable region SEQ ID NO: 167 MUS239 TDP-43 Heavy chain 2A10 construct US20140255304 4366 variable region SEQ ID NO: 175 MUS240 TDP-43 Heavy chain 2A10 construct US20140255304 4367 variable region SEQ ID NO: 18 MUS241 TDP-43 Heavy chain H6L13 FL, H19L13 US20140255304 4368 variable region FL, H20L13 FL, SEQ ID NO: 183 H21L13 FL, H25L13 FL MUS242 TDP-43 Heavy chain H16L18 FL, H19L18 US20140255304 4369 variable region FL, H20L18 FL, SEQ ID NO: 191 H21L18 FL, H25L18 FL MUS243 TDP-43 Heavy chain H18L16 FL US20140255304 4370 variable region SEQ ID NO: 199 MUS244 TDP-43 Heavy chain H6L13, H6L16, US20140255304 4371 variable region H6L18, H6L14, SEQ ID NO: 207 H6L15, H6L17, H6L6 MUS245 TDP-43 Heavy chain H14L13, H14L16, US20140255304 4372 variable region H14L18, H14L14, SEQ ID NO: 215 H14L15, H14L17, H14L6, H14L11 MUS246 TDP-43 Heavy chain H16L13, H16L16, US20140255304 4373 variable region H16L18, H16L14, SEQ ID NO: 223 H16L15, H16L17, H16L6, H16L11 MUS247 TDP-43 Heavy chain H18L13, H18L16, US20140255304 4374 variable region H18L18, H18L14, SEQ ID NO: 231 H18L15, H18L17, H18L6, H18L11 MUS248 TDP-43 Heavy chain H1L13, H5L13, US20140255304 4375 variable region H6L13, H14L13, SEQ ID NO: 239 H15L13, H16L13, H17L13, H18L13, H19L13, H20L13, H21L13, H22L13, H23L13, H24L13, H25L13, H700L13 MUS249 TDP-43 Heavy chain H1L15, H5L15, US20140255304 4376 variable region H6L15, H14L15, SEQ ID NO: 247 H15L15, H16L15, H17L15, H18L15, H19L15, H20L15, H21L15, H22L15, H23L15, H24L15, H25L15, H700L15 MUS250 TDP-43 Heavy chain H1L17, H5L17, US20140255304 4377 variable region H6L17, H14L17, SEQ ID NO: 255 H15L17, H16L17, H17L17, H18L17, H19L17, H20L17, H21L17, H22L17, H23L17, H24L17, H25L17, H700L17 MUS251 TDP-43 Heavy chain 2A10 construct US20140255304 4378 variable region SEQ ID NO: 26 MUS252 TDP-43 Heavy chain H16L16FL, H16L18 US20140255304 4379 variable region FL SEQ ID NO: 263 MUS253 TDP-43 Heavy chain 2A10 construct US20140255304 4380 variable region SEQ ID NO: 35 MUS254 TDP-43 Heavy chain 2A10 construct US20140255304 4381 variable region SEQ ID NO: 45 MUS255 TDP-43 Heavy chain 2A10 construct US20140255304 4382 variable region SEQ ID NO: 53 MUS256 TDP-43 Heavy chain 2A10 construct US20140255304 4383 variable region SEQ ID NO: 61 MUS257 TDP-43 Heavy chain 2A10 construct US20140255304 4384 variable region SEQ ID NO: 69 MUS258 TDP-43 Heavy chain 2A10 construct US20140255304 4385 variable region SEQ ID NO: 77 MUS259 TDP-43 Heavy chain 2A10 construct US20140255304 4386 variable region SEQ ID NO: 87 MUS260 trkC Heavy chain US20070031418 4387 variable region SEQ ID NO: 1 MUS261 NOGO Heavy chain 2A10 construct WO2007003421 3181 variable region SEQ ID NO: 77 humanized construct H1 MUS262 NOGO Heavy chain 2A10 construct WO2007003421 3182 variable region SEQ ID NO: 14 humanized construct H14 MUS263 NOGO Heavy chain 2A10 construct WO2007003421 3183 variable region SEQ ID NO: 15 humanized construct H15 MUS264 NOGO Heavy chain 2A10 construct WO2007003421 3184 variable region SEQ ID NO: 16 humanized construct H16 MUS265 NOGO Heavy chain 2A10 construct WO2007003421 3185 variable region SEQ ID NO: 17 humanized construct H17 MUS266 NOGO Heavy chain 2A10 construct WO2007003421 3186 variable region SEQ ID NO: 18 humanized construct H18 MUS267 NOGO Heavy chain 2A10 construct WO2007003421 3187 variable region SEQ ID NO: 85 humanized construct H19 MUS268 NOGO Heavy chain 2A10 construct WO2007003421 3188 variable region SEQ ID NO: 86 humanized construct H20 MUS269 NOGO Heavy chain 2A10 construct WO2007003421 3189 variable region SEQ ID NO: 87 humanized construct H21 MUS270 NOGO Heavy chain 2A10 construct WO2007003421 3190 variable region SEQ ID NO: 88 humanized construct H22 MUS271 NOGO Heavy chain 2A10 construct WO2007003421 3191 variable region SEQ ID NO: 89 humanized construct H23 MUS272 NOGO Heavy chain 2A10 construct WO2007003421 3192 variable region SEQ ID NO: 90 humanized construct H24 MUS273 NOGO Heavy chain 2A10 construct WO2007003421 3193 variable region SEQ ID NO: 91 humanized construct H25 MUS274 NOGO Heavy chain 2A10 construct WO2007003421 3194 variable region SEQ ID NO: 11 humanized construct H5 MUS275 NOGO Heavy chain 2A10 construct WO2007003421 3195 variable region SEQ ID NO: 12 humanized construct H6 MUS276 NOGO Heavy chain 2A10 construct WO2007003421 3196 variable region SEQ ID NO: 13 construct H700 MUS277 ACVR2B Light chain H7L4, H7L5, H7L6 U.S. Pat. No. 8,388,968 4388 (SMA - muscle SEQ ID NO: 141 growth) MUS278 ACVR2B Light chain U.S. Pat. No. 8,388,968 4389 SEQ ID NO: 141 MUS279 amyloids Light chain #118 WO2010012004 3242 SEQ ID NO: 10 MUS280 amyloids Light chain #121 WO2010012004 3243 SEQ ID NO: 12 MUS281 amyloids Light chain #201 WO2010012004 3244 SEQ ID NO: 14 MUS282 amyloids Light chain #204 WO2010012004 3245 SEQ ID NO: 15 MUS283 amyloids Light chain #205 WO2010012004 3246 SEQ ID NO: 17 MUS284 EAG1 Light chain chimeric ImAb3 WO2006037604 3247 SEQ ID NO: 10 MUS285 EAG1 Light chain chimeric ImAb4 WO2006037604 3248 SEQ ID NO: 14 MUS286 EAG1 Light chain LC-lmAb3-humB3 WO2006037604 3249 SEQ ID NO: 18 MUS287 EAG1 Light chain ImAb4 WO2006037604 3250 SEQ ID NO: 2 MUS288 EAG1 Light chain LC-lmAb4-humA17 WO2006037604 3251 SEQ ID NO: 22 MUS289 EAG1 Light chain LC-lmAb3-humA3 WO2006037604 3252 SEQ ID NO: 26 MUS290 EAG1 Light chain LC-lmAb3-humA17 WO2006037604 3253 SEQ ID NO: 30 MUS291 EAG1 Light chain LC-lmAb4-humA5-1 WO2006037604 3254 SEQ ID NO: 34 MUS292 EAG1 Light chain LC-lmAb4-humO1 WO2006037604 3255 SEQ ID NO: 38 MUS293 EAG1 Light chain ImAb3 WO2006037604 3256 SEQ ID NO: 6 MUS294 GDF-8 Light chain 597-120-M1 US20130287762 4390 SEQ ID NO: 12 MUS295 GDF-8 Light chain 597-120 US20130287762 4391 SEQ ID NO: 18 MUS296 GDF-8 Light chain 311-3 US20130287762 4392 SEQ ID NO: 6 MUS297 growth Light chain 4393 differentiation factor 8 MUS298 growth Light chain Domagrozumab 4394 differentiation factor 8 MUS299 MAG Light chain 4395 MUS300 MSTN Light chain H25L13, H25L16, 4396 H25L18, H25L14, H25L15, H25L17, H25L6, H25L11 MUS301 Myostatin Light chain 306-155 US20130142788 4397 SEQ ID NO: 145 MUS302 Myostatin Light chain 14-173 US20130142788 4398 SEQ ID NO: 146 MUS303 Myostatin Light chain 14-173-M1 US20130142788 4399 SEQ ID NO: 147 MUS304 myostatin Light chain NI-204.67E12 US20110256132 4400 SEQ ID NO: 27 MUS305 myostatin Light chain NI-204.12G3 US20110256132 4401 SEQ ID NO: 31 MUS306 myostatin Light chain NI-204.12G3 US20110256132 4402 SEQ ID NO: 32 MUS307 myostatin Light chain NI-204.7G5 US20110256132 4403 SEQ ID NO: 33 MUS308 myostatin Light chain NI-204.7G5 US20110256132 4404 SEQ ID NO: 34 MUS309 Myostatin Light chain 114-41-M1 US20130142788 4405 SEQ ID NO: 27 MUS310 Myostatin Light chain 14-173, 14-173-M1 US20130142788 4406 SEQ ID NO: 33 MUS311 Myostatin Light chain 306-155 US20130142788 4407 SEQ ID NO: 37 MUS312 Myostatin Light chain 303-8 US20130142788 4408 SEQ ID NO: 40 MUS313 myostatin Light chain NI-204.34A3 US20130209489 4409 antagonists SEQ ID NO: 1 MUS314 myostatin Light chain NI-205.21G2 US20130209489 4410 antagonists SEQ ID NO: 10 MUS315 myostatin Light chain NI-204.25H3 US20130209489 4411 antagonists SEQ ID NO: 2 MUS316 myostatin Light chain NI-204.25H3 US20130209489 4412 antagonists SEQ ID NO: 3 MUS317 myostatin Light chain B12 US20130209489 4413 antagonists SEQ ID NO: 4 MUS318 myostatin Light chain B1 US20130209489 4414 antagonists SEQ ID NO: 5 MUS319 myostatin Light chain NI-205.3F10 US20130209489 4415 antagonists SEQ ID NO: 6 MUS320 myostatin Light chain NI-205.3F10 US20130209489 4416 antagonists SEQ ID NO: 7 MUS321 myostatin Light chain NI-205.51C1 US20130209489 4417 antagonists SEQ ID NO: 8 MUS322 myostatin Light chain NI-205.51C1 US20130209489 4418 antagonists SEQ ID NO: 9 MUS323 NOGO Light chain H6L13 FL, H19L13 US20140147435 3257 FL, H20L13 FL, SEQ ID NO: 35 H21L13 FL, H25L13 FL MUS324 NOGO Light chain H16L16 FL, H19L16 US20140147435 3258 FL, H20L16 FL, SEQ ID NO: 38 H21L16 FL, H25L16 FL, H18L16 FL MUS325 NOGO Light chain H16L18 FL, H19L18 US20140147435 3259 FL, H20L18 FL, SEQ ID NO: 40 H21L18 FL, H25L18 FL MUS326 Nogo receptor- Light chain 7E11 US20090215691 3260 1 SEQ ID NO: 15 MUS327 Nogo receptor- Light chain 7E11 US20090215691 3261 1 SEQ ID NO: 17 MUS328 RTN4 Light chain 4419 MUS329 S1P4 Light chain WO2015057939 4420 SEQ ID NO: 41 MUS330 trk-C (NT-3 Light chain 2250 U.S. Pat. No. 7,615,383 3262 trkC ligand) SEQ ID NO: 49 MUS331 trk-C (NT-3 Light chain 2253 U.S. Pat. No. 7,615,383 3263 trkC ligand) SEQ ID NO: 50 MUS332 trk-C (NT-3 Light chain 2256 U.S. Pat. No. 7,615,383 3264 trkC ligand) SEQ ID NO: 51 MUS333 trk-C (NT-3 Light chain 6.1.2 U.S. Pat. No. 7,615,383 3265 trkC ligand) SEQ ID NO: 52 MUS334 trk-C (NT-3 Light chain 6.4.1 U.S. Pat. No. 7,615,383 3266 trkC ligand) SEQ ID NO: 53 MUS335 trk-C (NT-3 Light chain 2345 U.S. Pat. No. 7,615,383 3267 trkC ligand) SEQ ID NO: 54 MUS336 trk-C (NT-3 Light chain 2349 U.S. Pat. No. 7,615,383 3268 trkC ligand) SEQ ID NO: 55 MUS337 GDF-8 Light chain 12A5-18HC U.S. Pat. No. 8,956,608 4421 constant region SEQ ID NO: 17 MUS338 many - growth Light chain fusion H21L13, H21L16, U.S. Pat. No. 8,053,569 3275 factors (to protein H21L18, H21L14, SEQ ID NO: 31 increase H21L15, H21L17, transport across H21L6, H21L11 BBB) MUS339 many - growth Light chain fusion H23L13, H23L16, U.S. Pat. No. 8,053,569 3276 factors (to protein H23L18, H23L14, SEQ ID NO: 36 increase H23L15, H23L17, transport across H23L6, H23L11 BBB) MUS340 NOGO Light chain 2A10 construct WO2007003421 3277 construct L11 SEQ ID NO: 80 MUS341 NOGO Light chain 2A10 construct WO2007003421 3278 humanized SEQ ID NO: 35 construct L13 MUS342 NOGO Light chain 2A10 construct WO2007003421 3279 humanized SEQ ID NO: 36 construct L14 MUS343 NOGO Light chain 2A10 construct WO2007003421 3280 humanized SEQ ID NO: 37 construct L15 MUS344 NOGO Light chain 2A10 construct WO2007003421 3281 construct L16 SEQ ID NO: 38 MUS345 NOGO Light chain 2A10 construct WO2007003421 3282 humanized SEQ ID NO: 39 construct L17 MUS346 NOGO Light chain 2A10 construct WO2007003421 3283 humanized SEQ ID NO: 40 construct L18 MUS347 NOGO Light chain 2A10 construct WO2007003421 3284 construct L6 SEQ ID NO: 34 MUS348 RTN4 Light chain IgG4, Atinumab U.S. Pat. No. 8,163,285 3285 immunomodulator SEQ ID NO: 25 MUS349 amyloid Light chain F11G3 U.S. Pat. No. 9,125,846 3315 oligomers variable region SEQ ID NO: 12 MUS350 differentiation Light chain H9L4, H9L5, H8L6 US20140023638 4422 factor 8 variable region SEQ ID NO: 18 (GDF8) MUS351 DR6 and P75 Light chain M73-C04 WO2010062904 3316 variable region SEQ ID NO: 102 MUS352 DR6 and P75 Light chain 1P1D6.3 WO2010062904 3317 variable region SEQ ID NO: 112 MUS353 DR6 and P75 Light chain M50-H02 WO2010062904 3318 variable region SEQ ID NO: 12 MUS354 DR6 and P75 Light chain 1P2F2.1 WO2010062904 3319 variable region SEQ ID NO: 122 MUS355 DR6 and P75 Light chain 1P5D10.2 WO2010062904 3320 variable region SEQ ID NO: 132 MUS356 DR6 and P75 Light chain M5L-H09 WO2010062904 3321 variable region SEQ ID NO: 22 MUS357 DR6 and P75 Light chain M53-E04 WO2010062904 3322 variable region SEQ ID NO: 32 MUS358 DR6 and P75 Light chain M53-F04 WO2010062904 3323 variable region SEQ ID NO: 42 MUS359 DR6 and P75 Light chain M62-B02 WO2010062904 3324 variable region SEQ ID NO: 52 MUS360 DR6 and P75 Light chain M63-E10 WO2010062904 3325 variable region SEQ ID NO: 62 MUS361 DR6 and P75 Light chain M66-B03 WO2010062904 3326 variable region SEQ ID NO: 72 MUS362 DR6 and P75 Light chain M67-G02 WO2010062904 3327 variable region SEQ ID NO: 82 MUS363 DR6 and P75 Light chain M72-F03 WO2010062904 3328 variable region SEQ ID NO: 92 MUS364 GDF-8 Light chain 595-16-M1 U.S. Pat. No. 8,956,608 4423 variable region SEQ ID NO: 27 MUS365 GDF-8 Light chain A12A5-12HC U.S. Pat. No. 8,956,608 4424 variable region SEQ ID NO: 9 MUS366 growth Light chain U.S. Pat. No. 8,840,894 4425 differentiation variable region SEQ ID NO: 368 factor 8 MUS367 LPG (lyso- Light chain #7 U.S. Pat. No. 8,591,902 3329 phosphatidyl- variable region SEQ ID NO: 17 glucoside) MUS368 LPG (lyso- Light chain #15 U.S. Pat. No. 8,591,902 3330 phosphatidyl- variable region SEQ ID NO: 7 glucoside) MUS369 MAG Light chain U.S. Pat. No. 8,071,731 3331 variable region SEQ ID NO: 16 MUS370 MAG Light chain U.S. Pat. No. 8,071,731 3332 variable region SEQ ID NO: 17 MUS371 MAG Light chain U.S. Pat. No. 8,071,731 3333 variable region SEQ ID NO: 18 MUS372 MAG Light chain U.S. Pat. No. 8,071,731 3334 variable region SEQ ID NO: 19 MUS373 MAI (myelin Light chain WO2013158748 3335 associated variable region SEQ ID NO: 11 inhibitor) MUS374 MAI (myelin Light chain WO2013158748 3336 associated variable region SEQ ID NO: 27 inhibitor) MUS375 myostatin Light chain NI-204.34A3 SEQ ID 8 WO 4426 variable region 2006107611 MUS376 myostatin Light chain NI-204.9F6 US20110256132 4427 variable region SEQ ID NO: 17 MUS377 myostatin Light chain NT-204.9F6 US20110256132 4428 variable region SEQ ID NO: 21 MUS378 myostatin Light chain NI-204.11F11 US20110256132 4429 variable region SEQ ID NO: 24 MUS379 myostatin Light chain 303-8 US20110256132 4430 variable region SEQ ID NO: 7 MUS380 NOGO Light chain H1L6, H5L6, H6L6, US20140147435 3338 variable region H14L6, H15L6, SEQ ID NO: 19 H16L6, H17L6, H18L6, H19L6, H20L6, H21L6, H22L6, H23L6, H24L6, H25L6, H700L6 MUS381 NOGO Light chain H1L13, H5L13, US20140147435 3339 variable region H6L13, H14L13, SEQ ID NO: 20 H15L13, H16L13, H17L13, H18L13, H19L13, H20L13, H21L13, H22L13, H23L13, H24L13, H25L13, H700L13 MUS382 NOGO Light chain H1L14, H5L14, US20140147435 3340 variable region H6L14, H14L14, SEQ ID NO: 21 H15L14, H16L14, H17L14, H18L14, H19L14, H20L14, H21L14, H22L14, H23L14, H24L14, H25L14, H700L14 MUS383 NOGO Light chain H1L15, H5L15, US20140147435 3341 variable region H6L15, H14L15, SEQ ID NO: 22 H15L15, H16L15, H17L15, H18L15, H19L15, H20L15, H21L15, H22L15, H23L15, H24L15, H25L15, H700L15 MUS384 NOGO Light chain H1L16, H5L16, US20140147435 3342 variable region H6L16, H14L16, SEQ ID NO: 23 H15L16, H16L16, H17L16, H18L16, H19L16, H20L16, H21L16, H22L16, H23L16, H24L16, H25L16, H700L16 MUS385 NOGO Light chain H1L17, H5L17, US20140147435 3343 variable region H6L17, H14L17, SEQ ID NO: 24 H15L17, H16L17, H17L17, H18L17, H19L17, H20L17, H21L17, H22L17, H23L17, H24L17, H25L17, H700L17 MUS386 NOGO Light chain H1L18, H5L18, US20140147435 3344 variable region H6L18, H14L18, SEQ ID NO: 25 H15L18, H16L18, H17L18, H18L18, H19L18, H20L18, H21L18, H22L18, H23L18, H24L18, H25L18, H700L18 MUS387 NOGO Light chain H5L11, H6L11, US20140147435 3345 variable region H14L11, H15L11, SEQ ID NO: 78 H16L11, H17L11, H18L11, H19L11, H20L11, H21L11, H22L11, H23L11, H24L11, H25L11, H700L11 MUS388 Nogo-66 Light chain Antibody clone 50 US20140065155 3346 variable region SEQ ID NO: 4 MUS389 Nogo-66 Light chain Antibody clone 51 US20140065155 3347 variable region SEQ ID NO: 6 MUS390 NogoA/NiG Light chain 6A3-Ig4 WO2009056509 3348 variable region SEQ ID NO: 25 MUS391 NogoA/NiG Light chain 6A3-IgG1 WO2009056509 3349 variable region SEQ ID NO: 5 MUS392 RGM A Light chain 5F9.1-GL, 5F9.1-GL, US20150183871 3350 variable region 5F9.1-GL, 5F9.1-GL, SEQ ID NO: 44 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, h5F9.4, h5F9.11, h5F9.12 MUS393 RGM A Light chain 5F9.2-GL, 5F9.2-GL, US20150183871 3351 variable region 5F9.2-GL, 5F9.2-GL, SEQ ID NO: 45 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, h5F9.5, h5F9.19, h5F9.20 MUS394 RGM A Light chain 5F9.3-GL, 5F9.3-GL, US20150183871 3352 variable region 5F9.3-GL, 5F9.3-GL, SEQ ID NO: 46 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, h5F9.6, h5F9.21, h5F9.22 MUS395 RGM A Light chain h5F9.5, h5F9.6, US20150183871 3353 variable region h5F9.7, h5F9.8, SEQ ID NO: 48 h5F9.9, h5F9.10 MUS396 RGM A Light chain h5F9.11, h5F9.19, US20150183871 3354 variable region h5F9.21 SEQ ID NO: 49 MUS397 RGM A Light chain h5F9.12, h5F9.20, US20150183871 3355 variable region h5F9.22, h5F9.23, SEQ ID NO: 50 h5F9.25, h5F9.25, h5F9.26 MUS398 RGM A Light chain h5F9.1, h5F9.7, US20150183871 3356 variable region h5F9.23 SEQ ID NO: 51 MUS399 RGM A Light chain h5F9.2, h5F9.8, US20150183871 3357 variable region h5F9.25 SEQ ID NO: 52 MUS400 RGMa Light chain AE12-15 US20140023659 3358 variable region SEQ ID NO: 103 MUS401 RGMa Light chain AE12-20 US20140023659 3359 variable region SEQ ID NO: 111 MUS402 RGMa Light chain AE12-21 US20140023659 3360 variable region SEQ ID NO: 119 MUS403 RGMa Light chain AE12-23 US20140023659 3361 variable region SEQ ID NO: 127 MUS404 RGMa Light chain AE12-2 US20140023659 3362 variable region SEQ ID NO: 13 MUS405 RGMa Light chain AE12-24 US20140023659 3363 variable region SEQ ID NO: 135 MUS406 RGMa Light chain AE12-3 US20140023659 3364 variable region SEQ ID NO: 21 MUS407 RGMa Light chain AE12-4 US20140023659 3365 variable region SEQ ID NO: 29 MUS408 RGMa Light chain AE12-5 US20140023659 3366 variable region SEQ ID NO: 37 MUS409 RGMa Light chain AE12-6 US20140023659 3367 variable region SEQ ID NO: 45 MUS410 RGMa Light chain AE12-1 US20140023659 3368 variable region SEQ ID NO: 5 MUS411 RGMa Light chain AE12-7 US20140023659 3369 variable region SEQ ID NO: 53 MUS412 RGMa Light chain AE12-8 US20140023659 3370 variable region SEQ ID NO: 61 MUS413 RGMa Light chain AE12-13 US20140023659 3371 variable region SEQ ID NO: 95 MUS414 S1P4 Light chain WO2015057939 4431 variable region SEQ ID NO: 9 MUS415 SOD1 Light chain NI205.14W3 US20140301945 4432 variable region SEQ ID NO: 10 MUS416 SOD1 Light chain NI205.19G5 US20140301945 4433 variable region SEQ ID NO: 14 MUS417 SOD1 Light chain US20140301945 4434 variable region SEQ ID NO: 18 MUS418 SOD1 Light chain US20140301945 4435 variable region SEQ ID NO: 22 MUS419 SOD1 Light chain US20140301945 4436 variable region SEQ ID NO: 26 MUS420 SOD1 Light chain Landogrozumab, US20140301945 4437 variable region LY2495655, LY- SEQ ID NO: 30 2495656 MUS421 SOD1 Light chain 2A10 construct US20140301945 4438 variable region SEQ ID NO: 34 MUS422 SOD1 Light chain 2A10 construct US20140301945 4439 variable region SEQ ID NO: 38 MUS423 SOD1 Light chain 2A10 construct US20140301945 4440 variable region SEQ ID NO: 42 MUS424 SOD1 Light chain 2A10 construct US20140301945 4441 variable region SEQ ID NO: 46 MUS425 SOD1 Light chain 2A10 construct US20140301945 4442 variable region SEQ ID NO: 50 MUS426 SOD1 Light chain NI205.1A9 US20140301945 4443 variable region SEQ ID NO: 6 MUS427 SOD1 Light chain NI205.31D2 U.S. Pat. No. 9,109,037 4444 variable region SEQ ID NO: 109 MUS428 SOD1 Light chain NI205.8F8 U.S. Pat. No. 9,109,037 4445 variable region SEQ ID NO: 121 MUS429 SOD1 Light chain NI205.8F8 U.S. Pat. No. 9,109,037 4446 variable region SEQ ID NO: 139 MUS430 SOD1 Light chain NI205.31C11 U.S. Pat. No. 9,109,037 4447 variable region SEQ ID NO: 157 MUS431 SOD1 Light chain NI205.31C11 U.S. Pat. No. 9,109,037 4448 variable region SEQ ID NO: 175 MUS432 SOD1 Light chain NI205.8C10 U.S. Pat. No. 9,109,037 4449 variable region SEQ ID NO: 191 MUS433 SOD1 Light chain NI205.8C10 U.S. Pat. No. 9,109,037 4450 variable region SEQ ID NO: 199 MUS434 SOD1 Light chain NI205.10H7 U.S. Pat. No. 9,109,037 4451 variable region SEQ ID NO: 209 MUS435 SOD1 Light chain NI205.10H7 U.S. Pat. No. 9,109,037 4452 variable region SEQ ID NO: 225 MUS436 SOD1 Light chain NI205.58E11 U.S. Pat. No. 9,109,037 4453 variable region SEQ ID NO: 27 MUS437 SOD1 Light chain N1205.58E11 U.S. Pat. No. 9,109,037 4454 variable region SEQ ID NO: 45 MUS438 SOD1 Light chain NI205.14H5 U.S. Pat. No. 9,109,037 4455 variable region SEQ ID NO: 63 MUS439 SOD1 Light chain NI205.14H5 U.S. Pat. No. 9,109,037 4456 variable region SEQ ID NO: 81 MUS440 SOD1 Light chain NI205.36D5 U.S. Pat. No. 9,109,037 4457 variable region SEQ ID NO: 9 MUS441 SOD1 Light chain NI205.31D2 U.S. Pat. No. 9,109,037 4458 variable region SEQ ID NO: 99 MUS442 TDP-43 Light chain 2A10 construct US20140255304 4459 variable region SEQ ID NO: 122 MUS443 TDP-43 Light chain 2A10 construct US20140255304 4460 variable region SEQ ID NO: 134 MUS444 TDP-43 Light chain 2A10 construct US20140255304 4461 variable region SEQ ID NO: 14 MUS445 TDP-43 Light chain 2A10 construct US20140255304 4462 variable region SEQ ID NO: 142 MUS446 TDP-43 Light chain 2A10 construct US20140255304 4463 variable region SEQ ID NO: 150 MUS447 TDP-43 Light chain 2A10 construct US20140255304 4464 variable region SEQ ID NO: 155 MUS448 TDP-43 Light chain 2A10 construct US20140255304 4465 variable region SEQ ID NO: 163 MUS449 TDP-43 Light chain 2A10 construct US20140255304 4466 variable region SEQ ID NO: 171 MUS450 TDP-43 Light chain 2A10 construct US20140255304 4467 variable region SEQ ID NO: 179 MUS451 TDP-43 Light chain H16L16 FL, H19L16 US20140255304 4468 variable region FL, H20L16 FL, SEQ ID NO: 187 H21L16 FL, H25L16 FL, H18L16 FL MUS452 TDP-43 Light chain H6L13 FL US20140255304 4469 variable region SEQ ID NO: 195 MUS453 TDP-43 Light chain H5L13, H5L16, US20140255304 4470 variable region H5L18, H5L14, SEQ ID NO: 203 H5L15, H5L17, H5L6, H5L11 MUS454 TDP-43 Light chain H700L13, H700L16, US20140255304 4471 variable region H700L18, H700L14, SEQ ID NO: 211 H700L15, H700L17, H700L6, H700L11 MUS455 TDP-43 Light chain H15L13, H15L16, US20140255304 4472 variable region H15L18, H15L14, SEQ ID NO: 219 H15L15, H15L17, H15L6, H15L11 MUS456 TDP-43 Light chain 2A10 construct US20140255304 4473 variable region SEQ ID NO: 22 MUS457 TDP-43 Light chain H17L13, H17L16, US20140255304 4474 variable region H17L18, H17L14, SEQ ID NO: 227 H17L15, H17L17, H17L6, H17L11 MUS458 TDP-43 Light chain H1L6, H5L6, H6L6, US20140255304 4475 variable region H14L6, H15L6, SEQ ID NO: 235 H16L6, H17L6, H18L6, H19L6, H20L6, H21L6, H22L6, H23L6, H24L6, H25L6, H700L6 MUS459 TDP-43 Light chain H1L14, H5L14, US20140255304 4476 variable region H6L14, H14L14, SEQ ID NO: 243 H15L14, H16L14, H17L14, H18L14, H19L14, H20L14, H21L14, H22L14, H23L14, H24L14, H25L14, H700L14 MUS460 TDP-43 Light chain H1L16, H5L16, US20140255304 4477 variable region H6L16, H14L16, SEQ ID NO: 251 H15L16, H16L16, H17L16, H18L16, H19L16, H20L16, H21L16, H22L16, H23L16, H24L16, H25L16, H700L16 MUS461 TDP-43 Light chain H1L18, H5L18, US20140255304 4478 variable region H6L18, H14L18, SEQ ID NO: 259 H15L18, H16L18, H17L18, H18L18, H19L18, H20L18, H21L18, H22L18, H23L18, H24L18, H25L18, H700L18 MUS462 TDP-43 Light chain H1L13, H1L16, US20140255304 4479 variable region H1L18, H1L14, SEQ ID NO: 267 H1L15, H1L17, H1L6 MUS463 TDP-43 Light chain 2A10 construct US20140255304 4480 variable region SEQ ID NO: 31 MUS464 TDP-43 Light chain 2A10 construct US20140255304 4481 variable region SEQ ID NO: 40 MUS465 TDP-43 Light chain 2A10 construct US20140255304 4482 variable region SEQ ID NO: 49 MUS466 TDP-43 Light chain 2A10 construct US20140255304 4483 variable region SEQ ID NO: 57 MUS467 TDP-43 Light chain 2A10 construct US20140255304 4484 variable region SEQ ID NO: 6 MUS468 TDP-43 Light chain 2A10 construct US20140255304 4485 variable region SEQ ID NO: 65 MUS469 TDP-43 Light chain 2A10 construct US20140255304 4486 variable region SEQ ID NO: 73 MUS470 TDP-43 Light chain 2A10 construct US20140255304 4487 variable region SEQ ID NO: 82 MUS471 trkC Light chain US20070031418 4488 variable region SEQ ID NO: 2 MUS472 NOGO Light chain 2A10 construct WO2007003421 3375 variable region SEQ ID NO: 78 humanized construct L11 MUS473 NOGO Light chain 2A10 construct WO2007003421 3376 variable region SEQ ID NO: 20 humanized construct L13 MUS474 NOGO Light chain 2A10 construct WO2007003421 3377 variable region SEQ ID NO: 21 humanized construct L14 MUS475 NOGO Light chain 2A10 construct WO2007003421 3378 variable region SEQ ID NO: 22 humanized construct L15 MUS476 NOGO Light chain 2A10 construct WO2007003421 3379 variable region SEQ ID NO: 23 humanized construct L16 MUS477 NOGO Light chain 2A10 construct WO2007003421 3380 variable region SEQ ID NO: 24 humanized construct L17 MUS478 NOGO Light chain 2A10 construct WO2007003421 3381 variable region SEQ ID NO: 25 humanized construct L18 MUS479 NOGO Light chain 2A10 construct WO2007003421 3382 variable region SEQ ID NO: 19 humanized construct L6 MUS480 GDF-8 scFv 591-37 US20130287762 4489 SEQ ID NO: 14 MUS481 GDF-8 scFv 358-11 US20130287762 4490 SEQ ID NO: 2 MUS482 GDF-8 scFv 591-37-M1 US20130287762 4491 SEQ ID NO: 8 MUS483 myostatin scFv NI-204.7B3 SEQ ID 4 WO 4492 2006107611 MUS484 SOD1 scFv 2A10 construct Ghadge, G. D. et al., 4493 Single chain variable fragment antibodies block aggregation and toxicity induced by familial ALS-linked mutant forms of SOD1, Neurobiol. Dis. (2013), NCBI Accession # AGK37119.1 MUS485 SOD1 scFv 2A10 construct Ghadge, G. D. et al., 4494 Single chain variable fragment antibodies block aggregation and toxicity induced by familial ALS-linked mutant forms of SOD1, Neurobiol. Dis. (2013), NCBI Accession # AGK37120.1

    Neuropathy Antibodies

    [0292] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the neuropathy payload antibody polypeptides listed in Table 7 (NEURO1-NEURO65; SEQ ID NO: 3040-3046, 3076, 3124-3130, 3164-3177, 3262-3268, 3285, 3329-3336, 3358-3371, 4495-4500).

    TABLE-US-00007 TABLE 7 Neuropathy Antibodies Antibody Antibody Reference SEQ ID No. Target Description Name Information NO NEURO1 trk-C (NT-3 Heavy chain 2250 U.S. Pat. No. 7,615,383 3040 trkC ligand) SEQ ID NO: 42 NEURO2 trk-C (NT-3 Heavy chain 2253 U.S. Pat. No. 7,615,383 3041 trkC ligand) SEQ ID NO: 43 NEURO3 trk-C (NT-3 Heavy chain 2256 U.S. Pat. No. 7,615,383 3042 trkC ligand) SEQ ID NO: 44 NEURO4 trk-C (NT-3 Heavy chain 6.1.2 U.S. Pat. No. 7,615,383 3043 trkC ligand) SEQ ID NO: 45 NEURO5 trk-C (NT-3 Heavy chain 6.4.1 U.S. Pat. No. 7,615,383 3044 trkC ligand) SEQ ID NO: 46 NEURO6 trk-C (NT-3 Heavy chain 2345 U.S. Pat. No. 7,615,383 3045 trkC ligand) SEQ ID NO: 47 NEURO7 trk-C (NT-3 Heavy chain 2349 U.S. Pat. No. 7,615,383 3046 trkC ligand) SEQ ID NO: 48 NEURO8 RTN4 (NOGO) Heavy chain IgG4, Atinumab U.S. Pat. No. 8,163,285 3076 immunomodulator SEQ ID NO: 24 NEURO9 LPG Heavy chain #7 U.S. Pat. No. 8,591,902 3124 (lysophosphatidyl- variable region SEQ ID NO: 18 glucoside) NEURO10 LPG Heavy chain #15 U.S. Pat. No. 8,591,902 3125 (lysophosphatidyl- variable region SEQ ID NO: 8 glucoside) NEURO11 MAG Heavy chain U.S. Pat. No. 8,071,731 3126 variable region SEQ ID NO: 13 NEURO12 MAG Heavy chain U.S. Pat. No. 8,071,731 3127 variable region SEQ ID NO: 14 NEURO13 MAG Heavy chain U.S. Pat. No. 8,071,731 3128 variable region SEQ ID NO: 15 NEURO14 MAI (myelin Heavy chain WO2013158748 3129 associated variable region SEQ ID NO: 1 inhibitor) NEURO15 MAI (myelin Heavy chain WO2013158748 3130 associated variable region SEQ ID NO: 17 inhibitor) NEURO16 RAGE protein Heavy chain Mab 7F9 US20130149313 4495 variable region SEQ ID NO: 1 NEURO17 RAGE protein Heavy chain Mab 4E5 US20130149313 4496 variable region SEQ ID NO: 17 NEURO18 RAGE protein Heavy chain Mab 11E6 US20130149313 4497 variable region SEQ ID NO: 9 NEURO19 RGMa Heavy drain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 NEURO20 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 NEURO21 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 NEURO22 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 NEURO23 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 NEURO24 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 NEURO25 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 NEURO26 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 NEURO27 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 NEURO28 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 NEURO29 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 NEURO30 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 NEURO31 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 NEURO32 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 NEURO33 trk-C (NT-3 Light chain 2250 U.S. Pat. No. 7,615,383 3262 trkC ligand) SEQ ID NO: 49 NEURO34 trk-C (NT-3 Light chain 2253 U.S. Pat. No. 7,615,383 3263 trkC ligand) SEQ ID NO: 50 NEURO35 trk-C (NT-3 Light chain 2256 U.S. Pat. No. 7,615,383 3264 trkC ligand) SEQ ID NO: 51 NEURO36 trk-C (NT-3 Light chain 6.1.2 U.S. Pat. No. 7,615,383 3265 trkC ligand) SEQ ID NO: 52 NEURO37 trk-C (NT-3 Light chain 6.4.1 U.S. Pat. No. 7,615,383 3266 trkC ligand) SEQ ID NO: 53 NEURO38 trk-C (NT-3 Light chain 2345 U.S. Pat. No. 7,615,383 3267 trkC ligand) SEQ ID NO: 54 NEURO39 trk-C (NT-3 Light chain 2349 U.S. Pat. No. 7,615,383 3268 trkC ligand) SEQ ID NO: 55 NEURO40 RTN4 Light chain IgG4, Atinumab U.S. Pat. No. 8,163,285 3285 immunomodulator SEQ ID NO: 25 NEURO41 LPG Light chain #7 U.S. Pat. No. 8,591,902 3329 (lysophosphatidyl- variable region SEQ ID NO: 17 glucoside) NEURO42 LPG Light chain #15 U.S. Pat. No. 8,591,902 3330 (lysophosphatidyl- variable region SEQ ID NO: 7 glucoside) NEURO43 MAG Light chain U.S. Pat. No. 8,071,731 3331 variable region. SEQ ID NO: 16 NEURO44 MAG Light chain U.S. Pat. No. 8,071,731 3332 variable region SEQ ID NO: 17 NEURO45 MAG Light chain U.S. Pat. No. 8,071,731 3333 variable region SEQ ID NO: 18 NEURO46 MAG Light chain U.S. Pat. No. 8,071,731 3334 variable region SEQ ID NO: 19 NEURO47 MAI (myelin Light chain WO2013158748 3335 associated variable region SEQ ID NO: 11 inhibitor) NEURO48 MAI (myelin Light chain WO2013158748 3336 associated variable region SEQ ID NO: 27 inhibitor) NEURO49 RAGE protein Light chain Mab 11E6 US20130149313 4498 variable region SEQ ID NO: 13 NEURO50 RAGE protein Light chain Mab 4E5 US20130149313 4499 variable region SEQ ID NO: 21 NEURO51 RAGE protein Light chain Mab 7F9 US20130149313 4500 variable region SEQ ID NO: 5 NEURO52 RGMa Light chain AE12-15 US20140023659 3358 variable region SEQ ID NO: 103 NEURO53 RGMa Light chain AE12-20 US20140023659 3359 variable region SEQ ID NO: 111 NEURO54 RGMa Light chain AE12-21 US20140023659 3360 variable region SEQ ID NO: 119 NEURO55 RGMa Light chain AE12-23 US20140023659 3361 variable region SEQ ID NO: 127 NEURO56 RGMa Light chain AE12-2 US20140023659 3362 variable region SEQ ID NO: 13 NEURO57 RGMa Light chain AE12-24 US20140023659 3363 variable region SEQ ID NO: 135 NEURO58 RGMa Light chain AE12-3 US20140023659 3364 variable region SEQ ID NO: 21 NEURO59 RGMa Light chain AE12-4 US20140023659 3365 variable region SEQ ID NO: 29 NEURO60 RGMa Light chain AE12-5 US20140023659 3366 variable region SEQ ID NO: 37 NEURO61 RGMa Light chain AE12-6 US20140023659 3367 variable region SEQ ID NO: 45 NEURO62 RGMa Light chain AE12-1 US20140023659 3368 variable region SEQ ID NO: 5 NEURO63 RGMa Light chain AE12-7 US20140023659 3369 variable region SEQ ID NO: 53 NEURO64 RGMa Light chain AE12-8 US20140023659 3370 variable region SEQ ID NO: 61 NEURO65 RGMa Light chain AE12-13 US20140023659 3371 variable region SEQ ID NO: 95

    Psychiatric Disorder Antibodies

    [0293] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the psychiatric disorder payload antibody polypeptides listed in Table 8 (PSYCH1-PSYCH160; SEQ ID NO: 2977-2998, 3152-3177, 3205-3226, 3350-3371, 4501-4568).

    TABLE-US-00008 TABLE 8 Psychiatric Disorder Antibodies Antibody Antibody Reference SEQ ID No. Target Description Name Information NO PSYCH1 ACTH Heavy chain Ab4 WO2015127288 2995 SEQ ID NO: 121 PSYCH2 ACTH Heavy chain Ab1.H WO2015127288 2983 SEQ ID NO: 441 PSYCH3 ACTH Heavy chain Ab2.H WO2015127288 2984 SEQ ID NO: 481 PSYCH4 ACTH Heavy chain Ab3.H WO2015127288 2985 SEQ ID NO: 521 PSYCH5 ACTH Heavy chain Ab4.H WO2015127288 2986 SEQ ID NO: 561 PSYCH6 ACTH Heavy chain Ab6.H WO2015127288 2987 SEQ ID NO: 601 PSYCH7 ACTH Heavy chain Ab7.H WO2015127288 2988 SEQ ID NO: 641 PSYCH8 ACTH Heavy chain Ab7A.H WO2015127288 2989 SEQ ID NO: 681 PSYCH9 ACTH Heavy chain Ab10.H WO2015127288 2990 SEQ ID NO: 721 PSYCH10 ACTH Heavy chain Ab11.H WO2015127288 2991 SEQ ID NO: 761 PSYCH11 ACTH Heavy chain Ab11A.H WO2015127288 2992 SEQ ID NO: 801 PSYCH12 ACTH Heavy chain Ab5 WO2015127288 2996 SEQ ID NO: 161 PSYCH13 ACTH Heavy chain Ab3 WO2015127288 2993 SEQ ID NO: 81 PSYCH14 ACTH Heavy chain Ab12.H WO2015127288 2994 SEQ ID NO: 841 PSYCH15 ACTH Heavy chain Ab6 WO2015127288 2997 SEQ ID NO: 201 PSYCH16 ACTH Heavy chain Ab7 WO2015127288 2977 SEQ ID NO: 241 PSYCH17 ACTH Heavy chain Ab9 WO2015127288 2978 SEQ ID NO: 281 PSYCH18 ACTH Heavy chain Ab10 WO2015127288 2979 SEQ ID NO: 321 PSYCH19 ACTH Heavy chain Ab11 WO2015127288 2980 SEQ ID NO: 361 PSYCH20 ACTH Heavy chain Ab12 WO2015127288 2981 SEQ ID NO: 401 PSYCH21 ACTH Heavy chain Ab2 WO2015127288 2982 SEQ ID NO: 41 PSYCH22 ACTH Heavy chain Ab1 WO2015127288 2998 SEQ ID NO: 1 PSYCH23 neuregulin Heavy chain US20140363438 4501 (NRG) SEQ ID NO: 72 PSYCH24 neuregulin Heavy chain US20140363438 4502 (NRG) SEQ ID NO: 74 PSYCH25 Anx-A1 Heavy chain VJ-4B6 US20150004164 4503 variable region SEQ ID NO: 16 PSYCH26 Anx-A1 Heavy chain VJ-4B6 US20150004164 4504 variable region SEQ ID NO: 20 PSYCH27 RGM A Heavy chain 5F9.1-GL US20150183871 3152 variable region SEQ ID NO: 35 PSYCH28 RGM A Heavy chain 5F9.2-GL US20150183871 3153 variable region SEQ ID NO: 36 PSYCH29 RGM A Heavy chain 5F9.3-GL US20150183871 3154 variable region SEQ ID NO: 37 PSYCH30 RGM A Heavy chain 5F9.4-GL US20150183871 3155 variable region SEQ ID NO: 38 PSYCH31 RGM A Heavy chain 5F9.5-GL US20150183871 3156 variable region SEQ ID NO: 39 PSYCH32 RGM A Heavy chain 5F9.6-GL US20150183871 3157 variable region SEQ ID NO: 40 PSYCH33 RGM A Heavy chain 5F9.7-GL US20150183871 3158 variable region SEQ ID NO: 41 PSYCH34 RGM A Heavy chain 5F9.8-GL US20150183871 3159 variable region SEQ ID NO: 42 PSYCH35 RGM A Heavy chain 5F9.9-G.L US20150183871 3160 variable region SEQ ID NO: 43 PSYCH36 RGM A Heavy chain h5F9.1, h5F9.1, h5F9.1, US20150183871 3161 variable region h5F9.1, h5F9.1, h5F9.2, SEQ ID NO: 47 h5F9.3 PSYCH37 RGM A Heavy chain h5F9.3, h5F9.9, US20150183871 3162 variable region h5F9.25 SEQ ID NO: 53 PSYCH38 RGM A Heavy chain h5F9.4, h5F9.10, US20150183871 3163 variable region h5F9.26 SEQ ID NO: 54 PSYCH39 RGMa Heavy chain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 PSYCH40 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 PSYCH41 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 PSYCH42 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 PSYCH43 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 PSYCH44 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 PSYCH45 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 PSYCH46 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 PSYCH47 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 PSYCH48 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 PSYCH49 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 PSYCH50 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 PSYCH51 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 PSYCH52 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 PSYCH53 TMEFE2 Heavy chain PQ01 US20150030602 4505 variable region SEQ ID NO: 10 PSYCH54 TNFa Heavy chain 2SD4 US20140296493 4506 variable region SEQ ID NO: 10 PSYCH55 TNFa Heavy chain D2E7 US20140296493 4507 variable region SEQ ID NO: 2 PSYCH56 ghrelin Heavy chain US20060233788 4508 variable region SEQ ID NO: 12 PSYCH57 ghrelin Heavy chain US20060233788 4509 variable region SEQ ID NO: 13 PSYCH58 ghrelin Heavy chain US20060233788 4510 variable region SEQ ID NO: 32 PSYCH59 ghrelin Heavy chain US20060233788 4511 variable region SEQ ID NO: 33 PSYCH60 neuregulin Heavy chain US20140363438 4512 (NRG) variable region SEQ ID NO: 21 PSYCH61 neuregulin Heavy chain US20140363438 4513 (NRG) variable region SEQ ID NO: 52 PSYCH62 neuregulin Heavy chain US20140363438 4514 (NRG) variable region SEQ ID NO: 54 PSYCH63 neuregulin Heavy chain US20140363438 4515 (NRG) variable region SEQ ID NO: 56 PSYCH64 neuregulin Heavy chain US20140363438 4516 (NRG) variable region SEQ ID NO: 58 PSYCH65 neuregulin Heavy chain US20140363438 4517 (NRG) variable region SEQ ID NO: 60 PSYCH66 neuregulin Heavy chain US20140363438 4518 (NRG) variable region SEQ ID NO: 62 PSYCH67 neuregulin Heavy chain US20140363438 4519 (NRG) variable region SEQ ID NO: 63 PSYCH68 neuregulin Heavy chain US20140363438 4520 (NRG) variable region SEQ ID NO: 64 PSYCH69 neuregulin Heavy chain US20140363438 4521 (NRG) variable region SEQ ID NO: 66 PSYCH70 neuregulin Heavy chain US20140363438 4522 (NRG) variable region SEQ ID NO: 68 PSYCH71 neuregulin Heavy chain US20140363438 4523 (NRG) variable region SEQ ID NO: 70 PSYCH72 ACTH Light chain Ab3 WO2015127288 3205 SEQ ID NO: 101 PSYCH73 ACTH Light chain Ab4 WO2015127288 3206 SEQ ID NO: 141 PSYCH74 ACTH Light chain Ab5 WO2015127288 3207 SEQ ID NO: 181 PSYCH75 ACTH Light chain Ab1 WO2015127288 3208 SEQ ID NO: 21 PSYCH76 ACTH Light chain Ab6 WO2015127288 3209 SEQ ID NO: 221 PSYCH77 ACTH Light chain Ab7 WO2015127288 3210 SEQ ID NO: 261 PSYCH78 ACTH Light chain Ab9 WO2015127288 3211 SEQ ID NO: 301 PSYCH79 ACTH Light chain Ab10 WO2015127288 3212 SEQ ID NO: 341 PSYCH80 ACTH Light chain Ab11 WO2015127288 3213 SEQ ID NO: 381 PSYCH81 ACTH Light chain Ab12 WO2015127288 3214 SEQ ID NO: 421 PSYCH82 ACTH Light chain Ab1.H WO2015127288 3215 SEQ ID NO: 461 PSYCH83 ACTH Light chain Ab2.H WO2015127288 3216 SEQ ID NO: 501 PSYCH84 ACTH Light chain Ab3.H WO2015127288 3217 SEQ ID NO: 541 PSYCH85 ACTH Light chain Ab4.H WO2015127288 3218 SEQ ID NO: 581 PSYCH86 ACTH Light chain Ab2 WO2015127288 3219 SEQ ID NO: 61 PSYCH87 ACTH Light chain Ab6.H WO2015127288 3220 SEQ ID NO: 621 PSYCH88 ACTH Light chain Ab7.H WO2015127288 3221 SEQ ID NO: 661 PSYCH89 ACTH Light chain Ab7A.H WO2015127288 3222 SEQ ID NO: 701 PSYCH90 ACTH Light chain Ab10.H WO2015127288 3223 SEQ ID NO: 741 PSYCH91 ACTH Light chain Ab11.H WO2015127288 3224 SEQ ID NO: 781 PSYCH92 ACTH Light chain Ab11A.H WO2015127288 3225 SEQ ID NO: 821 PSYCH93 ACTH Light chain Ab12.H WO2015127288 3226 SEQ ID NO: 861 PSYCH94 neuregulin Light chain US20140363438 4524 (NRG) SEQ ID NO: 73 PSYCH95 neuregulin Light chain US20140363438 4525 (NRG) SEQ ID NO: 75 PSYCH96 Anx-A1 Light chain VJ-4B6 US20150004164 4526 variable region SEQ ID NO: 15 PSYCH97 Anx-A1 Light chain VJ-4B6 US20150004164 4527 variable region SEQ ID NO: 19 PSYCH98 RGM A Light chain 5F9.1-GL, 5F9.1-GL, US20150183871 3350 variable region 5F9.1-GL, 5F9.1-GL, SEQ ID NO: 44 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, 5F9.1-GL, h5F9.4, h5F9.11, h5F9.12 PSYCH99 RGM A Light chain 5F9.2-GL, 5F9.2-GL, US20150183871 3351 variable region 5F9.2-GL, 5F9.2-GL, SEQ ID NO: 45 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, 5F9.2-GL, h5F9.5, h5F9.19, h5F9.20 PSYCH100 RGM A Light chain 5F9.3-GL, 5F9.3-GL, US20150183871 3352 variable region 5F9.3-GL, 5F9.3-GL, SEQ ID NO: 46 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, 5F9.3-GL, h5F9.6, h5F9.21, h5F9.22 PSYCH101 RGM A Light chain h5F9.5, h5F9.6, h5F9.7, US20150183871 3353 variable region h5F9.8, h5F9.9, SEQ ID NO: 48 h5F9.10 PSYCH102 RGM A Light chain h5F9.11, US20150183871 3354 variable region h5F9.19, h5F9.21 SEQ ID NO: 49 PSYCH103 RGM A Light chain h5F9.12, h5F9.20, US20150183871 3355 variable region h5F9.22, h5F9.23, SEQ ID NO: 50 h5F9.25, h5F9.25, h5F9.26 PSYCH104 RGM A Light chain h5F9.1, h5F9.7, US20150183871 3356 variable region h5F9.23 SEQ ID NO: 51 PSYCH105 RGM A Light chain h5F9.2, h5F9.8, US20150183871 3357 variable region h5F9.25 SEQ ID NO: 52 PSYCH106 RGMa Light chain AE12-15 US20140023659 3358 variable region SEQ ID NO: 103 PSYCH107 RGMa Light chain AE12-20 US20140023659 3359 variable region SEQ ID NO: 111 PSYCH108 RGMa Light chain AE12-21 US20140023659 3360 variable region SEQ ID NO: 119 PSYCH109 RGMa Light chain AE12-23 US20140023659 3361 variable region SEQ ID NO: 127 PSYCH110 RGMa Light chain AE12-2 US20140023659 3362 variable region SEQ ID NO: 13 PSYCH111 RGMa Light chain AE12-24 US20140023659 3363 variable region SEQ ID NO: 135 PSYCH112 RGMa Light chain AE12-3 US20140023659 3364 variable region SEQ ID NO: 21 PSYCH113 RGMa Light chain AE12-4 US20140023659 3365 variable region SEQ ID NO: 29 PSYCH114 RGMa Light chain AE12-5 US20140023659 3366 variable region SEQ ID NO: 37 PSYCH115 RGMa Light chain AE12-6 US20140023659 3367 variable region SEQ ID NO: 45 PSYCH116 RGMa Light chain AE12-1 US20140023659 3368 variable region SEQ ID NO: 5 PSYCH117 RGMa Light chain AE12-7 US20140023659 3369 variable region SEQ ID NO: 53 PSYCH118 RGMa Light chain AE12-8 US20140023659 3370 variable region SEQ ID NO: 61 PSYCH119 RGMa Light chain AE12-13 US20140023659 3371 variable region SEQ ID NO: 95 PSYCH120 TMEFE3 Light chain PQ01 US20150030602 4528 variable region SEQ ID NO: 12 PSYCH121 TNFa Light chain D2E7 US20140296493 4529 variable region SEQ ID NO: 1 PSYCH122 TNFa Light chain 2SD4 US20140296493 4530 variable region SEQ ID NO: 9 PSYCH123 ghrelin Light chain US20060233788 4531 variable region SEQ ID NO: 3 PSYCH124 ghrelin Light chain US20060233788 4532 variable region SEQ ID NO: 30 PSYCH125 ghrelin Light chain US20060233788 4533 variable region SEQ ID NO: 31 PSYCH126 ghrelin Light chain US20060233788 4534 variable region SEQ ID NO: 4 PSYCH127 neuregulin Light chain US20140363438 4535 (NRG) variable region SEQ ID NO: 22 PSYCH128 neuregulin Light chain US20140363438 4536 (NRG) variable region SEQ ID NO: 23 PSYCH129 neuregulin Light chain US20140363438 4537 (NRG) variable region SEQ ID NO: 24 PSYCH130 neuregulin Light chain US20140363438 4538 (NRG) variable region SEQ ID NO: 25 PSYCH131 neuregulin Light chain US20140363438 4539 (NRG) variable region SEQ ID NO: 26 PSYCH132 neuregulin Light chain US20140363438 4540 (NRG) variable region SEQ ID NO: 27 PSYCH133 neuregulin Light chain US20140363438 4541 (NRG) variable region SEQ ID NO: 53 PSYCH134 neuregulin Light chain US20140363438 4542 (NRG) variable region SEQ ID NO: 55 PSYCH135 neuregulin Light chain US20140363438 4543 (NRG) variable region SEQ ID NO: 57 PSYCH136 neuregulin Light chain US20140363438 4544 (NRG) variable region SEQ ID NO: 59 PSYCH137 neuregulin Light chain US20140363438 4545 (NRG) variable region SEQ ID NO: 61 PSYCH138 neuregulin Light chain US20140363438 4546 (NRG) variable region SEQ ID NO: 65 PSYCH139 neuregulin Light chain US20140363438 4547 (NRG) variable region SEQ ID NO: 67 PSYCH140 neuregulin Light chain US20140363438 4548 (NRG) variable region SEQ ID NO: 69 PSYCH141 neuregulin Light chain US20140363438 4549 (NRG) variable region SEQ ID NO: 71 PSYCH142 neurokinin B Single chain scFv N024C01 U.S. Pat. No. 7,514,079 4550 SEQ ID NO: 22 PSYCH143 neurokinin B Single chain scFv N025B07 U.S. Pat. No. 7,514,079 4551 SEQ ID NO: 23 PSYCH144 neurokinin B Single chain scFv N015E08 U.S. Pat. No. 7,514,079 4552 SEQ ID NO: 24 PSYCH145 neurokinin B Single chain scFv N015F10 U.S. Pat. No. 7,514,079 4553 SEQ ID NO: 25 PSYCH146 neurokinin B Single chain scFv N024D01 U.S. Pat. No. 7,514,079 4554 SEQ ID NO: 26 PSYCH147 neurokinin B Single chain scFv N015D08 U.S. Pat. No. 7,514,079 4555 SEQ ID NO: 27 PSYCH148 neurokinin B Single chain scFv N024B07 U.S. Pat. No. 7,514,079 4556 SEQ ID NO: 28 PSYCH149 neurokinin B Single chain scFv N024E07 U.S. Pat. No. 7,514,079 4557 SEQ ID NO: 29 PSYCH150 neurokinin B Single chain scFv N023F05 U.S. Pat. No. 7,514,079 4558 SEQ ID NO: 30 PSYCH151 neurokinin B Single chain scFv N024D08 U.S. Pat. No. 7,514,079 4559 SEQ ID NO: 31 PSYCH152 neurokinin B Single chain scFv N023B03 U.S. Pat. No. 7,514,079 4560 SEQ ID NO: 32 PSYCH153 neurokinin B Single chain scFv N023E01 U.S. Pat. No. 7,514,079 4561 SEQ ID NO: 33 PSYCH154 neurokinin B Single chain scFv N024C05 U.S. Pat. No. 7,514,079 4562 SEQ ID NO: 34 PSYCH155 neurokinin B Single chain scFv N025E05 U.S. Pat. No. 7,514,079 4563 SEQ ID NO: 35 PSYCH156 neurokinin B Single chain scFv N025C01 U.S. Pat. No. 7,514,079 4564 SEQ ID NO: 36 PSYCH157 neurokinin B Single drain scFv N024F09 U.S. Pat. No. 7,514,079 4565 SEQ ID NO: 37 PSYCH158 neurokinin B Single chain scFv N024B01 U.S. Pat. No. 7,514,079 4566 SEQ ID NO: 38 PSYCH159 neurokinin B Single chain scFv N024F07 U.S. Pat. No. 7,514,079 4567 SEQ ID NO: 39 PSYCH160 neurokinin B Single chain scFv N015D10 U.S. Pat. No. 7,514,079 4568 SEQ ID NO: 40

    Cancer, Inflammation and Immune System Antibodies

    [0294] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the cancer, inflammation and immune system payload antibody polypeptides listed in Table 9 (CH1-CH13310; SEQ ID NO: 2977-2998, 3031-3039, 3060-3076, 3129-3147, 3181-3196, 3205-3226, 3277-3285, 3335-3345, 3375-3382, 3453-3459, 3856, 3890-3898, 4232-4237, 4308, 4323, 4420, 4431, 4501-4504, 4512-4527, 4535-17658).

    TABLE-US-00009 Lengthy table referenced here US20190153471A1-20190523-T00001 Please refer to the end of the specification for access instructions.

    [0295] In Table 9, the target number (Target No.) code is described in the following semi-colon delimited list where the target number is followed by the target (e.g., Target No. 1 with target AC133 is shown as Target No. 1-Target AC133). The targets represented by the codes in Table 9 include, but are not limited to, Target No. 1-Target AC133, Target No. 2-Target ACTH; Target No. 3-Target activin receptor-like kinase 1 (ALK-1); Target No. 4-Target ADAMTS4; Target No. 5-Target AFP; Target No. 6-Target Albumin; Target No. 7-Target ALCAM; Target No. 8-Target alpha-4 integrin; Target No. 9-Target angiopoietin 2 (ANGPT2; ANG-2); Target No. 10-Target angiopoietin 2 (AN(.7..sup.-i-PT2; ANG-2) (ANGPT2; ANG-2); Target No. 11-Target Annexin IV or a phospholipid; and (b) a complement inhibitor; Target No. 12-Target Anti-CD-3; Target No. 13-Target antiHER2; Target No. 14-Target anti-Her2 and anti-Her3; Target No. 15-Target antiHER.3; Target No. 16-Target anti-idiotype (Id); Target No. 17-Target Anx-A1; Target No. 18-Target AOC3 (VAP-1); Target No. 19-Target Alpha-V integrins Target No. 20-Target AXL, Target No. 21-Target B and T human lymphocytes; Target No. 22-Target b7 subunit of a4b7, aEb7 integrins, humanized IgG1; Target No. 23-Target B7-H1; Target No. 24-Target B7-H3; Target No. 25-Target B7-H4; Target No. 26-Target B7-H5: Target No. 27-Target B7-H6; Target No. 28-Target B7-H7, Target No. 29-Target B7-H8; Target No. 30-Target BMP9; Target No. 31-Target BSG; Target No. 32-Target C3b, Target No. 33-Target C3b, Properdin (factor P), Factors Ba and Bb, C5, C6, C7, C8, C9; Target No. 34-Target C5, Target No 35-Target C5a; Target No. 36-Target C5d polypeptide; Target No. 37-Target CA 125 (MUC16); Target No. 38-Target CA-125 (imitation); Target No. 39-Target C-antigen; Target No. 40-Target Carbohydrate Antigen 242 (CA242); Target No. 41-Target carbonic anhydrase 9(CA-1X); Target No. 42-Target CC chemokines; Target No. 43-Target CCL11 (eotaxin-1); Target No. 44-Target CCL2, MCP-1, MCAF; Target No. 45-Target CCR2; Target No. 46-Target CCR4; Target No. 47-Target CD100; Target No. 48-Target CD11; Target No. 49-Target CD11 a; Target No. 50-Target CD123; Target No. 51-Target CD147 (basigin); Target No. 52-Target CD154 (CD40LG); Target No. 53-Target CD19; Target No. 54-Target CD19; Target No. 55-Target CD2; Target No. 56-Target CD20; Target No. 57-Target CD20/CD40; Target No. 58-Target CD20/EGFR; Target No. 59-Target CD200; Target No 60-Target CD22; Target No. 61-Target CD221; Target No. 62-Target CD248 (TEM-1); Target No. 63-Target CD27; Target No. 64-Target CD274 (PD-L1); Target No. 63-Target CD28; Target No. 66-Target CD3; Target No. 67-Target CD3; Target No. 68-Target CD3 epsilon; Target No. 69-Target CD3 epsilon, anti-IL1-Ri; Target No. 70-Target CD3, CD19; Target No. 71-Target CD3, EpCAM; Target No. 72-Target CD3. MSCP; Target No. 73-Target CD3/CD19 or CD3/CD20; Target No. 74-Target CD3; CD19; Target No. 75-Target CD30; Target No. 76-Target CD31; Target No. 77-Target CD32; Target No. 78-Target CD324/E-cadherin; Target No. 79-Target CD32b; Target No. 80-Target CD33; Target No. 81-Target CD34; Target No. 82-Target CD35; Target No. 83-Target CD37; Target No. 84-Target CD37 and CD20, Target No. 85-Target CD38; Target No. 86-Target CD38, human IgG1; Target No. 87-Target CD38, human IgG2; Target No. 88-Target CD3E; Target No. 89-Target CD3E, EPCAM; Target No. 90-Target CD3E, EPCAM (IL-beta); Target No. 91-Target CD4; Target No. 92-Target CD40; Target No. 93-Target CD40LG; Target No. 94-Target CD44 v6; Target No. 95-Target CD-49d, CD11a; Target No. 96-Target CD51; Target No. 97-Target CD52; Target No. 98-Target CD55/CD59 and CD20; Target No. 99-Target CD6; Target No. 100-Target CD64; Target No. 101-Target CD70; Target No. 102-Target CD74; Target No. 103-Target CD79B; Target No. 104-Target CD89, Target No. 105-Target CEA; Target No. 106-Target CEACAM5; Target No. 107-Target Cell surface targets; Target No. 108-Target CH region of an immunoglobulin; Target No. 109-Target c-MET; Target No. 110-Target c-MET/EGFR; Target No. 111-Target c-MET/EGFR; c-MET; Target No. 112-Target c-MET/EGFIR; EGFR; HGF; Target No. 113-Target c-MET/FGFR; Target No. 114-Target c-MET/HER; Target No. 115-Target c-MET/HER; ErbB2; Target No. 116-Target c-MET; EGFR; VEGF; c-MET/EGER; Target No. 117-Target CSAp; Target No. 118-Target CSF1R; Target No. 119-Target CSF2; Target No. 120-Target CSF2RA; Target No. 121-Target CSPG4; Target No. 122-Target CTGF; Target No. 123-Target CTLA4; Target No. 124-Target CTLA4, human igG2; Target No. 125-Target CTLA4, human IgG3; Target No. 126-Target C-X-C chemokine receptor type 4; Target No. 127-Target CXCL10; Target No. 128-Target CXCL13; Target No. 129-Target CXCR4; Target No. 130-Target difucosyl Lewis blood group antigens Y-6 and B-7-2; Target No. 131-Target DKK1; Target No. 132-Target DLL3; Target No. 133-Target DLL4; Target No. 134-Target DNA/histone complex; Target No. 135-Target DPP4, CD26; Target No. 136-Target DR5; Target No. 137-Target EFNA1; Target No. 138-Target EGF; Target No. 139-Target EGF7; Target No. 140-Target EGFR; Target No. 141-Target EGFR (EGFRvIII); Target No. 142-Target EGFR (HER1); Target Na. 143-Target EGFR and IGF1R; Target No. 144-Target EGFR family; Target No. 145-Target EGFR, ERBB1, HER1; Target No. 146-Target EGFR. ERBB1, HER2; Target No. 147-Target EGFR, HER2, or HER3; Target No. 148-Target EGFR/cMet; Target No. 149-Target EGFR/HER 3; Target No. 150-Target EGER/VEGFR/HER; Target No. 151-Target EGFR; c-Met; Target No. 152-Target EGFR; VEGF; Target No. 153-Target EGERvIII; Target No. 154-Target EGP-1 (TROP2); Target No. 155-Target EMP2; Target No. 156-Target endoglin; Target No. 157-Target EPCAM; Target No. 158-Target EpCAM, CD3; Target No. 159-Target EphA2 receptor; Target No. 160-Target EPHA3; Target No. 161-Target EphA3; EGFR; HER2; PD-L1; HGF; Target No. 162-Target episialin; Target No. 163-Target ERB2; Target No. 164-Target ERBB; Target No. 165-Target ERBB1; Target No. 166-Target ERBB2; Target No. 167-Target ERBB3; Target No. 168-Target ErbB3/IGF1R; Target No. 169-Target ErbB4; Target No. 170-Tantet ErbB5; Target No. 171-Tantet ErbB6; Target No. 172-Target ErbB7; Target No. 173-Target ErbB8; Target No. 174-Target euGc, NGNA; Target No. 175-Target F3; Target No. 176-Target FAP; Target No. 177-Target FAP; Target No. 178-Target FasR; Target No. 179-Target FcRn; Target No. 180-Target FcRIIB (FcR); Target No. 181-Target FcRIIB; Target No. 182-Target FcRIIIA; Target No. 183-Target FGF-8; Target No. 184-Target FGFR2; Target No. 185-Target fibronectin ED-A; Target No. 186-Target fibronectin IIICS isoform; Target No. 187-Target fibronectin extra domain-B; Target No. 188-Target FLT1; Target No. 189-Target FLT3; Target No. 190-Target folate receptor alpha; Target No. 191-Target FOLR1; Target No. 192-Target Frizzled receptor; Target No. 193-Target ganglioside; Target No. 194-Target GD2; Target No. 195-Target GD2/DOTA; Target No. 196-Target GD2/huOKT3; Target No. 197-Target GD3; Target No. 198-Target GD3 ganglioside; Target No. 199-Target GFR3; Target No. 200-Target glycan antigen; Target No. 201-Target glypican 3; Target No. 202-Target GM2; Target No. 203-Target GPNMB; Target No. 204-Target Growth factor 7; Target No. 205-Target GUCY2C, anti-GCC; Target No. 206-Target HB-EGF; Target No. 207-Target HB-EGF/EGFR; Target No. 208-Target hen egg lysozyme, Target No. 209-Target HER/EGFR; Target No. 210-Target HER1, HER3, CD80, CD86, PD-1, CTLA4, B7-H4, RON, CD200, CD4, BAF R, EGFR, IGFR, VEGFR, a member of the TNF family of receptors, a Tie receptor, MET, IGF1, IGF2, TNF, a INF ligand, IL-6, TWEAK, Fn14, CD20, CD23, CRIPTO, HGF, alpha4beta1 integrin, alpha5betal integrin, alpha6beta4 integrin, and alphaVbeta6 integrin; Target No. 211-'Target HER2; Target No. 212-Target HER2/CD3; Target No. 213-Target HER2/Dig; Target No. 214-Target HER2/neu; Target No. 215-Target HER3; Target No. 216-Target HER3, human IgG1; Target No. 217-Target HOF; Target No. 218-Target hIL-12; Target No. 219-Target hIL13; Target No. 220-Target HIV gp120; Target No. 221-Target HLA-DR; Target No. 222-Target hNav1.7; Target No. 223-Target hPG; Target No. 224-Target human TNF; Target No. 225-Target huTNFR, Target No. 226-Target huTNFR1; Target No. 227-Target ICAM-1; Target No. 228-Target IFNAR1; Target No. 229-Target IFN-; Target No. 230-Target IGF; Target No. 231-Target IGF; IGF1R; Target No. 232-Target IGF1; Target No. 233-Target IGF1R; Target No. 234-Target IGF1R/Dig; Target No. 235-Target IGF-1R/ErbB3; Target No. 236-Target IGF1R; EGFR; Target No. 237-Target IgG4 (CD40); Target No. 238-Target IGHE; Target No. 239-Target IL1; Target No. 240-Target IL10; Target No, 241-Target IL11; Target No. 242-Target IL12; Target No. 243-Target IL12B, IL12 p40, NKSF2, CMLF p40; Target No. 244-Target IL12B, IL12 p40, NKSF2, CMLF p41; Target No. 245-Target IL12p40; Target No. 246-Target IL13; Target No. 247-Target IL13, Human IgG4; Target No. 248-Target IL13, Human IgG5; Target No. 243-Target IL17; Target No. 250-Target IL17A; Target No. 251-Target IL17A and IL17F; Target No. 252-Target IL17RA; Target No. 253-Target IL18; Target No. 254-Target IL18BP; Target No. 255-Target IL1A; Target No. 256-Target IL113; Target No. 257-Target 11,20; Target No. 258-Target 11,20, NOF; Target No, 259-Target IL22; Target No. 260-Target IL23A; Target No. 261-Target IL23p19 subunit humanized IgG1; Target No. 262-Target IL23p19 subunit, humanized IgG2; Target No. 263-Target IL2RA; Target No. 264-Target IL31RA; Target No. 265-Target IL4; Target No. 266-Target IL4R; Target No. 267-Target IL5; Target No. 268-Target IL5RA; Target No. 269-Target IL6: Target No. 270-Target IL6R; Target No. 271-Target IL6R, humanized IgG2; Target No. 272-Target IL7; Target No. 273-Target IL7R; Target No. 274-Target IL8; Target No. 275-Target IL9; Target No. 276-Target ILGF2; Target No. 277-Target Integrin 2; Target No. 278-Target integrin 47; Target No. 279-Target integrin 48; Target No. 280-Target IP-10; Target No. 281-Target IS12B; Target No. 282-Target ITGA2; Target No. 283-Target ITGA4_ITGB7; Target No. 284-Target ITGAL; Target No. 285-Target ITGAV_ITGB3; Target No. 286-Target ITGAV_ITGB3; Target No. 287-Target KDR; Target No. 288-Target KIR2; Target No. 289-Target KIR2D; Target No. 290-Target KLRC1; Target No. 291-Target LAG-3; Target No. 292-Target LecLe.sup.x, Le.sup.aLe.sup.x, Di-Le.sup.a, Le.sup.x containing glycans and Le.sup.a containing glycans; Target No. 293-Target Lewis b (LeB); Target No. 294-Target Lewis Y (LeY); Target No. 295-Target LIGHT/HER2/CD23; Target No. 296-Target LIGHT/HER2/CD24; Target No. 297-Target LIGHT/HER2/CD25; Target No. 298-Target LIGHT/HER2/CD26; Target No 299-Target LIGHT/HER2/CD27; Target No. 300-Target LIGHT/HER2/CD28; Target No. 301-Target LIGHT/HER2/CD29; Target No. 302-Target LIGHT/HER2/CD30; Target No. 303-Target LIGHT/HER2/CD31; Target No. 304-Target LIGHT/HER2/CD32; Target No. 305-Target LINGO-1; Target No. 306-Target LOXL2; Target No. 307-Target LTA; Target No. 308-Target MAGE-A3; Target No. 309-Target MAI (myelin associated inhibitor); Target No. 310-Target many targets; Target No. 311-Target MCP-1; Target No. 312-Target MCP-2; Target No. 313-Target MCP-3; Target No. 314-Target MCP-4; Target No. 315-Target MCP-5; Target No. 316-Target MCP-6; Target No. 317-Target MCSP; Target No. 318-Target MEK; Target No. 319-Target mesothelin; Target No. 320-Target MET; Target No. 321-Target MET Receptor; Target No. 322-Target MHC; Target No. 323-Target WIC class II; Target No. 324-Target MIF; Target No. 325-Target MMP3; Target No. 326-Target molecules on brain microvascular endothelial cells; Target No. 327-Target monosialo-GM2; Target No. 328-Target MS4A1; Target No. 329-Target MSLN; Target No. 330-Target MST1R; Target No. 331-Target MT4-MMP/EGFR; Target No. 332-Target MTX and EGFR; Target No. 333-Target MTX and hCD-20; Target No. 334-Target MTX and hCD-3; Target No. 335-Target MTX and mCD-3; Target No. 336-Target MUC1; Target No. 337-Target MUC1/MUC5ac; Target No. 338-Target MUC5AC; Target No. 339-Target mucin CanAg; Target No. 340-Target N terminus end of properdin; Target No. 341-Target NCAM1; Target No. 342-Target NeuGc, NGNA; Target No. 343-Target neuregulin (NRG); Target No. 344-Target neurokinin B; Target No. 345-Target neurotensin; Target No. 346-Target NGF; Target No. 347-Target NGF; c-MET; Target No. 348-Target N-glycolyl-GM3; Target No. 349-Target NMDA; Target No. 350-Target NOGO; Target No. 351-Target Nogo receptor-1; Target No. 352-Target Notch receptor; Target No. 353-Target NOTCH1; Target No. 354-Target NRP1; Target No. 355-Target O-acetylated-GD2; Target No. 356-Target OPGL; Target No. 357-Target OX-40; Target No. 358-Target oxLDL; Target No. 359-Target PAM4 antigens; Target No. 360-Target PD-1; Target No. 361-Target PD1, human IgG4, Target No. 362-Target PDGFRA; Target No. 363-Target PDGFR-beta; Target Inc. 364-Target PDGFR/VEGFA; Target No. 365-Target PD-L1; Target No. 366-Target PD-L1, human IgG1; Target No. 367-Target PD-L2; Target No. 368-Target periostin; Target No. 369-Target PERP; Target No. 370-Target PhosphatidyL-serine, chimeric IgG1; Target No. 371-Target PhosphatidyL-serine, Chimeric IgG2; Target No. 372-Target polyubiquitin; Target No. 373-Target PSMA; Target No. 374-Target PVRL4; Target No. 375-Target PVRL5; Target No. 376-Target RANKL, Target No. 377-Target RANKL/PTH; Target No. 378-Target RFB4; Target No. 379-Target RON, Target No. 380-Target RTN4 (NOGO); Target No. 381-Target S1P4; Target No. 382-Target SDC1; Target No. 383-Target selectin; Target No. 384-Target Serum albumin (mouse); Target No. 385-Target Serum albumin or neonatal Pc receptor; Target No. 386-Target sialic acid (Neu5Gc or Neu5Ac); Target No. 387-Target sialyl Tn (sTn), Target No. 388-Target Sialyl-Levis A (sLeA); Target No. 389-Target sialyltetraosyl carbohydrate (Colo205); Target No. 390-Target SIRP; Target No. 391-Target SLAMF7; Target No. 392-Target SLC34A2; Target No. 393-Target SOST; Target No. 394-Target STEAP1; Target No. 395-Target sTn; Target No. 396-Target TAC; Target No. 397-Target TAG-72; Target No. 398-Target Tenascin (TNC-A1 or TNC-A4); Target No. 399-Target Tenascin (TNC-A2); Target No. 400-Target tenascin C; Target No. 401-Target tenascin W; Target No. 402-Target tenascin; Target No. 403-Target Ten-M2; Target No. 404-Target TGF beta 1; Target No. 405-Target TGFbeta; Target No. 406-Target TGF-; Target No. 407-Target TIGIT; Target No. 408-Target TIM-3; Target No. 409-Target TLR3; Target No. 410-Target Tn antigen; Target No. 411-Target Tn-(MUC1); Target No. 412-Target TNF; Target No. 413-Target TNFalpha, Target No. 414-Target TNFRSF10B; Target No. 415-Target TNFRSF12A; Target No. 416-Target TNFRSF8; Target No. 417-Target TNFRSF9; Target No. 418-Target TNFSF11; Target No. 419-Target TNFSF13B; Target No. 420-Target TPBG; Target No. 421-Target TRAIL-R2; Target No. 422-Target TrkA; Target No. 423-Target TSLP; Target No. 424-Target tumor associated carbohydrate antigen (TACA); Target No. 425-Target tumor specific glycosylation MUC1; Target No. 426-Target tumor-associated calcium signal transducer 2; Target No. 427-Target TYRP1(glycoprotein 75); Target No. 428-Target VEGF; Target No. 429-Target VEGF, c-Met, CD20, CD38, CD25, CD74, FcalphaR1, FcepsilonRI, acetyl choline receptor, fas, fasL, TRAIL hepatitis virus, hepatitis C virus, envelope E2 of hepatitis C virus, tissue factor, a complex of tissue factor and Factor VII, EGFr, CD4, and CD28; Target No. 430-Target VEGF A; Target No. 431-Target VEGFA, ANGT2; Target No. 432-Target VEGFR2; Target No. 433-Target vimentin; Target No. 434-Target VRGF; Target No. 435-Target VSTM5; Target No. 436-Target VWF; Target No. 437-Target 64 integrins Target No. 438-Target -folate receptor, v6integrin, BCMA, B7-H3, B7-H6, CAIX, CD19, CD20, CD22, CD30, CD33, CD37, CD44, CD44v6, CD44v7/8, CD70, CD123, CD138, CD171, CEA, DLL4, EGP-2, EGP-40, CSPG4, EGFR, EGFR family including ErbB2 (HER2), EGFRvIII, EPCAM, EphA2, EpCAM, FAP, FBP, fetal acetylcholine receptor, Fzd7, GD2, GD3, Glypican-3 (GPC3), h5T4, IL-11R, IL13R-2, KDR, light chain, light chain, LeY, L1CAM, MAGE-A1, mesothelin. MHC presented peptides, MUC1, MUC16, NCAM, NKG2D ligands, Notch1, Notch2/3, NY-ESO-1, PRAMF, PSCA, PSMA, Survivin, TAG-72, TEMs, TERT, VEGPR2, and ROR1; and Target No. 439-Target v6 integrin.

    [0296] In Table 9, the description number (Description No.) code is described in the following semi-colon delimited list where the description number is followed by the description (e.g., Description No. 1 with description aglycosylated antibody is shown as Description No. 1-Description aglycosylated antibody). The targets represented by the codes in Table 9 include, but are not limited to, Description No. 1Descriptionaglycosylated antibody; Description No. 2DescriptionAmplified variable region; Description No. 3DescriptionAmtibody; Description No. 4DescriptionAntibody for Pulmonary Fibrosis; Description No. 5-DescriptionBinding peptide; Description No. 6DescriptionBispecitic; Description No. 7Descriptionbispecific antibody; Description No. 8DescriptionBR96 scFv; Description No. 9DescriptionChain A, Human Igg1 Fc Frament; Description No. 10-DescriptionChain B, Human Igg1 Fc Fragment; Description No. 11DescriphonChimeric antigen receptor with cd19 Binding domain; Description No. 12DescriptionConsensus sequence; Description No. 13DescriptionConstant region; Description No. 14DescriptionConstant region IgG1; Description No. 15DescriptionConstant region IgG2; Description No. 16DescriptionConstant region IgG3; Description No. 17DescriptionConstruct; Description No. 18DescriptionDiabody; Description No. 19DescriptionDomain antibody; Description No. 20DescriptiondsFv; Description No. 21DescriptionDVD heavy chain; Description No. 22DescriptionDVD light chain; Description No. 23DescriptionEGFR-specific variable region and CH2 region; Description No. 24DescriptionFab Heavy chain; Description No. 25Description Fab heavy chain-Fc; Description No. 26Description Fc; Description No. 27Description Fc domain; Description No. 28Description Fc polypeptide; Description No. 29Description fc region Igg1; Description No. 30Description fibronectin type III (FN3) domain; Description No. 31Description first Fc domain, isoleucine zipper, IgG2 hinge, and second Fc domain; Description No. 32Description fragment crystallizable region Description No. 33Description full sequence; Description No. 34Description fusion construct; Description No. 35Description fusion protein; Description No. 36Description Fusion protein, bispecific; Description No. 37Description Fusion protein, tumor suppressor protein epha7ecd; Description No. 38Description Germline Heavy Chainvariable region; Description No. 39Description Heavy chain variable region; Description No. 40Description Heavy chain; Description No. 41Description Heavy chainconstant region; Description No. 42Description Heavy Chainvariable region; Description No. 43Description Heavy Chain (Genetic Recombination), Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 44Description Heavy chain I; Description No. 45Description Heavy Chain I, Antibody for immunosuppressant; Description No. 46Description Heavy chain 2; Description No. 47Description Heavy chain A; Description No. 48Description Heavy chain amino acid sequence humanized; Description No. 49Description Heavy chain antigen binding region; Description No. 50Description Heavy chain B; Description No. 51Description Heavy chain camelidae antibodies; Description No. 52Description Heavy chain CDR; Description No. 53Description Heavy Chain CDR 1, immunesuppressant; Description No. 54Description Heavy Chain CDR 2, immunesuppressant; Description No. 55Description Heavy Chain CDR 3, immunesuppressant; Description No. 56Description Heavy chain CDR grafted anti-IL-5; Description No. 57Description Heavy Chain CDR1; Description No. 58Description Heavy Chain CDR1, Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 59Description Heavy chain CDR1, Antibody for rheumatoid arthritis; Description No. 60Description Heavy Chain CDR1, immunesuppressant; Description No. 61Description Heavy Chain CDR2; Description No. 62Description Heavy Chain CDR2, Antibody for paroxysmal nocturnal hernoglobinuria; Description No. 63Description Heavy chain CDR2, Antibody for rheumatoid arthritis; Description No. 64Description Heavy Chain CDR2, immunesuppressant; Description No. 65-Description Heavy Chain CDR3; Description No. 66Description Heavy Chain CDR3. Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 67Description Heavy chain CDR3, Antibody for rheumatoid arthritis; Description No. 68Description Heavy Chain CDR3, immunesuppressant; Description No. 69Description Heavy chain chimeric; Description No. 70Description Heavy chain Consensus sequence; Description No. 71Description Heavy chain constant; Description No. 72Description heavy chain constant domain; Description No. 73Description Heavy chain constant gamma-1; Description No. 74Description Heavy chain constant1u gamma 1; Description No. 75Description Heavy chain constant of polypeptide; Description No. 76Description Heavy chain-constant region Hu1D10-IgG2M3; Description No. 77Description Heavy chain constant region, human IgG4; Description No. 78-Description Heavy chain constant region, wildtype; Description No. 79-Description Heavy chain constant, CHI; Description No. 80-Description Heavy chain constant, CH2; Description No. 81-Description Heavy chain constant, CH3; Description No. 82-Description Heavy chain constant, human IgG; Description No. 83Description Heavy chain constant human IgG4; Description No. 84Description Heavy chain constant, human IgG4 hingeless; Description No. 85Description Heavy chain Fab; Description No. 86Description Heavy chain Fab fragment, Chimeric (anti-alpha2-VH-IGHG1-CHI); Description No. 87Description Heavy chain gamma consensus sequence; Description No. 88Description Heavy chain gamma sequence; Description No. 89-Description Heavy chain humanized construct H1; Description No. 90-Description Heavy chain humanized construct H14; Description No. 91-Description Heavy chain humanized construct H15; Description No. 92Description Heavy chain humanized construct H6; Description No. 93Description Heavy chain humanized construct H17; Description No. 94-Description Heavy chain humanized construct H18; Description No. 95Description Heavy chain humanized construct H19; Description No. 96Description Heavy chain humanized construct H20; Description No. 97Description Heavy chain humanized construct H21; Description No. 98Description Heavy chain humanized construct H22; Description No. 99Description Heavy chain humanized construct H23; Description No. 100Description Heavy chain humanized construct H24; Description No. 101Description Heavy chain humanized construct H25; Description No. 102Description Heavy chain humanized construct H5; Description No. 103Description Heavy chain humanized construct H6; Description No. 104Description Heavy chain humanized construct H700; Description No. 105Description Heavy chain IgG4, immunomodulator; Description No. 106Description Heavy chain immunoglobulin variable region; Description No. 107Description Heavy chain immunoglobulin; Description No. 108Description Heavy chain leader and variable region of the murine anti-IGF-1 receptor antibody; Description No. 109Description Heavy chain mature; Description No. 110-Description Heavy chain mature fragment; Description No. 111Description Heavy chain mature immunoglobulin.; Description No. 112 Description Heavy chain mature variable region; Description No. 113Description Heavy chain mature Antibody for rheumatic diseases; Description No. 114Description Heavy chain of huAbF46-H4-A1, human IgG2 hinge and constant region of human IgG1; Description No. 115Description Heavy chain of huAbF46-114-A1, human IgG2 hinge and constant region of human IgG2; Description No. 116Description Heavy chain of huAbF46-H4-A1, U6-HC7 hinge and constant region of human IgG1; Description No. 117-Description Heavy chain polypeptide; Description No. 118Description Heavy chain protein; Description No. 119Description Heavy chain sequence; Description No. 120Description Heavy chain used in humanization; Description No. 121Description Heavy chain variable and constant chain; Description No. 122Description Heavy chain variable domain; Description No. 123Description heavy chain variable domain H1 AC10; Description No. 124Description heavy chain variable domain H2 AC11; Description No. 125Description heavy chain variable domain H3 AC12; Description No. 126Description heavy chain variable domain L1 AC11; Description No. 127Description heavy chain variable domain L2 AC12; Description No. 128Description heavy chain variable domain L3 AC13; Description No. 129Description Heavy chain variable domain of anti-alpha2-integrin; Description No. 130Description Heavy chain variable domain of anti-alpha2-integrin mAb; Description No. 131Description Heavy Chain Variable Domain Antibody for rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Crohn's disease, ulcerative colitis, moderate to severe chronic psoriasis and juvenile idiopathic arthritis, D2E7; Description No. 132Description Heavy Chain Variable domain, immunesuppressant for lupus; Description No. 133Description Heavy chain variable domain, murine; Description No. 134Description Heavy chain variable of scFv, immunesuppressant for lupus; Description No. 135Description heavy chain variable region (excludes the heavy chain variable region of the ErbB3 binding site of 16F); Description No. 136Description heavy chain variable region (VH); Description No. 137Description Heavy chain variable region (with signal sequence removed), Description No. 138Description Heavy chain variable region 1; Description No. 139-Description Heavy chain variable region 2; Description No. 140Description heavy chain variable region and heavy chain; Description No. 141Description Heavy chain variable region and IgG1 constant region; Description No. 142Description Heavy chain variable region chain, Antibody for rheumatoid arthritis; Description No. 143Description Heavy chain variable region consensus framework; Description No. 144Description Heavy chain variable region domain (as translated) listed in U.S. Pat. No. 5,736,137; Description No. 145Description Heavy chain variable region domain chain 1, Anti-IgE antibody; Description No. 146Description Heavy chain variable region domain. Antibody for Fibrotic diseases, scarring, diffuse scleroderma; Description No. 147Description heavy chain variable region dual variable domain; Description No. 148Description Heavy chain variable region humanized construct H1; Description No. 149Description Heavy chain variable region humanized construct H14; Description No. 150Description Heavy chain variable region humanized construct H15; Description No. 151Description Heavy chain variable region humanized construct H16; Description No. 152Description Heavy chain variable region humanized construct H17; Description No. 153Description Heavy chain variable region humanized construct HI 8; Description No. 154Description Heavy chain variable region humanized construct H19; Description No. 1.55Description Heavy chain variable region humanized construct H20; Description No. 156Description Heavy chain variable region humanized construct H21; Description No. 157Description Heavy chain variable region humanized construct H22; Description No. 158Description Heavy chain variable region humanized construct H23; Description No. 159Description Heavy chain variable region humanized construct H24; Description No. 160Description Heavy chain variable region humanized construct H25; Description No. 161Description Heavy chain variable region humanized construct H5; Description No. 162Description Heavy chain variable region humanized construct H6; Description No. 163Description Heavy chain variable region humanized construct H700; Description No. 164Description Heavy chain variable region variant; Description No. 165Description Heavy chain variable region with. CDRs and human CH1-hinge-aglycosylCH2CH3; Description No. 166Description Heavy chain variable region with predicted signal; Description No. 167Description Heavy chain variable region without predicted signal; Description No. 168Description Heavy chain variable region without signal; Description No. 169Description Heavy chain variable region without signal sequence; Description No. 170Description Heavy chain variable region, Amino acid sequence encoded by the 4-61 gene; Description No. 171Description Heavy chain variable region, Antibody for acute coronary syndrome, atherosclerosis; Description No. 172Description Heavy chain variable region, Antibody for allograft rejection; Description No. 173Description Heavy Chain Variable Region, Antibody for chronic plaque psoriasis; Description No. 174Description Heavy chain variable region, Antibody for Neuromyelitis optica and NMO Spectrum Disorder; Description No. 175Description Heavy chain variable region, Antibody for osteoporosis; Description No. 176Description Heavy chain variable region, Antibody for psoriasis (blocks T-cell migration); Description No. 177Description Heavy chain variable region, Antibody for Pulmonary Fibrosis; Description No. 178Description Heavy chain variable region, Antibody for rheumatoid arthritis; Description No. 179Description Heavy chain variable region, camelid derived; Description No. 180Description Heavy chain variable region, chimeric; Description No. 181Description Heavy chain variable region, E26 variants; Description No. 182Description Heavy chain variable region, human IgG1 subgroup III; Description No. 183Description Heavy chain variable region, humanized. immunoglobulin; Description No. 184Description Heavy Chain Variable Region, immunesuppressant Description No. 185Description Heavy chain variable region, immunoglobulin; Description No. 186-Description Heavy chain variable region, or mature/immunoglobulin; Description No. 187-Description heavy chain variable region variant; Description No. 188Description Heavy chain variable region, with peptide signal; Description No. 189Description Heavy chain variable region-CDR1; Description No. 190Description Heavy chain variable region-CDR2; Description No. 191Description Heavy chain variable region-CDR3; Description No. 192Description Heavy chain variable region-CH1; Description No. 193Description Heavy chain variable, Antibody for allergic reaction peanuts; Description No. 194Description Heavy chain variable, Autibody for psoriasis, graft-versus-host disease (prevention), acute kidney transplant rejection; Description No. 195Description Heavy chain variable, Antibody for rheumatoid arthritis; Description No. 196Description Heavy chain variable, Antibody for rheumatoid arthritis, lupus nephritis etc, multiple sclerosis; Description No. 197Description Heavy chain variant; Description No. 198Description Heavy chain V-D-J assignment; Description No. 199Description Heavy chain wild-type; Description No. 200Description Heavy Chain with Flag Tag; Description No. 201Description Heavy chain with signal peptide; Description No. 202Description Heavy chain, ANGPT2; Description No. 203Description Heavy chain, Antibody for acute coronary syndrome atherosclerosis; Description No. 204Description Heavy chain, Antibody for allergic diseases; Description No. 205Description Heavy chain, Antibody for allergic disorders; Description No. 206Description Heavy chain, Antibody for Allograft rejection, intravenous steroid-refractory ulcerative colitis, kidney transplantation, psoriasis; Description No. 207Description Heavy chain, Antibody for Allograft rejection, graft-versus-host disease; Description No. 208Description Heavy chain, Antibody for asthma, rheumatoid arthritis, leukemia, inflammatory diseases; Description No. 209Description Heavy Chain, Antibody for Crohn's disease and rheumatoid arthritis; Description No. 210Description Heavy chain, Antibody for Crohn's disease, psoriasis, ankylosing spondylitis; Description No. 211Description Heavy chain, Antibody for Crohn's disease, Psoriasis, Transplantation, Type 1 diabetes, Ulcerative colitis, Multiple sclerosis, Atherosclerosis; Description No. 212Description Heavy chain, Antibody for diabetes mellitus type 1; Description No. 213Description Heavy chain, Antibody for diabetes mellitus type 1, psoriasis; Description No. 214Description Heavy chain, Antibody for diabetes, vascular disease, acne, cancer and psoriasis; Description No. 215Description Heavy chain, Antibody for Idiopathic pulmonary fibrosis; Description No. 216Description Heavy chain, Antibody for idiopathic pulmonary fibrosis, focal segmental glomerulosclerosis, cancer; Description No. 217Description Heavy chain, Antibody for osteoporosis; Description No. 218Description Heavy chain, Antibody for osteoporosis, Denosumab OPGL-1; Description No. 219Description Heavy Chain, Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 220Description Heavy Chain, Antibody for Plague-type psoriasis; Description No. 221Description Heavy chain, Antibody for prevention of organ transplant rejections; Description No. 222Description Heavy chain, Antibody for psoriasis; Description No. 223Description Heavy chain, Antibody for psoriasis, organ transplant immunological rejection suppression; Description No. 224Description Heavy chain, Antibody for Psoriasis, rheumatoid arthritis; Description No. 225Description Heavy chain, Antibody for Psoriasis, rheumatoid arthritis, sciatica, lumbar radicular pain; Description No. 226Description Heavy chain, Antibody for psoriasis, Crohn's disease, multiple sclerosis; Description No. 227Description Heavy chain, Antibody for Psoriatic arthritis; Description No. 228Description Heavy chain, Antibody for rheumatic diseases; Description No. 229Description Heavy chain, Antibody for rheumatoid arthritis; Description No. 230Description Heavy chain, Antibody for Rheumatoid arthritis, disease-modifying anti-rheumatic drug; Description No. 231-Description Heavy chain, Antibody for Rheumatoid arthritis, Multiple sclerosis; Description No. 232Description Heavy Chain, Antibody for rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Crohn's disease, Ulcerative colitis, moderate to severe chronic psoriasis and juvenile idiopathic arthritis, D2E7; Description No. 233Description Heavy chain, Antibody for Systemic lupus erythematosus; Description No. 234Description Heavy Chain, Antibody for ulcerative colitis and Crohn's disease; Description No. 235Description Heavy chain, Anti-EGFr; Description No. 236Description Heavy chain, anti-IGFR Fab-hLIGHT; Description No. 237Description Heavy chain chimeric; Description No. 238Description Heavy chain, fusion; Description No. 239Description Heavy chain, human subgroup II; Description No. 240Description Heavy chain, immunoglobulin; Description No. 241Description Heavy Chain, immunosuppressant; Description No. 242Description Heavy chain, immunosuppressive drug; Description No. 243Description Heavy chain, mus musculus; Description No. 244Description Heavy chain, VEGFA; Description No. 245Description Heavy Chain-constant and variable region; Description No. 246Description Heavy chain-constant region; Description No. 247Description Heavy chain-constant region of Hu1D10-IgG1; Description No, 248Description Heavy chain-variable region; Description No. 249Description Heavy chain-variable region of Hu1d10-IgG2M3 or Hu1D10-IgG1; Description No. 250Description Heavy CHIMERIC chain 1 immunesuppressant, Anti-CD25 antibody; Description No. 251Description Heavy-chain-CDR1; Description No. 252Description Heavy-chain-CDR2; Description No. 253Description Heavy-chain-CDR3; Description No. 254Description Herceptin Heavy chain variable region-CH1 (Heavy chain variable region(1-120)+CH1(121-218)); Description No. 255Description H-GAMMA-1 (Heavy chain variable region(1-118)+CHI (119-216)+HINGE-REGION(217-231)+CH2(232-341)+CH3(342-448)); Description No. 256Description H-GAMMA-1 (Heavy chain variable region(1-120)+CH1 (121-218)+HINGE-REGION(219-233)+CH2(234-343)+CH3(344-450); Description No. 257Description H-GAMMA-1 (Heavy chain variable region(1-121)+CH1(122-219)+HINGE-REGION(220-220)+CH2(221-330)+CH3(331-437), Description No. 258Description Hinge, CH2 and CH3 domain of IgG1; Description No. 259Description huHMFG1-scFv; Description No. 260Description HuLuc-63 Heavy chain variable CDR1; Description No. 261Description HuLuc-63 Heavy Chain variable CDR2, Description No. 262-Description HuLuc-63 Heavy chain variable CDR3; Description No. 263Description HuLuc-63 Light chain variable CDR1; Description No. 264Description HuLuc-63 Light chain variable CDR2; Description No. 265Description HuLuc-63 Light chain variable CDR3; Description No. 266-Description human Heavy chainconstant region, Description No. 267Description Human IgG2 hinge region; Description No. 268Description Humanized Heavy chain variable region-CH1 (Heavy chain variable region(1-121)+CH1(122-219)); Description No. 269-Description Humanized Heavy chain variable region-CH1(Heavy chain variable region(1-121)+CH1(122-201); Description No. 270Description Humanized Light chain-KAPPA (V-KAPPA(1-107)+C-KAPPA(1.08-211)); Description No. 271Description Humanized Light chain-KAPPA (V-KAPPA(1-107)+C-KAPPA(108-214)); Description No. 272-Description Humanized L-KAPPA; Description No. 273Description Human-mouse chimeric anti-CD20 Heavy chain 1; Description No. 274Description Human-mouse chimeric anti-CD20 Light chain 1; Description No. 275Description Ig gamma-1 chain C region; Description No. 276Description Ig kappa constant region; Description No. 277Description IGHG1 constant region; Description No. 278Description immunosuppressive drug; Description No. 279Description isoleucine zipper; Description No. 280Description Kappa constant region; Description No. 281Description kappa light chain; Description No. 282Description Kappa Light Chainvariable region; Description No. 283Description Lambda light chain; Description No. 284Description Light chain; Description No. 285Description Light Chainvariable region; Description No. 286Description Light Chain (Genetic Recombination), Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 287Description Light chain (h-KAPPA (V-KAPPA(1-107)+C-KAPPA(108-214)); Description No. 288Description Light chain 1; Description No. 289Description Light Chain 1, Antibody for immunesuppressant; Description No. 290Description Light chain 1, Anti-HER2; Description No. 291Description Light chain 2; Description No. 292Description Light chain 3; Description No. 293Description Light chain 4; Description No. 294Description Light chain amino acid sequence humanized; Description No. 295-Description Light chain and lambda constant region; Description No. 296-Description Light chain antigen binding region; Description No. 297Description Light chain CDR; Description No. 298Description Light Chain CDR 1, immunesuppressant; Description No. 299Description Light Chain CDR 2, immunesuppressant; Description No. 300Description Light Chain CDR 3. immunesuppressant; Description No. 301Description Light chain CDR grafted anti-IL-5; Description No. 302Description Light chain CDR1; Description No. 303Description Light Chain CDR1, Antibody for paroxysmal nocturnal hernoglobinuria; Description No. 304Description Light chain CDR1, Antibody for rheumatoid arthritis; Description No. 305-Description Light Chain CDR1, immunesuppressant; Description No. 306Description Light chain CDR2; Description No. 307-Description Light Chain CDR2, Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 308Description Light chain CDR2, Antibody for rheumatoid arthritis; Description No. 309Description Light Chain CDR2, immunesuppressant; Description No. 310-Description Light chain CDR3; Description No. 311Description Light Chain CDR3, Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 312Description Light chain CDR3, Antibody for rheumatoid arthritis; Description No. 313Description Light Chain CDR3, immunesuppressant; Description No. 314Description Light chain chimeric; Description No. 315Description Light chain Ck; Description No. 316Description Light chain consensus, bum 1, light kappa subgroup I; Description No. 317Description Light chain constant region; Description No. 318-Description Light chain constant region kappa; Description No. 319Description Light chain constant region of Hu1D10-IgG2M3 or Hu1D10-IgG1; Description No. 320Description Light chain constant region, kappa; Description No. 321Description Light chain constant region, lambda, human; Description No. 322Description Light chain D; Description No. 323Description Light Chain F; Description No. 324Description Light chain F; Description No. 325Description Light chain humanized construct L11; Description No. 326Description Light chain humanized construct L13; Description No. 327Description Light chain humanized construct L14; Description No. 328Description Light chain humanized construct L15; Description No. 329Description Light chain humanized construct L16; Description No. 330Description Light chain humanized construct L17; Description No. 331Description Light chain humanized construct L18; Description No. 332Description Light chain humanized construct L6; Description No. 333Description Light chain IgG4, immunomodulator; Description No. 334Description Light chain immunoglobulin variable region; Description No. 335Description Light chain immunoglobulin; Description No. 336Description Light chain kappa; Description No. 337Description Light chain Kappa, Antibody for allergic reaction peanuts; Description No. 338Description Light chain kappa consensus framework, human; Description No. 339Description Light chain kappa consensus sequence; Description No. 340Description Light chain kappa constant; Description No. 341Description Light chain kappa constant region; Description No. 342Description Light chain kappa sequence; Description No. 343Description Light chain kappa variable region; Description No. 344Description Light chain leader and variable region of the murine anti-IGF-I receptor antibody, Description No. 345Description Light chain mature; Description No. 346Description Light chain mature fragment; Description No. 347Description Light chain mature immunoglobulin; Description No. 348Description Light chain mature protein, Antibody for rheumatic diseases; Description No. 349Description Light chain mature variable region; Description No. 350Description Light chain huAbF46-H4-A1(H36Y) and human kappa constant region; Description No. 351Description Light chain polypeptide; Description No. 352Description Light chain protein; Description No. 353Description Light chain sequence; Description No. 354Description Light Chain used in humanization; Description No. 355Description Light chain variable and constant chain; Description No. 356Description Light chain variable domain of anti-alpha2-integrin; Description No. 357Description Light chain variable domain of anti-alpha2-integrin mAb; Description No. 358Description Light Chain Variable Domain, Antibody for rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Crohn's disease, ulcerative colitis, moderate to severe chronic psoriasis and juvenile idiopathic arthritis, D2E7; Description No. 359Description Light chain variable domain, immunosuppressant for lupus; Description No. 360Description Light chain variable kappa.; Description No. 361Description Light chain variable kappa, Amino acid sequence encoded by the VK gene; Description No. 362Description Light chain variable of scFv, immunesuppressant for lupus; Description No. 363Description Light chainvariable region; Description No. 364Description Light chain variable region; Description No. 365Description light chain variable region (excludes the light chain variable region sequence of the ErbB3 binding site of 16F); Description No. 366Description light chain variable region (excludes the light chain variable region sequence of the IGF-1R binding site of 16F); Description No. 367Description light chain variable region (VL); Description No. 368Description light chain variable region 1; Description No. 369Description Light chain variable region 2; Description No. 370Description Light chain variable region and human IgG1 constant region; Description No. 371Description light chain variable region and light chain; Description No. 372Description Light chain variable region consensus framework; Description No. 373Description Light chain variable region domain (as translated) listed in U.S. Pat. No. 5,736,137; Description No. 374Description Light chain variable region domain chain 1, Anti-IgE antibody; Description No. 375Description Light chain variable region domain listed in U.S. Pat. No. 5,736,137 (with signal sequence removed); Description No. 376Description Light chain variable region domain, Antibody for Fibrotic diseases, scarring, diffuse scleroderma; Description No. 377Description light chain variable region dual variable domain; Description No. 378Description Light chain variable region humanized construct L11; Description No. 379Description Light chain variable region humanized construct L13; Description No. 380Description Light chain variable region humanized construct L14; Description No. 381Description Light chain variable region humanized construct L15; Description No. 382Description Light chain variable region humanized construct L16; Description No. 383Description Light chain variable region humanized construct L17; Description No. 384Description Light chain variable region humanized construct L18; Description No. 385Description Light chain variable region humanized construct L6; Description No. 386Description Light chain variable region kappa; Description No. 387Description Light chain variable region of Hu1D10-IgG2M3 or Hu1D10-IgG1; Description No. 388Description Light chain variable region variant; Description No. 389Description Light chain variable region with predicted signal; Description No. 390Description Light chain variable region without predicted signal; Description No. 391Description Light chain variable region without signal sequence; Description No. 392Description Light chain variable region, Antibody for acute coronary syndrome, atherosclerosis; Description No. 393Description Light chain variable region, Antibody for allograft rejection; Description No. 394Description Light Chain Variable Region, Antibody for chronic plaque psoriasis; Description No. 395Description Light chain variable region, Antibody for idiopathic pulmonary fibrosis, focal segmental glomerulosclerosis, cancer; Description No. 396Description Light chain variable region, Antibody for Neuromyelitis optica and NMO Spectrum Disorder; Description No. 397Description Light Chain Variable Region, Antibody for osteoporosis; Description No. 398Description Light chain variable region, Antibody for psoriasis (blocks T-cell migration); Description No. 399Description Light chain variable region, Antibody for Pulmonary Fibrosis; Description No. 400Description Light chain variable region, Antibody for rheumatoid arthritis; Description No. 401Description Light chain variable region, camelid derived; Description No. 402Description Light chain variable region, chimeric; Description No. 403Description Light chain variable region, Chimeric antigen receptor with cd19Binding domain; Description No. 404Description Light chain variable region, E26 variants; Description No. 405Description light chain variable region, Human kappa; Description No. 406Description Light chain variable region, humanized; Description No. 407Description Light chain variable region, humanized, immunoglobulin; Description No. 408Description Light Chain Variable Region, immunesuppressant; Description No. 409Description Light chain variable region, immunoglobulin; Description No. 410Description Light chain variable region, or mature/immunoglobulin; Description No. 411Description light chain variable region, variant; Description No. 412Description Light chain variable region; Light chain C; Description No. 413Description Light chain variable region; Light chain D; Description No. 414Description Light chain variable region; Light chain F; Description No. 415Description Light chain variable region; Light chain F; Description No. 416Description Light chain variable region-CDR1 From U.S. Pat. No. 8,557,243; Description No. 417Description Light chain variable region-CDR2 From U.S. Pat. No. 8,557,243, Description No. 418Description Light chain variable region-CDR3 From U.S. Pat. No. 8,557,243; Description No. 419Description Light chain variable, Antibody for psoriasis, graft-versus-host disease (prevention), acute kidney transplant rejection; Description No. 420Description Light chain variable, Antibody for rheumatoid arthritis; Description No. 421Description Light chain variable, Antibody for rheumatoid arthritis, lupus nephritis etc, multiple sclerosis; Description No. 422Description Light chain variant; Description No. 423Description Light chain V-J assignment; Description No. 424Description Light chain wild-type; Description No. 425Description Light chain with signal peptide; Description No. 426Description Light chain, 71F10Fab-hLIGHT fusion; Description No. 427-Description Light chain, ANGPT2; Description No. 428Description Light chain, Antibody for acute coronary syndrome, atherosclerosis; Description No. 429Description Light chain, Antibody for allergic diseases; Description No. 430Description Light chain, Antibody for allergic disorders; Description No. 431Description Light chain, Antibody for Allograft rejection intravenous steroid-refractory ulcerative colitis, kidney transplantation, psoriasis; Description No. 432Description Light chain, Antibody for Allograft rejection, graft-versus-host disease; Description No. 433Description Tight chain, Antibody for asthma, rheumatoid arthritis, leukemia, inflammatory diseases; Description No. 434Description Light Chain. Antibody for Crohn's disease and rheumatoid arthritis; Description No. 435Description Light chain, Antibody for Crohn's disease, psoriasis, ankylosing spondylitis; Description No. 436Description Light chain, Antibody for Crohn's disease, Psoriasis, Transplantation, Type 1 diabetes, Ulcerative colitis, Multiple sclerosis, Atherosclerosis; Description No. 437Description Light chain, Antibody for diabetes mellitus type 1, psoriasis; Description No. 438Description Light chain, Antibody for diabetes mellitus type 2; Description No. 439Description Light chain, Antibody for diabetes, vascular disease, acne, cancer and psoriasis; Description No. 440Description Light chain, Antibody for idiopathic pulmonary fibrosis; Description No. 441Description Light chain, Antibody for idiopathic pulmonary fibrosis, focal segmental glomerulosclerosis, cancer; Description No. 442Description Light chain, Antibody for osteoporosis; Description No. 443Description Light chain, Antibody for osteoporosis, Denosumab OPGL-1; Description No. 444Description Light Chain, Antibody for paroxysmal nocturnal hemoglobinuria; Description No. 445Description Light Chain, Antibody for Plaque-type psoriasis; Description No. 446Description Tight chain, Antibody for prevention of organ transplant rejections; Description No. 447Description Light chain, Antibody for psoriasis; Description No. 448Description Light chain, Antibody for psoriasis, organ transplant immunological rejection suppression; Description No. 449Description Light chain, Antibody for Psoriasis, rheumatoid arthritis; Description No. 450Description Light chain, Antibody for Psoriatic arthritis; Description No. 451Description Light chain, Antibody for rheumatic diseases; Description No. 452Description Light chain, Antibody for rheumatoid arthritis; Description No. 453Description Light chain, Antibody for Rheumatoid arthritis, disease-modifying anti-rheumatic drug; Description No. 454Description Light chain, Antibody for Rheumatoid arthritis, Multiple sclerosis; Description No. 455Description Light chain, Antibody for rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis. Crohn's disease, ulcerative colitis, moderate to severe chronic psoriasis and juvenile idiopathic arthritis, D2E7; Description No. 456Description Light chain, Antibody for Systemic lupus erythematosus; Description No. 457Description Light Chain, Antibody for ulcerative colitis and Crohn's disease; Description No. 458Description Light chain, anti-CD23 Fab-hLIGHT fusion; Description No. 459Description Light chain, chimeric; Description No. 460Description Light chain, Chimeric (anti-alpha2-VL-IGKC-CL); Description No. 461Description Light chain, human subgroup; Description No. 462Description Light Chain, immunesuppressant; Description No. 463Description Light chain, immunosuppressive drug; Description No. 464Description Light chain, kappa constant; Lambda chain constant region; Description No. 465Description Light chain, lambda constant; Description No. 466Description Tight chain, lambda human Ig; Description No. 467Description Light chain, mus musculus; Description No. 468Description Light chain, VEGFA; Description No. 469Description Licilit chain-variable region; Description No. 470Description Light CHIMERIC chain 1, immunesuppressant, Anti-CD25 antibody; Description No. 471Description L-KAPPA (V-KAPPA(1-107)+C-KAPPA(108-214)); Description No. 472Description MAb17-1A gamma; Description No. 473-Description MAb17-1A kappa; Description No. 474Description Mouse Anti-CD20 Heavy chain; Description No. 475Description Mouse Anti-CD20 Light chain; Description No. 476Description Nanobody; Description No. 477Description Polypeptide; Description No. 478Description polypeptide, Antibody for thrombotic thrombocytopenic purpura, acute coronary syndrome; Description No. 479Description Scf Light chain variable region-Heavy; Description No. 480Description ScFv; Description No. 481Description say fusion protein; Description No. 482Description Scfv Heavy-Light; Description No. 483Description say immunesuppressant for lupus; Description No. 484Description say, Antibody for allergic reaction peanuts; Description No. 485Description ScFv, BHA10 ScFvs with S46(VL) stabilizing mutation; Description No. 486Description Scfv, BHA10 Says with V55G(VL) stabilizing mutation; Description No. 487Description Scfv, Chimeric antigen receptor with cd19Binding domain; Description No. 488Description scFv-CH chain; Description No. 489Description SEA/E-120; Description No. 490Description secretory signal sequence of Heavy chain; Description No. 491Description Single chain; Description No. 492Description Single chain antibody; Description No. 493Description Single chain scFv; Description No. 494Description single chain variable fragment; Description No. 495Description single chain variable fragment (scFv); Description No. 496Description single chain variable region; Description No. 497Description Single heavy chain variable domain; Description No. 498Description. Single variable domain antibody; Description No. 499Description Single-chain fusion peptide; Description No. 500Description single-domain; Description No. 501Description single-domain antibody (dAb); Description No. 502Description single-domain antibody (sdAb); Description No. 503Description Small modular immunopharmaceutical (smip) polypeptide; Description No. 504Description Variable domain antibody; Description No. 505Description Variable region, Description No. 506Description variant Fe region; Description No. 507Description VH-VL; and Description No. 508Description VL-VH.

    [0297] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Priliximab, a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Priliximab may be used to treat, prevent and/or reduce the effects of multiple sclerosis. As another non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Priliximab, a fragment or variant thereof may be used to treat, prevent and/or reduce the effects of Crohns Disease.

    [0298] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Rovelizumab, a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Rovelizumab, a fragment or variant thereof may be used to treat, prevent and/or reduce the effects of multiple sclerosis.

    [0299] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Nerelimomab, a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Nerelimomab, a fragment or variant thereof may be used as an immunosuppressant.

    [0300] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding BAYX1351, a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding BAYX1351, a fragment or variant thereof may be used as an immunosuppressant.

    [0301] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Clenoliximab (also known as CE94PE, IDEC-151 and PRIMATIZED), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic, acid sequences encoding Clenoliximab (also known as CE94PE, IDEC-151 and PRIMATIZED), a fragment or variant thereof may be used to treat, prevent or reduce the effects of rheumatoid arthritis and/or asthma. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding the heavy chain of Clenoliximab (also known as CE94PE, IDE C-151 and PRIMATIZED), a fragment or variant thereof may be used to treat, prevent or reduce the effects of rheumatoid arthritis and/or asthma. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding the light chain of Clenoliximab (also known as CE94PE, IDEC-151 and PRIMATIZED), a fragment or variant thereof may be used to treat, prevent or reduce the effects of rheumatoid arthritis and/or asthma. As a non-limiting, example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding the heavy chain of Clenoliximab (also known as CE94PE, IDEC-151 and PRIMATIZED) as described in U.S. Pat. No. 6,136,310 as SEQ ID NO: 11 (the contents of which are herein incorporated by reference in its entirety), a fragment or variant thereof may be used to treat, prevent or reduce the effects of rheumatoid arthritis and/or asthma. As a non-limiting example, the payload region of the AA V particle comprises one or more nucleic acid sequences encoding the light chain of Clenoliximab (also known as CE94PE, IDEC-151 and PRIMATIZED) as described in U.S. Pat. No. 6,136,310 as SEQ ID NO: 5 (the contents of which are herein incorporated by reference in its entirety), a fragment or variant thereof may be used to treat, prevent or reduce the effects of rheumatoid arthritis and/or asthma.

    [0302] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Maslimoniab, a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Maslimomab, a fragment or variant thereof may be used as an immunosuppressant.

    [0303] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Atorolimumab (also known as P3x22914G4), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Atorolimumab (also known as P3x22914G4), a fragment or variant thereof may be used as an immunosuppressant.

    [0304] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Vapaliximab (also known as 2D10), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Vapaliximab (also known as 2D10), a fragment or variant thereof may be used as an immunosuppressant.

    [0305] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Ziralimumab (also known as ABX-RB2, cem2.6), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Ziralimumab (also known as ABX-RB2, cem2.6), a fragment or variant thereof may be used to treat, prevent and/or reduce the effects of cancer, inflammation and/or immune system disorders.

    [0306] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Zolimomab aritox (also known as H65-ricin A chain immunotoxin and H65-RTA), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Zolimomab aritox (also known as H65-ricin A chain immunotoxin and H65-RTA) a fragment or variant thereof may be used to treat, prevent or reduce the effects of systemic lupus erythematosus, graft-versus-host disease and/or cutaneous T cell lymphoma.

    [0307] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Zanolimuniab (also known as HuMax-CD4), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Zanolimumab also known as Hu Max-CD4), fragment or variant thereof may be used to treat, prevent or reduce the effects of rheumatoid arthritis, psoriasis and/or T-cell lymphoma.

    [0308] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Bertilimumab (also known as CAT-213), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Bertilimumab (also known as CAT-213), a fragment or variant thereof may be used to treat, prevent or reduce the effects of allergies.

    [0309] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Pascolizumab (also known as SB 240683), a fragment or variant thereof. As a non-limiting, example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Pascolizumab (also known as SB-240683), a fragment or variant thereof may be used to treat, prevent or reduce the effects of allergies.

    [0310] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Odulimomab (also known as afolimomab, anti-LFA1 and ANTILFA), a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Odulimomab (also known as afolimomab, anti-LFA1 and ANTILFA), a fragment or variant thereof may be used to treat, prevent or reduce the effects of allograft rejection.

    [0311] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Enlimomab pegol, a fragment or variant thereof. As a non-limiting example, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding Enlimomab pegol, a fragment or variant thereof may be used to treat, prevent or reduce the effects of renal transplant rejection.

    [0312] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding an antibody or a fragment thereof as described in United States Publication Nos. US20130122003, US20150056211, US20160069US20150056211, US20160069894 or U.S. Pat. No. 7,524,496. In a non-limiting example, the antibody targets IL-6. In another non-limiting example, the antibody targets EGF.

    Migraine and Pain Antibodies

    [0313] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the migraine and pain payload antibody polypeptides listed in Table 10 (M1-MP564; SEQ ID NO: 3453-3459, 3856, 3890-3898, 4232-4237, 5220-5239, 6406-6429, 6454-6639, 6955-6956, 7905, 8797-8821, 8842-9026, 9288. 17659-17755).

    TABLE-US-00010 TABLE 10 Migraine and Pain Antibodies Antibody SEQ ID No. Target Description Antibody Name Reference Information NO MP1 CGRP Heavy chain G1, cluster U.S. Pat. No. 9,115,194 17659 headache SEQ ID NO: 11 MP2 CGRP Heavy chain 10E4 U.S. Pat. No. 9,102,731 17660 SEQ ID NO: 36 MP3 CGRP Heavy chain 11H9 U.S. Pat. No. 9,102,731 17661 SEQ ID NO: 38 MP4 CGRP Heavy chain 12G8 HIL U.S. Pat. No. 9,102,731 17662 SEQ ID NO: 39 MP5 CGRP Heavy chain 13H2 U.S. Pat. No. 9,102,731 17663 SEQ ID NO: 40 MP6 CGRP Heavy chain 32H7 U.S. Pat. No. 9,102,731 17664 SEQ ID NO: 41 MP7 CGRP Heavy chain A US20120294802 17665 SEQ ID NO: 3 MP8 CGRP Heavy chain Ab1 US20120294802 17666 SEQ ID NO: 4 MP9 CGRP Heavy chain Ab10 US20120294802 17667 SEQ ID NO: 94 MP10 CGRP Heavy chain Ab11 US20120294802 17668 SEQ ID NO: 104 MP11 CGRP Heavy chain Ab12 US20120294802 17669 SEQ ID NO: 114 MP12 CGRP Heavy chain Ab13 US20120294802 17670 SEQ ID NO: 124 MP13 CGRP Heavy chain 02E7 U.S. Pat. No. 9,102,731 17671 SEQ ID NO: 31 MP14 CGRP Heavy chain Ab14 US20120294802 17672 SEQ ID NO: 134 MP15 CGRP Heavy chain Ab2 US20120294802 17673 SEQ ID NO: 14 MP16 CGRP Heavy chain Ab3 US20120294802 17674 SEQ ID NO: 24 MP17 CGRP Heavy chain Ab4 US20120294802 17675 SEQ ID NO: 34 MP18 CGRP Heavy chain Ab5 US20120294802 17676 SEQ ID NO: 44 MP19 CGRP Heavy chain Ab6 US20120294802 17677 SEQ ID NO: 54 MP20 CGRP Heavy chain Ab7 US20120294802 17678 SEQ ID NO: 64 MP21 CGRP Heavy chain Ab8 US20120294802 17679 SEQ ID NO: 74 MP22 CGRP Heavy chain Ab9 US20120294802 17680 SEQ ID NO: 84 MP23 CGRP Heavy chain B US20120294802 17681 SEQ ID NO: 13 MP24 CGRP Heavy chain 01E11/04E4/09D4 U.S. Pat. No. 9,102,731 17682 SEQ ID NO: 29 MP25 CGRP Heavy chain C US20120294802 17683 SEQ ID NO: 23 MP26 CGRP Heavy chain D US20120294802 17684 SEQ ID NO: 33 MP27 CGRP Heavy chain E US20120294802 17685 SEQ ID NO: 43 MP28 CGRP Heavy chain F US20120294802 17686 SEQ ID NO: 53 MP29 CGRP Heavy chain G US20120294802 17687 SEQ ID NO: 63 MP30 CGRP Heavy chain H US20120294802 17688 SEQ ID NO: 73 MP31 CGRP Heavy chain I US20120294802 17689 SEQ ID NO: 83 MP32 CGRP Heavy chain J US20120294802 17690 SEQ ID NO: 93 MP33 CGRP Heavy chain K US20120294802 17691 SEQ ID NO: 103 MP34 CGRP Heavy chain L US20120294802 17692 SEQ ID NO: 113 MP35 CGRP Heavy chain 01H7 U.S. Pat. No. 9,102,731 17693 SEQ ID NO: 30 MP36 CGRP Heavy chain M US20120294802 17694 SEQ ID NO: 123 MP37 CGRP Heavy chain N US20120294802 17695 SEQ ID NO: 133 MP38 CGRP Heavy chain 03B6 U.S. Pat. No. 9,102,731 17696 SEQ ID NO: 32 MP39 CGRP Heavy chain 03C8/05F5/12E8 U.S. Pat. No. 9,102,731 17697 SEQ ID NO: 33 MP40 CGRP Heavy chain 04H6 U.S. Pat. No. 9,102,731 17698 SEQ ID NO: 34 MP41 CGRP Heavy chain 09F5 U.S. Pat. No. 9,102,731 17699 SEQ ID NO: 35 MP42 CGRP Heavy chain 11D11 U.S. Pat. No. 9,102,731 17700 SEQ ID NO: 37 MP43 TrkA Heavy chain BXhVH1 WO2009098238 3453 SEQ ID NO: 1 MP44 TrkA Heavy chain BXhVH2 WO2009098238 3455 SEQ ID NO: 2 MP45 TrkA Heavy chain BXhVH3 WO2009098238 3456 SEQ ID NO: 3 MP46 TrkA Heavy chain BXhVH4 WO2009098238 3457 SEQ ID NO: 4 MP47 TrkA Heavy chain BXhVH5 WO2009098238 3458 SEQ ID NO: 5 MP48 TrkA Heavy chain BXhVH5VL1 US20150183885 5220 SEQ ID NO: 28 MP49 TrkA Heavy chain GBR US20150183885 5224 VH5(G42E)VL1 SEQ ID NO: 53 MP50 TrkA Heavy chain GBR US20150183885 5221 VH5(K3Q)VL1 SEQ ID NO: 50 MP51 TrkA Heavy chain GBR US20150183885 5232 VH5(K3Q, SEQ ID NO: 61 A49S, Y50A)VL1 MP52 TrkA Heavy chain GBR US20150183885 5237 VH5(K3Q, SEQ ID NO: 66 A49S, Y50A, P60A, T62S)VL1 MP53 TrkA Heavy chain GBR US20150183885 5233 VH5(K3Q, SEQ ID NO: 62 P60A, T62S)VL1 MP54 TrkA Heavy chain GBR US20150183885 5229 VH5(K3Q, SEQ ID NO: 58 T40A)VL1 MP55 TrkA Heavy chain GBR US20150183885 5234 VH5(K3Q, SEQ ID NO: 63 T40A, P60A, T62S)VL1 MP56 TrkA Heavy chain GBR US20150183885 5238 VH5(K3Q, SEQ ID NO: 67 T40A, R44G, A49S, Y50A, P60A, T62S)VL1 MP57 TrkA Heavy chain GBR US20150183885 5239 VH5(K3Q, SEQ ID NO: 68 T40A, R44G, A49S, Y50A, P60A, T62S, R94K)VL1 MP58 TrkA Heavy chain GBR US20150183885 5236 VH5(K3Q, SEQ ID NO: 65 T40A, R44G, A49S, Y50A)VL1 MP59 TrkA Heavy chain GBR US20150183885 5227 VH5(K3Q, SEQ ID NO: 56 V37A(VL1 MP60 TrkA Heavy chain GBR US20150183885 5228 VH5(K3Q, SEQ ID NO: 57 V37A)VL1(*) MP61 TrkA Heavy chain GBR US20150183885 5231 VH5(K3Q, SEQ ID NO: 60 V37A, R44G)VL1 MP62 TrkA Heavy chain GBR US20150183885 5235 VH5(K3Q, SEQ ID NO: 64 V37A, T40A, P60A, T62S)VL1 MP63 TrkA Heavy chain GBR US20150183885 5230 VH5(P60A, SEQ ID NO: 59 T62S)VL1 MP64 TrkA Heavy chain GBR US20150183885 5226 VH5(R94K)VL1 SEQ ID NO: 55 MP65 TrkA Heavy chain GBR US20150183885 5222 VH5(V37A)VL1 SEQ ID NO: 51 MP66 TrkA Heavy chain GBR US20150183885 5223 VH5(V37A)VL1(*) SEQ ID NO: 52 MP67 TrkA Heavy chain GBR US20150183885 5225 VH5(V89L)VL1 SEQ ID NO: 54 MP68 TrkA Heavy chain HUVHWOV WO2009098238 3459 SEQ ID NO: 6 MP69 TrkA Heavy chain mVHEP WO2009098238 3454 SEQ ID NO: 15 MP70 GFR3 Heavy chain H1M2236N U.S. Pat. No. 8,968,736 6425 variable region SEQ ID NO: 397 MP71 GFR3 Heavy chain H1M2243N U.S. Pat. No. 8,968,736 6424 variable region SEQ ID NO: 381 MP72 GFR3 Heavy chain H4H2207N U.S. Pat. No. 8,968,736 6413 variable region SEQ ID NO: 2 MP73 GFR3 Heavy chain H4H2210N U.S. Pat. No. 8,968,736 6427 variable region SEQ ID NO: 66 MP74 GFR3 Heavy chain H4H2212N U.S. Pat. No. 8,968,736 6411 variable region SEQ ID NO: 18 MP75 GFR3 Heavy chain H4H2234N U.S. Pat. No. 8,968,736 6428 variable region SEQ ID NO: 82 MP76 GFR3 Heavy chain H4H2236N3 U.S. Pat. No. 8,968,736 6422 variable region SEQ ID NO: 34 MP77 GFR3 Heavy chain H4H2243N2 U.S. Pat. No. 8,968,736 6426 variable region SEQ ID NO: 50 MP78 GFR3 Heavy chain H4H2291S U.S. Pat. No. 8,968,736 6429 variable region SEQ ID NO: 98 MP79 GFR3 Heavy chain H4H2292S U.S. Pat. No. 8,968,736 6406 variable region SEQ ID NO: 114 MP80 GFR3 Heavy chain H4H2293P U.S. Pat. No. 8,968,736 6407 variable region SEQ ID NO: 130 MP81 GFR3 Heavy chain H4H2294S U.S. Pat. No. 8,968,736 6408 variable region SEQ ID NO: 146 MP82 GFR3 Heavy chain H4H2295S U.S. Pat. No. 8,968,736 6409 variable region SEQ ID NO: 162 MP83 GFR3 Heavy chain H4H2296S U.S. Pat. No. 8,968,736 6410 variable region SEQ ID NO: 178 MP84 GFR3 Heavy chain H4H2341S U.S. Pat. No. 8,968,736 6412 variable region SEQ ID NO: 194 MP85 GFR3 Heavy chain H4H2342P U.S. Pat. No. 8,968,736 6414 variable region SEQ ID NO: 210 MP86 GFR3 Heavy chain H4H2344S U.S. Pat. No. 8,968,736 6415 variable region SEQ ID NO: 226 MP87 GFR3 Heavy chain H4H2345S U.S. Pat. No. 8,968,736 6416 variable region SEQ ID NO: 242 MP88 GFR3 Heavy chain H4H2346S U.S. Pat. No. 8,968,736 6417 variable region SEQ ID NO: 258 MP89 GFR3 Heavy chain H4H2352S U.S. Pat. No. 8,968,736 6418 variable region SEQ ID NO: 290 MP90 GFR3 Heavy chain H4H2354S U.S. Pat. No. 8,968,736 6419 variable region SEQ ID NO: 306 MP91 GFR3 Heavy chain H4H2355S U.S. Pat. No. 8,968,736 6420 variable region SEQ ID NO: 322 MP92 GFR3 Heavy chain H4H2357S U.S. Pat. No. 8,968,736 6421 variable region SEQ ID NO: 338 MP93 GFR3 Heavy chain H4H2364S U.S. Pat. No. 8,968,736 6423 variable region SEQ ID NO: 354 MP94 hNav1.7 Heavy chain H1H1015B WO2014159595 6461 variable region SEQ ID NO: 126 MP95 hNav1.7 Heavy chain H1H1019B WO2014159595 6457 variable region SEQ ID NO: 110 MP96 hNav1.7 Heavy chain H1H1021B WO2014159595 6546 variable region SEQ ID NO: 428 MP97 hNav1.7 Heavy chain H1H1022B WO2014159595 6462 variable region SEQ ID NO: 130 MP98 hNav1.7 Heavy chain H1H1023B WO2014159595 6463 variable region SEQ ID NO: 134 MP99 hNav1.7 Heavy chain H1H1026B WO2014159595 6464 variable region SEQ ID NO: 138 MP100 hNav1.7 Heavy chain H1H1028B WO2014159595 6547 variable region SEQ ID NO: 430 MP101 hNav1.7 Heavy chain H1H1029B WO2014159595 6548 variable region SEQ ID NO: 432 MP102 hNav1.7 Heavy chain H1H1030B WO2014159595 6466 variable region SEQ ID NO: 142 MP103 hNav1.7 Heavy chain H1H1032B WO2014159595 6467 variable region SEQ ID NO: 146 MP104 hNav1.7 Heavy chain H1H1036B WO2014159595 6549 variable region SEQ ID NO: 434 MP105 hNav1.7 Heavy chain H1H1038B WO2014159595 6468 variable region SEQ ID NO: 150 MP106 hNav1.7 Heavy chain H1H1039B WO2014159595 6550 variable region SEQ ID NO: 436 MP107 hNav1.7 Heavy chain H1H1040B WO2014159595 6551 variable region SEQ ID NO: 438 MP108 hNav1.7 Heavy chain H1H1041B WO2014159595 6469 variable region SEQ ID NO: 154 MP109 hNav1.7 Heavy chain H1H1042B WO2014159595 6552 variable region SEQ ID NO: 440 MP110 hNav1.7 Heavy chain H1H1044B WO2014159595 6470 variable region SEQ ID NO: 158 MP111 hNav1.7 Heavy chain H1H1045B WO2014159595 6471 variable region SEQ ID NO: 162 MP112 hNav1.7 Heavy chain H1H1050B WO2014159595 6472 variable region SEQ ID NO: 166 MP113 hNav1.7 Heavy chain H1H1052B WO2014159595 6553 variable region SEQ ID NO: 442 MP114 hNav1.7 Heavy chain H1H1055B WO2014159595 6473 variable region SEQ ID NO: 170 MP115 hNav1.7 Heavy chain H1H1056B WO2014159595 6474 variable region SEQ ID NO: 174 MP116 hNav1.7 Heavy chain H1H1058B WO2014159595 6554 variable region SEQ ID NO: 444 MP117 hNav1.7 Heavy chain H1H1059B WO2014159595 6475 variable region SEQ ID NO: 178 MP118 hNav1.7 Heavy chain H1H1060B WO2014159595 6477 variable region SEQ ID NO: 182 MP119 hNav1.7 Heavy chain H1H1061B WO2014159595 6555 variable region SEQ ID NO: 446 MP120 hNav1.7 Heavy chain H1H1065B WO2014159595 6556 variable region SEQ ID NO: 448 MP121 hNav1.7 Heavy chain H1H1066B WO2014159595 6557 variable region SEQ ID NO: 450 MP122 hNav1.7 Heavy chain H1H1067B WO2014159595 6558 variable region SEQ ID NO: 452 MP123 hNav1.7 Heavy chain H1H1068B WO2014159595 6559 variable region SEQ ID NO: 454 MP124 hNav1.7 Heavy chain H1H1076B WO2014159595 6560 variable region SEQ ID NO: 456 MP125 hNav1.7 Heavy chain H1H1089B WO2014159595 6561 variable region SEQ ID NO: 458 MP126 hNav1.7 Heavy chain H1H1090B WO2014159595 6563 variable region SEQ ID NO: 460 MP127 hNav1.7 Heavy chain H1H1097B WO2014159595 6564 variable region SEQ ID NO: 462 MP128 hNav1.7 Heavy chain H1H1100B WO2014159595 6565 variable region SEQ ID NO: 464 MP129 hNav1.7 Heavy chain H1H1102B WO2014159595 6566 variable region SEQ ID NO: 466 MP130 hNav1.7 Heavy chain H1H1106B WO2014159595 6567 variable region SEQ ID NO: 468 MP131 hNav1.7 Heavy chain H1H1107B WO2014159595 6568 variable region SEQ ID NO: 470 MP132 hNav1.7 Heavy chain H1H1108B WO2014159595 6569 variable region SEQ ID NO: 472 MP133 hNav1.7 Heavy chain H1H1109B WO2014159595 6570 variable region SEQ ID NO: 474 MP134 hNav1.7 Heavy chain H1H1111B WO2014159595 6571 variable region SEQ ID NO: 476 MP135 hNav1.7 Heavy chain H1H1114B WO2014159595 6545 variable region SEQ ID NO: 426 MP136 hNav1.7 Heavy chain H1H1117B WO2014159595 6572 variable region SEQ ID NO: 478 MP137 hNav1.7 Heavy chain H1H1118B WO2014159595 6573 variable region SEQ ID NO: 480 MP138 hNav1.7 Heavy chain H1H1119B WO2014159595 6574 variable region SEQ ID NO: 482 MP139 hNav1.7 Heavy chain H1H1121B WO2014159595 6575 variable region SEQ ID NO: 484 MP140 hNav1.7 Heavy chain H1H1126B WO2014159595 6576 variable region SEQ ID NO: 486 MP141 hNav1.7 Heavy chain H1H1130B WO2014159595 6577 variable region SEQ ID NO: 488 MP142 hNav1.7 Heavy chain H1H1131B WO2014159595 6578 variable region SEQ ID NO: 490 MP143 hNav1.7 Heavy chain H1H1133B WO2014159595 6579 variable region SEQ ID NO: 492 MP144 hNav1.7 Heavy chain H1H1134B WO2014159595 6580 variable region SEQ ID NO: 494 MP145 hNav1.7 Heavy chain H1H1135B WO2014159595 6581 variable region SEQ ID NO: 496 MP146 hNav1.7 Heavy chain H1H1137B WO2014159595 6582 variable region SEQ ID NO: 498 MP147 hNav1.7 Heavy chain H1H1139B WO2014159595 6584 variable region SEQ ID NO: 500 MP148 hNav1.7 Heavy chain H1H1141B WO2014159595 6585 variable region SEQ ID NO: 502 MP149 hNav1.7 Heavy chain H1H1149B WO2014159595 6586 variable region SEQ ID NO: 504 MP150 hNav1.7 Heavy chain H1H1153B WO2014159595 6587 variable region SEQ ID NO: 506 MP151 hNav1.7 Heavy chain H1H1156B WO2014159595 6588 variable region SEQ ID NO: 508 MP152 hNav1.7 Heavy chain H1H1157B WO2014159595 6589 variable region SEQ ID NO: 510 MP153 hNav1.7 Heavy chain H1H1158B WO2014159595 6590 variable region SEQ ID NO: 512 MP154 hNav1.7 Heavy chain H1H1162B WO2014159595 6591 variable region SEQ ID NO: 514 MP155 hNav1.7 Heavy chain H1H1172B WO2014159595 6592 variable region SEQ ID NO: 516 MP156 hNav1.7 Heavy chain H2M799N WO2014159595 6631 variable region SEQ ID NO: 823 MP157 hNav1.7 Heavy chain H4H1003P WO2014159595 6633 variable region SEQ ID NO: 860 MP158 hNav1.7 Heavy chain H4H1025P WO2014159595 6636 variable region SEQ ID NO: 872 MP159 hNav1.7 Heavy chain H4H361 B WO2014159595 6492 variable region SEQ ID NO: 234 MP160 hNav1.7 Heavy chain H4H362B WO2014159595 6510 variable region SEQ ID NO: 30 MP161 hNav1.7 Heavy chain H4H362P WO2014159595 6635 variable region SEQ ID NO: 868 MP162 hNav1.7 Heavy chain H4H365B WO2014159595 6493 variable region SEQ ID NO: 238 MP163 hNav1.7 Heavy chain H4H367B WO2014159595 6521 variable region SEQ ID NO: 34 MP164 hNav1.7 Heavy chain H4H368B WO2014159595 6532 variable region SEQ ID NO: 38 MP165 hNav1.7 Heavy chain H4H370B WO2014159595 6593 variable region SEQ ID NO: 518 MP166 hNav1.7 Heavy chain H4H371 B WO2014159595 6494 variable region SEQ ID NO: 242 MP167 hNav1.7 Heavy chain H4H372B WO2014159595 6495 variable region SEQ ID NO: 246 MP168 hNav1.7 Heavy chain H4H373B WO2014159595 6496 variable region SEQ ID NO: 250 MP169 hNav1.7 Heavy chain H4H378B WO2014159595 6594 variable region SEQ ID NO: 520 MP170 hNav1.7 Heavy chain H4H379B WO2014159595 6497 variable region SEQ ID NO: 254 MP171 hNav1.7 Heavy chain H4H381 B WO2014159595 6498 variable region SEQ ID NO: 258 MP172 hNav1.7 Heavy chain H4H382B WO2014159595 6543 variable region SEQ ID NO: 42 MP173 hNav1.7 Heavy chain H4H383B WO2014159595 6595 variable region SEQ ID NO: 522 MP174 hNav1.7 Heavy chain H4H385B WO2014159595 6500 variable region SEQ ID NO: 262 MP175 hNav1.7 Heavy chain H4H385B WO2014159595 6613 variable region SEQ ID NO: 681 MP176 hNav1.7 Heavy chain H4H388B WO2014159595 6501 variable region SEQ ID NO: 266 MP177 hNav1.7 Heavy chain H4H389B WO2014159595 6596 variable region SEQ ID NO: 524 MP178 hNav1.7 Heavy chain H4H391B WO2014159595 6562 variable region SEQ ID NO: 46 MP179 hNav1.7 Heavy chain H4H391P WO2014159595 6583 variable region SEQ ID NO: 50 MP180 hNav1.7 Heavy chain H4H395B WO2014159595 6614 variable region SEQ ID NO: 685 MP181 hNav1.7 Heavy chain H4H396B WO2014159595 6502 variable region SEQ ID NO: 270 MP182 hNav1.7 Heavy chain H4H397B WO2014159595 6604 variable region SEQ ID NO: 54 MP183 hNav1.7 Heavy chain H4H398B WO2014159595 6503 variable region SEQ ID NO: 274 MP184 hNav1.7 Heavy chain H4H399B WO2014159595 6504 variable region SEQ ID NO: 278 MP185 hNav1.7 Heavy chain H4H400B WO2014159595 6505 variable region SEQ ID NO: 282 MP186 hNav1.7 Heavy chain H4H402B WO2014159595 6506 variable region SEQ ID NO: 286 MP187 hNav1.7 Heavy chain H4H405B WO2014159595 6597 variable region SEQ ID NO: 526 MP188 hNav1.7 Heavy chain H4H407B WO2014159595 6598 variable region SEQ ID NO: 528 MP189 hNav1.7 Heavy chain H4H408B WO2014159595 6609 variable region SEQ ID NO: 58 MP190 hNav1.7 Heavy chain H4H409B WO2014159595 6507 variable region SEQ ID NO: 290 MP191 hNav1.7 Heavy chain H4H413B WO2014159595 6599 variable region SEQ ID NO: 530 MP192 hNav1.7 Heavy chain H4H415B WO2014159595 6508 variable region SEQ ID NO: 294 MP193 hNav1.7 Heavy chain H4H416B WO2014159595 6509 variable region SEQ ID NO: 298 MP194 hNav1.7 Heavy chain H4H419B WO2014159595 6511 variable region SEQ ID NO: 302 MP195 hNav1.7 Heavy chain H4H422B WO2014159595 6512 variable region SEQ ID NO: 306 MP196 hNav1.7 Heavy chain H4H426B WO2014159595 6611 variable region SEQ ID NO: 62 MP197 hNav1.7 Heavy chain H4H427B WO2014159595 6600 variable region SEQ ID NO: 532 MP198 hNav1.7 Heavy chain H4H432B WO2014159595 6601 variable region SEQ ID NO: 534 MP199 hNav1.7 Heavy chain H4H434B WO2014159595 6513 variable region SEQ ID NO: 310 MP200 hNav1.7 Heavy chain H4H434B WO2014159595 6615 variable region SEQ ID NO: 689 MP201 hNav1.7 Heavy chain H4H434P WO2014159595 6616 variable region SEQ ID NO: 693 MP202 hNav1.7 Heavy chain H4H436B WO2014159595 6602 variable region SEQ ID NO: 536 MP203 hNav1.7 Heavy chain H4H437B WO2014159595 6603 variable region SEQ ID NO: 538 MP204 hNav1.7 Heavy chain H4H438B WO2014159595 6514 variable region SEQ ID NO: 314 MP205 hNav1.7 Heavy chain H4H438B WO2014159595 6617 variable region SEQ ID NO: 697 MP206 hNav1.7 Heavy chain H4H439B WO2014159595 6612 variable region SEQ ID NO: 66 MP207 hNav1.7 Heavy chain H4H439P WO2014159595 6618 variable region SEQ ID NO: 70 MP208 hNav1.7 Heavy chain H4H441 B WO2014159595 6619 variable region SEQ ID NO: 701 MP209 hNav1.7 Heavy chain H4H441 P WO2014159595 6634 variable region SEQ ID NO: 864 MP210 hNav1.7 Heavy chain H4H442B WO2014159595 6515 variable region SEQ ID NO: 318 MP211 hNav1.7 Heavy chain H4H443B WO2014159595 6624 variable region SEQ ID NO: 74 MP212 hNav1.7 Heavy chain H4H444B WO2014159595 6516 variable region SEQ ID NO: 322 MP213 hNav1.7 Heavy chain H4H445B WO2014159595 6605 variable region SEQ ID NO: 540 MP214 hNav1.7 Heavy chain H4H446B WO2014159595 6517 variable region SEQ ID NO: 326 MP215 hNav1.7 Heavy chain H4H448B WO2014159595 6627 variable region SEQ ID NO: 78 MP216 hNav1.7 Heavy chain H4H453B WO2014159595 6606 variable region SEQ ID NO: 542 MP217 hNav1.7 Heavy chain H4H456B WO2014159595 6518 variable region SEQ ID NO: 330 MP218 hNav1.7 Heavy chain H4H457B WO2014159595 6519 variable region SEQ ID NO: 334 MP219 hNav1.7 Heavy chain H4H458B WO2014159595 6520 variable region SEQ ID NO: 338 MP220 hNav1.7 Heavy chain H4H460B WO2014159595 6522 variable region SEQ ID NO: 342 MP221 hNav1.7 Heavy chain H4H461 B WO2014159595 6523 variable region SEQ ID NO: 346 MP222 hNav1.7 Heavy chain H4H462B WO2014159595 6524 variable region SEQ ID NO: 350 MP223 hNav1.7 Heavy chain H4H463B WO2014159595 6525 variable region SEQ ID NO: 354 MP224 hNav1.7 Heavy chain H4H464B WO2014159595 6526 variable region SEQ ID NO: 358 MP225 hNav1.7 Heavy chain H4H465B WO2014159595 6527 variable region SEQ ID NO: 362 MP226 hNav1.7 Heavy chain H4H466B WO2014159595 6528 variable region SEQ ID NO: 366 MP227 hNav1.7 Heavy chain H4H467B WO2014159595 6529 variable region SEQ ID NO: 370 MP228 hNav1.7 Heavy chain H4H468B WO2014159595 6630 variable region SEQ ID NO: 82 MP229 hNav1.7 Heavy chain H4H468P WO2014159595 6632 variable region SEQ ID NO: 86 MP230 hNav1.7 Heavy chain H4H471B WO2014159595 6637 variable region SEQ ID NO: 90 MP231 hNav1.7 Heavy chain H4H471P WO2014159595 6638 variable region SEQ ID NO: 94 MP232 hNav1.7 Heavy chain H4H472B WO2014159595 6530 variable region SEQ ID NO: 374 MP233 hNav1.7 Heavy chain H4H473B WO2014159595 6531 variable region SEQ ID NO: 378 MP234 hNav1.7 Heavy chain H4H475B WO2014159595 6533 variable region SEQ ID NO: 382 MP235 hNav1.7 Heavy chain H4H477B WO2014159595 6534 variable region SEQ ID NO: 386 MP236 hNav1.7 Heavy chain H4H478B WO2014159595 6607 variable region SEQ ID NO: 544 MP237 hNav1.7 Heavy chain H4H480B WO2014159595 6535 variable region SEQ ID NO: 390 MP238 hNav1.7 Heavy chain H4H481 B WO2014159595 6536 variable region SEQ ID NO: 394 MP239 hNav1.7 Heavy chain H4H482B WO2014159595 6537 variable region SEQ ID NO: 398 MP240 hNav1.7 Heavy chain H4H483B WO2014159595 6538 variable region SEQ ID NO: 402 MP241 hNav1.7 Heavy chain H4H484B WO2014159595 6539 variable region SEQ ID NO: 406 MP242 hNav1.7 Heavy chain H4H486B WO2014159595 6540 variable region SEQ ID NO: 410 MP243 hNav1.7 Heavy chain H4H488B WO2014159595 6541 variable region SEQ ID NO: 414 MP244 hNav1.7 Heavy chain H4H489B WO2014159595 6542 variable region SEQ ID NO: 418 MP245 hNav1.7 Heavy chain H4H490B WO2014159595 6608 variable region SEQ ID NO: 546 MP246 hNav1.7 Heavy chain H4H491B WO2014159595 6544 variable region SEQ ID NO: 422 MP247 hNav1.7 Heavy chain H1 H1 105B WO2014159595 6481 variable region SEQ ID NO: 198 MP248 hNav1.7 Heavy chain H1 H1 123B WO2014159595 6483 variable region SEQ ID NO: 202 MP249 hNav1.7 Heavy chain H1 H1 138B WO2014159595 6484 variable region SEQ ID NO: 206 MP250 hNav1.7 Heavy chain H1 H1 144B WO2014159595 6485 variable region SEQ ID NO: 210 MP251 hNav1.7 Heavy chain H1 H1 147B WO2014159595 6486 variable region SEQ ID NO: 214 MP252 hNav1.7 Heavy chain H1 H1 155B WO2014159595 6487 variable region SEQ ID NO: 218 MP253 hNav1.7 Heavy chain H1 H1 164B WO2014159595 6489 variable region SEQ ID NO: 222 MP254 hNav1.7 Heavy chain H1 H1 166B WO2014159595 6490 variable region SEQ ID NO: 226 MP255 hNav1.7 Heavy chain H1 H1 169B WO2014159595 6491 variable region SEQ ID NO: 230 MP256 hNav1.7 Heavy chain H1 H1006P WO2014159595 6620 variable region SEQ ID NO: 705 MP257 hNav1.7 Heavy chain H1 H1025B WO2014159595 6622 variable region SEQ ID NO: 722 MP258 hNav1.7 Heavy chain H1 H1068B WO2014159595 6621 variable region SEQ ID NO: 709 MP259 hNav1.7 Heavy chain H1 H1069B WO2014159595 6478 variable region SEQ ID NO: 186 MP260 hNav1.7 Heavy chain H1 H1082B WO2014159595 6479 variable region SEQ ID NO: 190 MP261 hNav1.7 Heavy chain H1 H1098B WO2014159595 6480 variable region SEQ ID NO: 194 MP262 hNav1.7 Heavy chain H1 M683N WO2014159595 6482 variable region SEQ ID NO: 2 MP263 hNav1.7 Heavy chain H1 M797N WO2014159595 6610 variable region SEQ ID NO: 6 MP264 hNav1.7 Heavy chain H1 M799N WO2014159595 6499 variable region SEQ ID NO: 26 MP265 hNav1.7 Heavy chain H1 M801 N WO2014159595 6623 variable region SEQ ID NO: 727 MP266 hNav1.7 Heavy chain H1 M826N WO2014159595 6625 variable region SEQ ID NO: 743 MP267 hNav1.7 Heavy chain H1 M834N WO2014159595 6454 variable region SEQ ID NO: 10 MP268 hNav1.7 Heavy chain H1 M836N WO2014159595 6626 variable region SEQ ID NO: 759 MP269 hNav1.7 Heavy chain H1 M839N WO2014159595 6465 variable region SEQ ID NO: 14 MP270 hNav1.7 Heavy chain H1 M852N WO2014159595 6476 variable region SEQ ID NO: 18 MP271 hNav1.7 Heavy chain H1 M875N WO2014159595 6488 variable region SEQ ID NO: 22 MP272 hNav1.7 Heavy chain H1 M879N WO2014159595 6628 variable region SEQ ID NO: 791 MP273 hNav1.7 Heavy chain H1 M994N WO2014159595 6629 variable region SEQ ID NO: 807 MP274 hNav1.7 Heavy chain H1H1003B WO2014159595 6639 variable region SEQ ID NO: 98 MP275 hNav1.7 Heavy chain H1H1006B WO2014159595 6455 variable region SEQ ID NO: 102 MP276 hNav1.7 Heavy chain H1H1008B WO2014159595 6456 variable region SEQ ID NO: 106 MP277 hNav1.7 Heavy chain H1H1010B WO2014159595 6458 variable region SEQ ID NO: 114 MP278 hNav1.7 Heavy chain H1H1011B WO2014159595 6459 variable region SEQ ID NO: 118 MP279 hNav1.7 Heavy chain H1H1013B WO2014159595 6460 variable region SEQ ID NO: 122 MP280 TNF Heavy chain US20030157061 6955 variable region SEQ ID NO: 2 MP281 TNF Heavy chain US20030157061 6956 variable region SEQ ID NO: 6 MP282 TrkA Heavy chain HuVHWO WO2009098238 3856 variable region SEQ ID NO: 17 MP283 NGF Heavy chain, Fulranumab, U.S. Pat. No. 7,601,818 17701 Antibody for 4D4, AMG- SEQ ID NO: 40 chronic pain 403, JNJ- 42160443 MP284 NGF Heavy chain, Fasinumab, 17702 Antibody for REGN475, chronic pain SAR164877 MP285 NGF Heavy chain, Tanezumab, US20040237124 17703 Antibody for PF- SEQ ID NO: 1 pain, chronic 04383119, RN and acute, 624, E3 osteoarthritis MP286 CGRP Light chain G1, cluster U.S. Pat. No. 9,115,194 17704 headache SEQ ID NO: 12 MP287 CGRP Light chain 04E4 U.S. Pat. No. 9,102,731 17705 SEQ ID NO: 17 MP288 CGRP Light chain 10E4 U.S. Pat. No. 9,102,731 17706 SEQ ID NO: 22 MP289 CGRP Light chain 02E7 U.S. Pat. No. 9,102,731 17707 SEQ ID NO: 14 MP290 CGRP Light chain 12E8 U.S. Pat. No. 9,102,731 17708 SEQ ID NO: 25 MP291 CGRP Light chain 01E11 U.S. Pat. No. 9,102,731 17709 SEQ ID NO: 12 MP292 CGRP Light chain 01H7 U.S. Pat. No. 9,102,731 17710 SEQ ID NO: 13 MP293 CGRP Light chain 03B6 U.S. Pat. No. 9,102,731 17711 SEQ ID NO: 15 MP294 CGRP Light chain 03C8 U.S. Pat. No. 9,102,731 17712 SEQ ID NO: 16 MP295 CGRP Light chain 04H6 U.S. Pat. No. 9,102,731 17713 SEQ ID NO: 18 MP296 CGRP Light chain 05F5 U.S. Pat. No. 9,102,731 17714 SEQ ID NO: 19 MP297 CGRP Light chain 09D4 U.S. Pat. No. 9,102,731 17715 SEQ ID NO: 20 MP298 CGRP Light chain 09F5 U.S. Pat. No. 9,102,731 17716 SEQ ID NO: 21 MP299 CGRP Light chain 11D11 HL U.S. Pat. No. 9,102,731 17717 SEQ ID NO: 23 MP300 CGRP Light chain 11H9 U.S. Pat. No. 9,102,731 17718 SEQ ID NO: 24 MP301 CGRP Light chain 12G8 HL U.S. Pat. No. 9,102,731 17719 SEQ ID NO: 26 MP302 CGRP Light chain 13H2 U.S. Pat. No. 9,102,731 17720 SEQ ID NO: 27 MP303 CGRP Light chain 32H7 U.S. Pat. No. 9,102,731 17721 SEQ ID NO: 28 MP304 CGRP Light chain A US20120294802 17722 SEQ ID NO: 1 MP305 CGRP Light chain Ab1 US20120294802 17723 SEQ ID NO: 2 MP306 CGRP Light chain Ab10 US20120294802 17724 SEQ ID NO: 92 MP307 CGRP Light chain Ab11 US20120294802 17725 SEQ ID NO: 102 MP308 CGRP Light chain Ab12 US20120294802 17726 SEQ ID NO: 112 MP309 CGRP Light chain Ab13 US20120294802 17727 SEQ ID NO: 122 MP310 CGRP Light chain Ab14 US20120294802 17728 SEQ ID NO: 132 MP311 CGRP Light chain Ab2 US20120294802 17729 SEQ ID NO: 12 MP312 CGRP Light chain Ab3 US20120294802 17730 SEQ ID NO: 22 MP313 CGRP Light chain Ab4 US20120294802 17731 SEQ ID NO: 32 MP314 CGRP Light chain Ab5 US20120294802 17732 SEQ ID NO: 42 MP315 CGRP Light chain Ab6 US20120294802 17733 SEQ ID NO: 52 MP316 CGRP Light chain Ab7 US20120294802 17734 SEQ ID NO: 62 MP317 CGRP Light chain Ab8 US20120294802 17735 SEQ ID NO: 72 MP318 CGRP Light chain Ab9 US20120294802 17736 SEQ ID NO: 82 MP319 CGRP Light chain B US20120294802 17737 SEQ ID NO: 11 MP320 CGRP Light chain C US20120294802 17738 SEQ ID NO: 21 MP321 CGRP Light chain D US20120294802 17739 SEQ ID NO: 31 MP322 CGRP Light chain E US20120294802 17740 SEQ ID NO: 41 MP323 CGRP Light chain F US20120294802 17741 SEQ ID NO: 51 MP324 CGRP Light chain G US20120294802 17742 SEQ ID NO: 61 MP325 CGRP Light chain H US20120294802 17743 SEQ ID NO: 71 MP326 CGRP Light chain I US20120294802 17744 SEQ ID NO: 81 MP327 CGRP Light chain J US20120294802 17745 SEQ ID NO: 91 MP328 CGRP Light chain K US20120294802 17746 SEQ ID NO: 101 MP329 CGRP Light chain L US20120294802 17747 SEQ ID NO: 111 MP330 CGRP Light chain M US20120294802 17748 SEQ ID NO: 121 MP331 CGRP Light chain N US20120294802 17749 SEQ ID NO: 131 MP332 TrkA Light chain BXhVH5VL1, US20150183885 7905 GBR SEQ ID NO: 29 VH5(K3Q)VL1, GBR VH5(V37A)VL1, GBR VH5(V37A)VL1(*), GBR VH5(G42E)VL1, GBR VH5(V89L)VL1, GBR VH5(R94K)VL1, GBR VH5(K3Q, V37A)VL1, GBR VH5(K3Q, V37A)VL1(*), GBR VH5(K3Q, T40A)VL1, GBR VH5(P60A, T62S)VL1, GBR VH5(K3Q, V37A, R44G)VL1, GBR VH5(K3Q, A49S, Y50A)VL1, GBR VH5(K3Q, P60A, T62S)VL1, GBR VH5(K3Q, T40A, P60A, T62S)VL1, GBR VH5(K3Q, V37A, T40A, P60A, T62S)VL1, GBR VH5(K3Q, T40A, R44G, A49S, Y50A)VL1, GBR VH5(K3Q, A49S, Y50A, P60A, T62S)VL1, GBR VH5(K3Q, T40A, R44G, A49S, Y50A, P60A, T62S)VL1, GBR VH5(K3Q, T40A, R44G, A49S, Y50A, P60A, T62S, R94K)VL1 MP333 TrkA Light chain BXhVL2 WO2009098238 3897 SEQ ID NO: 8 MP334 TrkA Light chain BXhVL3 WO2009098238 3898 SEQ ID NO: 9 MP335 TrkA Light chain BXhVL4 WO2009098238 3890 SEQ ID NO: 10 MP336 TrkA Light chain BXhVL5 WO2009098238 3891 SEQ ID NO: 11 MP337 TrkA Light chain BXhVL7 WO2009098238 3893 SEQ ID NO: 13 MP338 TrkA Light chain BXhVL8 WO2009098238 3894 SEQ ID NO: 14 MP339 TrkA Light chain BXhVL1 WO2009098238 3896 SEQ ID NO: 7 MP340 TrkA Light chain BXhVL WO2009098238 3892 SEQ ID NO: 12 MP341 TrkA Light chain mVLEP WO2009098238 3895 SEQ ID NO: 16 MP342 GFR3 Light chain H1M2236N U.S. Pat. No. 8,968,736 8817 variable region SEQ ID NO: 405 MP343 GFR3 Light chain H1M2243N U.S. Pat. No. 8,968,736 8816 variable region SEQ ID NO: 389 MP344 GFR3 Light chain H4H2207N U.S. Pat. No. 8,968,736 8797 variable region SEQ ID NO: 10 MP345 GFR3 Light chain H4H2210N U.S. Pat. No. 8,968,736 8820 variable region SEQ ID NO: 74 MP346 GFR3 Light chain H4H2212N U.S. Pat. No. 8,968,736 8808 variable region SEQ ID NO: 26 MP347 GFR3 Light chain H4H2234N U.S. Pat. No. 8,968,736 8821 variable region SEQ ID NO: 90 MP348 GFR3 Light chain H4H2236N3 U.S. Pat. No. 8,968,736 8818 variable region SEQ ID NO: 42 MP349 GFR3 Light chain H4H2243N2 U.S. Pat. No. 8,968,736 8819 variable region SEQ ID NO: 58 MP350 GFR3 Light chain H4H2291S U.S. Pat. No. 8,968,736 8798 variable region SEQ ID NO: 106 MP351 GFR3 Light chain H4H2292S U.S. Pat. No. 8,968,736 8799 variable region SEQ ID NO: 122 MP352 GFR3 Light chain H4H2293P U.S. Pat. No. 8,968,736 8800 variable region SEQ ID NO: 138 MP353 GFR3 Light chain H4H2294S U.S. Pat. No. 8,968,736 8801 variable region SEQ ID NO: 154 MP354 GFR3 Light chain H4H2295S U.S. Pat. No. 8,968,736 8802 variable region SEQ ID NO: 170 MP355 GFR3 Light chain H4H2296S U.S. Pat. No. 8,968,736 8803 variable region SEQ ID NO: 186 MP356 GFR3 Light chain H4H2341S U.S. Pat. No. 8,968,736 8804 variable region SEQ ID NO: 202 MP357 GFR3 Light chain H4H2342P U.S. Pat. No. 8,968,736 8805 variable region SEQ ID NO: 218 MP358 GFR3 Light chain H4H2344S U.S. Pat. No. 8,968,736 8806 variable region SEQ ID NO: 234 MP359 GFR3 Light chain H4H2345S U.S. Pat. No. 8,968,736 8807 variable region SEQ ID NO: 250 MP360 GFR3 Light chain H4H2346S U.S. Pat. No. 8,968,736 8809 variable region SEQ ID NO: 266 MP361 GFR3 Light chain H4H2350P U.S. Pat. No. 8,968,736 8810 variable region SEQ ID NO: 282 MP362 GFR3 Light chain H4H2352S U.S. Pat. No. 8,968,736 8811 variable region SEQ ID NO: 298 MP363 GFR3 Light chain H4H2354S U.S. Pat. No. 8,968,736 8812 variable region SEQ ID NO: 314 MP364 GFR3 Light chain H4H2355S U.S. Pat. No. 8,968,736 8813 variable region SEQ ID NO: 330 MP365 GFR3 Light chain H4H2357S U.S. Pat. No. 8,968,736 8814 variable region SEQ ID NO: 346 MP366 GFR3 Light chain H4H2364S U.S. Pat. No. 8,968,736 8815 variable region SEQ ID NO: 362 MP367 hNav1.7 Light chain H1 H1 105B WO2014159595 8870 variable region SEQ ID NO: 200 MP368 hNav1.7 Light chain H1 H1 138B WO2014159595 8871 variable region SEQ ID NO: 208 MP369 hNav1.7 Light chain H1 H1 144B WO2014159595 8872 variable region SEQ ID NO: 212 MP370 hNav1.7 Light chain H1 H1 147B WO2014159595 8873 variable region SEQ ID NO: 216 MP371 hNav1.7 Light chain H1 H1 155B WO2014159595 8874 variable region SEQ ID NO: 220 MP372 hNav1.7 Light chain H1 H1 164B WO2014159595 8875 variable region SEQ ID NO: 224 MP373 hNav1.7 Light chain H1 H1 166B WO2014159595 8876 variable region SEQ ID NO: 228 MP374 hNav1.7 Light chain H1 H1 169B WO2014159595 8877 variable region SEQ ID NO: 232 MP375 hNav1.7 Light chain H1 H1006P WO2014159595 9006 variable region SEQ ID NO: 707 MP376 hNav1.7 Light chain H1 H1025B WO2014159595 9009 variable region SEQ ID NO: 724 MP377 hNav1.7 Light chain H1 H1068B WO2014159595 9007 variable region SEQ ID NO: 711 MP378 hNav1.7 Light chain H1 H1069B WO2014159595 8866 variable region SEQ ID NO: 188 MP379 hNav1.7 Light chain H1 H1082B WO2014159595 8867 variable region SEQ ID NO: 192 MP380 hNav1.7 Light chain H1 H1098B WO2014159595 8868 variable region SEQ ID NO: 196 MP381 hNav1.7 Light chain H1 M683N WO2014159595 8923 variable region SEQ ID NO: 4 MP382 hNav1.7 Light chain H1 M797N WO2014159595 9015 variable region SEQ ID NO: 8 MP383 hNav1.7 Light chain H1 M799N WO2014159595 8890 variable region SEQ ID NO: 28 MP384 hNav1.7 Light chain H1 M801 N WO2014159595 9010 variable region SEQ ID NO: 735 MP385 hNav1.7 Light chain H1 M826N WO2014159595 9011 variable region SEQ ID NO: 751 MP386 hNav1.7 Light chain H1 M834N WO2014159595 8847 variable region SEQ ID NO: 12 MP387 hNav1.7 Light chain H1 M836N WO2014159595 9013 variable region SEQ ID NO: 767 MP388 hNav1.7 Light chain H1 M839N WO2014159595 8858 variable region SEQ ID NO: 16 MP389 hNav1.7 Light chain H1 M852N WO2014159595 8869 variable region SEQ ID NO: 20 MP390 hNav1.7 Light chain H1 M875N WO2014159595 8879 variable region SEQ ID NO: 24 MP391 hNav1.7 Light chain H1 M879N WO2014159595 9014 variable region SEQ ID NO: 799 MP392 hNav1.7 Light chain H1 M994N WO2014159595 9017 variable region SEQ ID NO: 815 MP393 hNav1.7 Light chain H1H1002B WO2014159595 8935 variable region SEQ ID NO: 548 MP394 hNav1.7 Light chain H1H1003B WO2014159595 8842 variable region SEQ ID NO: 100 MP395 hNav1.7 Light chain H1H1005B WO2014159595 8936 variable region SEQ ID NO: 550 MP396 hNav1.7 Light chain H1H1006B WO2014159595 8843 variable region SEQ ID NO: 104 MP397 hNav1.7 Light chain H1H1008B WO2014159595 8844 variable region SEQ ID NO: 108 MP398 hNav1.7 Light chain H1H1009B WO2014159595 8937 variable region SEQ ID NO: 552 MP399 hNav1.7 Light chain H1H1010B WO2014159595 8846 variable region SEQ ID NO: 116 MP400 hNav1.7 Light chain H1H1011B WO2014159595 8848 variable region SEQ ID NO: 120 MP401 hNav1.7 Light chain H1H1013B WO2014159595 8849 variable region SEQ ID NO: 124 MP402 hNav1.7 Light chain H1H1015B WO2014159595 8850 variable region SEQ ID NO: 128 MP403 hNav1.7 Light chain H1H1016B WO2014159595 8938 variable region SEQ ID NO: 554 MP404 hNav1.7 Light chain H1H1019B WO2014159595 8845 variable region SEQ ID NO: 112 MP405 hNav1.7 Light chain H1H1020B WO2014159595 8939 variable region SEQ ID NO: 556 MP406 hNav1.7 Light chain H1H1022B WO2014159595 8851 variable region SEQ ID NO: 132 MP407 hNav1.7 Light chain H1H1023B WO2014159595 8852 variable region SEQ ID NO: 136 MP408 hNav1.7 Light chain H1H1024B WO2014159595 8940 variable region SEQ ID NO: 558 MP409 hNav1.7 Light chain H1H1025B WO2014159595 8942 variable region SEQ ID NO: 560 MP410 hNav1.7 Light chain H1H1026B WO2014159595 8853 variable region SEQ ID NO: 140 MP411 hNav1.7 Light chain H1H1030B WO2014159595 8854 variable region SEQ ID NO: 144 MP412 hNav1.7 Light chain H1H1032B WO2014159595 8855 variable region SEQ ID NO: 148 MP413 hNav1.7 Light chain H1H1034B WO2014159595 8943 variable region SEQ ID NO: 562 MP414 hNav1.7 Light chain H1H1035B WO2014159595 8944 variable region SEQ ID NO: 564 MP415 hNav1.7 Light chain H1H1038B WO2014159595 8856 variable region SEQ ID NO: 152 MP416 hNav1.7 Light chain H1H1041B WO2014159595 8857 variable region SEQ ID NO: 156 MP417 hNav1.7 Light chain H1H1044B WO2014159595 8859 variable region SEQ ID NO: 160 MP418 hNav1.7 Light chain H1H1045B WO2014159595 8860 variable region SEQ ID NO: 164 MP419 hNav1.7 Light chain H1H1048B WO2014159595 8945 variable region SEQ ID NO: 566 MP420 hNav1.7 Light chain H1H1049B WO2014159595 8946 variable region SEQ ID NO: 568 MP421 hNav1.7 Light chain H1H1050B WO2014159595 8861 variable region SEQ ID NO: 168 MP422 hNav1.7 Light chain H1H1051B WO2014159595 8947 variable region SEQ ID NO: 570 MP423 hNav1.7 Light chain H1H1055B WO2014159595 8862 variable region SEQ ID NO: 172 MP424 hNav1.7 Light chain H1H1056B WO2014159595 8863 variable region SEQ ID NO: 176 MP425 hNav1.7 Light chain H1H1059B WO2014159595 8864 variable region SEQ ID NO: 180 MP426 hNav1.7 Light chain H1H1060B WO2014159595 8865 variable region SEQ ID NO: 184 MP427 hNav1.7 Light chain H1H1064B WO2014159595 8948 variable region SEQ ID NO: 572 MP428 hNav1.7 Light chain H1H1071B WO2014159595 8949 variable region SEQ ID NO: 574 MP429 hNav1.7 Light chain H1H1072B WO2014159595 8950 variable region SEQ ID NO: 576 MP430 hNav1.7 Light chain H1H1077B WO2014159595 8951 variable region SEQ ID NO: 578 MP431 hNav1.7 Light chain H1H1086B WO2014159595 8952 variable region SEQ ID NO: 580 MP432 hNav1.7 Light chain H1H1096B WO2014159595 8953 variable region SEQ ID NO: 582 MP433 hNav1.7 Light chain H1H1120B WO2014159595 8954 variable region SEQ ID NO: 584 MP434 hNav1.7 Light chain H1H1128B WO2014159595 8955 variable region SEQ ID NO: 586 MP435 hNav1.7 Light chain H1H1132B WO2014159595 8956 variable region SEQ ID NO: 588 MP436 hNav1.7 Light chain H1H1142B WO2014159595 8957 variable region SEQ ID NO: 590 MP437 hNav1.7 Light chain H1H1171B WO2014159595 8958 variable region SEQ ID NO: 592 MP438 hNav1.7 Light chain H2M799N WO2014159595 9018 variable region SEQ ID NO: 831 MP439 hNav1.7 Light chain H4H1003P WO2014159595 9020 variable region SEQ ID NO: 862 MP440 hNav1.7 Light chain H4H1025P WO2014159595 9023 variable region SEQ ID NO: 874 MP441 hNav1.7 Light chain H4H361 B WO2014159595 8878 variable region SEQ ID NO: 236 MP442 hNav1.7 Light chain H4H362B WO2014159595 8901 variable region SEQ ID NO: 32 MP443 hNav1.7 Light chain H4H362P WO2014159595 9022 variable region SEQ ID NO: 870 MP444 hNav1.7 Light chain H4H363B WO2014159595 8959 variable region SEQ ID NO: 594 MP445 hNav1.7 Light chain H4H364B WO2014159595 8960 variable region SEQ ID NO: 596 MP446 hNav1.7 Light chain H4H365B WO2014159595 8880 variable region SEQ ID NO: 240 MP447 hNav1.7 Light chain H4H366B WO2014159595 8961 variable region SEQ ID NO: 598 MP448 hNav1.7 Light chain H4H367B WO2014159595 8912 variable region SEQ ID NO: 36 MP449 hNav1.7 Light chain H4H368B WO2014159595 8924 variable region SEQ ID NO: 40 MP450 hNav1.7 Light chain H4H369B WO2014159595 8963 variable region SEQ ID NO: 600 MP451 hNav1.7 Light chain H4H371 B WO2014159595 8881 variable region SEQ ID NO: 244 MP452 hNav1.7 Light chain H4H372B WO2014159595 8882 variable region SEQ ID NO: 248 MP453 hNav1.7 Light chain H4H373B WO2014159595 8883 variable region SEQ ID NO: 252 MP454 hNav1.7 Light chain H4H374B WO2014159595 8964 variable region SEQ ID NO: 602 MP455 hNav1.7 Light chain H4H375B WO2014159595 8965 variable region SEQ ID NO: 604 MP456 hNav1.7 Light chain H4H376B WO2014159595 8966 variable region SEQ ID NO: 606 MP457 hNav1.7 Light chain H4H377B WO2014159595 8967 variable region SEQ ID NO: 608 MP458 hNav1.7 Light chain H4H379B WO2014159595 8884 variable region SEQ ID NO: 256 MP459 hNav1.7 Light chain H4H380B WO2014159595 8968 variable region SEQ ID NO: 610 MP460 hNav1.7 Light chain H4H381 B WO2014159595 8885 variable region SEQ ID NO: 260 MP461 hNav1.7 Light chain H4H382B WO2014159595 8932 variable region SEQ ID NO: 44 MP462 hNav1.7 Light chain H4H384B WO2014159595 8969 variable region SEQ ID NO: 612 MP463 hNav1.7 Light chain H4H385B WO2014159595 8886 variable region SEQ ID NO: 264 MP464 hNav1.7 Light chain H4H385B WO2014159595 9000 variable region SEQ ID NO: 683 MP465 hNav1.7 Light chain H4H387B WO2014159595 8970 variable region SEQ ID NO: 614 MP466 hNav1.7 Light chain H4H388B WO2014159595 8887 variable region SEQ ID NO: 268 MP467 hNav1.7 Light chain H4H391B WO2014159595 8933 variable region SEQ ID NO: 48 MP468 hNav1.7 Light chain H4H391P WO2014159595 8934 variable region SEQ ID NO: 52 MP469 hNav1.7 Light chain H4H392B WO2014159595 8971 variable region SEQ ID NO: 616 MP470 hNav1.7 Light chain H4H394B WO2014159595 8972 variable region SEQ ID NO: 618 MP471 hNav1.7 Light chain H4H395B WO2014159595 8973 variable region SEQ ID NO: 620 MP472 hNav1.7 Light chain H4H395B WO2014159595 9001 variable region SEQ ID NO: 687 MP473 hNav1.7 Light chain H4H396B WO2014159595 8888 variable region SEQ ID NO: 272 MP474 hNav1.7 Light chain H4H397B WO2014159595 8941 variable region SEQ ID NO: 56 MP475 hNav1.7 Light chain H4H398B WO2014159595 8889 variable region SEQ ID NO: 276 MP476 hNav1.7 Light chain H4H399B WO2014159595 8891 variable region SEQ ID NO: 280 MP477 hNav1.7 Light chain H4H400B WO2014159595 8892 variable region SEQ ID NO: 284 MP478 hNav1.7 Light chain H4H402B WO2014159595 8893 variable region SEQ ID NO: 288 MP479 hNav1.7 Light chain H4H404B WO2014159595 8974 variable region SEQ ID NO: 622 MP480 hNav1.7 Light chain H4H408B WO2014159595 8962 variable region SEQ ID NO: 60 MP481 hNav1.7 Light chain H4H409B WO2014159595 8894 variable region SEQ ID NO: 292 MP482 hNav1.7 Light chain H4H411B WO2014159595 8976 variable region SEQ ID NO: 626 MP483 hNav1.7 Light chain H4H410B WO2014159595 8975 variable region SEQ ID NO: 624 MP484 hNav1.7 Light chain H4H412B WO2014159595 8977 variable region SEQ ID NO: 628 MP485 hNav1.7 Light chain H4H414B WO2014159595 8978 variable region SEQ ID NO: 630 MP486 hNav1.7 Light chain H4H415B WO2014159595 8895 variable region SEQ ID NO: 296 MP487 hNav1.7 Light chain H4H416B WO2014159595 8896 variable region SEQ ID NO: 300 MP488 hNav1.7 Light chain H4H419B WO2014159595 8897 variable region SEQ ID NO: 304 MP489 hNav1.7 Light chain H4H421B WO2014159595 8979 variable region SEQ ID NO: 632 MP490 hNav1.7 Light chain H4H422B WO2014159595 8898 variable region SEQ ID NO: 308 MP491 hNav1.7 Light chain H4H426B WO2014159595 8983 variable region SEQ ID NO: 64 MP492 hNav1.7 Light chain H4H428B WO2014159595 8980 variable region SEQ ID NO: 634 MP493 hNav1.7 Light chain H4H430B WO2014159595 8981 variable region SEQ ID NO: 636 MP494 hNav1.7 Light chain H4H431B WO2014159595 8982 variable region SEQ ID NO: 638 MP495 hNav1.7 Light chain H4H433B WO2014159595 8984 variable region SEQ ID NO: 640 MP496 hNav1.7 Light chain H4H434B WO2014159595 8899 variable region SEQ ID NO: 312 MP497 hNav1.7 Light chain H4H434B WO2014159595 9002 variable region SEQ ID NO: 691 MP498 hNav1.7 Light chain H4H434P WO2014159595 9003 variable region SEQ ID NO: 695 MP499 hNav1.7 Light chain H4H435B WO2014159595 8985 variable region SEQ ID NO: 642 MP500 hNav1.7 Light chain H4H438B WO2014159595 8900 variable region SEQ ID NO: 316 MP501 hNav1.7 Light chain H4H438B WO2014159595 9004 variable region SEQ ID NO: 699 MP502 hNav1.7 Light chain H4H439B WO2014159595 8999 variable region SEQ ID NO: 68 MP503 hNav1.7 Light chain H4H439P WO2014159595 9008 variable region SEQ ID NO: 72 MP504 hNav1.7 Light chain H4H440B WO2014159595 8986 variable region SEQ ID NO: 644 MP505 hNav1.7 Light chain H4H441B WO2014159595 8987 variable region SEQ ID NO: 646 MP506 hNav1.7 Light chain H4H441 B WO2014159595 9005 variable region SEQ ID NO: 703 MP507 hNav1.7 Light chain H4H441 P WO2014159595 9021 variable region SEQ ID NO: 866 MP508 hNav1.7 Light chain H4H442B WO2014159595 8902 variable region SEQ ID NO: 320 MP509 hNav1.7 Light chain H4H443B WO2014159595 9012 variable region SEQ ID NO: 76 MP510 hNav1.7 Light chain H4H444B WO2014159595 8903 variable region SEQ ID NO: 324 MP511 hNav1.7 Light chain H4H446B WO2014159595 8904 variable region SEQ ID NO: 328 MP512 hNav1.7 Light chain H4H448B WO2014159595 9016 variable region SEQ ID NO: 80 MP513 hNav1.7 Light chain H4H450B WO2014159595 8988 variable region SEQ ID NO: 648 MP514 hNav1.7 Light chain H4H451B WO2014159595 8989 variable region SEQ ID NO: 650 MP515 hNav1.7 Light chain H4H452B WO2014159595 8990 variable region SEQ ID NO: 652 MP516 hNav1.7 Light chain H4H455B WO2014159595 8991 variable region SEQ ID NO: 654 MP517 hNav1.7 Light chain H4H456B WO2014159595 8905 variable region SEQ ID NO: 332 MP518 hNav1.7 Light chain H4H457B WO2014159595 8906 variable region SEQ ID NO: 336 MP519 hNav1.7 Light chain H4H458B WO2014159595 8907 variable region SEQ ID NO: 340 MP520 hNav1.7 Light chain H4H459B WO2014159595 8992 variable region SEQ ID NO: 656 MP521 hNav1.7 Light chain H4H460B WO2014159595 8908 variable region SEQ ID NO: 344 MP522 hNav1.7 Light chain H4H461 B WO2014159595 8909 variable region SEQ ID NO: 348 MP523 hNav1.7 Light chain H4H462B WO2014159595 8910 variable region SEQ ID NO: 352 MP524 hNav1.7 Light chain H4H463B WO2014159595 8911 variable region SEQ ID NO: 356 MP525 hNav1.7 Light chain H4H464B WO2014159595 8913 variable region SEQ ID NO: 360 MP526 hNav1.7 Light chain H4H465B WO2014159595 8914 variable region SEQ ID NO: 364 MP527 hNav1.7 Light chain H4H466B WO2014159595 8915 variable region SEQ ID NO: 368 MP528 hNav1.7 Light chain H4H467B WO2014159595 8916 variable region SEQ ID NO: 372 MP529 hNav1.7 Light chain H4H468B WO2014159595 9019 variable region SEQ ID NO: 84 MP530 hNav1.7 Light chain H4H468P WO2014159595 9024 variable region SEQ ID NO: 88 MP531 hNav1.7 Light chain H4H469B WO2014159595 8993 variable region SEQ ID NO: 658 MP532 hNav1.7 Light chain H4H470B WO2014159595 8994 variable region SEQ ID NO: 660 MP533 hNav1.7 Light chain H4H471B WO2014159595 9025 variable region SEQ ID NO: 92 MP534 hNav1.7 Light chain H4H471P WO2014159595 9026 variable region SEQ ID NO: 96 MP535 hNav1.7 Light chain H4H472B WO2014159595 8917 variable region SEQ ID NO: 376 MP536 hNav1.7 Light chain H4H473B WO2014159595 8918 variable region SEQ ID NO: 380 MP537 hNav1.7 Light chain H4H474B WO2014159595 8995 variable region SEQ ID NO: 662 MP538 hNav1.7 Light chain H4H475B WO2014159595 8919 variable region SEQ ID NO: 384 MP539 hNav1.7 Light chain H4H476B WO2014159595 8996 variable region SEQ ID NO: 664 MP540 hNav1.7 Light chain H4H477B WO2014159595 8920 variable region SEQ ID NO: 388 MP541 hNav1.7 Light chain H4H479B WO2014159595 8997 variable region SEQ ID NO: 666 MP542 hNav1.7 Light chain H4H480B WO2014159595 8921 variable region SEQ ID NO: 392 MP543 hNav1.7 Light chain H4H481 B WO2014159595 8922 variable region SEQ ID NO: 396 MP544 hNav1.7 Light chain H4H482B WO2014159595 8925 variable region SEQ ID NO: 400 MP545 hNav1.7 Light chain H4H483B WO2014159595 8926 variable region SEQ ID NO: 404 MP546 hNav1.7 Light chain H4H484B WO2014159595 8927 variable region SEQ ID NO: 408 MP547 hNav1.7 Light chain H4H486B WO2014159595 8928 variable region SEQ ID NO: 412 MP548 hNav1.7 Light chain H4H487B WO2014159595 8998 variable region SEQ ID NO: 668 MP549 hNav1.7 Light chain H4H488B WO2014159595 8929 variable region SEQ ID NO: 416 MP550 hNav1.7 Light chain H4H489B WO2014159595 8930 variable region SEQ ID NO: 420 MP551 hNav1.7 Light chain H4H491B WO2014159595 8931 variable region SEQ ID NO: 424 MP552 TNF Light chain US20030157061 9288 variable region SEQ ID NO: 4 MP553 TrkA Light chain 3-23*01 WO2009098238 4233 variable region SEQ ID NO: 19 MP554 TrkA Light chain BXhVH5VL1 WO2009098238 4237 variable region N297A i SEQ ID NO: 23 MP555 TrkA Light chain HuVLWO WQ2009098238 4232 variable region SEQ ID NO: 18 MP556 TrkA Light chain JH4 WO2009098238 4234 variable region SEQ ID NO: 20 MP557 TrkA Light chain JK1 WO2009098238 4236 variable region SEQ ID NO: 22 MP558 TrkA Light chain L6*01 WO2009098238 4235 variable region SEQ ID NO: 21 MP559 NGF Light chain Fasinumab, U.S. Pat. No. 7,988,967 17750 variable region, REGN475, SEQ ID NO: 110; Antibody for SAR164877 U.S. Pat. No. 7,988,967 chronic pain SEQ ID NO: 92 MP560 NGF Light chain, Fulranumab, U.S. Pat. No. 7,601,818 17751 Antibody for 4D4, AMG- SEQ ID NO: 44; chronic pain 403, JNJ- U.S. Pat. No. 8,552,157 42160443 SEQ ID NO: 17; U.S. Pat. No. 8,048,421 SEQ ID NO: 84 MP561 NGF Light chain, Fasinumab, 17752 Antibody for REGN475, chronic pain SAR164877 MP562 NGF Light chain, Tanezumab, US20040237124 17753 Antibody for PF-04383119, SEQ ID NO: 2 pain, chronic RN624, E3 and acute, osteoarthritis MP563 CGRP Variable Heavy G1, cluster U.S. Pat. No. 9,115,194 17754 Domain headache SEQ ID NO: 1 MP564 CGRP Variable Light G1, cluster U.S. Pat. No. 9,115,194 17755 Domain headache SEQ ID NO: 2

    Ocular Disease Antibodies

    [0314] In one embodiment the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the ocular disease payload antibody polypeptides listed in Table 11 (OC1-00676; SEQ ID NO: 3124-3125, 3164-3177, 3329-3330, 3358-3371, 4308, 4323, 4420, 4431, 4680-4682, 4685-4728, 4735-4772, 47794781, 4783, 6792-6919, 7022-7024, 7271-7274, 7389-7392, 7396-7439, 74467496, 7503-7505, 9142-9255, 9257-9269, 9350, 9466-9468, 9617-9624, 9630-9633, 9655-9677 17666-17670, 17672-17680, 17723-17736, 17756-17875)

    TABLE-US-00011 TABLE 11 Ocular Disease Antibodies Antibody SEQ ID No. Target Description Antibody Name Reference Information NO OC1 VEGF-A Fab-12 1cz8_L, Ranibizumab, Lien and Lowman, In: 17756 Fab-12 variant Lucentis Chemajovsky, 2008, Therapeutic Y0317/L- Antibodies. Handbook of KAPPA (V- Experimental Pharmacology 181, KAPPA(1- Springer-Verlag, Berlin 107) + C- Heidelberg 131-150 KAPPA(108- 213) OC2 VEGF-A Fab-12 variant Ranibizumab, Lien and Lowman, In: 17757 Y031/Fab-12 Lucentis Chemajovsky, 2008, Therapeutic variant Y0317 Antibodies. Handbook of and VH-CH1 Experimental Pharmacology 181, (VH(1- Springer-Verlag, Berlin 123) + CH1(124- Heidelberg 131-150 215) OC3 VEGF-A Fab-12 variant Ranibizumab, Lien and Lowman, In: 17758 Y0317/L- Lucentis Chemajovsky, 2008, Therapeutic K APPA (V- Antibodies. Handbook of KAPPA(1- Experimental Pharmacology 181, 107) + C- Springer-Verlag, Berlin KAPPA(108- Heidelberg 131-150 213) OC4 VEGF-A Fab-12 variant Ranibizumab, Lien and Lowman, In: 17759 Y0317/VH- Lucentis Chemajovsky, 2008, Therapeutic CH1 (VH(1- Antibodies. Handbook of 123) + CH1(124- Experimental Pharmacology 181, 215) Springer-Verlag, Berlin Heidelberg 131-150 OC5 Fusion protein Aflibercept 17760 fusion protein OC6 Fusion protein Conbercept 17761 fusion protein OC7 Annexin IV or a Heavy chain B4 WO2014116880 4680 phospholipid; SEQ ID NO: 15 and (b) a complement inhibitor OC8 Annexin IV or a Heavy chain B4 WO2014116880 4681 phospholipid; SEQ ID NO: 16 and (b) a complement inhibitor OC9 Annexin IV or a Heavy chain C2 WO2014116880 4682 phospholipid; SEQ ID NO: 36 and (b) a complement inhibitor OC10 C3b Heavy chain rhuMAB 4D5- U.S. Pat. No. 8,377,437 4685 8 SEQ ID NO: 14 OC11 C3b, Properdin Heavy chain H-6 WO2015099838 4716 (factor P), SEQ ID NO: 49 Factors Ba and Bb, C5, C6, C7, C8, C9 OC12 C3b, Properdin Heavy chain H-7 WO2015099838 4717 (factor P), SEQ ID NO: 50 Factors Ba and Bb, C5, C6, C7, C8, C9 OC13 C3b, Properdin Heavy chain H-8 WO2015099838 4718 (factor P), SEQ ID NO: 51 Factors Ba and Bb, C5, C6, C7, C8. C9 OC14 C3b, Properdin Heavy chain H-9 WO2015099838 4719 (factor P), SEQ ID NO: 52 Factors Ba and Bb, C5, C6, C7, C8, C9 OC15 C3b, Properdin Heavy chain H-10 WO2015099838 4720 (factor P), SEQ ID NO: 53 Factors Ba and Bb, C5, C6, C7, C8, C9 OC16 C3b, Properdin Heavy chain H-11 WO2015099838 4721 (factor P), SEQ ID NO: 54 Factors Ba and Bb, C5, C6, C7, C8, C9 OC17 C3b, Properdin Heavy chain H-12 WO2015099838 4722 (factor P), SEQ ID NO: 55 Factors Ba and Bb, C5, C6, C7, C8, C9 OC18 C3b, Properdin Heavy chain H-13 WO2015099838 4723 (factor P), SEQ ID NO: 56 Factors Ba and Bb, C5, C6, C7, C8, C9 OC19 C3b, Properdin Heavy chain H-14 WO2015099838 4724 (factor P), SEQ ID NO: 57 Factors Ba and Bb, C5, C6, C7, C8, C9 OC20 C3b, Properdin Heavy chain H-15 WO2015099838 4725 (factor P), SEQ ID NO: 58 Factors Ba and Bb, C5, C6, C7, C8, C9 OC21 C3b, Properdin Heavy chain H-16 WO2015099838 4726 (factor P), SEQ ID NO: 59 Factors Ba and Bb, C5, C6, C7, C8, C9 OC22 C3b, Properdin Heavy chain H-17 WO2015099838 4727 (factor P), SEQ ID NO: 60 Factors Ba and Bb, C5, C6, C7, C8, C9 OC23 C3b, Properdin Heavy chain H-18 WO2015099838 4728 (factor P), SEQ ID NO: 61 Factors Ba and Bb, C5, C6, C7, C8, C9 OC24 C3b, Properdin Heavy chain H-19 WO2015099838 4686 (factor P), SEQ ID NO: 62 Factors Ba and Bb, C5, C6, C7, C8, C9 OC25 C3b, Properdin Heavy chain H-20 WO2015099838 4687 (factor P), SEQ ID NO: 63 Factors Ba and Bb, C5, C6, C7, C8, C9 OC26 C3b, Properdin Heavy chain H-21 WO2015099838 4688 (factor P), SEQ ID NO: 64 Factors Ba and Bb, C5, C6, C7, C8, C9 OC27 C3b, Properdin Heavy chain H-22 WO2015099838 4689 (factor P), SEQ ID NO: 65 Factors Ba and Bb, C5, C6, C7, C8, C9 OC28 C3b, Properdin Heavy chain H-23 WO2015099838 4690 (factor P), SEQ ID NO: 66 Factors Ba and Bb, C5, C6, C7, C8, C9 OC29 C3b, Properdin Heavy chain H-24 WO2015099838 4691 (factor P), SEQ ID NO: 67 Factors Ba and Bb, C5, C6, C7, C8, C9 OC30 C3b, Properdin Heavy chain H-25 WO2015099838 4692 (factor P), SEQ ID NO: 68 Factors Ba and Bb, C5, C6, C7, C8, C9 OC31 C3b, Properdin Heavy chain H-26 WO2015099838 4693 (factor P), SEQ ID NO: 69 Factors Ba and Bb, C5, C6, C7, C8, C9 OC32 C3b, Properdin Heavy chain H-27 WO2015099838 4694 (factor P), SEQ ID NO: 70 Factors Ba and Bb, C5, C6, C7, C8, C9 OC33 C3b, Properdin Heavy chain H-28 WO2015099838 4695 (factor P), SEQ ID NO: 71 Factors Ba and Bb, C5, C6, C7, C8, C9 OC34 C3b, Properdin Heavy chain H-29 WO2015099838 4696 (factor P), SEQ ID NO: 72 Factors Ba and Bb, C5, C6, C7, C8, C9 OC35 C3b, Properdin Heavy chain H-30 WO2015099838 4697 (factor P), SEQ ID NO: 73 Factors Ba and Bb, C5, C6, C7, C8, C9 OC36 C3b, Properdin Heavy chain H-31 WO2015099838 4698 (factor P), SEQ ID NO: 74 Factors Ba and Bb, C5, C6, C7, C8, C9 OC37 C3b, Properdin Heavy chain H-32 WO2015099838 4699 (factor P), SEQ ID NO: 75 Factors Ba and Bb, C5, C6, C7, C8, C9 OC38 C3b, Properdin Heavy chain H-33 WO2015099838 4700 (factor P), SEQ ID NO: 76 Factors Ba and Bb, C5, C6, C7, C8, C9 OC39 C3b, Properdin Heavy chain H-34 WO2015099838 4701 (factor P), SEQ ID NO: 77 Factors Ba and Bb, C5, C6, C7, C8, C9 OC40 C3b, Properdin Heavy chain H-35 WO2015099838 4702 (factor P), SEQ ID NO: 78 Factors Ba and Bb, C5, C6, C7, C8, C9 OC41 C3b, Properdin Heavy chain H-36 WO2015099838 4703 (factor P), SEQ ID NO: 79 Factors Ba and Bb, C5, C6, C7, C8, C9 OC42 C3b, Properdin Heavy chain H-37 WO2015099838 4704 (factor P), SEQ ID NO: 80 Factors Ba and Bb, C5, C6, C7, C8, C9 OC43 C3b, Properdin Heavy chain H-38 WO2015099838 4705 (factor P), SEQ ID NO: 81 Factors Ba and Bb, C5, C6, C7, C8, C9 OC44 C3b, Properdin Heavy chain H-39 WO2015099838 4706 (factor P), SEQ ID NO: 82 Factors Ba and Bb, C5, C6, C7, C8, C9 OC45 C3b, Properdin Heavy chain H-40 WO2015099838 4707 (factor P), SEQ ID NO: 83 Factors Ba and Bb, C5, C6, C7, C8, C9 OC46 C3b, Properdin Heavy chain H-41 WO2015099838 4708 (factor P), SEQ ID NO: 84 Factors Ba and Bb, C5, C6, C7, C8, C9 OC47 C3b, Properdin Heavy chain H-42 WO2015099838 4709 (factor P), SEQ ID NO: 85 Factors Ba and Bb, C5, C6, C7, C8, C9 OC48 C3b, Properdin Heavy chain H-43 WO2015099838 4710 (factor P), SEQ ID NO: 86 Factors Ba and Bb, C5, C6, C7, C8, C9 OC49 C3b, Properdin Heavy chain H-1 WO2015099838 4711 (factor P), SEQ ID NO: 44 Factors Ba and Bb, C5, C6, C7, C8, C9 OC50 C3b, Properdin Heavy chain H-2 WO2015099838 4712 (factor P), SEQ ID NO: 45 Factors Ba and Bb, C5, C6, C7, C8, C9 OC51 C3b, Properdin Heavy chain H-3 WO2015099838 4713 (factor P), SEQ ID NO: 46 Factors Ba and Bb, C5, C6, C7, C8, C9 OC52 C3b, Properdin Heavy chain H-4 WO2015099838 4714 (factor P), SEQ ID NO: 47 Factors Ba and Bb, C5, C6, C7, C8, C9 OC53 C3b, Properdin Heavy chain H-5 WO2015099838 4715 (factor P), SEQ ID NO: 48 Factors Ba and Bb, C5, C6, C7, C8, C9 OC54 C5 Heavy chain NVS808 US20150158936 4735 SEQ ID NO: 107 OC55 C5 Heavy chain NVS806 US20150158936 4736 SEQ ID NO: 121 OC56 C5 Heavy chain NVS804 US20150158936 4737 SEQ ID NO: 135 OC57 C5 Heavy chain NVS809 US20150158936 4738 SEQ ID NO: 149 OC58 C5 Heavy chain NVS805 US20150158936 4739 SEQ ID NO: 163 OC59 C5 Heavy chain NVS962-S US20150158936 4740 SEQ ID NO: 177 OC60 C5 Heavy chain NVS962-Q US20150158936 4741 SEQ ID NO: 191 OC61 C5 Heavy chain NVS962-S31A US20150158936 4742 SEQ ID NO: 205 OC62 C5 Heavy chain NVS962-G US20150158936 4743 SEQ ID NO: 219 OC63 C5 Heavy chain NVS963 US20150158936 4744 SEQ ID NO: 23 OC64 C5 Heavy chain NVS962-T US20150158936 4745 SEQ ID NO: 233 OC65 C5 Heavy chain NVS965-T US20150158936 4746 SEQ ID NO: 247 OC66 C5 Heavy chain NVS965-Q US20150158936 4747 SEQ ID NO: 261 OC67 C5 Heavy chain NVS965-S US20150158936 4748 SEQ ID NO: 275 OC68 C5 Heavy chain NVS964 US20150158936 4749 SEQ ID NO: 37 OC69 C5 Heavy chain Antibody 8109 US20150158936 4750 SEQ ID NO: 418 OC70 C5 Heavy chain Antibody 8110 US20150158936 4751 SEQ ID NO: 434 OC71 C5 Heavy chain Antibody 8111 US20150158936 4752 SEQ ID NO: 449 OC72 C5 Heavy chain Antibody 8113 US20150158936 4753 SEQ ID NO: 462 OC73 C5 Heavy chain Antibody 8114 US20150158936 4754 SEQ ID NO: 478 OC74 C5 Heavy chain NVS966 US20150158936 4755 SEQ ID NO: 51 OC75 C5 Heavy chain NVS965 US20150158936 4756 SEQ ID NO: 65 OC76 C5 Heavy chain NVS967 US20150158936 4757 SEQ ID NO: 79 OC77 C5 Heavy chain NVS962 US20150158936 4758 SEQ ID NO: 9 OC78 C5 Heavy chain NVS807 US20150158936 4759 SEQ ID NO: 93 OC79 C5 Heavy chain H5 US20150239966 4760 SEQ ID NO: 10 OC80 C5 Heavy chain H6 US20150239966 4761 SEQ ID NO: 12 OC81 C5 Heavy chain H1 US20150239966 4762 SEQ ID NO: 2 OC82 C5 Heavy chain H2 US20150239966 4763 SEQ ID NO: 4 OC83 C5 Heavy chain H3 US20150239966 4764 SEQ ID NO: 6 OC84 C5 Heavy chain H4 US20150239966 4765 SEQ ID NO: 8 OC85 C5 Heavy chain Tesidolumab, U.S. Pat. No. 8,241,628 4766 LFG 316, SEQ ID NO: 9 LFG-316, LFG316 OC86 C5 Heavy chain U.S. Pat. No. 9,133,269 4767 SEQ ID NO: 1 OC87 C5 Heavy chain U.S. Pat. No. 9,133,269 4768 SEQ ID NO: 2 OC88 C5 Heavy chain U.S. Pat. No. 9,133,269 4769 SEQ ID NO: 27 OC89 C5 Heavy chain U.S. Pat. No. 9,133,269 4770 SEQ ID NO: 3 OC90 C5 Heavy chain U.S. Pat. No. 9,133,269 4771 SEQ ID NO: 4 OC91 C5 Heavy chain U.S. Pat. No. 9,133,269 4772 SEQ ID NO: 5 OC92 C5a Heavy chain BNJ364 US20130224187 4779 SEQ ID NO: 25 OC93 C5a Heavy chain BNJ367, US20130224187 4780 BNJ371, SEQ ID NO: 33 BNJ378 OC94 C5a Heavy chain BNJ366 US20130224187 4781 SEQ ID NO: 44 OC95 CA 125 Heavy chain Sofituzumab U.S. Pat. No. 7,723,485 4783 (MUC16) vedotin, SEQ ID NO: 1 DMUC5754A (conjugate), MMUC1206A (nonconjugate) OC96 CGRP Heavy chain Ab4 US20120294802 17675 SEQ ID NO: 34 OC97 CGRP Heavy chain Ab1 US20120294802 17666 SEQ ID NO: 4 OC98 CGRP Heavy chain Ab5 US20120294802 17676 SEQ ID NO: 44 OC99 CGRP Heavy chain Ab6 US20120294802 17677 SEQ ID NO: 54 OC100 CGRP Heavy chain Ab7 US20120294802 17678 SEQ ID NO: 64 OC101 CGRP Heavy chain Ab8 US20120294802 17679 SEQ ID NO: 74 OC102 CGRP Heavy chain Ab9 US20120294802 17680 SEQ ID NO: 84 OC103 CGRP Heavy chain Ab10 US20120294802 17667 SEQ ID NO: 94 OC104 CGRP Heavy chain Ab11 US20120294802 17668 SEQ ID NO: 104 OC105 CGRP Heavy chain Ab12 US20120294802 17669 SEQ ID NO: 114 OC106 CGRP Heavy chain Ab13 US20120294802 17670 SEQ ID NO: 124 OC107 CGRP Heavy chain Ab14 US20120294802 17672 SEQ ID NO: 134 OC108 CGRP Heavy chain Ab2 US20120294802 17673 SEQ ID NO: 14 OC109 CGRP Heavy chain Ab3 US20120294802 17674 SEQ ID NO: 24 OC110 Factor D Heavy chain Fab 238 WO2009134711 17762 SEQ ID NO: 52 OC111 Factor D, Heavy Chain Lampalizumab, U.S. Pat. No. 8,273,352 17763 humanized SEQ ID NO: 62 IgG1 OC112 platelet-derived Heavy chain Rinucumab, 17764 growth factor REGN2176 receptor beta PDGFRB OC113 S1P4 Heavy chain WO2015057939 4308 SEQ ID NO: 39 OC114 VEGF, C5, Heavy chain NVS73 US20140186350 17765 Factor P, Factor SEQ ID 113 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC115 VEGF, C5, Heavy chain NVS73T US20140186350 17766 Factor P, Factor SEQ ID 115 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC116 VEGF, C5, Heavy chain NVS75 US20140186350 17767 Factor P, Factor SEQ ID 194 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC117 VEGF, C5, Heavy chain NVS74T, US20140186350 17768 Factor P, Factor NCS75T SEQ ID 196 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC118 VEGF, C5, Heavy chain NVS1 US20140186350 17769 Factor P, Factor SEQ ID 21 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC119 VEGF, C5, Heavy chain NVS2 US20140186350 17770 Factor P, Factor SEQ ID 23 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC120 VEGF, C5, Heavy chain NVS3 US20140186350 17771 Factor P, Factor SEQ ID 25 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC121 VEGF, C5, Heavy chain NVS36 US20140186350 17772 Factor P, Factor SEQ ID 27 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC122 VEGF, C5, Heavy chain NVS37 US20140186350 17773 Factor P, Factor SEQ ID 29 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC123 VEGF, C5, Heavy chain NVS70 US20140186350 17774 Factor P, Factor SEQ ID 42 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC124 VEGF, C5, Heavy chain NVS70T US20140186350 17775 Factor P, Factor SEQ ID 44 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC125 VEGF, C5, Heavy chain NVS71 US20140186350 17776 Factor P, Factor SEQ ID 61 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC126 VEGF, C5, Heavy chain NVS71T US20140186350 17777 Factor P, Factor SEQ ID 63 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC127 VEGF, C5, Heavy chain NVS72 US20140186350 17778 Factor P, Factor SEQ ID 83 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC128 VEGF, C5, Heavy chain NVS72T US20140186350 17779 Factor P, Factor SEQ ID 85 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC129 VEGF, C5, Heavy chain NVS4, NVS1j US20140186350 17780 Factor P, Factor SEQ ID 9 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC130 VEGF, C5, Heavy chain NVS81 US20140186350 17781 Factor P, Factor SEQ ID 157 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC131 VEGF, C5, Heavy chain NVS81T US20140186350 17782 Factor P, Factor SEQ ID 159 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC132 VEGF, C5. Heavy chain NVS82 US20140186350 17783 Factor P, Factor SEQ ID 161 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC133 VEGF, C5, Heavy chain NVS82T US20140186350 17784 Factor P, Factor SEQ ID 163 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC134 VECF, C5, Heavy chain NVS1b US20140186350 17785 Factor P, Factor SEQ ID 171 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC135 VEGF, C5, Heavy chain NVS1c US20140186350 17786 Factor P, Factor SEQ ID 173 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC136 VEGF, C5, Heavy chain NVS1d US20140186350 17787 Factor P, Factor SEQ ID 175 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC137 VEGF, C5, Heavy chain NVS1e US20140186350 17788 Factor P, Factor SEQ ID 177 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC138 VEGF, C5, Heavy chain NVS1f US20140186350 17789 Factor P, Factor SEQ ID 179 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC139 VEGF, C5, Heavy chain NVS1g US20140186350 17790 Factor P, Factor SEQ ID 181 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC140 VEGF, C5, Heavy chain NVS1h US20140186350 17791 Factor P, Factor SEQ ID 183 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC141 sphingosine-1- Heavy chain Sonepcizumab, 17792 phosphate full S1P-LT1011 OC142 sphingosine-1- Heavy chain Sonepcizumab, 17793 phosphate variable S1P-LT1009 OC143 Factor D Heavy chain Fab 238 WO2009134711 17794 variable region SEQ ID NO: 18 OC144 Factor D Heavy chain Fab 238-1 WO2009134711 17795 variable region SEQ ID NO: 19 OC145 Factor D Heavy chain Humanized WO2009134711 17796 variable region Clone #111 SEQ ID NO: 2 OC146 Factor D Heavy chain Fab 238-2 WO2009134711 17797 variable region SEQ ID NO: 20 OC147 Factor D Heavy chain Fab 238-3 WO2009134711 17798 variable region SEQ ID NO: 21 OC148 Factor D Heavy chain Fab 238-4 WO2009134711 17799 variable region SEQ ID NO: 22 OC149 Factor D Heavy chain Fab 238-5 WO2009134711 17800 variable region SEQ ID NO: 23 OC150 Factor D Heavy chain Fab 238-6 WO2009134711 17801 variable region SEQ ID NO: 24 OC151 Factor D Heavy chain Fab 238-7 WO2009134711 17802 variable region SEQ ID NO: 25 OC152 Factor D Heavy chain Fab 238-8 WO2009134711 17803 variable region SEQ ID NO: 26 OC153 Factor D Heavy chain Fab 238-9 WO2009134711 17804 variable region SEQ ID NO: 27 OC154 Factor D Heavy chain Fab 238-10 WO2009134711 17805 variable region SEQ ID NO: 28 OC155 Factor D Heavy chain Fab 238-11 WO2009134711 17806 variable region SEQ ID NO: 29 OC156 Factor D Heavy chain L243 WO2009134711 17807 variable region SEQ ID NO: 34 OC157 Factor D Heavy chain humanized WO2009134711 17808 variable region L243 SEQ ID NO: 38 OC158 LPG Heavy chain #7 U.S. Pat. No. 8,591,902 3124 (lysophosphati- variable region SEQ ID NO: 18 dylglucoside) OC159 LPG Heavy chain #15 U.S. Pat. No. 8,591,902 3125 (lysophosphati- variable region SEQ ID NO: 8 dylglucoside) OC160 PDGFR-beta Heavy chain 3373N US20140193402 6792 variable region SEQ ID 114 OC161 PDGFR-beta Heavy chain 3374N US20140193402 6793 variable region SEQ ID 130 OC162 PDGFR-beta Heavy chain 3094P US20140193402 6794 variable region SEQ ID 146 OC163 PDGFR-beta Heavy chain 3095S US20140193402 6795 variable region SEQ ID 162 OC164 PDGFR-beta Heavy chain 3096S US20140193402 6796 variable region SEQ ID 178 OC165 PDGFR-beta Heavy chain 3305N US20140193402 6797 variable region SEQ ID 18 OC166 PDGFR-beta Heavy chain 3097S US20140193402 6798 variable region SEQ ID 194 OC167 PDGFR-beta Heavy chain 3299N US20140193402 6799 variable region SEQ ID 2 OC168 PDGFR-beta Heavy chain 3098S US20140193402 6800 variable region SEQ ID 210 OC169 PDGFR-beta Heavy chain 3099S US20140193402 6801 variable region SEQ ID 226 OC170 PDGFR-beta Heavy chain 3102S US20140193402 6802 variable region SEQ ID 242 OC171 PDGFR-beta Heavy chain 3103S US20140193402 6803 variable region SEQ ID 258 OC172 PDGFR-beta Heavy chain 3104S US20140193402 6804 variable region SEQ ID 274 OC173 PDGFR-beta Heavy chain 3105S US20140193402 6805 variable region SEQ ID 290 OC174 PDGFR-beta Heavy chain 3106S US20140193402 6806 variable region SEQ ID 306 OC175 PDGFR-beta Heavy chain 3107S US20140193402 6807 variable region SEQ ID 322 OC176 PDGFR-beta Heavy chain 3310N US20140193402 6808 variable region SEQ ID 34 OC177 PDGFR-beta Heavy chain 3361N US20140193402 6809 variable region SEQ ID 50 OC178 PDGFR-beta Heavy chain 3363N US20140193402 6810 variable region SEQ ID 66 OC179 PDGFR-beta Heavy chain 3365N US20140193402 6811 variable region SEQ ID 82 OC180 PDGFR-beta Heavy chain 3368N US20140193402 6812 variable region SEQ ID 98 OC181 PDGFR/VEGF-A Heavy chain Cluster # 1322 US20110177074 6813 variable region SEQ ID NO: 100 OC182 PDGFR/VEGF-A Heavy chain Cluster # 1323 US20110177074 6814 variable region SEQ ID NO: 104 OC183 PDGFR/VEGF-A Heavy chain Cluster # 1330 US20110177074 6815 variable region SEQ ID NO: 108 OC184 PDGFR/VEGF-A Heavy chain Cluster # 1334 US20110177074 6816 variable region SEQ ID NO: 112 OC185 PDGFR/VEGF-A Heavy chain Cluster # 1345 US20110177074 6817 variable region SEQ ID NO: 116 OC186 PDGFR/VEGF-A Heavy chain Cluster # 600 US20110177074 6818 variable region SEQ ID NO: 12 OC187 PDGFR/VEGF-A Heavy chain Cluster # 1346 US20110177074 6819 variable region SEQ ID NO: 120 OC188 PDGFR/VEGF-A Heavy chain Cluster # 1359 US20110177074 6820 variable region SEQ ID NO: 124 OC189 PDGFR/VEGF-A Heavy chain Cluster # 1365 US20110177074 6821 variable region SEQ ID NO: 128 OC190 PDGFR/VEGF-A Heavy chain Cluster # 1402 US20110177074 6822 variable region SEQ ID NO: 132 OC191 PDGFR/VEGF-A Heavy chain Cluster # 1515 US20110177074 6823 variable region SEQ ID NO: 136 OC192 PDGFR/VEGF-A Heavy chain Cluster # 1531 US20110177074 6824 variable region SEQ ID NO: 140 OC193 PDGFR/VEGF-A Heavy chain Cluster # 1535 US20110177074 6825 variable region SEQ ID NO: 144 OC194 PDGFR/VEGF-A Heavy chain Cluster # 1541 US20110177074 6826 variable region SEQ ID NO: 148 OC195 PDGFR/VEGF-A Heavy chain Cluster # 1550 US20110177074 6827 variable region SEQ ID NO: 152 OC196 PDGFR/VEGF-A Heavy chain Cluster # 1564 US20110177074 6828 variable region SEQ ID NO: 156 OC197 PDGFR/VEGF-A Heavy chain Cluster # 607 US20110177074 6829 variable region SEQ ID NO: 16 OC198 PDGFR/VEGF-A Heavy chain Cluster # 1601 US20110177074 6830 variable region SEQ ID NO: 160 OC199 PDGFR/VEGF-A Heavy chain Cluster # 1629 US20110177074 6831 variable region SEQ ID NO: 164 OC200 PDGFR/VEGF-A Heavy chain Cluster # 635 US20110177074 6832 variable region SEQ ID NO: 168 OC201 PDGFR/VEGF-A Heavy chain Cluster # 636 US20110177074 6833 variable region SEQ ID NO: 172 OC202 PDGFR/VEGF-A Heavy chain Cluster # 638 US20110177074 6834 variable region SEQ ID NO: 176 OC203 PDGFR/VEGF-A Heavy chain Cluster # 656 US20110177074 6835 variable region SEQ ID NO: 180 OC204 PDGFR/VEGF-A Heavy chain Cluster # 665 US20110177074 6836 variable region SEQ ID NO: 184 OC205 PDGFR/VEGF-A Heavy chain Cluster # 668 US20110177074 6837 variable region SEQ ID NO: 188 OC206 PDGFR/VEGF-A Heavy drain Cluster # 669 US20110177074 6838 variable region SEQ ID NO: 192 OC207 PDGFR/VEGF-A Heavy chain Cluster # 679 US20110177074 6839 variable region SEQ ID NO: 196 OC208 PDGFR/VEGF-A Heavy chain Cluster # 613 US20110177074 6840 variable region SEQ ID NO: 20 OC209 PDGFR/VEGF-A Heavy chain Cluster # 695 US20110177074 6841 variable region SEQ ID NO: 200 OC210 PDGFR/VEGF-A Heavy chain Cluster # 709 US20110177074 6842 variable region SEQ ID NO: 204 OC211 PDGFR/VEGF-A Heavy chain Cluster # 710 US20110177074 6843 variable region SEQ ID NO: 208 OC212 PDGFR/VEGF-A Heavy chain Cluster # 741 US20110177074 6844 variable region SEQ ID NO: 212 OC213 PDGFR/VEGF-A Heavy chain Cluster # 752 US20110177074 6845 variable region SEQ ID NO: 216 OC214 PDGFR/VEGF-A Heavy chain Cluster # 772 US20110177074 6846 variable region SEQ ID NO: 220 OC215 PDGFR/VEGF-A Heavy chain Cluster # 779 US20110177074 6847 variable region SEQ ID NO: 224 OC216 PDGFR/VEGF-A Heavy chain Cluster # 799 US20110177074 6848 variable region SEQ ID NO: 228 OC217 PDGFR/VEGF-A Heavy chain Cluster # 830 US20110177074 6849 variable region SEQ ID NO: 232 OC218 PDGFR/VEGF-A Heavy chain Cluster # 844 US20110177074 6850 variable region SEQ ID NO: 236 OC219 PDGFR/VEGF-A Heavy chain Cluster # 941 US20110177074 6851 variable region SEQ ID NO: 24 OC220 PDGFR/VEGF-A Heavy chain Cluster # 847 US20110177074 6852 variable region SEQ ID NO: 240 OC221 PDGFR/VEGF-A Heavy chain Cluster # 868 US20110177074 6853 variable region SEQ ID NO: 244 OC222 PDGFR/VEGF-A Heavy chain Cluster # 870 US20110177074 6854 variable region SEQ ID NO: 248 OC223 PDGFR/VEGF-A Heavy chain Cluster # 883 US20110177074 6855 variable region SEQ ID NO: 252 OC224 PDGFR/VEGF-A Heavy chain Cluster # 887 US20110177074 6856 variable region SEQ ID NO: 256 OC225 PDGFR/VEGF-A Heavy chain Cluster # 901 US20110177074 6857 variable region SEQ ID NO: 260 OC226 PDGFR/VEGF-A Heavy chain Cluster # 905 US20110177074 6858 variable region SEQ ID NO: 264 OC227 PDGFR/VEGF-A Heavy chain Cluster # 909 US20110177074 6859 variable region SEQ ID NO: 268 OC228 PDGFR/VEGF-A Heavy chain Cluster # 928 US20110177074 6860 variable region SEQ ID NO: 272 OC229 PDGFR/VEGF-A Heavy chain Cluster # 1036 US20110177074 6861 variable region SEQ ID NO: 276 OC230 PDGFR/VEGF-A Heavy chain Cluster # 946 US20110177074 6862 variable region SEQ ID NO: 28 OC231 PDGFR/VEGF-A Heavy chain Cluster # 1039 US20110177074 6863 variable region SEQ ID NO: 280 OC232 PDGFR/VEGF-A Heavy chain Cluster # 1040 US20110177074 6864 variable region SEQ ID NO: 284 OC233 PDGFR/VEGF-A Heavy chain Cluster # 1044 US20110177074 6865 variable region SEQ ID NO: 288 OC234 PDGFR/VEGF-A Heavy chain Cluster # 1048 US20110177074 6866 variable region SEQ ID NO: 292 OC235 PDGFR/VEGF-A Heavy chain Cluster # 1056 US20110177074 6867 variable region SEQ ID NO: 296 OC236 PDGFR/VEGF-A Heavy chain Cluster # 1064 US20110177074 6868 variable region SEQ ID NO: 300 OC237 PDGFR/VEGF-A Heavy chain Cluster # 1080 US20110177074 6869 variable region SEQ ID NO: 304 OC238 PDGFR/VEGF-A Heavy chain Cluster # 1092 US20110177074 6870 variable region SEQ ID NO: 308 OC239 PDGFR/VEGF-A Heavy chain Cluster # 1094 US20110177074 6871 variable region SEQ ID NO: 312 OC240 PDGFR/VEGF-A Heavy chain Cluster # 1096 US20110177074 6872 variable region SEQ ID NO: 316 OC241 PDGFR/VEGF-A Heavy chain Cluster # 947 US20110177074 6873 variable region SEQ ID NO: 32 OC242 PDGFR/VEGF-A Heavy chain Cluster # 1107 US20110177074 6874 variable region SEQ ID NO: 320 OC243 PDGFR/VEGF-A Heavy chain Cluster # 1111 US20110177074 6875 variable region SEQ ID NO: 324 OC244 PDGFR/VEGF-A Heavy chain Cluster # 1123 US20110177074 6876 variable region SEQ ID NO: 328 OC245 PDGFR/VEGF-A Heavy chain Cluster # 1135 US20110177074 6877 variable region SEQ ID NO: 332 OC246 PDGFR/VEGF-A Heavy chain Cluster # 1142 US20110177074 6878 variable region SEQ ID NO: 336 OC247 PDGFR/VEGF-A Heavy chain Cluster # 1155 US20110177074 6879 variable region SEQ ID NO: 340 OC248 PDGFR/VEGF-A Heavy chain Cluster # 1250 US20110177074 6880 variable region SEQ ID NO: 344 OC249 PDGFR/VEGF-A Heavy chain Cluster # 1252 US20110177074 6881 variable region SEQ ID NO: 348 OC250 PDGFR/VEGF-A Heavy chain Cluster # 1254 US20110177074 6882 variable region SEQ ID NO: 352 OC251 PDGFR/VEGF-A Heavy chain Cluster # 1257 US20110177074 6883 variable region SEQ ID NO: 356 OC252 PDGFR/VEGF-A Heavy chain Cluster # 949 US20110177074 6884 variable region SEQ ID NO: 36 OC253 PDGFR/VEGF-A Heavy chain Cluster # 1264 US20110177074 6885 variable region SEQ ID NO: 360 OC254 PDGFR/VEGF-A Heavy chain Cluster # 1266 US20110177074 6886 variable region SEQ ID NO: 364 OC255 PDGFR/VEGF-A Heavy chain Cluster # 1268 US20110177074 6887 variable region SEQ ID NO: 368 OC256 PDGFR/VEGF-A Heavy chain Cluster # 1269 US20110177074 6888 variable region SEQ ID NO: 372 OC257 PDGFR/VEGF-A Heavy chain Cluster # 1270 US20110177074 6889 variable region SEQ ID NO: 376 OC258 PDGFR/VEGF-A Heavy chain Cluster # 1281 US20110177074 6890 variable region SEQ ID NO: 380 OC259 PDGFR/VEGF-A Heavy chain Cluster # 1283 US20110177074 6891 variable region SEQ ID NO: 384 OC260 PDGFR/VEGF-A Heavy chain Cluster # 1285 US20110177074 6892 variable region SEQ ID NO: 388 OC261 PDGFR/VEGF-A Heavy chain Cluster # 1409 US20110177074 6893 variable region SEQ ID NO: 392 OC262 PDGFR/VEGF-A Heavy chain Cluster # 1410 US20110177074 6894 variable region SEQ ID NO: 396 OC263 PDGFR/VEGF-A Heavy chain Cluster # 975 US20110177074 6895 variable region SEQ ID NO: 40 OC264 PDGFR/VEGF-A Heavy chain Cluster # 1413 US20110177074 6896 variable region SEQ ID NO: 400 OC265 PDGFR/VEGF-A Heavy chain Cluster # 1416 US20110177074 6897 variable region SEQ ID NO: 404 OC266 PDGFR/VEGF-A Heavy chain Cluster # 1420 US20110177074 6898 variable region SEQ ID NO: 408 OC267 PDGFR/VEGF-A Heavy chain Cluster # 1428 US20110177074 6899 variable region SEQ ID NO: 412 OC268 PDGFR/VEGF-A Heavy chain Cluster # 1437 US20110177074 6900 variable region SEQ ID NO: 416 OC269 PDGFR/VEGF-A Heavy chain Cluster # 1449 US20110177074 6901 variable region SEQ ID NO: 420 OC270 PDGFR/VEGF-A Heavy chain Cluster # 1458 US20110177074 6902 variable region SEQ ID NO: 424 OC271 PDGFR/VEGF-A Heavy chain Cluster # 1476 US20110177074 6903 variable region SEQ ID NO: 428 OC272 PDGFR/VEGF-A Heavy chain Cluster # 1479 US20110177074 6904 variable region SEQ ID NO: 432 OC273 PDGFR/VEGF-A Heavy chain Cluster # 997 US20110177074 6905 variable region SEQ ID NO: 44 OC274 PDGFR/VEGF-A Heavy chain Cluster # 1035 US20110177074 6906 variable region SEQ ID NO: 48 OC275 PDGFR/VEGF-A Heavy chain Cluster # 1223 US20110177074 6907 variable region SEQ ID NO: 52 OC276 PDGFR/VEGF-A Heavy chain Cluster # 1228 US20110177074 6908 variable region SEQ ID NO: 56 OC277 PDGFR/VEGF-A Heavy chain Cluster # 1230 US20110177074 6909 variable region SEQ ID NO: 60 OC278 PDGFR/VEGF-A Heavy chain Cluster # 1231 US20110177074 6910 variable region SEQ ID NO: 64 OC279 PDGFR/VEGF-A Heavy chain Cluster # 1236 US20110177074 6911 variable region SEQ ID NO: 68 OC280 PDGFR/VEGF-A Heavy chain Cluster # 1238 US20110177074 6912 variable region SEQ ID NO: 72 OC281 PDGFR/VEGF-A Heavy chain Cluster # 1244 US20110177074 6913 variable region SEQ ID NO: 76 OC282 PDGFR/VEGF-A Heavy chain Cluster # 1245 US20110177074 6915 variable region SEQ ID NO: 80 OC283 PDGFR/VEGF-A Heavy chain Cluster # 1299 US20110177074 6916 variable region SEQ ID NO: 84 OC284 PDGFR/VEGF-A Heavy chain Cluster # 1312 US20110177074 6917 variable region SEQ ID NO: 88 OC285 PDGFR/VEGF-A Heavy chain Cluster # 1314 US20110177074 6918 variable region SEQ ID NO: 92 OC286 PDGFR/VEGF-A Heavy chain Cluster # 1317 US20110177074 6919 variable region SEQ ID NO: 96 OC287 PDGFR/VEGF-A Heavy chain Cluster # 597 US20110177074 6914 variable region SEQ ID NO: 8 OC288 RGMa Heavy chain AE12-1 US20140023659 3164 variable region SEQ ID NO: 1 OC289 RGMa Heavy chain AE12-20 US20140023659 3165 variable region SEQ ID NO: 107 OC290 RGMa Heavy chain AE12-21 US20140023659 3166 variable region SEQ ID NO: 115 OC291 RGMa Heavy chain AE12-23 US20140023659 3167 variable region SEQ ID NO: 123 OC292 RGMa Heavy chain AE12-24 US20140023659 3168 variable region SEQ ID NO: 131 OC293 RGMa Heavy chain AE12-3 US20140023659 3169 variable region SEQ ID NO: 17 OC294 RGMa Heavy chain AE12-4 US20140023659 3170 variable region SEQ ID NO: 25 OC295 RGMa Heavy chain AE12-5 US20140023659 3171 variable region SEQ ID NO: 33 OC296 RGMa Heavy chain AE12-6 US20140023659 3172 variable region SEQ ID NO: 41 OC297 RGMa Heavy chain AE12-7 US20140023659 3173 variable region SEQ ID NO: 49 OC298 RGMa Heavy chain AE12-8 US20140023659 3174 variable region SEQ ID NO: 57 OC299 RGMa Heavy chain AE12-2 US20140023659 3175 variable region SEQ ID NO: 9 OC300 RGMa Heavy chain AE12-13 US20140023659 3176 variable region SEQ ID NO: 91 OC301 RGMa Heavy chain AE12-15 US20140023659 3177 variable region SEQ ID NO: 99 OC302 S1P4 Heavy chain WO2015057939 4323 variable region SEQ ID NO: 7 OC303 VEGF, C5, Heavy chain NVS73 US20140186350 17809 Factor P, Factor variable region SEQ ID 111 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC304 VEGF, C5, Heavy chain NVS75 US20140186350 17810 Factor P, Factor variable region SEQ ID 193 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC305 VEGF, C5, Heavy chain NVS70 US20140186350 17811 Factor P, Factor variable region SEQ ID 40 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC306 VEGF, C5, Heavy chain NVS71 US20140186350 17812 Factor P, Factor variable region SEQ ID 59 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC307 VEGF, C5, Heavy chain NVS4 US20140186350 17813 Factor P, Factor variable region SEQ ID 7 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC308 VEGF, C5, Heavy chain NVS72 US20140186350 17814 Factor P, Factor variable region SEQ ID 81 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC309 VEGF-A Heavy chain H6 US20140086829 7022 variable region SEQ ID 4 OC310 VEGF-A Heavy chain H5 US20140086829 7023 variable region SEQ ID 5 OC311 VEGF-A Heavy chain H7 US20140086829 7024 variable region SEQ ID 6 OC312 C5a Heavy chain BNJ364 US20130224187 7271 with signal SEQ ID 24 peptide OC313 C5a Heavy chain BNJ367, US20130224187 7272 with signal BNJ371, SEQ ID 32 peptide BNJ378 OC314 C5a Heavy chain BNJ366 US20130224187 7273 with signal SEQ ID 43 peptide OC315 C5a Heavy chain BNJ369, US20130224187 7274 with signal BNJ381, SEQ ID 48 peptide BNJ383 OC316 Annexin IV or a Light chain B4 WO2014116880 7389 phospholipid; SEQ ID 13 and (b) a complement inhibitor OC317 Annexin IV or a Light chain B4 WO2014116880 7390 phospholipid; SEQ ID 14 and (b) a complement inhibitor OC318 Annexin IV or a Light chain C2 WO2014116880 7391 phospholipid; SEQ ID 34 and (b) a complement inhibitor OC319 Annexin IV or a Light chain C2 WO2014116880 7392 phospholipid; SEQ ID 35 and (b) a complement inhibitor OC320 C3b Light chain rhuMAB 4D5- U.S. Pat. No. 8,377,437 7396 8 SEQ ID 13 OC321 C3b, Properdin Light chain L-1 WO2015099838 7397 (factor P), SEQ ID 1 Factors Ba and Bb, C5, C6, C7, C8, C9 OC322 C3b, Properdin Light chain L-10 WO2015099838 7398 (factor P), SEQ ID 10 Factors Ba and Bb, C5, C6, C7, C8, C9 OC323 C3b, Properdin Light chain L-11 WO2015099838 7399 (factor P), SEQ ID 11 Factors Ba and Bb, C5, C6, C7, C8, C9 OC324 C3b, Properdin Light chain L-12 WO2015099838 7400 (factor P), SEQ ID 12 Factors Ba and Bb, C5, C6, C7, C8, C9 OC325 C3b, Properdin Light chain L-13 WO2015099838 7401 (factor P), SEQ ID 13 Factors Ba and Bb, C5, C6, C7, C8, C9 OC326 C3b, Properdin Light chain L-14 WO2015099838 7402 (factor P), SEQ ID 14 Factors Ba and Bb, C5, C6, C7, C8, C9 OC327 C3b, Properdin Light chain L-15 WO2015099838 7403 (factor P), SEQ ID 15 Factors Ba and Bb, C5, C6, C7, C8, C9 OC328 C3b, Properdin Light chain L-16 WO2015099838 7404 (factor P), SEQ ID 16 Factors Ba and Bb, C5, C6, C7, C8, C9 OC329 C3b, Properdin Light chain L-17 WO2015099838 7405 (factor P), SEQ ID 17 Factors Ba and Bb, C5, C6, C7, C8, C9 OC330 C3b, Properdin Light chain L-18 WO2015099838 7406 (factor P), SEQ ID 18 Factors Ba and Bb, C5, C6, C7, C8, C9 OC331 C3b, Properdin Light chain L-19 WO2015099838 7407 (factor P), SEQ ID 19 Factors Ba and Bb, C5, C6, C7, C8, C9 OC332 C3b, Properdin Light chain L-2 WO2015099838 7408 (factor P), SEQ ID 2 Factors Ba and Bb, C5, C6, C7, C8, C9 OC333 C3b, Properdin Light chain L-20 WO2015099838 7409 (factor P), SEQ ID 20 Factors Ba and Bb, C5, C6, C7, C8. C9 OC334 C3b, Properdin Light chain L-21 WO2015099838 7410 (factor P), SEQ ID 21 Factors Ba and Bb, C5, C6, C7, C8, C9 OC335 C3b, Properdin Light chain L-22 WO2015099838 7411 (factor P), SEQ ID 22 Factors Ba and Bb, C5, C6, C7, C8, C9 OC336 C3b, Properdin Light chain L-23 WO2015099838 7412 (factor P), SEQ ID 23 Factors Ba and Bb, C5, C6, C7, C8, C9 OC337 C3b, Properdin Light chain L-24 WO2015099838 7413 (factor P), SEQ ID 24 Factors Ba and Bb, C5, C6, C7, C8, C9 OC338 C3b, Properdin Light chain L-25 WO2015099838 7414 (factor P), SEQ ID NO: 25 Factors Ba and Bb, C5, C6, C7, C8, C9 OC339 C3b, Properdin Light chain L-26 WO2015099838 7415 (factor P), SEQ ID NO: 26 Factors Ba and Bb, C5, C6, C7, C8, C9 OC340 C3b, Properdin Light chain L-27 WO2015099838 7416 (factor P), SEQ ID NO: 27 Factors Ba and Bb, C5, C6, C7, C8, C9 OC341 C3b, Properdin Light chain L-28 WO2015099838 7417 (factor P), SEQ ID NO: 28 Factors Ba and Bb, C5, C6, C7, C8, C9 OC342 C3b, Properdin Light chain L-29 WO2015099838 7418 (factor P), SEQ ID NO: 29 Factors Ba and Bb, C5, C6, C7, C8, C9 OC343 C3b, Properdin Light chain L-3 WO2015099838 7419 (factor P), SEQ ID NO: 3 Factors Ba and Bb, C5, C6, C7, C8, C9 OC344 C3b, Properdin Light chain L-30 WO2015099838 7420 (factor P), SEQ ID NO: 30 Factors Ba and Bb, C5, C6, C7, C8, C9 OC345 C3b, Properdin Light chain L-31 WO2015099838 7421 (factor P), SEQ ID NO: 31 Factors Ba and Bb, C5, C6, C7, C8, C9 OC346 C3b, Properdin Light chain L-32 WO2015099838 7422 (factor P), SEQ ID NO: 32 Factors Ba and Bb, C5, C6, C7, C8, C9 OC347 C3b, Properdin Light chain L-33 WO2015099838 7423 (factor P), SEQ ID NO: 33 Factors Ba and Bb, C5, C6, C7, C8, C9 OC348 C3b, Properdin Light chain L-34 WO2015099838 7424 (factor P), SEQ ID NO: 34 Factors Ba and Bb, C5, C6, C7, C8, C9 OC349 C3b, Properdin Light chain L-35 WO2015099838 7425 (factor P), SEQ ID NO: 35 Factors Ba and Bb, C5, C6, C7, C8, C9 OC350 C3b, Properdin Light chain L-36 WO2015099838 7426 (factor P), SEQ ID NO: 36 Factors Ba and Bb, C5, C6, C7, C8, C9 OC351 C3b, Properdin Light chain L-37 WO2015099838 7427 (factor P), SEQ ID NO: 37 Factors Ba and Bb, C5, C6, C7, C8, C9 OC352 C3b, Properdin Light chain L-38 WO2015099838 7428 (factor P), SEQ ID NO: 38 Factors Ba and Bb, C5, C6, C7, C8, C9 OC353 C3b, Properdin Light chain L-39 WO2015099838 7429 (factor P), SEQ ID NO: 39 Factors Ba and Bb, C5, C6, C7, C8, C9 OC354 C3b, Properdin Light chain L-4 WO2015099838 7430 (factor P), SEQ ID NO: 4 Factors Ba and Bb, C5, C6, C7, C8, C9 OC355 C3b, Properdin Light chain L-40 WO2015099838 7431 (factor P), SEQ ID NO: 40 Factors Ba and Bb, C5, C6, C7, C8, C9 OC356 C3b, Properdin Light chain L-41 WO2015099838 7432 (factor P), SEQ ID NO: 41 Factors Ba and Bb, C5, C6, C7, C8, C9 OC357 C3b, Properdin Light chain L-42 WO2015099838 7433 (factor P), SEQ ID NO: 42 Factors Ba and Bb, C5, C6, C7, C8, C9 OC358 C3b, Properdin Light chain L-43 WO2015099838 7434 (factor P), SEQ ID NO: 43 Factors Ba and Bb, C5, C6, C7, C8, C9 OC359 C3b, Properdin Light chain L-5 WO2015099838 7435 (factor P), SEQ ID NO: 5 Factors Ba and Bb, C5, C6, C7, C8, C9 OC360 C3b, Properdin Light chain L-6 WO2015099838 7436 (factor P), SEQ ID NO: 6 Factors Ba and Bb, C5, C6, C7, C8, C9 OC361 C3b, Properdin Light chain L-7 WO2015099838 7437 (factor P), SEQ ID NO: 7 Factors Ba and Bb, C5, C6, C7, C8, C9 OC362 C3b, Properdin Light chain L-8 WO2015099838 7438 (factor P), SEQ ID NO: 8 Factors Ba and Bb, C5, C6, C7, C8, C9 OC363 C3b, Properdin Light chain L-9 WO2015099838 7439 (factor P), SEQ ID NO: 9 Factors Ba and Bb, C5, C6, C7, C8, C9 OC364 C5 Light chain NVS962 US20150158936 7446 SEQ ID 10 OC365 C5 Light chain NVS808 US20150158936 7447 SEQ ID 108 OC366 C5 Light chain NVS806 US20150158936 7448 SEQ ID 122 OC367 C5 Light chain NVS804 US20150158936 7449 SEQ ID 136 OC368 C5 Light chain NVS809 US20150158936 7450 SEQ ID 150 OC369 C5 Light chain NVS805 US20150158936 7451 SEQ ID 164 OC370 C5 Light chain NVS962-S US20150158936 7452 SEQ ID 178 OC371 C5 Light chain NVS962-Q US20150158936 7453 SEQ ID 192 OC372 C5 Light chain NVS962-S31A US20150158936 7454 SEQ ID 206 OC373 C5 Light chain NVS962-G US20150158936 7455 SEQ ID 220 OC374 C5 Light chain NVS962-T US20150158936 7456 SEQ ID 234 OC375 C5 Light chain NVS963 US20150158936 7457 SEQ ID 24 OC376 C5 Light chain NVS965-T US20150158936 7458 SEQ ID 248 OC377 C5 Light chain NVS965-Q US20150158936 7459 SEQ ID 262 OC378 C5 Light chain NVS965-S US20150158936 7460 SEQ ID 276 OC379 C5 Light chain NVS964 US20150158936 7461 SEQ ID 38 OC380 C5 Light chain Antibody 8109 US20150158936 7462 SEQ ID 419 OC381 C5 Light chain Antibody 8110 US20150158936 7463 SEQ ID 435 OC382 C5 Light chain Antibody 8111 US20150158936 7464 SEQ ID 450 OC383 C5 Light chain Antibody 8113 US20150158936 7465 SEQ ID 463 OC384 C5 Light chain Antibody 8114 US20150158936 7466 SEQ ID 479 OC385 C5 Light chain NVS966 US20150158936 7467 SEQ ID 52 OC386 C5 Light chain NVS965 US20150158936 7468 SEQ ID 66 OC387 C5 Light chain NVS967 US20150158936 7469 SEQ ID 80 OC388 C5 Light chain NVS807 US20150158936 7470 SEQ ID 94 OC389 C5 Light chain L1 US20150239966 7471 SEQ ID 1 OC390 C5 Light chain L6 US20150239966 7472 SEQ ID NO: 11 OC391 C5 Light chain L2 US20150239966 7473 SEQ ID 3 OC392 C5 Light chain L3 US20150239966 7474 SEQ ID NO: 5 OC393 C5 Light chain L4 US20150239966 7475 SEQ ID NO: 7 OC394 C5 Light chain L5 US20150239966 7476 SEQ ID NO: 9 OC395 C5 Light chain Tesidolumab, U.S. Pat. No. 8,241,628 7477 LEG 316, SEQ ID 10 LFG-316, LFG316 OC396 C5 Light chain U.S. Pat. No. 9,133,269 7478 SEQ ID 10 OC397 C5 Light chain U.S. Pat. No. 9,133,269 7479 SEQ ID 11 OC398 C5 Light chain U.S. Pat. No. 9,133,269 7480 SEQ ID 12 OC399 C5 Light chain U.S. Pat. No. 9,133,269 7481 SEQ ID 13 OC400 C5 Light chain U.S. Pat. No. 9,133,269 7482 SEQ ID 14 OC401 C5 Light chain U.S. Pat. No. 9,133,269 7483 SEQ ID 15 OC402 C5 Light chain U.S. Pat. No. 9,133,269 7484 SEQ ID 16 OC403 C5 Light chain U.S. Pat. No. 9,133,269 7485 SEQ ID 17 OC404 C5 Light chain U.S. Pat. No. 9,133,269 7486 SEQ ID 18 OC405 C5 Light chain U.S. Pat. No. 9,133,269 7487 SEQ ID 19 OC406 C5 Light chain U.S. Pat. No. 9,133,269 7488 SEQ ID 20 OC407 C5 Light chain U.S. Pat. No. 9,133,269 7489 SEQ ID 21 OC408 C5 Light chain U.S. Pat. No. 9,133,269 7490 SEQ ID 22 OC409 C5 Light chain U.S. Pat. No. 9,133,269 7491 SEQ ID 23 OC410 C5 Light chain U.S. Pat. No. 9,133,269 7492 SEQ ID 24 OC411 C5 Light chain U.S. Pat. No. 9,133,269 7493 SEQ ID 6 OC412 C5 Light chain U.S. Pat. No. 9,133,269 7494 SEQ ID 7 OC413 C5 Light chain U.S. Pat. No. 9,133,269 7495 SEQ ID 8 OC414 C5 Light chain U.S. Pat. No. 9,133,269 7496 SEQ ID 9 OC415 C5a Light chain BNJ364, US20130224187 7503 BNJ367, SEQ ID 17 BNJ366, BNJ369 OC416 C5a Light chain BNJ371, US20130224187 7504 BNJ381 SEQ ID 36 OC417 C5a Light chain BNJ378, US20130224187 7505 BNJ383 SEQ ID 40 OC418 CGRP Light chain Ab11 US20120294802 17725 SEQ ID NO: 102 OC419 CGRP Light chain Ab12 US20120294802 17726 SEQ ID NO: 112 OC420 CGRP Light chain Ab2 US20120294802 17729 SEQ ID NO: 12 OC421 CGRP Light chain Ab13 US20120294802 17727 SEQ ID NO: 122 OC422 CGRP Light chain Ab14 US20120294802 17728 SEQ ID NO: 132 OC423 CGRP Light chain Ab1 US20120294802 17723 SEQ ID NO: 2 OC424 CGRP Light chain Ab3 US20120294802 17730 SEQ ID NO: 22 OC425 CGRP Light chain Ab4 US20120294802 17731 SEQ ID NO: 32 OC426 CGRP Light chain Ab5 US20120294802 17732 SEQ ID NO: 42 OC427 CGRP Light chain Ab6 US20120294802 17733 SEQ ID NO: 52 OC428 CGRP Light chain Ab7 US20120294802 17734 SEQ ID NO: 62 OC429 CGRP Light chain Ab8 US20120294802 17735 SEQ ID NO: 72 OC430 CGRP Light chain Ab9 US20120294802 17736 SEQ ID NO: 82 OC431 CGRP Light chain Ab10 US20120294802 17724 SEQ ID NO: 92 OC432 Factor D Light chain Fab 238 WO2009134711 17815 SEQ ID NO: 47 OC433 Factor D, Light Chain Lampalizumab, U.S. Pat. No. 8,273,352 17816 humanized SEQ ID NO: 47 IgG2 OC434 platelet-derived Light chain Rinucumab, 17817 growth factor REGN2176 receptor beta PDGFRB OC435 S1P4 Light chain WO2015057939 4420 SEQ ID NO: 41 OC436 VEGF, C5, Light chain NVS73, US20140186350 17818 Factor P, Factor SEQ ID 122 D, EPO, EPOR, IL-1, IL-17A, Il-10, INF, or FGFR2 OC437 VEGF, C5, Light chain NVS81 US20140186350 17819 Factor P, Factor SEQ ID 158 D, EPO, EPOR, IL-1, IL-17A, Il-10, INF, or FGFR2 OC438 VEGF, C5, Light chain NVS81T US20140186350 17820 Factor P, Factor SEQ ID 160 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC439 VEGF, C5, Light chain NVS82 US20140186350 17821 Factor P, Factor SEQ ID 162 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC440 VEGF, C5, Light chain NVS82T US20140186350 17822 Factor P, Factor SEQ ID 164 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC441 VEGF, C5, Light chain NVS1b US20140186350 17823 Factor P, Factor SEQ ID 172 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC442 VEGF, C5, Light chain NVS1c US20140186350 17824 Factor P, Factor SEQ ID 174 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC443 VEGF, C5, Light chain NVS1d US20140186350 17825 Factor P, Factor SEQ ID 176 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC444 VEGF, C5, Light chain NVS1e US20140186350 17826 Factor P, Factor SEQ ID 178 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC445 VEGF, C5, Light chain NVS1f US20140186350 17827 Factor P, Factor SEQ ID 180 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC446 VEGF, C5, Light chain NVS1g US20140186350 17828 Factor P, Factor SEQ ID 182 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC447 VEGF, C5, Light chain NVS1h US20140186350 17829 Factor P, Factor SEQ ID 184 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC448 VEGF, C5, Light chain NVS1j US20140186350 17830 Factor P, Factor SEQ ID 185 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC449 VEGF, C5, Light chain NVS4, NVS1, US20140186350 17831 Factor P, Factor NVS2, NVS3, SEQ ID 19 D, EPO, EPOR, NVS36, IL-1, IL-17A, NVS37 Il-10, TNF, or FGFR2 OC450 VEGF, C5, Light chain NVS75, US20140186350 17832 Factor P, Factor NVS74T, SEQ ID 202 D, EPO, EPOR, NCS75T IL-1, IL-17A, Il-10, TNF, or FGFR2 OC451 VEGF, C5, Light chain NVS70, US20140186350 17833 Factor P, Factor NVS70T SEQ ID 51 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC452 VEGF, C5, Light chain NVS71, US20140186350 17834 Factor P, Factor NVS71T SEQ ID 73 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC453 VEGF, C5, Light chain NVS72, US20140186350 17835 Factor P, Factor NVS72T SEQ ID 95 D, EPO, EPOR, IL-1, IL-17A, 1l-10, TNF, or FGFR2 OC454 sphingosine-1- Light chain Sonepcizumab, 17836 phosphate full S1P-LT1012 OC455 sphingosine-1- Light chain Sonepcizumab, 17837 phosphate variable S1P-LT1010 OC456 Factor D Light chain Humanized WO2009134711 17838 variable region Clone #111 SEQ ID NO: 1 OC457 Factor D Light chain Fab 238-4 WO2009134711 17839 variable region SEQ ID NO: 10 OC458 Factor D Light chain Fab 238-5 WO2009134711 17840 variable region SEQ ID NO: 11 OC459 Factor D Light chain Fab 238-6 WO2009134711 17841 variable region SEQ ID NO: 12 OC460 Factor D Light chain Fab 238-7 WO2009134711 17842 variable region SEQ ID NO: 13 OC461 Factor D Light chain Fab 238-8 WO2009134711 17843 variable region SEQ ID NO: 14 OC462 Factor D Light chain Fab 238-9 WO2009134711 17844 variable region SEQ ID NO: 15 OC463 Factor D Light chain Fab 238-10 WO2009134711 17845 variable region SEQ ID NO: 16 OC464 Factor D Light chain Fab 238-11 WO2009134711 17846 variable region SEQ ID NO: 17 OC465 Factor D Light chain L243 WO2009134711 17847 variable region SEQ ID NO: 32 OC466 Factor D Light chain humanized WO2009134711 17848 variable region L243 SEQ ID NO: 36 OC467 Factor D Light chain Fab 238 WO2009134711 17849 variable region SEQ ID NO: 6 OC468 Factor D Light chain Fab 238-1 WO2009134711 17850 variable region SEQ ID NO: 7 OC469 Factor D Light chain Fab 238-2 WO2009134711 17851 variable region SEQ ID NO: 8 OC470 Factor D Light chain Fab 238-3 WO2009134711 17852 variable region SEQ ID NO: 9 OC471 LPG Light chain #7 U.S. Pat. No. 8,591,902 3329 (lysophosphati- variable region SEQ ID NO: 17 dylglucoside) OC472 LPG Light chain #15 U.S. Pat. No. 8,591,902 3330 (lysophosphati- variable region SEQ ID NO: 7 dylglucoside) OC473 PDGFR-beta Light chain 3299N US20140193402 9142 variable region SEQ ID 10 OC474 PDGFR-beta Light chain 3368N US20140193402 9143 variable region SEQ ID 106 OC475 PDGFR-beta Light chain 3373N US20140193402 9144 variable region SEQ ID 122 OC476 PDGFR-beta Light chain 3374N US20140193402 9145 variable region SEQ ID 138 OC477 PDGFR-beta Light chain 3094P US20140191402 9146 variable region SEQ ID 154 OC478 PDGFR-beta Light chain 3095S US20140193402 9147 variable region SEQ ID 170 OC479 PDGFR-beta Light chain 3096S US20140193402 9148 variable region SEQ ID 186 OC480 PDGFR-beta Light chain 3097S US20140193402 9149 variable region SEQ ID 202 OC481 PDGFR-beta Light chain 3098S US20140193402 9150 variable region SEQ ID 218 OC482 PDGFR-beta Light chain 3099S US20140193402 9151 variable region SEQ ID 234 OC483 PDGFR-beta Light chain 3102S US20140193402 9152 variable region SEQ ID 250 OC484 PDGFR-beta Light chain 3305N US20140193402 9153 variable region SEQ ID 26 OC485 PDGFR-beta Light chain 3103S US20140193402 9154 variable region SEQ ID 266 OC486 PDGFR-beta Light chain 3104S US20140193402 9155 variable region SEQ ID 282 OC487 PDGFR-beta Light chain 3105S US20140193402 9156 variable region SEQ ID 298 OC488 PDGFR-beta Light chain 3106S US20140193402 9157 variable region SEQ ID 314 OC489 PDGFR-beta Light chain 3107S US20140193402 9158 variable region SEQ ID 330 OC490 PDGFR-beta Light chain 3310N US20140193402 9159 variable region SEQ ID 42 OC491 PDGFR-beta Light chain 3361N US20140193402 9160 variable region SEQ ID 58 OC492 PDGFR-beta Light chain 3363N US20140193402 9161 variable region SEQ ID 74 OC493 PDGFR-beta Light chain 3365N US20140193402 9162 variable region SEQ ID 90 OC494 PDGFR/VEGF-A Light chain Cluster # 600 US20110177074 9163 variable region SEQ ID NO: 10 OC495 PDGFR/VEGF-A Light chain Cluster # 1323 US20110177074 9164 variable region SEQ ID NO: 102 OC496 PDGFR/VEGF-A Light chain Cluster # 1330 US20110177074 9165 variable region SEQ ID NO: 106 OC497 PDGFR/VEGF-A Light chain Cluster # 1334 US20110177074 9166 variable region SEQ ID NO: 110 OC498 PDGFR/VEGF-A Light chain Cluster # 1345 US20110177074 9167 variable region SEQ ID NO: 114 OC499 PDGFR/VEGF-A Light chain Cluster # 1346 US20110177074 9168 variable region SEQ ID NO: 118 OC500 PDGFR/VEGF-A Light chain Cluster # 1359 US20110177074 9169 variable region SEQ ID NO: 122 OC501 PDGFR/VEGF-A Light chain Cluster # 1365 US20110177074 9170 variable region SEQ ID NO: 126 OC502 PDGFR/VEGF-A Light chain Cluster # 1402 US20110177074 9171 variable region SEQ ID NO: 130 OC503 PDGFR/VEGF-A Light chain Cluster # 1515 US20110177074 9172 variable region SEQ ID NO: 134 OC504 PDGFR/VEGF-A Light chain Cluster # 1531 US20110177074 9173 variable region SEQ ID NO: 138 OC505 PDGFR/VEGF-A Light chain Cluster # 607 US20110177074 9174 variable region SEQ ID NO: 14 OC506 PDGFR/VEGF-A Light chain Cluster # 1535 US20110177074 9175 variable region SEQ ID NO: 142 OC507 PDGFR/VEGF-A Light chain Cluster # 1541 US20110177074 9176 variable region SEQ ID NO: 146 OC508 PDGFR/VEGF-A Light chain Cluster # 1550 US20110177074 9177 variable region SEQ ID NO: 150 OC509 PDGFR/VEGF-A Light chain Cluster # 1564 US20110177074 9178 variable region SEQ ID NO: 154 OC510 PDGFR/VEGF-A Light chain Cluster # 1601 US20110177074 9179 variable region SEQ ID NO: 158 OC511 PDGFR/VEGF-A Light chain Cluster # 1629 US20110177074 9180 variable region SEQ ID NO: 162 OC512 PDGFR/VEGF-A Light chain Cluster # 635 US20110177074 9181 variable region SEQ ID NO: 166 OC513 PDGFR/VEGF-A Light chain Cluster # 636 US20110177074 9182 variable region SEQ ID NO: 170 OC514 PDGFR/VEGF-A Light chain Cluster # 638 US20110177074 9183 variable region SEQ ID NO: 174 OC515 PDGFR/VEGF-A Light chain Cluster # 656 US20110177074 9184 variable region SEQ ID NO: 178 OC516 PDGFR/VEGF-A Light chain Cluster # 613 US20110177074 9185 variable region SEQ ID NO: 18 OC517 PDGFR/VEGF-A Light chain Cluster # 665 US20110177074 9186 variable region SEQ ID NO: 182 OC518 PDGFR/VEGF-A Light chain Cluster # 668 US20110177074 9187 variable region SEQ ID NO: 186 OC519 PDGFR/VEGF-A Light chain Cluster # 669 US20110177074 9188 variable region SEQ ID NO: 190 OC520 PDGFR/VEGF-A Light chain Cluster # 679 US20110177074 9189 variable region SEQ ID NO: 194 OC521 PDGFR/VEGF-A Light chain Cluster # 695 US20110177074 9190 variable region SEQ ID NO: 198 OC522 PDGFR/VEGF-A Light chain Cluster # 709 US20110177074 9191 variable region SEQ ID NO: 202 OC523 PDGFR/VEGF-A Light chain Cluster # 710 US20110177074 9192 variable region SEQ ID NO: 206 OC524 PDGFR/VEGF-A Light chain Cluster # 741 US20110177074 9193 variable region SEQ ID NO: 210 OC525 PDGFR/VEGF-A Light chain Cluster # 752 US20110177074 9194 variable region SEQ ID NO: 214 OC526 PDGFR/VEGF-A Light chain Cluster # 772 US20110177074 9195 variable region SEQ ID NO: 218 OC527 PDGFR/VEGF-A Light chain Cluster # 941 US20110177074 9196 variable region SEQ ID NO: 22 OC528 PDGFR/VEGF-A Light chain Cluster # 779 US20110177074 9197 variable region SEQ ID NO: 222 OC529 PDGFR/VEGF-A Light chain Cluster # 799 US20110177074 9198 variable region SEQ ID NO: 226 OC530 PDGFR/VEGF-A Light chain Cluster # 830 US20110177074 9199 variable region SEQ ID NO: 230 OC531 PDGFR/VEGF-A Light chain Cluster # 844 US20110177074 9200 variable region SEQ ID NO: 234 OC532 PDGFR/VEGF-A Light chain Cluster # 847 US20110177074 9201 variable region SEQ ID NO: 238 OC533 PDGFR/VEGF-A Light chain Cluster # 868 US20110177074 9202 variable region SEQ ID NO: 242 OC534 PDGFR/VEGF-A Light chain Cluster # 870 US20110177074 9203 variable region SEQ ID NO: 246 OC535 PDGFR/VEGF-A Light chain Cluster # 883 US20110177074 9204 variable region SEQ ID NO: 250 OC536 PDGFR/VEGF-A Light chain Cluster # 887 US20110177074 9205 variable region SEQ ID NO: 254 OC537 PDGFR/VEGF-A Light chain Cluster # 901 US20110177074 9206 variable region SEQ ID NO: 258 OC538 PDGFR/VEGF-A Light chain Cluster # 946 US20110177074 9207 variable region SEQ ID NO: 26 OC539 PDGFR/VEGF-A Light chain Cluster # 905 US20110177074 9208 variable region SEQ ID NO: 262 OC540 PDGFR/VEGF-A Light chain Cluster # 909 US20110177074 9209 variable region SEQ ID NO: 266 OC541 PDGFR/VEGF-A Light chain Cluster # 928 US20110177074 9210 variable region SEQ ID NO: 270 OC542 PDGFR/VEGF-A Light chain Cluster # 1036 US20110177074 9211 variable region SEQ ID NO: 274 OC543 PDGFR/VEGF-A Light chain Cluster # 1039 US20110177074 9212 variable region SEQ ID NO: 278 OC544 PDGFR/VEGF-A Light chain Cluster # 1040 US20110177074 9213 variable region SEQ ID NO: 282 OC545 PDGFR/VEGF-A Light chain Cluster # 1044 US20110177074 9214 variable region SEQ ID NO: 286 OC546 PDGFR/VEGF-A Light chain Cluster # 1048 US20110177074 9215 variable region SEQ ID NO: 290 OC547 PDGFR/VEGF-A Light chain Cluster # 1056 US20110177074 9216 variable region SEQ ID NO: 294 OC548 PDGFR/VEGF-A Light chain Cluster # 1064 US20110177074 9217 variable region SEQ ID NO: 298 OC549 PDGFR/VEGF-A Light chain Cluster # 947 US20110177074 9218 variable region SEQ ID NO: 30 OC550 PDGFR/VEGF-A Light chain Cluster # 1080 US20110177074 9219 variable region SEQ ID NO: 302 OC551 PDGFR/VEGF-A Light chain Cluster # 1092 US20110177074 9220 variable region SEQ ID NO: 306 OC552 PDGFR/VEGF-A Light chain Cluster # 1094 US20110177074 9221 variable region SEQ ID NO: 310 OC553 PDGFR/VEGF-A Light chain Cluster # 1096 US20110177074 9222 variable region SEQ ID NO: 314 OC554 PDGFR/VEGF-A Light chain Cluster # 1107 US20110177074 9223 variable region SEQ ID NO: 318 OC555 PDGFR/VEGF-A Light chain Cluster # 1111 US20110177074 9224 variable region SEQ ID NO: 322 OC556 PDGFR/VEGF-A Light chain Cluster # 1123 US20110177074 9225 variable region SEQ ID NO: 326 OC557 PDGFR/VEGF-A Light chain Cluster # 1135 US20110177074 9226 variable region SEQ ID NO: 330 OC558 PDGFR/VEGF-A Light chain Cluster # 1142 US20110177074 9227 variable region SEQ ID NO: 334 OC559 PDGFR/VEGF-A Light chain Cluster # 1155 US20110177074 9228 variable region SEQ ID NO: 338 OC560 PDGFR/VEGF-A Light chain Cluster # 949 US20110177074 9229 variable region SEQ ID NO: 34 OC561 PDGFR/VEGF-A Light chain Cluster # 1250 US20110177074 9230 variable region SEQ ID NO: 342 OC562 PDGFR/VEGF-A Light chain Cluster # 1252 US20110177074 9231 variable region SEQ ID NO: 346 OC563 PDGFR/VEGF-A Light chain Cluster # 1254 US20110177074 9232 variable region SEQ ID NO: 350 OC564 PDGFR/VEGF-A Light chain Cluster # 1257 US20110177074 9233 variable region SEQ ID NO: 354 OC565 PDGFR/VEGF-A Light chain Cluster # 1264 US20110177074 9234 variable region SEQ ID NO: 358 OC566 PDGFR/VEGF-A Light chain Cluster # 1266 US20110177074 9235 variable region SEQ ID NO: 362 OC567 PDGFR/VEGF-A Light chain Cluster # 1268 US20110177074 9236 variable region SEQ ID NO: 366 OC568 PDGFR/VEGF-A Light chain Cluster # 1269 US20110177074 9237 variable region SEQ ID NO: 370 OC569 PDGFR/VEGF-A Light chain Cluster #1270 US20110177074 9238 variable region SEQ ID NO: 374 OC570 PDGFR/VEGF-A Light chain Cluster # 1281 US20110177074 9239 variable region SEQ ID NO: 378 OC571 PDGFR/VEGF-A Light chain Cluster # 975 US20110177074 9240 variable region SEQ ID NO: 38 OC572 PDGFR/VEGF-A Light chain Cluster # 1283 US20110177074 9241 variable region SEQ ID NO: 382 OC573 PDGFR/VEGF-A Light chain Cluster # 1285 US20110177074 9242 variable region SEQ ID NO: 386 OC574 PDGFR/VEGF-A Light chain Cluster # 1409 US20110177074 9243 variable region SEQ ID NO: 390 OC575 PDGFR/VEGF-A Light chain Cluster # 1410 US20110177074 9244 variable region SEQ ID NO: 394 OC576 PDGFR/VEGF-A Light chain Cluster # 1413 US20110177074 9245 variable region SEQ ID NO: 398 OC577 PDGFR/VEGF-A Light chain Cluster # 1416 US20110177074 9246 variable region SEQ ID NO: 402 OC578 PDGFR/VEGF-A Light chain Cluster # 1420 US20110177074 9247 variable region SEQ ID NO: 406 OC579 PDGFR/VEGF-A Light chain Cluster # 1428 US20110177074 9248 variable region SEQ ID NO: 410 OC580 PDGFR/VEGF-A Light chain Cluster # 1437 US20110177074 9249 variable region SEQ ID NO: 414 OC581 PDGFR/VEGF-A Light chain Cluster # 1449 US20110177074 9250 variable region SEQ ID NO: 418 OC582 PDGFR/VEGF-A Light chain Cluster # 997 US20110177074 9251 variable region SEQ ID NO: 42 OC583 PDGFR/VEGF-A Light chain Cluster # 1458 US20110177074 9252 variable region SEQ ID NO: 422 OC584 PDGFR/VEGF-A Light chain Cluster # 1476 US20110177074 9253 variable region SEQ ID NO: 426 OC585 PDGFR/VEGF-A Light chain Cluster # 1479 US20110177074 9254 variable region SEQ ID NO: 430 OC586 PDGFR/VEGF-A Light chain Cluster # 1035 US20110177074 9255 variable region SEQ ID NO: 46 OC587 PDGFR/VEGF-A Light chain Cluster # 1228 US20110177074 9257 variable region SEQ ID NO: 54 OC588 PDGFR/VEGF-A Light chain Cluster # 1230 US20110177074 9258 variable region SEQ ID NO: 58 OC589 PDGFR/VEGF-A Light chain Cluster # 1231 US20110177074 9260 variable region SEQ ID NO: 62 OC590 PDGFR/VEGF-A Light chain Cluster # 1236 US20110177074 9261 variable region SEQ ID NO: 66 OC591 PDGFR/VEGF-A Light chain Cluster # 1238 US20110177074 9262 variable region SEQ ID NO: 70 OC592 PDGFR/VEGF-A Light chain Cluster # 1244 US20110177074 9263 variable region SEQ ID NO: 74 OC593 PDGFR/VEGF-A Light chain Cluster # 1245 US20110177074 9264 variable region SEQ ID NO: 78 OC594 PDGFR/VEGF-A Light chain Cluster # 1299 US20110177074 9265 variable region SEQ ID NO: 82 OC595 PDGFR/VEGF-A Light chain Cluster # 1312 US20110177074 9266 variable region SEQ ID NO: 86 OC596 PDGFR/VEGF-A Light chain Cluster # 1314 US20110177074 9267 variable region SEQ ID NO: 90 OC597 PDGFR/VEGF-A Light chain Cluster # 1317 US20110177074 9268 variable region SEQ ID NO: 94 OC598 PDGFR/VEGF-A Light chain Cluster # 1322 US20110177074 9269 variable region SEQ ID NO: 98 OC599 PDGFR/VEGF-A Light chain Cluster # 597 US20110177074 9259 variable region SEQ ID NO: 6 OC600 RGMa Light chain AE12-15 US20140023659 3358 variable region SEQ ID NO: 103 OC601 RGMa Light chain AE12-20 US20140023659 3359 variable region SEQ ID NO: 111 OC602 RGMa Light chain AE12-21 US20140023659 3360 variable region SEQ ID NO: 119 OC603 RGMa Light chain AE12-23 US20140023659 3361 variable region SEQ ID NO: 127 OC604 RGMa Light chain AE12-2 US20140023659 3362 variable region SEQ ID NO: 13 OC605 RGMa Light chain AE12-24 US20140023659 3363 variable region SEQ ID NO: 135 OC606 RGMa Light chain AE12-3 US20140023659 3364 variable region SEQ ID NO: 21 OC607 RGMa Light chain AE12-4 US20140023659 3365 variable region SEQ ID NO: 29 OC608 RGMa Light chain AE12-5 US20140023659 3366 variable region SEQ ID NO: 37 OC609 RGMa Light chain AE12-6 US20140023659 3367 variable region SEQ ID NO: 45 OC610 RGMa Light chain AE12-1 US20140023659 3368 variable region SEQ ID NO: 5 OC611 RGMa Light chain AE12-7 US20140023659 3369 variable region SEQ ID NO: 53 OC612 RGMa Light chain AE12-8 US20140023659 3370 variable region SEQ ID NO: 61 OC613 RGMa Light chain AE12-13 US20140023659 3371 variable region SEQ ID NO: 95 OC614 S1P4 Light chain WO2015057939 4431 variable region SEQ ID NO: 9 OC615 VEGF, C5, Light chain NVS73 US20140186350 17853 Factor P, Factor variable region SEQ ID 120 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC616 VEGF, C5, Light chain NVS4 US20140186350 17854 Factor P, Factor variable region SEQ ID 17 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC617 VEGF, C5, Light chain NVS75 US20140186350 17855 Factor P, Factor variable region SEQ ID 201 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC618 VEGF, C5, Light chain NVS70 US20140186350 17856 Factor P, Factor variable region SEQ ID 49 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC619 VEGF, C5, Light chain NVS71 US20140186350 17857 Factor P, Factor variable region SEQ ID 71 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC620 VEGF, C5, Light chain NVS72 US20140186350 17858 Factor P, Factor variable region SEQ ID 93 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC621 VEGF-A Light chain L3 US20140086829 9350 variable region SEQ ID NO: 8 OC622 C5a Light chain BNJ364, US20130224187 9466 with signal BNJ367, SEQ ID 16 peptide BNJ366, BNJ369 OC623 C5a Light chain BNJ371, US20130224187 9467 with signal BNJ381 SEQ ID 35 peptide OC624 C5a Light chain BNJ378, US20130224187 9468 with signal BNJ383 SEQ ID 39 peptide OC625 VEGF-A scFv L3H6 US20140086829 9617 SEQ ID NO: 10 OC626 VEGF-A scFv L3H5 US20140086829 9618 SEQ ID NO: 12 OC627 VEGF-A scFv L3H7 US20140086829 9619 SEQ ID NO: 14 OC628 VEGF-A scFv Fab L3H6 US20140086829 9620 SEQ ID 17 OC629 VEGF-A scFv Fab L3H6 US20140086829 9621 SEQ ID 18 OC630 VEGF-A scFv Fab L3H5 US20140086829 9622 SEQ ID 21 OC631 VEGF-A scFv Fab L3H5 US20140086829 9623 SEQ ID 22 OC632 VEGF-A scFv Fab L3H7 US20140086829 9624 SEQ ID 25 OC633 Annexin IV or a scoff B4 WO2014116880 9630 phospholipid; SEQ ID 17 and (b) a complement inhibitor OC634 Annexin IV or a scFV B4 WO2014116880 9631 phospholipid; SEQ ID 18 and (b) a complement inhibitor OC635 Annexin IV or a scFV C2 WO2014116880 9632 phospholipid; SEQ ID 37 and (b) a complement inhibitor OC636 Annexin IV or a scFV C2 WO2014116880 9633 phospholipid; SEQ ID 38 and (b) a complement inhibitor OC637 VEGF, C5, single chain NVS78 US20140186350 17859 Factor P, Factor SEQ ID 146 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC638 VEGF, C5, single chain NVS78T US20140186350 17860 Factor P, Factor SEQ ID 147 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC639 VEGF, C5, single chain NVS90 US20140186350 17861 Factor P, Factor SEQ ID 148 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC640 VEGF, C5, single chain NVS90T US20140186350 17862 Factor P, Factor SEQ ID 149 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC641 VEGF, C5, single chain NVS79 US20140186350 17863 Factor P, Factor SEQ ID 150 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC642 VEGF, C5, single chain NVS79T US20140186350 17864 Factor P, Factor SEQ ID 151 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC643 VEGF, C5, single chain NVS91 US20140186350 17865 Factor P, Factor SEQ ID 152 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC644 VEGF, C5, single chain NVS91T US20140186350 17866 Factor P, Factor SEQ ID 153 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC645 VEGF, C5, single chain NVS80 US20140186350 17867 Factor P, Factor SEQ ID 154 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC646 VEGF, C5, single chain NVS80T US20140186350 17868 Factor P, Factor SEQ ID 156 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC647 VEGF, C5, single chain NVS83 US20140186350 17869 Factor P, Factor SEQ ID 165 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC648 VEGF, C5, single chain NVS83T US20140186350 17870 Factor P, Factor SEQ ID 166 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC649 VEGF, C5, single chain NVS84 US20140186350 17871 Factor P, Factor SEQ ID 167 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC650 VEGF, C5, single chain NVS84T US20140186350 17872 Factor P, Factor SEQ ID 168 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC651 VEGF, C5, single chain NVS85 US20140186350 17873 Factor P, Factor SEQ ID 169 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC652 VEGF, C5, single chain NVS85T US20140186350 17874 Factor P, Factor SEQ ID 170 D, EPO, EPOR, IL-1, IL-17A, Il-10, TNF, or FGFR2 OC653 TGFbeta single-domain DOM23h-33 WO2011012609 9655 SEQ ID 1 OC654 TGFbeta single-domain DOM23h-439 WO2011012609 9656 SEQ ID 10 OC655 TGFbeta single-domain DOM23h-440 WO2011012609 9657 SEQ ID 11 OC656 TGFbeta single-domain DOM23h-262- WO2011012609 9658 6 SEQ ID 12 OC657 TGFbeta single-domain DOM23h-262- WO2011012609 9659 10 SEQ ID 13 OC658 TGFbeta single-domain DOM23h-271- WO2011012609 9660 3 SEQ ID 14 OC659 TGFbeta single-domain DOM23h-271- WO2011012609 9661 7 SEQ ID 15 OC660 TGFbeta single-domain DOM23h-271- WO2011012609 9662 12 SEQ ID 16 OC661 TGFbeta single-domain DOM23h-271- WO2011012609 9663 13 SEQ ID 17 OC662 TGFbeta single-domain DOM23h-437- WO2011012609 9664 4 SEQ ID 18 OC663 TGFbeta single-domain DOM23h-437- WO2011012609 9665 6 SEQ ID 19 OC664 TGFbeta single-domain DOM23h-251 WO2011012609 9666 SEQ ID 2 OC665 TGFbeta single-domain DOM23h-437- WO2011012609 9667 8 SEQ ID 20 OC666 TGFbeta single-domain DOM23h-437- WO2011012609 9668 9 SEQ ID 21 OC667 TGFbeta single-domain DOM23h-439- WO2011012609 9669 6 SEQ ID 22 OC668 TGFbeta single-domain DOM23h-439- WO2011012609 9670 8 SEQ ID 23 OC669 TGFbeta single-domain DOM23h-262 WO2011012609 9671 SEQ ID 3 OC670 TGFbeta single-domain DOM23h-271 WO2011012609 9672 SEQ ID 4 OC671 TGFbeta single-domain DOM23h-348 WO2011012609 9673 SEQ ID 5 OC672 TGFbeta single-domain DOM23h-435 WO2011012609 9674 SEQ ID 6 OC673 TGFbeta single-domain DOM23h-436 WO2011012609 9675 SEQ ID 7 OC674 TGFbeta single-domain DOM23h-437 WO2011012609 9676 SEQ ID 8 OC675 TGFbeta single-domain DOM23h-438 WO2011012609 9677 SEQ ID 9 OC676 VEGFA Brolucizumab, 17875 ESBA-1008, ESBA1008,

    Systemic Disease Antibodies

    [0315] In one embodiment, the payload region of the AAV particle comprises one or more nucleic acid sequences encoding one or more of the systemic disease payload antibody polypeptides listed in Table 12 (SYS1-SYS73; SEQ ID NO: 7124, 7127, 7291-7293, 9394, 9397, 9485-9487, 17876-47938).

    TABLE-US-00012 TABLE 12 Systemic Disease Antibodies Antibody No. Target Description Antibody Name Reference Information SEQ ID NO SYS1 integral IIb3, Chain A, Antibody Tadocizumab, C4G1, U.S. Pat. No. 5,777,085 17876 GPIIb/IIIa for platelet YM-337 SEQ ID NO: 23 aggregation SYS2 integrin IIb3, Chain B, Antibody Tadocizumab, C4G1, U.S. Pat. No. 5,777,085 17877 GPIIb/IIIa for platelet YM-337 SEQ ID NO: 12 aggregation SYS3 Fab fragment Tadocizumab 17878 SYS4 Fab fragment Tadocizumab 17879 SYS5 Fusion protein Sotatercept 17880 SYS6 selectin P Heavy chain Inclacumab, LC1004- 17881 002, RO4905417 SYS7 Heavy chain Alirocumab 17882 SYS8 Heavy chain Abciximab 17883 SYS9 Heavy chain Bococizumab 17884 SYS10 Heavy chain Evinacumab 17885 SYS11 Heavy chain Inclacumab 17886 SYS12 Heavy chain Lanadelumab 17887 SYS13 Heavy chain Ralpancizumab 17888 SYS14 Heavy chain Roledumab 17889 SYS15 CD20 Heavy Chain, Idarucizumab U.S. Pat. No. 8,486,398 17890 Antibody for SEQ ID NO: 35; reversing U.S. Pat. No. 8,486,398 anticoagulation SEQ ID NO: 39 of dabigatran SYS16 oxLDL Heavy chain Orticumab, BI-204, 17891 Antibody for MLDL-1278A, R7418, acute coronary RG-7418 syndrome, atherosclerosis SYS17 Heavy chain Fab Idarucizumab 17892 fragment SYS18 selectin P Heavy chain Inclacumab, LC1004- U.S. Pat. No. 7,563,441 17893 variable region 002, RO4905417 SEQ ID NO: 4 SYS19 oxLDL Heavy chain Orticumab, Bi-204, U.S. Pat. No. 8,318,161 7124 variable region, MLDL-1278A, R7418, SEQ ID NO: 3 Antibody for RG-7418 acute coronary syndrome, atherosclerosis SYS20 C5 Heavy Chain Pexelizumab, 17894 Variable Region, 5G1.1-SC Antibody for cardiopulmonary bypass, myocardial infection, h5g1.1VHC + F SYS21 PCSK9 Heavy chain Alirocumab U.S. Pat. No. 8,062,640 17895 variable region, SEQ ID NO: 90 Antibody for cholesterol SYS22 TNFSF11 Heavy Chain Denosumab, Prolia U.S. Pat. No. 7,364,736; 7127 Variable Region, U.S. Pat. No. 8,058,418; Antibody for U.S. Pat. No. 8,409,578 osteoporosis SYS23 TFPI Heavy chain, Concizumab, Anti- U.S. Pat. No. 8,361,469 17896 Antibody for TFPI, NN7415, SEQ ID NO: 24 bleeding, mab2021 SYS24 PCSK9 Heavy chain Bococizumab U.S. Pat. No. 8,399,646 17897 Antibody for SEQ ID NO: 15 cardiovascular disease SYS25 PCSK9 Heavy cliain, Alirocumab 17898 Antibody for cholesterol SYS26 PCSK9 Heavy chain, Ralpancizumab, PF- 17899 Antibody for 05335810, RN317 dyslipidemia, Hypercholesterolemia SYS27 F9, F10 Heavy chain, Emicizumab, ACE910, 17900 Antibody for hBS910 hematology (hemophilia), anti 10 SYS28 F9, F10 Heavy chain, Emicizumab, ACE910, 17901 Antibody for hBS910 hematology (hemophilia), anti F-91 SYS29 PCSK9 Heavy chain, Lodelcizumab, 17902 Antibody for LGT209, NVP- hypercholesterolemia LGT209 SYS30 PCSK9 Heavy chain, Evolocumab U.S. Pat. No. 8,030,457 17903 Antibody for hyperlipidemia SYS31 ANGPTL3 Heavy chain, Evinacumab, REGN 17904 Antibody for 1500 Hypertriglyceridemia SYS32 TNFSF11 Heavy Chain, Denosumab, Prolia U.S. Pat. No. 7,364,736; 7292 Antibody for U.S. Pat. No. 8,058,418; osteoporosis U.S. Pat. No. 8,409,578 SYS33 SOST Heavy chain, Romosozumab U.S. Pat. No. 7,592,429; 17905 Antibody for U.S. Pat. No. 7,872,106; osteoporosis, U.S. Pat. No. 8,003,108: U.S. Pat. No. 8,017,120 SEQ ID NOs: 147, 145 SYS34 SOST Heavy chain, Blosozumab U.S. Pat. No. 7,744,874 7291 Antibody for SEQ ID NO: 3 osteoporosis, SYS35 TNFSF11 Heavy chain, Denosumab, Prolia U.S. Pat. No. 8,962,807 7293 Antibody for SEQ ID NO: 177; osteoporosis, U.S. Pat. No. 7,528,236 Denosumab SEQ ID NO: 28 OPGL-1 SYS36 RHD Heavy chain, Roledumab, LFB-R593, WO 2010100383 17906 Antibody for DMATRIA prevention of fetomaternal alloimmunization in RhD women SYS37 CD20 Heavy Chain, Idarucizumab U.S. Pat. No. 8,486,398 17907 Antibody for SEQ ID NO: 38; reversing U.S. Pat. No. 8,486,398 anticoagulation SEQ ID NO: 41; of dabigatran U.S. Pat. No. 8,486,398 SEQ ID NO: 36 SYS38 hemophilia Factor IX-Fc US20050147618 17908 antibody SEQ ID NO: 23 SYS39 hemophilia Factor VIII-Fc WO2011069164 17909 antibody SEQ ID NO: 2 SYS40 selectin P Light chain Inclacumab, LC1004- U.S. Pat. No. 8,039,596 17910 (a5b1) 002, RO4905418 SEQ ID NO: 10; U.S. Pat. No. 7,432,359 SEQ ID NO: 89 SYS41 Light chain Alirocumab 17911 SYS42 Light chain Abciximab 17912 SYS43 Light chain Bococizumab 17913 SYS44 Light chain Evinacumab 17914 SYS45 Light chain Idarucizumab 17915 SYS46 Light chain Inclacumab 17916 SYS47 Light chain Lanadelumab 17917 SYS48 Light chain Ralpancizumab 17918 SYS49 Light chain Roledumab 17919 SYS50 ANGPTL3 Light chain, Evinacumab, REGN 17920 Antibody for 1500 Hypertriglyceridemia SYS51 CD41 7E3 Light chain 1, Abciximab, c7E3 Fab, U.S. Pat. No. 5,275,812; 17921 Antibody for ReoPro U.S. Pat. No. 5,770,198; preventing blood U.S. Pat. No. 5,440,020 clot, ReoPro-Like SYS52 CD41 7E3 Light chain 1, Abciximab, c7E3 Fab, U.S. Pat. No. 5,275,812; 17922 Antibody for ReoPro U.S. Pat. No. 5,770,198; preventing blood U.S. Pat. No. 5,440,020 clot, ReoPro-Like SYS53 selectin P Light chain Inclacumab, LC1004- U.S. Pat. No. 7,563,441 17923 variable region 002, RO4905417 SEQ ID NO: 3 SYS54 oxLDL Light chain Orticumab, Bi-204, U.S. Pat. No. 8,318,161 9394 variable region, MLDL-1278A, R7418, SEQ ID NO: 4 Antibody for RG-7418 acute coronary syndrome, atherosclerosis SYS55 C5 Light Chain Pexelizumab, 17924 Variable Region, 5G1.1-SC Antibody for cardiopulmonary bypass, myocardial infection, h5g1.1VHC + F SYS56 PCSK9 Light chain Alirocumab U.S. Pat. No. 8,062,640 17925 variable region, SEQ ID NO: 92 Antibody for cholesterol SYS57 TNFSF11 Light Chain Denosumab, Prolia U.S. Pat. No. 7,364,736; 9397 Variable Region, U.S. Pat. No. 8,058,418; Antibody for U.S. Pat. No. 8,409,578 osteoporosis SYS58 oxLDL Light chain, Orticumab, BI-204, 17926 Antibody for MLDL-1278A, R7418, acute coronary RG-7418 syndrome, atherosclerosis SYS59 PCSK9 Light chain, Lodelcizumab, U.S. Pat. No. 8,710,192 17927 Antibody for LGT209, NVP- SEQ ID NO: 17 blood, LGT209 hypercholesterolemia SYS60 PCSK9 Light chain, Bococizumab U.S. Pat. No. 8,399,646 17928 Antibody for SEQ ID NO: 14 cardiovascular disease SYS61 PCSK9 Light chain, Alirocumab 17929 Antibody for cholesterol SYS62 PCSK9 Light chain, Ralpancizumab, PF- 17930 Antibody for 05335810, RN317 dyslipidemia, Hypercholesterolemia SYS63 F9, F10 Light chain, Emicizumab, ACE910, 17931 Antibody for hBS910 hematology (hemophilia) SYS64 TFPI Light chain, Concizumab, Anti- U.S. Pat. No. 8,361,469 17932 Antibody for TFPI, NN7415, SEQ ID NO: 21 hemophilia, mab2021 SYS65 PCSK9 Light chain, Evolocumab U.S. Pat. No. 8,030,457 17933 Antibody for SEQ ID NO: 297 hyperlipidemia SYS66 TNFSF11 Light Chain, Denosumab, Prolia U.S. Pat. No. 7,364,736; 9486 Antibody for U.S. Pat. No. 8,058,418; osteoporosis U.S. Pat. No. 8,409,578 SYS67 SOST Light chain, Romosozumab U.S. Pat. No. 7,592,429; 17934 Antibody for U.S. Pat. No. 7,872,106; osteoporosis, U.S. Pat. No. 8,003,108; U.S. Pat. No. 8,017,120 SEQ ID NOs: 141, 143 SYS68 SOST Light chain, Blosozumab U.S. Pat. No. 7,744,874 9485 Antibody for SEQ ID NO: 6 osteoporosis, SYS69 TNFSF11 Light chain, Denosumab, Prolia U.S. Pat. No. 8,992,925 9487 Antibody for SEQ ID NO: 8; osteoporosis, U.S. Pat. No. 7,364,736 Denosumab SEQ ID NO: 4 OPGL-1 SYS70 RHD Light chain, Roledumab, LFB-R593, WO 2010100383 17935 Antibody for DMATRIA prevention of fetomaternal alloimmunization in RhD women SYS71 Peptide Ecallantide 17936 SYS72 C5 scFv, Antibody for Pexelizumab, 17937 cardiopulmonary 5G1.1-SC bypass, myocardial infection, h5g1.1 SYS73 Abaloparatide 17938

    [0316] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding a polypeptide which is an antibody, an antibody-based composition, or a fragment thereof. As a non-limiting example, the antibody may be one or more of the polypeptides listed in Tables 3-12. As another non-limiting example, the antibody may be one or more of the heavy chain sequences listed in Tables 3-12. As a non-limiting example, the antibody may be one or more of the light chain sequences listed in Table 3-12.

    [0317] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding a polypeptide comprising a heavy chain and a light chain sequence listed in Tables 3-12. The payload region may also comprise a linker between the heavy and light chain sequences. The linker may be a sequence known in the art or described in Table 2.

    [0318] In one embodiment, the payload region of the AAV particle comprises a nucleic acid sequence encoding a polypeptide comprising a heavy chain and a light chain sequence listed in Tables 3-12, where the heavy chain sequence is from a different antibody than the light chain sequence. The payload region may also comprise a linker between the heavy and light chain sequences. The linker may be a sequence known in the art or described in Table 2.

    [0319] In one embodiment, the payload region comprises, in the 5 to 3 direction, an antibody light chain sequence, a linker and a heavy chain sequence.

    [0320] In one embodiment, the payload region comprises a nucleic acid sequence encoding, in the 5 to 3 direction, an antibody light chain sequence from Tables 3-12, a linker from Table 2 and a heavy Chain sequence from Tables 3-12.

    [0321] In one embodiment, the payload region comprises, in the 5 to 3 direction, an antibody heavy chain sequence, a linker and a light chain sequence.

    [0322] In one embodiment, the payload region comprises a nucleic acid sequence encoding, in the 5 to 3 direction, an antibody heavy chain sequence from Tables 3-12, a linker from Table 2 and a light chain sequence from Tables 3-12.

    [0323] In one embodiment, the payload region comprises a nucleic acid sequence encoding a single heavy chain. As a non-limiting example, the heavy chain is an amino acid sequence or fragment thereof described in Tables 3-12.

    [0324] Shown in Tables 3-12 are a listing of antibodies and their polynucleotides and/or poly peptides sequences. These sequences may be encoded by or included in the AAV particles of the present invention. Variants or fragments of the antibody sequences described in Tables 3-12 may be utilized in the AAV particles of the present invention.

    [0325] In some embodiments, the AAV particles may comprise codon-optimized versions of the nucleic acids encoding the polypeptides listed in Tables 3-12. In some cases, the payload region of the AAV particles of the invention may encode one or more isoforms or variants of these heavy and light chain antibody domains. Such variants may be humanized or optimized antibody domains comprising one or more complementarity determining regions (CDRs) from the heavy and light chains listed in Tables 3-12. Methods of determining CDRs are well known in the art and are described herein. Payload regions may encode antibody variants with one or more heavy chain variable domain (V.sub.H) or light chain variable domain (V.sub.L) derived from the antibody sequences in Tables 3-12. in some cases, such variants may include bispecific antibodies. Bispecific antibodies encoded by payload regions of the invention may comprise variable domain pairs from two different antibodies.

    [0326] In one embodiment, the AAV particles may comprise a heavy and a light chain of an antibody described herein and two promoters. As a non-limiting example, the AAV particles may comprise a nucleic acid sequence of a genome as described in. FIG. 1 or FIG. 2 of US Patent Publication No. US20030219733, the contents of which are herein incorporated by reference in its entirety. As another non-limiting example, the AAV particles may be a dual-promoter AAV for antibody expression as described by Lewis et al. (J. of. Virology, September 2002, Vol. 76(17), p 8769-8775; the contents of which are herein incorporated by reference in its entirety).

    Disease Specific Epitopes, Innate Defense Regulator Peptides, Cyclic Peptides

    [0327] In one embodiment, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to enable expression of antibodies binding to disease-specific epitopes of proteins. Such antibodies may be used to diagnose, prevent, and/or treat the corresponding medical conditions by targeting epitopes of the protein presented by or accessible on native or non-native forms (e.g., misfolded forms of native proteins) of the target. Such epitopes may he specific to diseases involved with misfolding of a protein due to pathologic condition and resulting in misfolded aggregates. The disease-specific proteins are considered to be toxic to neurons and to have a role in neuronal cell death and dysfunction in neurodegenerative diseases including, but not limited to, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), Parkinson's disease, dementia by Lewy body (DLB), and priori diseases, e.g. Creutzfeldt-Jakob disease (CID), Gerstmann-Straussier-Scheinker syndrome (GSS), kuru, and fatal familial insomnia (FFI).

    [0328] In one embodiment, the encoded disease-specific epitopes may include epitopes on SOD1 that are revealed as SOD1. (Superoxide dismutase [CuZn]) dissociates from its homodimeric, normal state. The SOD epitopes may be selectively presented or accessible in non-native SOD1 forms including misfolded SODI monomer, misfolded SOD1 dimer, and the epitopes selectively presented or accessible in SOD1 aggregates. Such epitopes ma be specific to neurodegenerative diseases including, but not limited to, amyotrophic lateral sclerosis (ALS), Alzheimer's (AD), Parkinson's (PD), and Lewy body diseases (LBD).

    [0329] In one embodiment, the expressed antibodies may bind to epitopes presented by or accessible on non-native forms of SODI., such as those presented by SEQ ID NO: 2, 3, 5, 6, and 7 of U.S. Pat. No. 7,977,314 (the contents of which are herein incorporated by reference in its entirety), or presented h or accessible on monomeric forms of SOD1, such as those presented by SEQ ID NOs: 1 and 4 of U.S. Pat. No. 7,977,314, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the expressed antibodies may comprise isolated peptides corresponding to such epitopes, such as those presented in SEQ ID NOs: 1-8 or SEQ ID NOs: 8-16, or epitopes presented by SEQ ID NOs: 34-63, 65-79 of U.S. Pat. No. 7,977,314, the contents of which are herein incorporated by reference in their entirety.

    [0330] In one embodiment, the encoded disease-specific epitopes nay he specific to diseases associated with prion protein (PrP); familial amyloid polyneuropathy or senile systemic amyloidosis or a disease related by the presence of misfolded transthyretine (TTR); renal accumulation of 2 microglobulin amyloid deposits or a disease related by the presence of misfolded 2 microglobulin, amyotrophic lateral sclerosis (ALS) or a disease related by the presence of misfolded SOD1; leukemias or myelomas or a disease related by the presence of misfolded cluster of differentiation 38 (CD38); colon cancer metastasis and or a disease related by the presence of misfolded cluster of differentiation (CD44), tumors associated with tumor necrosis factor receptor (TNFR); cancers including cervical, head and neck, endometrial, lung and breast carcinomas, pleural mesotheliomas, malignant melanomas, Hodgkin lymphomas, anaplastic large cell non-Hodgkin lymphomas, or a disease related by the presence of misfolded Notch homolog 1 (NOTCH1) e.g. acute myeloid leukemias and B-cell chronic lymphoid leukemias; cancer in which Fas receptor (FasR) is implicated; cancers and related disorders in which misfolded epidermal growth factor (EGFR) is implicated; and/or other related diseases, disorders and conditions.

    [0331] In one embodiment, the encoded disease specific epitopes may include epitopes that are revealed as the proteins misfold. In one embodiment, the expressed antibodies may bind to predicted epitopes of human PrP, such as those presented by SEQ ID NOs: 1-10 of US Patent Publication No. US20100233176; bovine PrP, such as those presented by SEQ ID NOs: 11-15 of US Patent Publication No. US20100233176, TTI, such as those presented by SEQ ID NOs: 16-22 of US Patent Publication No. US20100233176; beta-2 microglobulin, such as those presented by SEQ ID NOs: 23-26 of US Patent Publication No. US20100233176; SOD1 such as those presented by SEQ ID NOs: 27-40 of US Patent Publication No. US20100233176; CD38, such as those presented by SEQ ID NOs: 41-45 of US Patent Publication No. US20100233176, CD44, such as those presented by 46-50 of US Patent Publication No. US20100233176; TNFR, such as those presented by 51-55 of US Patent Publication No. US20100233176; notch protein, such as those presented in SEQ It NOs: 56-60 of US Patent Publication No. US20100233176; FasR, such as those presented by SEQ ID NOs: 61-65 of US Patent Publication No. US20100233176 and EGFR, such as those presented by SEQ ID NOs: 66-80 of US Patent Publication No. US20100233176; the contents of which are herein incorporated by reference in their entirety.

    [0332] In one embodiment, the expressed antibodies may comprise peptides corresponding to such epitopes. In one embodiment, the expressed antibodies may comprise prion-specific peptides, such as those presented by SEQ ID NOs: 81-88 of US Patent Publication No. US20100233176, the contents of which are herein incorporated by reference in their entirety, and variations thereof.

    [0333] In one embodiment, the encoded disease-specific epitopes may be specific to prion diseases, including transmissible spongiform encephalopathies (TSEs) or other prion diseases. In one embodiment, the expressed antibodies may bind to predicted epitopes of PrP, such as those presented by SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 39-43, of US Patent Publication No. US20150004185, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the expressed antibodies may comprise prion-specific peptides or peptide fusions, such as those presented by SEQ ID NOs: 12-23, 25, 27, 29, 31, 33, 35, 37, 38, 43, and 44-48 of US Patent Publication No. US20150004185, the contents of which are herein incorporated by reference in their entirety.

    [0334] In one embodiment, the expressed antibodies may comprise prion peptides binding to prion specific abnormal isoform of the prion protein, such as those presented by SEQ ID NOs: 2-10 of US Patent Publication No. US20040072236, the contents of which are herein incorporated by reference in their entirety.

    [0335] In one embodiment, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to express innate defense regulator (IDR) peptides. IDRs are immunomodulatory peptides that act directly on cells to effect an innate immune response. Such IDRs may be used to treat neurodegenerative diseases associated with neuroinflammation, e.g. amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease, spinal muscular atrophy, and multiple sclerosis (MS) and other neurodegenerative diseases. In one embodiment, IDRs may be those presented by SEQ ID NOS: 1-969, and 973-1264 of International Publication No. WO2013034982, the contents of which are herein incorporated by reference in their entirety, or analogs, derivatives, amidated variations and conservative variations thereof.

    [0336] In one embodiment, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to express antibodies binding to an epitope of the Tropomyosin receptor kinase (TrkC) receptor. Such antibodies may comprise a peptide, such as one presented by SEQ ID NO: 1 of U.S. Pat. No. 9,200,080, the contents of which are herein incorporated by reference in their entirety.

    [0337] In some embodiments, the viral genomes of the AAV particles may comprise nucleic acids which have been engineered to express cyclic peptides with an amino acid sequence SNK. Non-limiting examples of other cyclic peptides include SEQ ID NO: 1-7 of U.S. Pat. No. 9,216,217, the contents of which are herein incorporated by reference in their entirety. The method of preparing the antibodies may include hyperimmune preparation method, as described in U.S. Pat. No. 9,216,217, the contents of which are herein incorporated by reference in their entirety.

    Prions

    [0338] In one embodiment, the viral genomes of the AAV particles may comprise a nucleic acid sequence encoding antibodies comprising prion peptides comprising prion epitopes, and fusions and repeats thereof such as those presented by SEQ ID NOs: 8-32, 35, and 36 of U.S. Pat. No. 9,056,918, the contents of which are herein incorporated by reference in their entirety.

    [0339] In one embodiment, the viral genomes of the AAV particles may comprise a nucleic acid sequence encoding prion binding proteins (PrPBP). In one embodiment, the PrPBPs are cadherins, such as those presented by SEQ ID NOs: 1 and 2 of International Publication WO1997/045746, the contents of which are herein incorporated by reference in their entirety. In one embodiment, the PrPBPs are cadherins, such as those presented by SEQ NOs: 2 and 7-9 of International Publication No. WO2001000235, the contents of which are herein incorporated by reference in their entirety.

    The nature of the Polypeptides and Variants

    [0340] Antibodies encoded by payload regions of the viral genomes of the invention may be translated as a whole polypeptide, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more nucleic acids, fragments of nucleic acids or variants of any of the aforementioned. As used herein, polypeptide means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. In some instances, the polypeptide encoded is smaller than about 50 amino acids and the polypeptide is then termed a peptide. If the polypeptide is a peptide, it will be at least about 2, 3, 4, or at least 5 amino acid residues long. Thus, polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogy, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. They may also comprise single chain or raultichain polypeptides and may be associated or linked. The term polypeptide may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.

    [0341] The term polypeptide variant refers to molecules which differ in their amino acid sequence from a native or reference sequence. The amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence. Ordinarily, variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence.

    [0342] In some embodiments variant mimics are provided. As used herein, the term variant mimic is one which contains one or more amino acids which would mimic an activated sequence. For example, glutamate may serve as a mimic for phosphoro-threonine and/or phosphoro-serine. Alternatively, variant may result in deactivation or in an inactivated product, containing the mimic, phenylalanine may act as an inactivating substitution for tyrosine; or alanine may act as an inactivating substitution for serine.

    [0343] The term amino acid sequence variant refers to molecules with some differences in their amino acid sequences as compared to a native or starting sequence. The amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence. Native or starting sequence should not be confused with a wild type sequence. As used herein, a native or starting sequence is a relative term referring to an original molecule against which a comparison may be made. Native or starting sequences or molecules may represent the wild-type (that sequence found in nature) but do not have to be the wild-type sequence.

    [0344] Ordinarily, variants will possess at least about 70% homology to a native sequence, and preferably, they will be at least about 80%, more preferably at least about 90% homologous to a native sequence. Homology as it applies to amino acid sequences is defined as the percentage of residues in the candidate amino acid sequence that are identical with the residues in the amino acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology. Methods and computer programs for the alignment are well known in the art. It is understood that homology depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation.

    [0345] By homologs as it applies to amino acid sequences is meant the corresponding sequence of other species having substantial identity to a second sequence of a second species.

    [0346] Analogs is meant to include polypeptide variants which differ by one or more amino acid alterations, e.g., substitutions, additions or deletions of amino acid residues that still maintain the properties of the parent polypeptide.

    [0347] Sequence tags or amino acids, such as one or more lysines, can be added to the peptide sequences of the invention (e.g., at the N-terminal or C-terminal ends). Sequence tags can be used for peptide purification or localization. Lysines can be used to increase peptide solubility or to allow for biotinylation. Alternatively, amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences. Certain amino acids (e.g., C-terminal or N-terminal residues) may alternatively be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence which is soluble, or linked to a solid support.

    [0348] Substitutional variants when referring to proteins are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.

    [0349] As used herein the term conservative amino acid substitution refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine and leucine for another non-polar residue. Likewise, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine. Additionally, the substitution of a basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and/or a polar residue for a non-polar residue.

    [0350] Insertional variants when referring to proteins are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. Immediately adjacent to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid.

    [0351] Deletional variants when referring to proteins, are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.

    [0352] As used herein, the term derivative is used synonymously with the term variant and refers to a molecule that has been modified or changed in any way relative to a reference molecule or starting molecule. In some embodiments, derivatives include native or starting proteins that have been modified with an organic proteinaceous or non-proteinaceous derivatizing agent, and post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues of the protein with an organic derivatizing agent that is capable of reacting with selected side-chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biolottical activity, for immunoassays, or for the preparation of anti-protein antibodies for immunoaffinity purification of the recombinant glycoprotein. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.

    [0353] Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues may be present in the proteins used in accordance with the present invention.

    [0354] Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains (T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 (1983)).

    [0355] Features when referring to proteins are defined as distinct amino acid sequence-based components of a molecule. Features of the proteins of the present invention include surface manifestations, local conformational shape, folds loops, half-loops, domains, half-domains, sites, termini or any combination thereof.

    [0356] As used herein when referring to proteins the term surface manifestation refers to a polypeptide based component of a protein appearing on an outermost surface.

    [0357] As used herein when referring to proteins the term local conformational shape means a poly peptide based structural manifestation of a protein which is located within a definable space of the protein.

    [0358] As used herein when referring to proteins the term fold means the resultant conformation of an amino acid sequence upon energy minimization. A fold may occur at the secondary or tertiary level of the folding process. Examples of secondary level folds include beta sheets and alpha helices. Examples of tertiary folds include domains and regions formed due to aggregation or separation of energetic forces. Regions formed in this way include hydrophobic and hydrophilic pockets, and the like.

    [0359] As used herein the term turn as it relates to protein conformation means a bend which alters the direction of the backbone of a peptide or polypeptide and may involve one, two, three or more amino acid residues.

    [0360] As used herein when referring to proteins the term loop refers to a structural feature of a peptide or poly peptide which reverses the direction of the backbone of a peptide or polypeptide and comprises four or more amino acid residues. Oliva et al. have identified at least 5 classes of protein loops (J. Mol Biol 266 (4): 814-830; 1997).

    [0361] As used herein when referring to proteins the term half-loop refers to a portion of an identified loop having at least half the number of amino acid residues as the loop from which it is derived. It is understood that loops may not always contain an even number of amino acid residues. Therefore, in those cases where a loop contains or is identified to comprise an odd number of amino acids, a half-loop of the odd-numbered loop will comprise the whole number portion or next whole number portion of the loop (number of amino acids of the loop/2+/0.5 amino acids). For example, a loop identified as a 7 amino acid loop could produce half-loops of 3 amino acids or 4 amino acids (7/23.5+/0.5 being 3 or 4).

    [0362] As used herein when referring to proteins the term domain refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).

    [0363] As used herein when referring to proteins the term half-domain means portion of an identified domain having at least half the number of amino acid residues as the domain from which it is derived. It is understood that domains may not always contain an even number of amino acid residues. Therefore, in those cases where a domain contains or is identified to comprise an odd number of amino acids, a half-domain of the odd-numbered domain will comprise the whole number portion or next whole number portion of the domain (number of amino acids of the domain/2+/0.5 amino acids). For example, a domain identified as a 7 amino acid domain could produce half-domains of 3 amino acids or 4 amino acids (7/23.5+/0.5 being 3 or 4). It is also understood that sub-domains may be identified within domains or half-domains, these subdomains possessing less than all of the structural or functional properties identified in the domains or half domains from which they were derived. It is also understood that the amino acids that comprise any of the domain types herein need not be contiguous along the backbone of the polypeptide (i.e., nonadjacent amino acids may fold structurally to produce a domain, half-domain or subdomain).

    [0364] As used herein when referring to proteins the terms site as it pertains to amino acid based embodiments is used synonymous with amino acid residue and amino acid side chain. A site represents a position within a peptide or polypeptide that may be modified, manipulated, altered, derivatized or varied within the polypeptide bared molecules of the present invention.

    [0365] As used herein the terms termini or terminus when referring to proteins refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but may include additional amino acids in the terminal regions. The polypeptide based molecules of the present invention may be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C-terminus (terminated by an amino acid with a free carboxyl group (COOH)). Proteins of the invention are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini. Alternatively, the termini of the polypeptides may be modified such that they begin or end, as the care may be, with a non-polypeptide based moiety such as an organic conjugate.

    [0366] Once any of the features have been identified or defined as a component of a molecule of the invention, any of several manipulations and/or modifications of these features may be performed by moving, swapping, inverting, deleting, randomizing or duplicating. Furthermore, it is understood that manipulation of features may result in the same outcome as a modification to the molecules of the invention. For example, a manipulation which involves deleting a domain would result in the alteration of the length of a molecule just as modification of a nucleic acid to encode less than a full length molecule would.

    [0367] Modifications and manipulations can be accomplished by methods known in the art such as site directed mutagenesis. The resulting modified molecules may then be tested for activity using in vitro or in vivo assays such as those described herein or any other suitable screening assay known in the art.

    AAV Production

    [0368] The present invention provides methods for the generation of parvoviral particles. e.g. AAV particles, by viral genome replication in a viral replication cell.

    [0369] In accordance with the invention, the viral genome comprising a payload region encoding an antibody, an antibody-based composition or fragment thereof, will be incorporated into the AAV particle produced in the viral replication cell. Methods of making AAV particles are well known in the art and are described in e.g., U.S. Pat. Nos. 6,204,059, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508, 5,064,764, 6,194,191, 6,566,118, 8,137,948; or International Publication Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597; Methods in Molecular Biology, ed. Richard, Humana Press, N.J. (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al, J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al. Vir. 219:37444 (1996); Zhao et al., Vir. 272:382-93 (2000); the contents of each of which are herein incorporated by reference in their entirety. In one embodiment, the AAV particles are made using the methods described in WO2015191508, the contents of which are herein incorporated by reference in their entirety.

    [0370] Viral replication cells commonly used for production of recombinant AAV viral vectors include but are not limited to 293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines as described in U.S. Pat. Nos. 6,156,303, 5,387,484, 5,741,683, 5,691,176, and 5,688,676; U.S. patent publication No. 2002/0081721, and International Patent Publication Nos. WO 00/47757, WO 00/24916, and WO 96/17947, the contents of each of which are herein incorporated by reference in their entireties.

    [0371] In some embodiments, the present invention provides a method for producing an AAV particle having enhanced (increased, improved) transduction efficiency comprising the steps of: 1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and/or AAV payload construct vector, 2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transsecting viral replication cells, 3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, and 5) harvesting and purifying the AAV particle comprising a viral genome.

    [0372] In some embodiments, the present invention provides a method for producing an AAV particle comprising the steps of 1) simultaneously co-transfecting mammalian cells, such as, hut not limited to HEK293 cells, with a payload region, a construct expressing rep and cap genes and a helper construct, 2) harvesting and purifying the AAV particle comprising a viral genome.

    [0373] In some embodiments, the viral genome of the AAV particle of the invention optionally encodes a selectable marker. The selectable marker may comprise a cell-surface marker, such as any protein expressed on the surface of the cell including, but not limited to receptors, CD markers, lectins, integrins, or truncated versions thereof.

    [0374] In some embodiments, selectable marker reporter genes as described in International application No. WO 96/23810; Heim et al., Current Biology 2:178-182 (1996); Heim et al., Proc. Natl. Acad. Sci. USA (1995); or Heim et al., Science 373:663-664 (1995), WO 96/30540, the contents of each of which are incorporated herein by reference in their entireties).

    II. FORMULATION AND DELIVERY

    Pharmaceutical Compositions

    [0375] According to the present invention the AAV particles may be prepared as pharmaceutical compositions. It will be understood that such compositions necessarily comprise one or more active ingredients and, most often, a pharmaceutically acceptable excipient.

    [0376] Relative amounts of the active ingredient (e.g. AAV particle), a pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and. 99% (w/w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 100%, e.g. between .5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.

    [0377] In some embodiments, the AAV particle pharmaceutical compositions described herein may comprise at least one payload. As a non-limiting example, the pharmaceutical compositions may contain an AAV particle with 1, 2, 3, 4 or 5 payloads. In one embodiment, the pharmaceutical composition may contain a nucleic acid encoding a payload construct encoding proteins selected from antibodies and/or antibody-based compositions.

    [0378] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, rats, birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys.

    [0379] In some embodiments, compositions are administered to humans, human patients or subjects.

    Formulations

    [0380] The AAV particles of the invention can be formulated using one or more excipients to: (1) increase -stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed expression of the payload; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein; (6) alter the release profile of encoded protein and/or (7) allow for regulatable expression of the payload.

    [0381] Formulations of the present invention can include, without limitation, saline, liposomes, lipid nanoparticles, polymers, peptides, proteins, cells transfected with viral vectors (e.g., for transfer or transplantation into a subject) and combinations thereof.

    [0382] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. As used herein the term pharmaceutical composition refers to compositions comprising at least one active ingredient and optionally one or more pharmaceutically acceptable excipients.

    [0383] In general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients. As used herein, the phrase active ingredient generally refers either to an AAV particle carrying, a payload region encoding the polypeptides of the invention or to the antibody or antibody-based composition encoded by a viral genome of by an AAV particle as described herein.

    [0384] Formulations of the AAV particles and pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.

    [0385] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a unit dose refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would he administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

    [0386] In one embodiment, the AAV particles of the invention may be formulated in PBS with 0.001% of pluronic acid (F-68) at a pH of about 7.0.

    [0387] Relative amounts of the active ingredient (e.g. AAV particle), the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 99% (w/w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.

    [0388] In some embodiments, the AAV formulations described herein may contain sufficient AAV particles for expression of at least one expressed. functional antibody or antibody-based composition. As a non-limiting example, the AAV particles may contain viral genomes encoding 1, 3, 4 or 5 functional antibodies.

    [0389] According to the present invention AAV particles may be formulated for CNS delivery. Agents that cross the brain blood barrier may be used. For example, some cell penetrating peptides that can target molecules to the brain blood barrier endothelium may be used for formulation (e.g., Mathupala, Expert Opin Ther Pat., 2009, 19, 137-140; the content of which is incorporated herein by reference in its entirety).

    Excipients and Diluents

    [0390] The AAV particles of the invention can be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; (6) alter the release profile of encoded protein in vivo and/or (7) allow for regulatable expression of the polypeptides of the invention.

    [0391] In some embodiments, a pharmaceutically acceptable excipient may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is approved for use for humans and for veterinary use. In some embodiments, an excipient may be approved by United States Food and Drug Administration. In some embodiments, an excipient may be of pharmaceutical grade. In some embodiments, an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the international Pharmacopoeia.

    [0392] Excipients, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gepriaro, Lippincott, Williams & Wilkins, Baltimore, Md., 2006; incorporated herein by reference in its entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

    [0393] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and/or combinations thereof.

    Inactive Ingredients

    [0394] In some embodiments, AAV particle formulations may comprise at least one inactive ingredient. As used herein, the term inactive ingredient refers to one or more agents that do not contribute to the activity of the active ingredient of the pharmaceutical composition included in formulations. In some embodiments, all, none or some of the inactive ingredients which may be used in the formulations of the present invention may be approved by the US Food and Drug Administration (FDA).

    [0395] In one embodiment, the AAV particle pharmaceutical compositions comprise at least one inactive ingredient such as, but not limited to, 1,2,6-Hexanetriol; 1,2-Dimyristoyl-Sn-Glycero-3-(Phospho-S-(1-Glycerol)); 1,2-Dimyristoyl-Sn-Glycero-3-Phosphocholine; 1,2-Dioleoyl-Sn-Glycero-3-Phosphocholine; 1,2-Dipalmitoyl-Sn-Glycero-3-(Phospho-Rac-(1-Glycerol)); 1,2-Distearoyl-Sn-Glycero-3-(Phospho-Rac-(1-Glycerol));1,2-Distearoyl-Sn-Glycero-3-Phosphocholine; 1-O-Tolylbiguanide, 2-Ethyl-1,6-Hexanediol, Acetic Acid; Acetic Acid, Glacial; Acetic Anhydride; Acetone; Acetone Sodium Bisuffile; Acetylated Lanolin Alcohols, Acetylated Monoglycerides; Acetylcysteine; Acetyltryptophan, DL-; Acrylates Copolymer; Acrylic Acid-Isooctyl Acrylate Copolymer; Acrylic Adhesive 788; Activated Charcoal; Adcote 72A103; Adhesive Tape; Adipic Acid; Aerotex Resin 3730; Alanine; Albumin Aggregated; Albumin Colloidal; Albumin Human; Alcohol; Alcohol, Dehydrated; Alcohol, Denatured; Alcohol, Diluted; Alfadex; Alginic Acid; Alkyl Ammonium Sulfonic Acid Betaine; Alkyl Aryl Sodium Sulfonate; Allantoin; Allyl Alpha-Ionone; Almond Oil; Alpha-Terpineol; Alpha-Tocopherol; Alpha-Tocopherol Acetate, Dl-; Alpha-Tocopherol, Dl-; Aluminum Acetate; Aluminum Chlorhydroxy Allantoinate; Aluminum Hydroxide; Aluminum Hydroxide-Sucrose, Hydrated; Aluminum Hydroxide Gel; Aluminum Hydroxide Gel F 500, Aluminum Hydroxide Gel F 5000; Aluminum Monostearate; Aluminum Oxide; Aluminum Polyester; Aluminum Silicate; Aluminum Starch Octenylsuccinate; Aluminum Stearate; Aluminum Subacetate; Aluminum Sulfate Anhydrous; Amerchol C; Amerchol-Cab; Aminomethylpropanol; Ammonia; Ammonia Solution; Ammonia Solution, Strong; Ammonium Acetate; Ammonium Hydroxide; Ammonium Laurel Sulfate; Ammonium Nonoxynol-4 Sulfate; Ammonium Salt Of C-12-C-15 Linear Primary Alcohol Ethoxylate; Ammonium Sulfate; Ammonyx; Amphoteric-2; Amphoteric-9; Anethole; Anhydrous Citric Acid; Anhydrous Dextrose; Anhydrous Lactose; Anhydrous Trisodium Citrate; Aniseed Oil; Anoxid Sbn; Antifoam; Antipyrine; Apaflurane; Apricot Kernel Oil Peg-6 Esters; Aquaphor; Arginine; Arlacel; Ascorbic Acid; Ascorbyl Palmitate; Aspartic Acid; Balsam Peru; Barium Sulfate; Beeswax; Beeswax, Synthetic; Beheneth-10; Bentonite; Benzalkonium Chloride; Benzenesulfonic Acid; Benzethonium Chloride; Benzododecinium Bromide; Benzoic Acid; Benzyl Alcohol; Benzyl Benzoate; Benzyl Chloride; Betadex; Bibapcitide; Bismuth Subgallate; Boric Acid; Brocrinal; Butane; Butyl Alcohol; Butyl Ester Of Vinyl Methyl Ether/Maleic Anhydride Copolymer (125000 Mw); Butyl Stearate; Bulylated Hydroxyanisole; Bulylated Hydroxytoluene; Butylene Glycol; Butylparaben; Butyric Acid; C20-40 Pareth-24; Caffeine; Calcium; Calcium Carbonate; Calcium Chloride; Calcium Gluceptate; Calcium Hydroxide; Calcium Lactate; Calcobutrol; Caldiamide Sodium; Caloxetate Trisodium; Calteridol Calcium; Canada Balsam; Caprylic/Capric Triglyceride; Caprylic/Capric/Stearic Triglyceride; Captan; Captisol; Caramel; Carbomer 1342; Carbomer 1382; Carbomer 934; Carbomer 934p; Carbomer 940; Carbomer 941; Carbomer 980; Carbomer 981; Carbomer Homopolymer Type B (Allyl Pentaerythritol Crosslinked); Carbomer Homopolymer Type C (Allyl Pentaerythritol Crosslinked); Carbon Dioxide; Carboxy Vinyl Copolymer; Carboxymeticellulose; Carboxymethylcellulose Sodium; Carboxypolymethylene; Carrageenan; Carrageenan Salt; Castor Oil; Cedar Leaf Oil; Cellulose; Cellulose. Microcrystalline; Cerasynt-Se; Ceresin; Ceteareth-12; Ceteareth-15; Ceteareth-30; Cetearyl Alcohol/Ceteareth-20; Cetearyl Ethylhexanoate; Ceteth-10; Ceteth-2; Ceteth-20 Ceteth-23; Cetostearyl Alcohol; Cetrimonium Chloride; Cetyl Alcohol; Cetyl Esters Wax; Cetyl Palmitate; Cetylpyridium Chloride; Chlorobutanol; Chlorobutanol Hemihydrate; Chlorobutanol, Anhydrous; Chlorocresol; Chloroxylenol; Cholesterol; Choleth; Choleth-24; Citrate; Citric Acid; Citric Acid Monohydrate; Citric Acid, Hydrous; Cocamide Ether Sulfate; Cocamine Oxide; Coco Betaine; Coco Diethanolamide; Coco Monoethanolamide; Cocoa Butter; Coco-Glycerides; Coconut Oil; Coconut Oil, Hydrogenated: Coconut Oil/Palm Kernel Oil Glycerides, Hydrogenated; Cocoyl Capry locaprate: Cola Nitida Seed Extract; Collagen; Coloring Suspension; Corn Oil; Cottonseed Oil; Cream Base; Creatine; Creatinine; Cresol; Croscarmellose Sodium; Crospovidone; Cupric Sulfate; Cupric Sulfate Anhydrous; Cyclomethicone; Cyclomethicone/Dimethicone Copolyol, Cysteine; Cysteine Hydrochloride; Cysteine Hydrochloride Anhydrous; Cysteine, Dl-; D&C Red No. 28; D&C Red No. 33; D&C Red No. 36; D&C Red No. 39; D&C Yellow No. 10; Dalfampridine; Daubert 1-5 Pestr (Matte) 164z; Decyl Methyl Sulfoxide; Dehydag Wax Sx: Dehydroacetic Acid; Dehymuls E; Denatonium Benzoate; Deoxycholic Acid; Dextran; Dextran 40; Dextrin; Dextrose; Dextrose Monohydrate; Dextrose Solution; Diatrizoic Acid; Diazolidinyl Urea; Dichlorobenzyl Alcohol; Dichlorodifluoromethane; Dichlorotetralluoroethane; Diethanolamine; Diethyl Pyrocarbonate; Diethyl Sebacate; Diethylene Glycol Monoethyl Ether; Diethylhexyl Phthalate; Dihydroxyaluminum Aminoacetate; Diisopropanolamine; Diisopropyl Adipate; Diisopropyl Dilinoleate; Dimethicone 350; Dimethicone Copolyol; Dimethicone Mdx4-4210; Dimethicone Medical Fluid 360; Dimethyl isosorbide; Dimethyl Sulfoxide; Dimethylaminoethyl Methacrylate-Butyl Methacrylate-Methyl Methacrylate Copolymer; Dimethyldioctadecylammonium Bentonite; Dimethylsiloxane/Methylvinylsiloxane Copolymer; Dinoseb Ammonium Salt; Dipalmitoylphosphatidylglycerol, Dl-; Dipropylene Glycol; Disodium Cocoamphodiacelate; Disodium Laureth Sulfosuccinate; Disodium Lauryl Sulfosuccinate; Disodium Sulfosalicylate; Disofenin; Divinylbenzene Styrene Copolymer; Dmdm Hydantoin; Docosanol; Docusate Sodium; Duro-Tak 280-2516; Duro-Tak 387-2516; Duro-Tak 80-1196; Duro-Tak 87-2070; Duro-Tak 87-2194; Duro-Tak 87-2287; Duro-Tak 87-2296; Duro-Tak 87-2888; Duro-Tak 87-2979; Edetate Calcium Disodium; Edetate Disodium; Edetate Disodium Anhydrous; Edetate Sodium; Edetic Acid; Egg Phospholipids; Entsufon; Entsufon Sodium; Epilactose; Epitetracycline Hydrochloride; Essence Bouquet 9200; Ethanolamine Hydrochloride; Ethyl Acetate; Ethyl Oleate; Ethylcelluloses, Ethylene Glycol; Ethylene Vinyl Acetate Copolymer; Ethylenediamine; Ethylenediamine Dihydrochloride; Ethylene-Propylene Copolymer; Ethylene-Vinyl Acetate Copolymer (28% Vinyl Acetate); Ethylene-Vinyl Acetate Copolymer (9% Vinylacetate); Ethylhexyl Hydroxystearate; Ethylparaben; Eucalyptol, Exametazine, Fat, Edible; Fat. Hard; Fatty Acid Esters; Fatty Acid Pentaerythriol Ester; Fatty Acids; Fatty Alcohol Citrate; Fatty Alcohols; Fd&C Blue No, 1; Fd&C Green No. 3; Fd&C Red No. 4; Fd&C Red No. 40; Fd&C Yellow No. 10 (Delisted); Fd&C Yellow No. 5; Fd&C Yellow No. 6; Ferric Chloride; Ferric Oxide; Flavor 89-186; Flavor 89-259; Flavor Df-119; Flavor Df-1530; Flavor Enhancer; Flavor FIG. 827118; Flavor Raspberry Pfc-8407; Flavor Rhodia Pharmaceutical No. Rf 451; Fluorochlorohydrocarbons; Formaldehyde; Formaldehyde Solution; Fractionated Coconut Oil; Fragrance 3949-5; Fragrance 520a; Fragrance 6.007; Fragrance 91-122; Fragrance 9128-Y; Fragrance 93498g; Fragrance Balsam Pine No. 5124; Fragrance Bouquet 10328; Fragrance Chemodem 6401-B; Fragrance Chemoderm 6411; Fragrance Cream No, 73457: Fragrance Cs-28197: Fragrance Felton 066m: Fragrance Firmenich 47373; Fragrance Givaudan Ess 9090/1c; Fragrance H-6540; Fragrance Herbal 10396; Fragrance Nj-1085; Fragrance P O Fl-147; Fragrance Pa 52805; Fragrance Pera Derm D; Fragrance Rhd-9819; Fragrance Shaw Mudge U-7776; Fragrance Tf 044078; Fragrance Ungerer Honeysuckle K 2771; Fragrance Lingerer N5195; Fructose; Gadolinium Oxide; Galactose; Gamma Cs clodextrin; Gelatin; Gelatin, Crosslinked; Gelfoam Sponge; Gellan Gum (Low Acyl); Gelva 737; Gentisic Acid; Gentisic Acid Ethanolamide; Gluceptate Sodium; Gluceptate Sodium Dihydrate; Gluconolactone: Glucuronic Acid; Glutamic Acid, Dl-; Glutathione; Glycerin; Glycerol Ester Of Hydrogenated Rosin; Glyceryl Citrate; Glyceryl Isostearate; Glyceryl Laurate; Glyceryl Monostearate; Glyceryl Oleate; Glyceryl Oleate/Propylene Glycol; Glyceryl Palmitate; Glyceryl Ricinoleate; Glyceryl Stearate; Glyceryl Stearate-Laureth-23; Glyceryl Stearate/Pep. Stearate; Glyceryl Stearate/Peg-100 Stearate; Glyceryl Stearate/Peg-40 Stearate; Glyceryl Stearate-Stearamidoethyl Diethylamine; Glyceryl Trioleate; Glycine; Glycine Hydrochloride Distearate; Glycol Stearate; Guanidine Hydrochloride; Guar Gum; Hair Conditioner (18n195-1m); Heptane; Hetastarch; Hexylene Glycol; High Density Polyethylene; Histidine; Human Albumin Microspheres; Hyaluronate Sodium; Hydrocarbon; Hydrocarbon Gel, Plasticized; Hydrochloric Acid; Hydrochloric Acid, Diluted; Hydrocortisone; Hydrogel Polymer; Hydrogen Peroxide; Hydrogenated Castor Oil; Hydrogenated Palm Oil; Hydrogenated Palm/Palm Kernel Oil Peg-6 Esters; Hydrogenated Polybutene 635-690; Hydroxide Ion; Hydroxyethyl Cellulose; Hydroxyethylpiperazine Ethane Sulfonic Acid; Hydroxymethyl Cellulose; Hydroxyoctacosanyl Hydroxystearate; Hydroxypropyl Cellulose; Hydroxypropyl Methylcellulose 2906; Hydroxypropyl-Beta-cyclodextrin; Hypromellose 2208 (15000 Mpa.S); Hypromellose 2910 (15000 Mpa.S); Hypromelloses; Imidurea; Iodine; Iodoxamic Acid; Iofetamine Hydrochloride; Irish Moss Extract; Isobutane; Isoceteth-20; Isoleucine; Isooctyl Acrylate; Isopropyl Alcohol; Isopropyl Isostearate; Isopropyl Myristate; Isopropyl Myristate Myristyl Alcohol; Isopropyl Palmitate; Isopropyl Stearate; Isostearic Acid; Isostearyl Alcohol; Isotonic Sodium Chloride Solution; Jelene; Kaolin; Kathon Cg; Kathon Cg II; Lactate; Lactic Acid; Lactic Acid, Dl-; Lactic Acid, L-; Lactobionic Acid; Lactose; Lactose Monohydrate; Lactose, Hydrous: Laneth; Lanolin; Lanolin Alcohol-Mineral Oil; Lanolin Alcohols; Lanolin Anhydrous: Lanolin Cholesterols; Lanolin Nonionic Derivatives; Lanolin, Ethoxylated; Lanolin, Hydrogenated; Lauralkonium Chloride; Lauramine Oxide; Laurdimonium Hydrolyzed Animal Collagen; Laureth Sulfate; Laureth-2; Laureth-23; Laureleth-4; Laurie Diethanolamide; Laurie Myristic Diethanolamide; Lauroyl Sarcosine; Lauryl Lactate; Lauryl Sulfate; Larandula Angustifolia Flowering Top; Lecithin; Lecithin Unbleached; Lecithin, Egg; Lecithin, Hydrogenated; Lecithin, Hydrogenated Soy; Lecithin, Soybean; Lemon Oil: Leucine: Levulinic Acid; Lidofenin; Light Mineral Oil; Light Mineral Oil (85 Ssu); Limonene, (+/); Lipocol Sc-15; Lysine; Lysine Acetate; Lysine Monohydrate: Magnesium Aluminum Silicate: Magnesium Aluminum Silicate Hydrate; Magnesium Chloride; Magnesium Nitrate; Magnesium Stearate; Maleic Acid: Mannitol; Maprofix; Mebrofenin; Medical Adhesive Modified S-15; Medical Antiform A-F Emulsion; Medronate Disodium; Medronic Acid; Meglumine; Menthol; Metacresol; Metaphosphoric Acid; Methartesulfonic Acid: Methionine; Methyl Alcohol; Methyl Gluceth-10; Methyl Gluceth-20; Methyl Gluceth-20 Sesquistearate; Methyl Glucose Sesquistearate; Methyl Laurate; Methyl Pyrrolidone; Methyl Salicylate; Methyl Stearate; Methylboronic Acid; Methylcellulose (4000 Mpa.S); Methyl celluloses; Methyldiloroisothiazolinorte; Methylene Blue: Methylisothiazolinone; Methylparaben; Microcrystalline Wax: Mineral Oil; Mono and Diglyceride; Monostearyl Citrate; Monothioglycerol; Multisterol Extract; Myristyl Alcohol; Myristyl Lactate; Myristyl-.Gamma.-Picolinium Chloride; N-(Carbarnoyl-Methoxy Peg-40)-1,2-Distearoyl-Cephalin Sodium; N,N-Dimethylacetamide; Niacinamide: Nioxime; Nitric Acid; Nitrogen; Nonoxynol Iodine; Nonoxynol-15; Nonoxvnol-9; Norflurane: Oatmeal: Octadecene-1/Maleic Acid Copolymer; Octanoic Acid; Octisalate; Octoxynol-1; Octoxynol-40; Octoxynol-9; Octyldodecanol; Octylphenol Poly-methylene; Oleic Acid; Oleth-10/Oleth-5; Oleth-2; Oleth-20; Oleyl Alcohol; Oleyl Oleate; Olive Oil; Oxidronate Disodium; Oxoquinoline; Palm Kernel Oil; Palmitamine Oxide; Parabens; Paraffin; Paraffin, White Soft; Parfum Creme 45/3; Peanut Oil; Peanut Oil, Refined; Pectin; Peg 6-32 Stearate/Glycol Stearate; Peg Vegetable Oil; Peg-100 Stearate; Peg-12 Glyceryl Laurate; Peg-120 Glyceryl Stearate; Peg-120 Methyl Glucose Dioleate; Peg-15 Cocamine; Peg-150 Distearate; Peg-2 Stearate; Peg-20 Sorbitan Isostearate; Peg-22 Methyl Ether/Dodecyl Glycol Copolymer; Peg-25 Propylene Glycol Stearate; Peg-4 Dilaurate; Pea-4 Laurate; Peg-40 Castor Oil; Peg-40 Sorbitan Diisostearate; Peg-45/Dodecyl Glycol Copolymer; Peg-5 Oleate; Peg-50 Stearate; Peg-54 Hydrogenated Castor Oil: Peg-6 Esostearate; Peg-60 Castor Oil; Peg-60 Hydrogenated Castor Oil; Peg-7 Methyl Ether; Peg-75 Lanolin; Peg-8 Laurate; Peg-8 Stearate; Pegoxol 7 Stearate; Pentadecalactone; Pentaerythritol Cocoate; Pentasodium Pentetate; Pentetate Calcium Trisodium; Pentetic Acid; Peppermint Oil; Perflutren; Perfume 25677: Perfume Bouquet; Perfume E-1991; Perfume Gd 5604; Perfume Tana 90/42 Scba; Perfume W-1952-1; Petrolatum; Petrolatum; White; Petroleum Distillates; Phenol; Phenol, Liquefied; Phenonip; Phenoxyethanol; Phenylalanine; Phenylethyl Alcohol; Phenylmercuric Acetate; Phenylinercuric Nitrate; Phosphatidyl Glycerol, Egg; Phospholipid; Phospholipid, Egg; Phospholipon 90 g; Phosphoric Acid; Pine Needle Oil (Pinus Sylvestris); Piperazine Hexahydrate; Plastibase-50w; Polacrilin; Polidronium Chloride, Poloxamer 124; Poloxamer 181, Poloxamer 182; Poloxamer 188; Poloxamer 237; Poloxamer 407; Poly(Bis(P-Carboxyphenoxy)Propane Anhydride): Sebacic Acid; Poly(Dimethylsiloxane/Methylvinylsiloxane/Methylhydrogensiloxane) Dimethylvinyl Or Dimethylhydroxy Or Trimethyl Endblocked; Poly(Dl-Lactic-Co-Glycolic Acid), (50:50; Poly(Dl-Lactic-Co-Glycolic Acid), Ethyl Ester Terminated, (50:50; Polyacrylic Acid (250000 Mw); Polybutene (1400 Mw); Polycarbophil; Polyester; Polyester Poly amine Copolymer; Polyester Rayon, Polyethylene Glycol 1000; Polyethylene Glycol 1450; Polyethylene Glycol 1500; Polyethylene Glycol 1540; Polyethylene Glycol 200; Polyethylene Glycol 300; Polyethylene Glycol 300-1600; Polyethylene Glycol 3350; Polyethylene Glycol 400; Polyethylene Glycol 4000; Polyethylene Glycol 540; Polyethylene Glycol 600; Polyethylene Glycol 6000, Polyethylene Glycol 8000; Polyethylene Glycol 900; Polyethylene High Density Containing Ferric Oxide Black (<1%); Polyethylene Low Density Containing Barium Sulfate (20-24%); Polyethylene T; Polyethylene Terephthalate.; Polygla.ctin; Polyglyceryl-3 Oleate; Polyglyceryl-4 Oleate; Polyhydroxyethyl Methacrylate: Polyisobutylene; Polyisobutylene (1100000 Mw); Polyisobutylene (35000 Mw); Polyisobutylene 178-236; Polyisobutylene 241-294; Polyisobutylene 35-39; Polyisobutylene Low Molecular Weight; Polyisobutylene Medium Molecular Weight; Polyisobutylene/Polybutene Adhesive; Polylactide: Polyols; Polyoxyethylene-Polyoxypropylene 1800; Polyoxyethylene Alcohols; Polyoxyethylene Fatty Acid Esters; Polyoxyethylene Propylene; Polyoxyl 20 Cetostearyl Ether; Polyoxyl 35 Castor Oil; Polyoxyl 40 Hydrogenated Castor Oil; Polyoxyl 40 Stearate; Polyoxyl 400 Stearate; Polyoxyl 6 And Polyoxyl 32 Palmitostearate; Polyoxyl Distearate; Polyoxyl Glyceryl Stearate, Polyoxyl Lanolin; Polyoxyl Palmitate; Polyoxyl Stearate; Polypropylene; Polypropylene Glycol; Polyquatemium-10; Polyquaternium-7 (70/30 Acrylamide/Dadinac; Polysiloxane; Polysorbate 20; Polysorbate 40; Polysorbate 60; Polysorbate 65; Polysorbate 80; Polyurethane; Polyvinyl Acetate; Polyvinyl Alcohol; Polyvinyl Chloride; Polyvinyl Chloride-Polyvinyl Acetate Copolymer; Polyvinylpyridine; Poppy Seed Oil; Potash; Potassium Acetate; Potassium Alum; Potassium Bicarbonate; Potassium Bisulfite; Potassium Chloride; Potassium Citrate; Potassium Hydroxide; Potassium Metabisulfite; Potassium Phosphate Dibasic; Potassium Phosphate, Monobasic; Potassium Soap; Potassium Sorbate; Povidone Acrylate Copolymer; Povidone Hydrogel; Povidone K17; Povidone K25; Povidone 1 29/32; Povidone K30; Povidone K90; Povidone K90f, Povidone/Eicosene Copolyriter Povidones; Ppg-12/Smdi Copolymer; Ppg-15 Stearyl Ether; Ppg-20 Methyl Glucose Ether Distearate; Ppg-26 Oleate; Product Wat; Proline; Promulgen D; Promulgen G; Propane; Propellant A-46; Propyl Propylene Carbonate; Propylene Glycol; Propylene Glycol Diacetate; Propylene Glycol Dicaprylate; Propylene Glycol Monolaurate; Propylene Glycol Monopalmitostearate; Propylene Glycol Palmitostearate; Propylene Glycol Ricinoleate; Propylene Cilycol/Diazolidinyl Urea/Methylparaben/Propylparben; Propylparaben; Protamine Sulfate; Protein Hydrolysate; Pvm/Ma Copolymer: Quaternium-15: Quaternium-15 Cis-Form: Quaternium-52: Ra-2397; Ra-3011; Saccharin; Saccharin Sodium; Saccharin Sodium Anhydrous; Safflower Oil; Sd Alcohol 3a; Sd Alcohol 40; Sd Alcohol 40-2; Sd Alcohol 40b; Sepineo P 600: Serine; Sesame Oil; Shea Butter; Silastic Brand Medical Grade Tubing; Silastic Medical AdhesiveSilicone, Type A; Silica, Dental; Silicon; Silicon Dioxide; Silicon Dioxide, Colloidal; Silicone; Silicone Adhesive 4102; Silicone Adhesive 4502; Silicone Adhesive Bio-Psa Q7-4201; Silicone Adhesive Bio-Psa 4301; Silicone Emulsion; Silicone/Polyester Film Strip; Simethicone; Simethicone Emulsion; Sipon Ls 20np; Soda Ash: Sodium Acetate; Sodium Acetate Anhydrous; Sodium Alkyl Sulfate; Sodium Ascorbate; Sodium Benzoate; Sodium Bicarbonate; Sodium Bisulfate; Sodium Bisulfite; Sodium Borate; Sodium Borate Decahydrate; Sodium Carbonate; Sodium Carbonate Decahydrate; Sodium Carbonate Monohydrate; Sodium Cetostearyl Sulfate; Sodium Chlorate; Sodium Chloride; Sodium Chloride Injection; Sodium Chloride Injection, Bacteriostatic; Sodium Cholesteryl Sulfate; Sodium Citrate; Sodium Cocoyl Sarcosinate; Sodium Desoxycholate; Sodium Dithionite; Sodium Dodecylbenzenesulfonate; Sodium Formaldehyde Sulfoxylate; Sodium Gluconate; Sodium Hydroxide; Sodium Hypochlorite; Sodium iodide; Sodium Lactate; Sodium Lactate, L-; Sodium Laureth-2 Sulfate; Sodium Laureth-3 Sulfate; Sodium Laureth-5 Sulfate; Sodium Lauroyl Sarcosinate; Sodium Laurel Sulfate; Sodium Lauryl Sulfoacetate; Sodium Metabisulfite; Sodium Nitrate; Sodium Phosphate; Sodium Phosphate Dihydrate; Sodium Phosphate, Dibasic; Sodium Phosphate, Dibasic, Anhydrous; Sodium Phosphate, Dibasic, Dihydrate; Sodium Phosphate, Dibasic, Dodecahydrate; Sodium Phosphate, Dibasic, Heptahydrate; Sodium Phosphate, Mollobasic; Sodium Phosphate, Monobasic, Anhydrous; Sodium Phosphate, Monobasic, Dihydrate; Sodium Phosphate, Monobasic, Monohydrate; Sodium Poly acrylate (2500000 Mw); Sodium Pyrophosphate; Sodium Pyrrolidone Carboxylate; Sodium Starch Glycolate; Sodium Succinate Hexahydrate; Sodium Sulfate; Sodium Sulfate Anhydrous; Sodium Sulfate Decahydrate; Sodium Sulfite; Sodium Sulfosuccinated Undecyclenic Monoalkylolamide; Sodium Tartrate; Sodium Thioglycolate; Sodium Thiomalate; Sodium Thiosulfate; Sodium Thiosulfate Anhydrous; Sodium Trimetaphosphate; Sodium Xylenesulfonate; Somay 44; Sorbic Acid; Sorbitan; Sorbitan Isostearate; Sorbitan Monolaurate; Sorbitan Monooleate; Sorbitan Monopalmitate; Sorbitan Monostearate; Sorbitan Sesquioleate; Sorbitan Trioleate; Sorbitan Tristearate; Sorbitol; Sorbitol Solution; Soybean Flour; Soybean Oil; Spearmint Oil; Spermaceti; Squalane; Stabilized Oxychloro Complex; Stannous 2-Ethylhexanoate; Stannous Chloride; Stannous Chloride Anhydrous; Stannous Fluoride; Stannous Tartrate, Starch; Starch 1500, Pregelatinized; Starch, Corn; Stearalkonium Chloride; Stearalkonium Hectorite/Propylene Carbonate; Stearamidoethyl Diethylamine; Steareth-10; Steareth-100; Steareth-2: Steareth-20; Steareth-21; Steareth-40; Stearic Acid; Stearic Diethanolamide; Stearoxytrimethylsilane; Steartrimonium Hydrolyzed Animal Collagen; Stearyl Alcohol; Sterile Water For Inhalation; Styrene/Isoprene/Styrene Block Copolymer; Succimer; Succinic Acid; Sucralose; Sucrose; Sucrose Distearate; Sucrose Polyesters; Sulfacetamide Sodium; Sulfobutylether .Beta.-Cyclodextrin; Sulfur Dioxide; Sulfuric Acid; Sulfurous Acid; Surfactol Qs; Tagatose, D-; Talc; Tall Oil; Tallow Glycerides; Tartaric Acid; Tartaric Acid, Dl-; Tenox; Tenox-2; Tert-Butyl Alcohol; Hydroperoxide; Tert-Butylhydroquinone; Tetrakis(2-Methoxyisobutylisocyanide)Copper(I) Tetrafluoroborate; Tetrapropyl Orthosilicate; Tetrofosmin; Theophylline; Thimerosal; Threonine; Thymol; Tin; Titanium Dioxide; Tocopherol; Tocophersolan; Total parenteral nutrition, lipid emulsion; Triacetin; Tricaprylin; Trichloromonofluoromethane; Trideceth-10; Triethanolamine Lauryl Sulfate; Trifluoroacetic Acid; Triglycerides, Medium Chain; Trihydroxystearin; Trilaneth-4 Phosphate; Trilaureth-4 Phosphate; Trisodium Citrate Dihydrate; Trisodium Hedta; Triton 720; Triton X-200; Trolamine; Tromantadine; Tromethamine (TRIS); Tryptophan; Tyloxapol; Tyrosine; Undecylenic Acid; Union 76 Amsco-Res 6038; Urea; Valine; Vegetable Oil; Vegetable Oil Glyceride, Hydrogenated; Vegetable Oil, Hydrogenated; Versetamide; Viscarin; Viscose/Cotton; Vitamin 1E; Wax, Emulsifying; Wecohee Fs; White Ceresin Wax; White Wax; Xanthan Gum; Zinc; Zinc Acetate; Zinc Carbonate; Zinc Chloride; and Zinc Oxide.

    [0396] Pharmaceutical composition formulations of AAV particles disclosed herein may include cations or anions. In one embodiment, the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mn2+, Mg+ and combinations thereof. As a non-limiting example, formulations may include polymers and complexes with a metal cation (See e.g., U.S. Pat. Nos. 6,265,389 and 6,555,525, each of which is herein incorporated by reference in its entirety).

    [0397] Formulations of the invention may also include one or more pharmaceutically acceptable salts. As used herein, pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alcanate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentariepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, giycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.

    [0398] Solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF) N,N-dimethylacetamide (DMAC),1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a hydrate.

    III. ADMINISTRATION AND DOSING

    Administration

    [0399] The AAV particles of the present invention may be administered by any delivery route which results in a therapeutically effective outcome. These include, but are not limited to, enteral (into the intestine), gastroenteral, epidural (into the dura mater), oral (by way of the mouth), transdermal, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intra-arterial (into an artery), intramuscular (into a muscle) intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraparenchymal (into brain tissue), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, installation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), or in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-articular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracistemal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracoronal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intramyocardial (within the myocardium), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratumor (within a tumor), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration which is then covered by a dressing which occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis and spinal.

    [0400] In some embodiments, compositions may he administered in a way which allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier. The AAV particles of the present invention may he administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution. The AAV particles may be formulated with any appropriate and pharmaceutically acceptable excipient.

    [0401] In one embodiment, the AAV particles of the present invention may be delivered to a subject via a single route administration.

    [0402] In one embodiment, the AAV particles of the present invention may be delivered to a subject via a multi-site route of administration. A subject may be administered at 2, 3, 4, 5 or more than 5 sites.

    [0403] In one embodiment, a subject may he administered the AAV particles of the present invention using a bolus infusion.

    [0404] In one embodiment, a subject may be administered the AAV particles of the present invention using sustained delivery over a period of minutes, hours or days. The infusion rate may be changed depending on the subject, distribution, formulation or another delivery parameter.

    [0405] In one embodiment, the AAV particles of the present invention may he delivered by intramuscular delivery route. (See, e.g., U.S. Pat. No. 6,506,379; the content of which is incorporated herein by reference in its entirety). Non-limiting examples of intramuscular administration include an intravenous injection or a subcutaneous injection.

    [0406] In one embodiment, the AAV particles of the present invention may be delivered by oral administration. Non-limiting examples of oral administration include a digestive tract administration and a buccal administration.

    [0407] In one embodiment, the AAV particles of the present invention may be delivered by intraocular delivery route. A non-limiting example of intraocular administration include an intravitreal injection.

    [0408] In one embodiment, the AAV particles of the present invention may be delivered by intranasal delivery route. Non-limiting examples of intranasal delivery include administration of nasal drops or nasal sprays.

    [0409] In some embodiments, the AAV particles that may be administered to a subject by peripheral injections. Non-limiting examples of peripheral injections include intraperitoneal, intramuscular, intravenous, conjunctival or joint injection. It was disclosed in the art that the peripheral administration of AAV vectors can be transported to the central nervous system, for example, to the motor neurons (e.g., U. S. Patent Publication Nos. 20100240739; and 20100130594; the content of each of which is incorporated herein by reference in their entirety).

    [0410] In one embodiment, the AAV particles may be delivered by injection into the CSF pathway. Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventricular administration.

    [0411] In one embodiment, the AAV particles may be delivered by systemic delivery. As a non-limiting example, the systemic delivery may be by intravascular administration.

    [0412] In one embodiment, the AAV particles of the present invention may be administered to a subject by intracranial delivery (See, e.g., U.S. Pat. No. 8,119,611; the content of which is incorporated herein by reference in its entirety).

    [0413] In one embodiment, the AAV particles of the present invention may be administered to a subject by intraparenchymal administration.

    [0414] In one embodiment, the AAV particles of the present invention may be administered to a subject by intramuscular administration.

    [0415] In one embodiment, the AAV particles of the present invention are administered to a subject and transduce muscle of a subject. As a non-limiting example, the AAV particles are administered by intramuscular administration.

    [0416] In one embodiment, the AAV particles of the present invention may be administered to a subject by intravenous administration.

    [0417] In one embodiment, the AAV particles of the present invention may be administered to a subject by subcutaneous administration.

    [0418] In one embodiment, the AAV particles of the present invention may be administered to a subject by topical administration.

    [0419] In one embodiment, the AAV particles may be delivered by direct injection into the brain. As a non-limiting example, the brain delivery may be by intrastriatal administration.

    [0420] In one embodiment, the AAV particles may be delivered by more than one route of administration. As non-limiting examples of combination administrations. AAV particles may be delivered by intrathecal and intracerebroventricular, or by intravenous and intraparenchymal administration.

    Parenteral and Injectable Administration

    [0421] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered parenterally. Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemuisions, solutions, suspensions, syrups, and/or elixirs. In addition to active ingredients, liquid dosage forms may comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycal, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofarfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents. In certain embodiments for parenteral administration, compositions are mixed with solubilizing agents such as CREMOPHOR, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof. In other embodiments, surfactants are included such as hydroxypropylcellulose.

    [0422] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and/or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and/or emulsions in nontoxic parenterally acceptable diluents and/or solvents, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water. Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

    [0423] Injectable formulations may be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

    [0424] In order to prolong the effect of active ingredients, it is often desirable to slow the absorption of active ingredients from subcutaneous or intramuscular injections. This may be accomplished by the use of liquid suspensions of crystalline or amorphous material with poor water solubility. The rate of absorption of active ingredients depends upon the rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle injectable depot forms are made by forming nucroencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglcolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodeuadable polymers include poly(orthoesters) and poly (anhydrides). Depot injectable formulations are prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.

    Rectal and Vaginal Administration

    [0425] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered rectally and/or vaginally. Compositions for rectal or vaginal administration are typically suppositories which can be prepared by mixing compositions with suitable non-irritating excipients such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature hut liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active ingredient.

    Oral Administration

    [0426] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may he administered orally. Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, an active ingredient is mixed with at least one inert, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and/or fillers or extenders (e.g. starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders (e.g. carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g. glycerol), disintegrating agents (e.g. agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate), solution retarding agents (e.g. paraffin), absorption accelerators (e.g. quaternary ammonium compounds), wetting agents (e.g. cetyl alcohol and glycerol monostearate), absorbents (e.g. kaolin and bentonite clay), and lubricants (e.g. talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may comprise buffering agents.

    Topical or Transdermal Administration

    [0427] As described herein, pharmaceutical compositions, AAV particles of the present invention may be formulated for administration topically. The skin may be an ideal target site for delivery as it is readily accessible. Three routes are commonly considered to deliver pharmaceutical compositions, AAV particles of the present invention to the skin: (i) topical application (e.g. for local/regional treatment and/or cosmetic applications); (ii) intradermal injection (e.g. for local/regional treatment and/or cosmetic applications); and (iii) systemic delivery (e.g. for treatment of dermatologic diseases that affect both cutaneous and extracutaneous regions). Pharmaceutical compositions, AAV particles of the present invention can be delivered to the skin by several different approaches known in the art.

    [0428] In some embodiments, the invention provides for a variety of dressings wound dressings) or bandages (e.g., adhesive bandages) for conveniently and/or effectively carrying out methods of the present invention. Typically dressing or bandages may comprise sufficient amounts of pharmaceutical compositions, AAV particles of the present invention described herein to allow users to perform multiple treatments.

    [0429] Dosage forms for topical and/or transdermal administration may include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and/or patches. Generally, active ingredients are admixed under sterile conditions with pharmaceutically acceptable excipients and/or any needed preservatives and/or buffers. Additionally, the present invention contemplates the use of transdermal patches, which often have the added advantage of providing controlled delivery of pharmaceutical compositions, AAV particles of the present invention to the body. Such dosage forms may be prepared, for example, by dissolving and/or dispensing pharmaceutical compositions, AAV particles in the proper medium. Alternatively, or additionally, rates may be controlled by either providing rate controlling membranes and/or by dispersing pharmaceutical compositions, AAV particles in a polymer matrix and/or gel.

    [0430] Formulations suitable for topical administration include, but are not limited to, liquid and/or semi liquid preparations such as liniments, lotions, oil in water and/or water in oil emulsions such as creams, ointments and/or pastes, and/or solutions and/or suspensions.

    [0431] Topically-administrable formulations may, for example, comprise from about 1% to about 10% (v/w) active ingredient, although the concentration of active ingredient may he as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further comprise one or more of the additional ingredients described herein.

    Depot Administration

    [0432] As described herein, in some embodiments, pharmaceutical compositions, AAV particles of the present invention are formulated in depots for extended release. Generally, specific organs or tissues (target tissues) are targeted for administration.

    [0433] In some aspects of the invention, pharmaceutical compositions, AAV particles of the present invention are spatially retained within or proximal to target tissues. Provided are methods of providing pharmaceutical compositions, AAV particles, to target tissues of mammalian subjects by contacting target tissues (which comprise one or more target cells) with pharmaceutical compositions, AAV particles, under conditions such that they are substantially retained in target tissues, meaning that at least 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or greater than 99.99% of the composition is retained in the target tissues. Advantageously, retention is determined by measuring the amount of pharmaceutical compositions, AAV particles, that enter one or more target cells. For example, at least 1%, 5%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 89%, 85%, 90%. 95%, 96%, 97%, 98%. 99%, 99.9%, 99.99% or greater than 99.99% of pharmaceutical compositions, AAV particles, administered to subjects are present intraceilularly at a period of time following administration. For example, intramuscular injection to mammalian subjects may be performed using aqueous compositions comprising pharmaceutical compositions, AAV particles of the present invention and one or more transfection reagents, and retention is determined by measuring the amount of pharmaceutical compositions, AAV particles, present in muscle cells.

    [0434] Certain aspects of the invention are directed to methods of providing pharmaceutical compositions, AAV particles of the present invention to a target tissues of mammalian subjects, by contacting target tissues (comprising one or more target cells) with pharmaceutical compositions, AAV particles under conditions such that they are substantially retained in such target tissues. Pharmaceutical compositions. AAV particles comprise enough active ingredient such that the effect of interest is produced in at least one target cell. In some embodiments, pharmaceutical compositions, AAV particles generally comprise one or more cell penetration agents, although naked formulations (such as without cell penetration agents or other agents) are also contemplated, with or without pharmaceutically acceptable carriers.

    Pulmonary Administration

    [0435] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be prepared, packaged, and/or sold in formulations suitable for pulmonary administration. In some embodiments, such administration is via the buccal cavity. In some embodiments, formulations may comprise dry particles comprising active ingredients. In such embodiments, dry particles may have a diameter in the range from about 0.5 nm to about 7 nm or from about 1 nm to about 6 nm. In some embodiments, formulations may be in the form of dry powders for administration using devices comprising, dry powder reservoirs to which streams of propellant may be directed to disperse such powder. In some embodiments, self-propelling solvent/powder dispensing containers may be used. In such embodiments, active ingredients may be dissolved and/or suspended in low-boiling propellant in sealed containers. Such powders may comprise particles wherein at least 98% of the particles by weight have diameters greater than 0.5 nm and at least 95% of the particles by number have diameters less than 7 nm. Alternatively, at least 95% of the particles by weight have a diameter greater than nm and at least 90% of the particles by number have a diameter less than 6 nm. Dry powder compositions may include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.

    [0436] Low boiling propellants generally include liquid propellants having a boiling point of below 65 at atmospheric pressure. Generally, propellants may constitute 50% to 99.9% (w/w) of the composition, and active ingredient may constitute 0.1% to 20% (w/w) of the composition. Propellants may further comprise additional ingredients such as liquid non-ionic and/or solid anionic surfactant and/or solid diluent (which may have particle sizes of the same order as particles comprising active ingredients).

    [0437] Pharmaceutical compositions formulated for pulmonary delivery may provide active ingredients in the form of droplets of solution and/or suspension. Such formulations may be prepared, packaged, and/or sold as aqueous and/or dilute alcoholic solutions and/or suspensions, optionally sterile, comprising active ingredients, and may conveniently be administered using any nebulization and/or atomization device. Such formulations may further comprise one or more additional ingredients including, but not limited to a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, and/or a preservative such as methylhydroxy benzoate. Droplets provided by this route of administration may have an average diameter in the range from about 0.1 nm to about 200 nm.

    Intranasal, Nasal and Buccal Administration

    [0438] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be administered nasally and/or intranasal. In some embodiments, formulations described herein useful for pulmonary delivery may also be useful for intranasal delivery. In some embodiments, formulations for intranasal administration comprise a coarse powder comprising the active ingredient and having an average particle from about 0.2 m to 500 m. Such formulations are administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nose.

    [0439] Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w/w) and as much as 100% (w/w) of active ingredient, and may comprise one or more of the additional ingredients described herein. A pharmaceutical composition may be prepared, packaged, and/or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets and/or lozenges made using conventional methods, and may, for example, 0.1% to 20% (w/w) active ingredient, the balance comprising an orally dissolvable and/or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise powders and/or an aerosolized and/or atomized solutions and/or suspensions comprising active ingredients. Such powdered, aerosolized, and/or aerosolized formulations, when dispersed, may comprise average particle and/or droplet sizes in the range of from about 0.1 nm to about 200 nm, and may further comprise one or more of any additional ingredients described herein.

    Ophthalmic or Otic Administration

    [0440] In some embodiments, pharmaceutical compositions, AAV particles of the present invention may be prepared, packaged, and/or sold in formulations suitable for ophthalmic and/or otic administration. Such formulations may, for example, be in the form of eye and/or ear drops including, for example, a 0.1/1.0% (w/w) solution and/or suspension of the active ingredient in aqueous and/or oily liquid excipients. Such drops may further comprise buffering agents, salts, and/or one or more other of any additional ingredients described herein. Other ophthalmically-administrable formulations which are useful include those which comprise active ingredients in microcrystalline form and/or in liposomal preparations. Subretinal inserts may also be used as forms of administration.

    Delivery

    [0441] In one embodiment, the AAV particles or pharmaceutical compositions of the present invention may be administered or delivered using the methods for treatment of disease described in U.S. Pa. No. 8,999,948, or International Publication No. WO2014178863, the contents of which are herein incorporated by reference in their entirety.

    [0442] In one embodiment, the AAV particles or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering gene therapy in Alzheimer's Disease or other neurodegenerative conditions as described in US Application No. 20150126590, the contents of which are herein incorporated by reference in their entirety.

    [0443] In one embodiment, the AAV particles or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivery of a CNS gene therapy as described in U.S. Pat. Nos. 6,436,708, and 8,946,152, and International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety.

    [0444] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering proteins using AAV vectors described in European Patent Application No. EP2678433, the contents of which are herein incorporated by reference in their entirety.

    [0445] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering DNA to the bloodstream described in U.S. Pat. No. 6,211,163, the contents of which are herein incorporated by reference in their entirety.

    [0446] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering a payload to the central nervous system described in U.S. Pat. No. 7,588,757, the contents of which are herein incorporated by reference in their entirety.

    [0447] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may he administered or delivered using the methods for delivering a payload described in U.S. Pat. No. 8,283,151 the contents of which are herein incorporated by reference in their entirety.

    [0448] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may be administered or delivered using the methods for delivering a payload using a glutamic acid decarboxylase (GAD) delivery vector described in International Patent Publication No. WO2001089583, the contents of which are herein incorporated by reference in their entirety.

    [0449] In one embodiment, the AAV particle or pharmaceutical compositions of the present invention may he administered or delivered using the methods for delivering a payload to neural cells described in International Patent Publication No. WO2012057363, the contents of which are herein incorporated by reference in their entirety.

    Delivery to Cells

    [0450] The present disclosure provides a method of delivering to a cell or tissue any of the above-described AAV particles, comprising contacting the cell or tissue with said AAV particle or contacting the cell or tissue with a formulation comprising said AAV particle, or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions. The method of delivering the AAV particle to a cell or tissue can he accomplished in vitro, ex vivo, or in vivo.

    Delivery to Subjects

    [0451] The present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described AAV particles comprising administering to the subject said AAV particle, or administering to the subject a formulation comprising said AAV particle, or administering to the subject any of the described compositions, including pharmaceutical compositions.

    Dose and Regimen

    [0452] The present invention provides methods of administering AAV particles in accordance with the invention to a subject in need thereof. The pharmaceutical, diagnostic, or prophylactic AAV particles and compositions of the present invention may be administered to a subject using any amount and any route of administration effective for preventing, treating, managing, or diagnosing diseases, disorders and/or conditions. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The subject may be a human, a mammal, or an animal. Compositions in accordance with the invention are typically formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate diagnostic dose level for any particular individual will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific payload employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific AAV particle employed; the duration of the treatment; drugs used in combination or coincidental with the specific AAV particle employed, and like factors well known in the medical arts.

    [0453] In certain embodiments, AAV particle pharmaceutical compositions in accordance with the present invention may be administered at dosage levels sufficient to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about 0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about 005 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about 0.05 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic, diagnostic, or prophylactic, effect. It will be understood that the above dosing concentrations may be converted to vg or viral genomes per kg or into total viral genomes administered by one of skill in the art.

    [0454] In certain embodiments, AAV particle pharmaceutical compositions in accordance with the present disclosure may be administered at about 10 to about 600 l/site, 50 to about 500 l/site, 100 to about 400 l/site, 120 to about 300 l/site, 140 to about 200 l/site, about 160 l/site. As non-limiting examples, AAV particles be administered at 50 l/site and/or 150 l/site.

    [0455] The desired dosage of the AAV particles of the present invention may be delivered only once, three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may he delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a split dose is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a single unit dose is a dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event.

    [0456] The desired dosage of the AAV particles of the present invention may be administered as a pulse dose or as a continuous flow. As used herein, a pulse dose is a series of single unit doses of any therapeutic administered with a set frequency over a period of time. As used herein, a. continuous flow is a dose of therapeutic administered continuously for a period of time in a single route/single point of contact, i.e., continuous administration event. A total daily dose, an amount given or prescribed in 24 hour period, may be administered by any of these methods, or as a combination of these methods, or by any other methods suitable for a pharmaceutical administration.

    [0457] In one embodiment, delivery of the AAV particles of the present invention to a subject provides neutralizing activity to a subject. The neutralizing activity can be for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years.

    [0458] In one embodiment delivery of the AAV particles of the present invention results in minimal serious adverse events (SAEs) as a result of the delivery of the AAV particles.

    [0459] In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) may comprise a total dose between about 110.sup.6 VG and about 110.sup.16 VG. In some embodiments, delivery may comprise a total dose of about 110.sup.6, 210.sup.6, 310.sup.6, 410.sup.6, 510.sup.6, 610.sup.6, 710.sup.6, 810.sup.6, 910.sup.6, 110.sup.7, 210.sup.7, 310.sup.7, 410.sup.7, 510.sup.7, 610.sup.7, 710.sup.7, 810.sup.7, 910.sup.7, 110.sup.8, 210.sup.8, 310.sup.8, 410.sup.8, 510.sup.8, 610.sup.8, 710 .sup.8, 810.sup.8, 910.sup.8, 110.sup.9, 210.sup.9, 310.sup.9, 410.sup.9, 510.sup.9, 610.sup.9, 710.sup.9, 810.sup.9, 910.sup.9, 110.sup.10, 1.910.sup.10, 210.sup.10, 310.sup.10, 3.3710.sup.10, 410.sup.10, 510.sup.10, 610.sup.10, 710.sup.10, 810.sup.10, 910.sup.10, 110.sup.11, 210.sup.11, 2.510.sup.11, 310.sup.11, 410.sup.11, 510.sup.11, 610.sup.11, 710.sup.11, 810.sup.11, 910.sup.11, 110.sup.12, 210.sup.12, 310.sup.12, 410.sup.12, 510.sup.12, 610.sup.12, 710.sup.12, 810.sup.12, 910.sup.12, 110.sup.13, 210.sup.13, 310.sup.13, 410.sup.13, 510.sup.13, 610.sup.13, 710.sup.13, 810.sup.13, 910.sup.13, 110.sup.14, 210.sup.14, 310.sup.14, 410.sup.14, 510.sup.14, 610.sup.14, 710.sup.14, 810.sup.14, 910.sup.14, 110.sup.15, 210.sup.15, 310.sup.15, 410.sup.14, 510.sup.14, 610.sup.15, 710.sup.15, 810.sup.15, 910.sup.15, or 110.sup.16 VG. As anon-limiting example, the total dose is 110.sup.13 VG. As another non-limiting example, the total dose is 2.110.sup.12 VG.

    [0460] In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) may comprise a composition concentration between about 110.sup.6 VG/mL and about 110.sup.16 VG mL. In some embodiments, delivery may comprise a composition concentration of about 110.sup.6, 210.sup.6, 310.sup.6, 410.sup.6, 510.sup.6, 610.sup.6, 710.sup.6, 810.sup.6, 910.sup.6, 110.sup.7, 210.sup.7, 310.sup.7, 410.sup.7, 510.sup.7, 610.sup.7, 710.sup.7, 810.sup.7, 910.sup.7, 110.sup.8, 210.sup.8, 310.sup.8, 410.sup.8, 510.sup.8, 610.sup.8, 710.sup.8, 810.sup.8, 910.sup.8, 110.sup.9, 210.sup.9, 310.sup.9, 410.sup.9, 510.sup.9, 610.sup.9, 710.sup.9, 810.sup.9, 910.sup.9, 110.sup.10, 210.sup.10, 310.sup.10 , 410.sup.10, 510.sup.10, 610.sup.10, 710.sup.10, 810.sup.10, 910.sup.10, 110.sup.11, 210.sup.11, 310.sup.11, 410.sup.11, 510.sup.11, 610.sup.11, 710.sup.11, 810.sup.11, 910.sup.11, 110.sup.12, 210.sup.12, 310.sup.12, 410.sup.12, 510.sup.12, 610.sup.12, 710.sup.12, 810.sup.12, 910.sup.12, 110.sup.13, 210.sup.13, 310.sup.13, 410.sup.13, 510.sup.13, 610.sup.13, 710.sup.13, 810.sup.13, 910.sup.13, 110.sup.14, 210.sup.14, 310.sup.14, 410.sup.14, 510.sup.14, 610.sup.14, 710.sup.14, 810.sup.14, 910.sup.14, 110.sup.15, 210.sup.15, 310.sup.15, 410.sup.15, 510.sup.15, 610.sup.15, 710.sup.15, 810.sup.15, 910.sup.15, or 110.sup.16 G/mL. In one embodiment, the delivery comprises a composition concentration of 110.sup.13 VG/mL. In one embodiment, the delivery comprises a composition concentration of 2.110.sup.12 VG/mL.

    Combinations

    [0461] The AAV particles may be used in combination with one or more other therapeutic, prophylactic, research or diagnostic agents. By in combination with, it is not intended to imply that the agents must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope of the present invention. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent. In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, research, or diagnostic compositions in combination with agents that may improve their bioavailability, reduce arid/or modify their metabolism, inhibit their excretion, and/or modify their distribution within the body.

    Measurement of Expression

    [0462] Expression of payloads from viral genomes may be determined using various methods known in the art such as, but not limited to immunochemistry (IHC), in situ hybridization (ISH), enzyme-linked immunosorbent assay (ELISA), affinity ELISA, ELISPOT, flow cytometry, immunocytology, surface plasmon resonance analysis, kinetic exclusion assay, liquid chromatography-mass spectrometry (LCMS), high-performance liquid chromatography (HPLC), BCA assay, immunoelectrophoresis, Western blot, SDS-PAGE, protein immunoprecipitation, and/or PCR.

    Bioavailability

    [0463] The AAV particles, when formulated into a composition with a delivery agent as described herein, can exhibit an increase in bioavailability as compared to a composition lacking a delivery agent as described herein. As used herein, the term bioavailability refers to the systemic availability of a given amount of AAV particle or expressed payload administered to a mammal. Bioavailability can be assessed by measuring the area under the curve (AUC) or the maximum serum or plasma concentration (C.sub.max) of the composition following. AUC is a determination of the area under the curve plotting the serum or plasma concentration of a compound (e.g., AAV particles or expressed payloads) along the ordinate (Y-axis) against time along the abscissa (X-axis). Generally, the AUC for a particular compound can be calculated using methods known to those of ordinary skill in the art and as described in G. S. Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, v. 72, Marcel Dekker, New York, Inc., 1996, the contents of which are herein incorporated by reference in its entirety.

    [0464] The C.sub.max value is the maximum concentration of the AAV particle or expressed payload achieved in the serum or plasma of a mammal following administration of the AAV particle to the mammal. The C.sub.max value of can be measured using methods known to those of ordinary skill in the art. The phrases increasing bioavailability or improving the pharmacokinetics, as used herein mean that the systemic availability of a first AAV particle or expressed payload, measured as AUC, C.sub.max, or C.sub.min in a mammal is greater, when co-administered with a delivery agent as described herein, than when such co-administration does not take place. In some embodiments, the bioavailability can increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%.

    Therapeutic Window

    [0465] As used herein therapeutic window refers to the range of plasma concentrations, or the range of levels of therapeutically active substance at the site of action, with a high probability of eliciting a therapeutic effect. In some embodiments, the therapeutic window of the AAV particle as described herein can increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 15%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%.

    Volume of Distribution

    [0466] As used herein, the term volume of distribution refers to the fluid volume that would be required to contain the total amount of the drug in the body at the same concentration as in the blood or plasma: V.sub.dist equals the amount of drug in the body/concentration of drug in blood or plasma, For example, for a 10 mg dose and a plasma concentration of 10 mg/L, the volume of distribution would be 1 liter. The volume of distribution reflects the extent to which the drug is present in the extravascular tissue. A large volume of distribution reflects the tendency of a compound to bind to the tissue components compared with plasma protein bink. In a clinical setting, Vdist can be used to determine a loading dose to achieve a steady state concentration. In some embodiments, the volume of distribution of the AAV particles as described herein can decrease at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%. at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%.

    Biological Effect

    [0467] In one embodiment, the biological effect of the AAV particles delivered to the animals may be categorized by analyzing the payload expression in the animals. The payload expression may be determined from analyzing a biological sample collected from a mammal administered the AAV particles of the present invention. For example, a protein expression of 50-200 pg/ml for the protein encoded by the AAV particles delivered to the mammal may be seen as a therapeutically effective amount of protein in the mammal.

    IV. METHODS AND USES OF THE COMPOSITIONS OF THE INVENTION

    [0468] The present disclosure provides a method for treating a disease, disorder and/or condition in a mammalian subject, including a human subject, comprising administering to the subject any of the AAV particles described herein or administering to the subject any of the described compositions, including pharmaceutical compositions, described herein.

    [0469] In one embodiment, the AAV particles of the present invention are administered to a subject prophylactically.

    [0470] In one embodiment, the AAV particles of the present invention are administered to a subject having at least one of the diseases described herein.

    [0471] In one embodiment, the AAV particles of the present invention are administered to a subject to treat a disease or disorder described herein. The subject may have the disease or disorder or may be at-risk to developing the disease or disorder.

    [0472] In one embodiment, the AAV particles of the present invention are part of an active immunization strategy to protect against diseases and disorders. In an active immunization strategy, a vaccine or AAV particles are administered to a subject to prevent an infectious disease by activating the subject's production of antibodies that can fight off invading bacteria or viruses.

    [0473] In one embodiment, the AAV particles of the present invention are part of a passive immunization strategy. In a passive immunization strategy, antibodies against a particular infectious agent are given directly to the subject.

    Diseases and Toxins

    [0474] Various infectious diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As used herein, the term infectious disease refers to any disorders caused by organisms such as bacteria, viruses, fungi or parasites. As a non-limiting example, the infectious disease may be Acute bacterial rhinosinusitis, 14-day measles, Acne, Acrodermatitis chronica atrophicans (ACA)-(late skin manifestation of latent Lyme disease), Acute hemorrhagic conjunctivitis, Acute hemorrhagic cystitis, Acute rhinosinusitis, Adult T-cell Leukemia-Lymphoma (ATLL), African Sleeping Sickness, AIDS (Acquired Immunodeficiency Syndrome), Alveolar hydatid, Amebiasis, Amebic meningoencephalitis, Anaplasmosis, Anthrax, Arboviral or parainfectious, Ascariasis (Roundworm infections), Aseptic meningitis, Athlete's foot (Tinea pedis), Australian tick typhus, Avian influenza, Babesiosis, Bacillary angiomatosis, Bacterial meningitis, Bacterial vaginosis, Balanitis, Balantidiasis, Bang's disease, Barinah Forest virus infection, Bartonellosis (Verruga peruana; Carrion's disease; Oroya fever), Bat Lyssavirus Infection, Bay sore (Chiclero's ulcer), Bitylisaicaris infection (Racoon roundworm infection), Beaver fever, Beef tapeworm, Bejel (endemic syphilis), Biphasic meningoencephalitis, Black Bane, Black death, Black piedra, Blackwater Fever, Blastomycosis, Blennorrhea of the newborn, Blepharitis, Boils, Bornholm disease (pleurodynia), Borrelia miyamotoi Disease, Botulism, Boutonneuse fever, Brazilian purpuric fever, Break Bone fever, Brill, Bronchiolins, Bronchitis, Brucellosis (Bang's disease), Bubonic plague, Bullous impetigo, Burkholderia (Glanders), Burkholderia pseudomallei (Melioidosis), Buruli Ulcers (also Mycoburuli ulcers), Busse, Busse-Buschke disease (Cryptococcosis), California group encephalitis, Campylobacteriosis, Candidiasis, Canefield fever (Canicola fever; 7-day fever; Wed's disease; leptospirosis; cariefield fever), Canicola fever, Capillariasis, Carate, Carbapenem-resistant Enterobacteriaceae (CRE), Carbuncle, Carrion's disease, Cat Scratch fever, Cave disease, Central Asian hemorrhagic fever, Central European tick, Cervical cancer, Chagas disease, Chancroid (Soft chancre), Chicago disease, Chickenpox (Varicella), Chiclero's ulcer, Chikungunya fever, Chlamydial infection, Cholera, Chromoblastomycosis, Ciguatera, Clap, Clonorchiasis (Liver fluke infection), Clostridium Difficile Infection, Clostridium Perfringens (Epsilon Toxin), Coccidioidomycosis fungal infection (Valley fever; desert rheumatism), Coenurosis, Colorado tick fever, Condyloma accuminata, Condyloma accuminata Warts), Condyloma lata, Congo fever, Congo hemorrhagic fever virus, Conjunctivitis cowpox, Crabs, Crimean, Croup, Cryptococcosis, Cryptosporidiosis (Crypto), Cutaneous Larval Migrans, Cyclosporiasis, Cystic hydatid, Cysticercosis, Cystitis, Czechoslovak tick, D68 (EV-D68), Dacryocytitis, Dandy fever, Darling's Disease, Deer fly fever, Dengue fever (1, 2, 3 and 4), Desert rheumatism, Devil's grip, Diphasic milk fever, Diphtheria, Disseminated intravascular Coagulation, Dog tapeworm, Donovanosis, Donovanosis (Granuloma inguinale), Dracontiasis, Dracunculosis, Duke's disease, Dum Dum Disease, Durand-Nicholas-Favre disease, Dwarf tapeworm, E. Coli infection (E. Coli), Eastern equine encephalitis, Ebola Hemorrhagic Fever (Ebola virus disease EVD), Ectothrix, Ehrlichiosis (Sennetsu fever), Encephalitis, Endemic Relapsing fever, Endemic syphilis, Endophthalmitis, Endothrix, Enterobiasis (Pinworm infection), Enterotoxin-B Poisoning (Staph Food Poisoning), Enterovirus Infection, Epidemic Keratoconjunctivitis, Epidemic Relapsing fever, Epidemic typhus, Epiglottitis, Erysipelis, Erysipeloid (Erysipelothricosis), Erythema chronicum migrans, Erythema infectiosum, Erythema marginatum, Erythema multiforme, Erythema nodosum, Erythema nodosum leprosum, Erythrasma, Espundia, Eumycotic mycetoma, European blastomycosis, Exanthem subiturn (Sixth disease), Eyeworm, Far Eastern tick, Fascioliasis, Fievre boutonneuse (Tick typhus), Fifth Disease (erythema infectiosum), Filatow-Dukes' Disease (Scalded Skin Syndrome; Ritter's Disease), Fish tapeworm, Fitz-Hugh-Curtis syndrome-Perihepatitis, Flinders Island Spotted Fever, Flu (Influenza), Folliculitis, Four Corners Disease, Four Corners Disease (Human Pulmonary Syndrome (HPS)), Frambesia, Francis disease, Furunculosis, Gas gangrene, Gastroenteritis, Genital Herpes, Genital Warts, German measles, Gerstmann-Straussler-Scheinker (GSS), Giardiasis, Gilchrist's disease, Gingivitis, Gingivostomatitis, Glanders, Glandular fever (infectious mononucleosis), Gnathostomiasis, Gonococcal infection (Gonorrhea), Gonorrhea, Granuloma inguinale (Donovanosis), Guinea Worm, Haemophilus Influenza disease, Hamburger disease, Hansen's diseaseleprosy, Hantaan disease, Hantaan-Korean hemorrhagic fever, Hantavirus Pulmonary Syndrome, Hantavirus Pulmonary Syndrome (HPS), Hard chancre, Hard measles, Haverhill feverRat bite fever, Head and Body Lice, Heartland fever, Helicobacterosis, Hemolytic Uremic Syndrome (HUS), Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis B, Hemangina, Herpes-genital, Herpes labialis, Herpes-neonatal, Hidradenitis, Histoplasmosis, Histoplasmosis infection (Histoplasmosis), His-Werner disease, HIV infection, Hookworm infections, Hordeola, Hordeola (Stye), HTLV, HTLV-associated myelopathy (HAM), Human granulocytic ehrlichiosis, Human monocytic ehrlichiosis, Human Papilloinavirus (HPV), Human Pulmonary Syndrome, Hydatid cyst, Hydrophobia, Impetigo, Including congenital (German Measles), Inclusion conjunctivitis, Inclusion conjunctivitis-Swimming Pool conjunctivitis-Pannus, Infantile diarrhea, Infectious Mononucleosis, Infectious myocarditis, infectious pericarditis, Influenza, Isosporiasis, Israeli spotted fever, Japanese Encephalitis, Jock itch, Jorge Lobo disease lobomycosis, Jungle yellow fever, Junin Argentinian hemorrhagic fever, Kala Azar, Kaposi's sarcoma, Keloidal blastomycosis, Keratoconjunctivitis Kuru, Kyasanur forest disease, LaCrosse encephalitis, Lassa hemorrhagic fever, Legionellosis (Legionnaires Disease), Legionnaire's pneumonia, Lemierre's Syndrome (Postanginal septicemia), Lemming fever, Leprosy, Leptospirosis (Nanukayami fever; Weil's disease), Listeriosis (Listeria), Liver fluke infection, Lobo's mycosis, Lockjaw, Loiasis, Louping III, Ludwig's angina, Lung fluke infection, Lung fluke infection (Paragonimiasis), Lyme disease, Lymphogranuloma venereum infection (LGV), Machupo Bolivian hemorrhagic fever, Madura foot, Mal del pinto, Malaria, Malignant pustule, Malta fever, Marburg hemorrhagic fever, Masters disease, Maternal Sepsis (Puerperal fever), Measles, Mediterranean spotted fever, Melioidosis (Whitmore's disease), Meningitis, Meningococcal Disease, MERS, Milker's nodule, Molluscum contagiosum, Moniliasis, monkeypox, Mononucleosis, Mononucleosis-like syndrome, Montezuma's Revenge, Morbilli MRSA (methicillin-resistant Staphylococcus aureus) infection, Mucormycosis-Zygomycosis, Multiple Organ Dysfunction Syndrome or MODS, Multiple-system atrophy (MSA), Mumps, Murine typhus, Murray Valley Encephalitis (MVE), Mycoburuh ulcers, Mycoburuli ulcers-Buruli ulcers, Mycotic vulvovaginitis, Myositis, Nanukayami fever, Necrotizing fasciitis, Necrotizing fasciitis-Type 1, Necrotizing fasciitis-Type 2, Negishi, New world sported fever, Nocardiosis, Nongonococcal urethritis, Non-Polio (Non-Polio Enterovirus), Norovirus infection, North American blastornycosis, North Asian tick typhus, Norwalk virus infection, Norwegian itch, O'Hara disease, Omsk hemorrhagic fever, Onchoceriasis, Onychomycosis, Opisthorchiasis, Opthalmia neonatorium, Oral hairy leukoplakia, Orf, Oriental Sore, Oriental Spotted Fever, Ornithosis (Parrot fever; Psittacosis), Oroya fever, Otitis extema, Otitis media, Pannus, Parttcoccidioidomycosis, Paragonimiasis, Paralytic Shellfish Poisoning (Paralytic Shellfish Poisoning), Paronychia (Whitlow), Parotitis, PCP pneumonia, Pediculosis, Peliosis hepatica, Pelvic Inflammatory Disease, Pertussis (also called Whooping cough), Phaeohyphomycosis, Pharyngoconjunctival fever, Piedra (White Piedra), Piedra (Black Piedra), Pigbel, Pink eye conjunctivitis, Pinta, Pinworm infection, Pitted Keratolysis, Pityriasis versicolor (Tinea versicolor), Plague; Bubonic, Pleurodynia, Pneumococcal Disease, Pneumocystosis, Pneumonia, Pneumonic (Plague), Polio or Poliomyelitis, Polycystic hydatid, Pontiac fever, Pork tapeworm, Posada-Wemicke disease, Postanginal septicemia, Powassan, Progressive multifocal leukencephalopathy, Progressive Rubella Panencephalitis, Prostatitis, Pseudomembranous colitis, Psittacosis, Puerperal fever, Pustular Rash diseases (Small pox), Pyelonephritis, Pyleplalebitis, Q-Fever, Quinsy, Quintana fever (5-day fever), Rabbit fever, Rabies, Racoon roundworm infection, Rat bite fever, Rat tapeworm, Reiter Syndrome, Relapsing fever, Respiratory syncytial virus (RSV) infection, Rheumatic fever, Rhodotorulosis, Ricin Poisoning, Rickettsialpox, Rickettsiosis Rift Valley Fever, Ringworm, Ritter's Disease, River Blindness, Rocky Mountain spotted fever, Rose Handler's disease (Sporotrichosis), Rose rash of infants, Roseola, Ross River fever, Rotavirus infection, Roundworm infections, Rubella, Rubeola, Russian spring, Salmonellosis gastroenteritis, San Joaquin Valley fever, Sao Paulo Encephalitis, Sao Paulo fever, SARS, Scabies Infestation (Scabies) (Norwegian itch), Scalded Skin Syndrome, Scarlet fever (Scarlatina), Schistosomiasis, Scombroid, Scrub typhus, Sennetsu fever, Sepsis (Septic shock), Severe Acute Respiratory Syndrome, Severe Acute Respiratory Syndrome (SARS), Shiga, Toxigenic Escherichia cob (STECNTEC), Shigellosis gastroenteritis (Shigella), Shinbone fever, Shingles, Shipping fever, Siberian tick typhus, Sinusitis, Sixth disease, Slapped cheek disease Sleeping sickness, Smallpox (Vanilla), Snail Fever, Soft chancre, Southern tick associated rash illness, Sparganosis, Spelunker's disease, Sporadic typhus, Sporotrichosis, Spotted fever, Spring, St. Louis encephalitis, Staphylococcal Food Poisoning, Staphylococcal Infection, Strep throat, Streptococcal Disease, Streptococcal Toxic-Shock Syndrome, Strongyloiciasis, Stye, Subacute Sclerosing Panencephalitis Subacute Sclerosing Panencephalitis (SSPE), Sudden Acute Respiratory Syndrome, Sudden Rash, Swimmer's ear, Swimmer's Itch, Swimming Pool conjunctivitis, Sylvatic yellow fever, Syphilis, Systemic Inflammatory Response Syndrome (SIRS), Tabes dorsalis (tertiary syphilis), Taeniasis, Taiga encephalitis, Tanner's disease, Tapeworm infections, Temporal lobe encephalitis, Temporal lobe encephalitis, tetani (Lock Jaw), Tetanus infection, Threadworm infections, Thrush, Tick, Tick typhus, Tinea barbae, Tinea capitis, Tinea corporis, Tinea cruris, Tinea manuum, Tinea nigra, Tinea pedis, Tinea unguium, Tinea eersicolor, Torulopsosis, Torulosis, Toxic Shock Syndrome, Toxoplasmosis, transmissible spongioform (CJD), Traveler's diarrhea, Trench fever 5, Trichinellosis, Trichomoniasis, Trichomycosis axillaris, Trichuriasis, Tropical Spastic Paraparesis (TSP), Trypanosomiasis, Tuberculosis (TB), Tuberculousis, Tularemia, Typhoid Fever, Typhus fever, Ulcus niolle, lindulant fever, urban yellow fever, Urethritis, Vaginitis, Vaginosis, Vancomycin Intermediate (VISA), Vancomycin Resistant (VISA), Varicella, Venezuelan Equine encephalitis, Verruga peruana, Vibrio cholerae (Cholera), Vibriosis (Vibrio), Vincent's disease or Trench mouth, Viral conjunctivitis, Viral Meningitis, Viral meningoencephalitis, Viral rash, Visceral Larval Migrans, Vomito negro, Vulvovaginitis, Warts, Waterhouse, Well's disease, West Nile Fever, Western equine encephalitis, Whipple's disease, Whipworm infection, White Piedra, Whitlow, Whitmore's disease, Winter diarrhea, Wolhynia fever, Wool sorters' disease, Yaws, Yellow Fever, Yersinosis, Yersinosis (Yersinia), Zahorsky's disease, Zika virus disease, Zoster, Zygomycosis, John Cunningham Virus (XV), Human immunodeficiency virus (HIV), Influenza virus, Hepatitis B, Hepatitis C, Hepatitis D, Respiratory-syncytial virus (RSV), Herpes simplex virus 1 and 2, Human Cytomegalovirus, Epstein-Barr virus, Varicella zoster virus, Coronaviruses Poxxiruses, Enterovirus 71, Rubella. virus, Human papilloma virus, Streptococcus pneumoniae, Streptococcus viridans, Staphylococcus aureus (S. aureus), Methicillin-resistant Staphylococcus aureus (MRSA), Vancomycin-intermediate Staphylococcus aureas (VISA), Vancomycin-resistant Staphylococcus aureus (VRSA), Staphylococcns epidermidis (S. epidermidis), Clostridium Tetani, Bordetella pertussis, Bordetella paratussis, Mycobacterium, Francisella Tularensis, Toxoplasma gondii, Candida (C. albicans, C. glabrata, C. parapsdosis, C. tropicalts, C. krusei and C. lusitaniae) and/or any other infectious diseases, disorders or syndromes.

    [0475] Various toxins may be treated with the pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of toxins include Ricin, Bacillus anthracis, Shiga toxin and Shiga-like toxin, Botulinum toxins.

    [0476] Various tropical diseases may be treated with pharmaceutical compositions, AAV particles, of the present in Non-limited examples of tropical diseases include Chikungunya fever, Dengue fever, Chagas disease, Rabies, Malaria, Ebola virus, Marburg virus, West Nile Virus, Yellow Fever, Japanese encephalitis virus, St. Louis encephalitis virus.

    [0477] Various foodborne illnesses and gastroenteritis may be treated with pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of foodborne illnesses and gastroenteritis include Rotavirus, Norwalk virus (Norovirus), Canipylobacter jejuni, Clostridium difficile, Entamoeba histolytica, Helicobacter pyroli, Enterotoxin B of Staphylococcus aureus, Hepatitis A virus (HAV), Hepatitis F, Listeria monocytogenes, Salmonella, Clostridium perfringens, and Salmonella.

    [0478] Various infectious agents may be treated with pharmaceutical compositions, AAV particles, of the present invention. Non-limited examples of infectious agents include adenoviruses, Anaplasma phagocytophillium, Ascaris lumbricoides, Bacillus anthracis, Bacillus cereus, Bacteriodes sp, Barmah Forest virus, Bartonella bacilliformis, Bartonella henselae, Bartonella quintana, beta-toxin of Clostridium perfringens, Bordetella pertussis, Bordetella parapertussis, Borrelia burgdorferi, Borrelia miyamotoi, Borrelia recurrentis, Borrelia sp., Botulinum toxin, Brucella sp., Burkholderia pseudomallei, California encephalitis virus, Campylobacter, Candida albicans, chikungunya virus, Chlamydia psittaci, Chlamydia trachomatis, Clonorchis sinensis, Clostridium difficile bacteria, Clostridium tetani, Colorado tick fever virus, Corynebacterium diptheriae, Corynebacterium miutissimum, Coxiello burnetii, coxsackie A, coxsackie B, Crimean-Congo hemorrhagic fever virus, cytomegalovirus, dengue virus, Eastern Equine encephalitis virus, Ebola viruses, echovirus, Ehrlichia chaffeensis, Ehrlichia equi., Ehrlichia sp., Entamoeba histolytica, Enterobacter sp., Entercoccus feacalis, Enterovirus 71, Epstein-Barr virus (EBV), Erysipelothrix rhusiopathiae, Escherichia coli, Flavivirus, Fusobacterium necrophorum, Gardnerella vaginalis, Group B streptococcus, Haemophoilus aegyptius, Haemophilus ducreyl, Haemophilus influenzae, hantavirus, Helicobacter pylori, Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E, herpes simplex virus 1 and 2 human herpes virus 6, human herpes Virus 8, human immunodeficiency virus 1 and 2, human T-cell leukemia viruses II and II, influenza viruses (A, B, C), Jamestown Canyon virus, Japanese encephalitis antigenic, Japanese encephalitis virus, John Cunningham virus, Juninvirus, Kaposi's Sarcoma-associated Herpes Virus (KSHV), Klebsiella granulomatis, Klebsiella sp., Kyasanur Forest Disease virus, La Crosse virus, Lassavirus, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, lymphocytic choriomeningitis virus, lyssavirus, Machupovirus, Marburg virus, measles virus, MERS coronavirus (MERS-CoV), Micrococcus sedentarius, Mobiluncus sp. Molluscipoxvirus, Moraxella catarrhalis, Morbilli-Rubeola virus, Mumpsvirus, Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycoplasma genitalium, Mycoplasma sp, Nairovirus, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia, Norwalk virus, norovirus, Omsk hemorrhagic fever virus, papilloma virus, parainfluenza viruses 1-3, parapoxvirus, parvovirus B19, Peptostreptococccus sp., Plasmodium sp., polioviruses types I, H, and ITT, Proteus sp., Pseudomonas aeraginosa, Pseudomonas pseudomallei, Pseudomonas sp., rabies virus, respiratory syncytial virus, ricin toxin, Rickettsia australis, Rickettsia conori, Rickettsia honei, Rickettsia prawazekii, Ross River Virus, rotavirus, rubellavirus, Saint Louis encephalitis, Salmonella Typhi, Sarcoptes scabiei, SARS-associated coronavirus (SARS-CoV), Serratia sp., Shiga toxin and Shiga-like toxin, Shigella sp., Sin Nombre Virus, Snowshoe hare virus, Staphylococcus aureus, Staphylococcus epidermidis, Streptobacillus moniliformis, Streptoccoccus pneumoniae, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus group A-H, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pailidum subsp. Pallidum, Treponema pallidum var. carateum, Treponema pallium var. endemicum, Tropheryma whippelii, Ureaplasma urealyticum, Varicella-Zoster virus, variola virus, Vibrio Cholerae, West Nile virus, yellow fever virus Yersinia enterocolitico, Yersinia pestis, and Zika virus.

    [0479] Various rare diseases may be treated with pharmaceutical compositions. AAV particles, of the present invention. As used herein, the term rare disease refers to any disease that affects a small percentage of the population. As a non-limiting example, the rare disease may be Acrocephalosyndactylia, Acrodermatitis, Addison Disease, Adie Syndrome, Alagille Syndrome, Amylose, Amyotrophic Lateral Sclerosis, Angelman Syndrome, Angiobimphoid Hyperplasia with Eosinophilia, Arnold-Chiari Malformation, Arthritis, Juvenile Rheumatoid, Asperger Syndrome, Bardet-Biedl Syndrome, Barrett Esophagus, Beckwith-Wiedemann Syndrome, Behcet Syndrome, Bloom Syndrome, Bowen's Disease, Brachial Plexus Neuropathies, Brown-Sequard Syndrome, Budd-Chian Syndrome, Burkitt Lymphoma, Carcinoma 256, Walker, Carob Disease, Charcot-Marie-Tooth Disease, Chediak-Higashi Syndrome, Chiari-Frommel Syndrome, Chondrodysplasia Punctata, Colonic Pseudo-Obstruction, Colorectal Neoplasms, Hereditary Noripolyposis, Craniofacial Dysostosis, Creutzfeldt-Jakob Syndrome, Crohn Disease, Cushing Syndrome, Cystic Fibrosis, Dandy-Walker Syndrome, De Lange Syndrome, Dementia, Vaschlar, Dermatitis Herpetiformis, DiGeorge Syndrome, Diffuse Cerebral Sclerosis of Schilder, Duane Retraction Syndrome, Dupuytren Contracture, Ebstein Anomaly, Eisenmenger Complex, Ellis-Van Creveld Syndrome, Encephalitis, Enchondromatosis, Epidermal Necrolysis, Toxic, Facial Hemiatrophy, Factor XII Deficiency, Fanconi Anemia, Felty's Syndrome, Fibrous Dysplasia, Polyostotic, Fox-Fordyce Disease, Friedreich Ataxia, Fusobacterium, Gardner Syndrome, Gaucher Disease, Gerstmann Syndrome, Giant Lymph Node Hyperplasia, Glycogen Storage Disease Type I, Glycogen Storage Disease Type II, Glycogen Storage Disease Type IV, Glycogen Storage Disease Type V, Glycogen. Storage Disease Type VII, Goldenhar Syndrome, Guillain-Barre Syndrome, Hallermann's Syndrome, Hamartoma Syndrome, Multiple, Hartnup Disease, Hepatolenticular Degeneration, Hepatolenticular Degeneration, Hereditary Sensory and Motor Neuropathy, Hirschsprung Disease. Histiocytic Necrotizing Lymphadenitis, Histiocytosis, Langerhans-Cell, Hodgkin Disease, Homer Syndrome, Huntington Disease, Hyperaldosteronism, Hyperhidrosis, Hyperostosis, Diffuse Idiopathic Skeletal, Hypopituitarism, Inappropriate ADH Syndrome, Intestinal Polyps, Isaacs Syndrome, Kartagener Syndrome, Keams-Sayre Syndrome, Klippel-Feil Syndrome, Klippel-Trenaunay-Weber Syndrome, Kluver-Bucy Syndrome, Korsakoff Syndrome, Lafora Disease, Lambert-Eaton Myasthenic Syndrome, Landau-Kleffner Syndrome, Langer-Giedion Syndrome, Leigh Disease, Lesch-Nyhan Syndrome, Leukodystrophy, Globoid Cell, Li-Fraumeni Syndrome, Long QT Syndrome, Machado-Joseph Disease, Mallory-Weiss Syndrome, Marek Disease, Marfan Syndrome, Meckel Diverticulum, Meige Syndrome, Melkersson-Rosenthal Syndrome, Meniere Disease, Mikulicz' Disease, Miller Fisher Syndrome, Mobius Syndrome, Moyamoya Disease, Mucocutaneous Lymph Node Syndrome, Mucopolysaccharidosis I, Mucopolysaccharidosis II, Mucopolysaccharidosis Mucopoh saccharidosis IV, Mucopolysaccharidosis I, Multiple Endocrine Neoplasia Type I, Munchausen Syndrome by Proxy, Muscular Atrophy, Spinal, Narcolepsy, Neuroaxonal Dystrophies, Neuromyelitis Optica, Neuronal Ceroid-Lipofuscinoses, Niemann-Pick Diseases, Noonan Syndrome, Optic Atrophies, Hereditary, Osteitis Deformans, Osteochondritis, Osteochondrodysplasias, Osteolysis, Essential, Paget Disease Extramammary, Paget's Disease, Mammary, Panniculitis, Nodular Nonsuppurative, Papillon-Lefevre Disease, Paralysis, Pelizaeus-Merzhacher Disease, Pemphigus, Benign Familial, Penile induration, Pericarditis, Constrictive, Peroxisomal Disorders, Peutz-Jeghers Syndrome, Pick Disease of the Brain, Pierre Robin Syndrome, Pigmentation Disorders, Pityriasis Lichenoides Polycystic Ovary Syndrome, Polyendocrinopathies, Autoimmune, Prader-Willi Syndrome, Pupil Disorders, Rett Syndrome, Reye Syndrome, Rubinstein-Taybi Syndrome, Sandhoff Disease, Sarcoma, Ewing's, Schnitzler Syndrome, Sjogren's Syndrome, Sjogren-Larsson Syndrome, Smith-Lemli-Opitz Syndrome, Spinal Muscular Atrophies of Childhood, Sturge-Weber Syndrome, Sweating, Gustatory, Takayasu Arteritis, Tangier Disease, Tay-Sachs Disease, Thromboangiitis Obliterans, Thyroiditis, Autoimmune, Tietze's Syndrome, Togaviridae Infections, Tolosa-Hunt Syndrome, Tourette Syndrome, Uveomeningoencephalitic Syndrome, Waardenburg's Syndrome, Wegener Granulomatosis, Wed Disease, Werner Syndrome, Williams Syridrome, Wilms Tumor, Wolff-Parkinson-White Syndrome, Wolfram Syndrome, Wolman Disease, Zellweger Syndrome, Zollinger-Ellison Syndrome, and von Willebrand Diseases.

    [0480] Various autoimmune diseases and autoimmune-related diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As used herein, the term autoimmune disease refers to a disease in which the body produces antibodies that attack its own tissues. As a non-limiting example, the autoimmune disease may be Acute Disseminated Encephalomyelitis (ADEM), Acute necrotizing hemorrhagic leukoencephalitis, Addison's disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Ankylosing spondylitis, Anti-GBM/Anti-TBM nephritis, Antiphospholipid syndrome (APS), Autoimmune angioedema, Autoimmune aplastic anemia, Autoimmune dysautonomia, Autoimmune hepatitis, Autoimmune hyperlipidemia, Autoimmune immunodeficiency, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune thrombocytopenic purpura (ATP), Autoimmune thyroid disease, Autoimmune urticaria, Axonal & neuronal neuropathies, Balo disease, Behcet's disease, Bullous pemphigoid, Cardiomyopathy, Castleman disease, Celiac disease, Chagas disease, Chronic fatigue syndrome**, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic recurrent multifocal osteomyelitis (CRMO), Churg-Strauss syndrome, Cicatricial pemphigoid/benign mucosal pemphigoid, Crohn's disease, Cogans syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST disease, Essential mixed cryoglobulinemia, Demyelinating neuropathies, Dermatitis herpetiformis, Dermatomyositis, Devic's disease (neuromyelitis optica), Discoid lupus, Dressier's syndrome, Endometriosis, Eosinophilic esophagitis, Eosinophilic fasciitis, Erytherna nodosum, Experimental allergic encephalomyelitis, Evans syndrome, Fibromyalgia**, Fibrosing alveolitis, Giant cell arteritis (temporal arteritis), Giant cell myocarditis, Glomerulonephritis, Goodpasture's syndrome, Granulomatosis with Polyangiitis (GPA) (formerly called Wegener's Granulomatosis), Graves' disease, Guillain-Barre syndrome, Hashimoto's encephalitis, Hashimoto's thyroiditis, Hemolytic anemia, Henoch-Schonlein purpura, Herpes gestationis, Hypogannnaglobulinemia, Idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, IgG4-related sclerosing disease, Immunoregulatory lipoproteins, Inclusion body myosins, interstitial cystitis, Juvenile arthritis, Juvenile diabetes (Type 1 diabetes), Juvenile myositis, Kawasaki syndrome, Lambert-Eaton syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjundivitis, Linear IgA disease (LAD), Lupus (SLE), Lyme disease, chronic, Meniere's disease, Microscopic polyangiitis, Mixed connective tissue disease (MCTD), Mooren's ulcer, Mucha-Habermann disease, Multiple sclerosis, Myasthenia gravis, Myosins, Narcolepsy, Neuromyelitis optica (Devic's), Neutropenia, Ocular cicatricial pemphigoid, Optic neuritis, Palindromic rheumatism, PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus), Paraneoplastic cerebellar degeneration, Paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg Syndr Parsonnage-Turner syndrome, Pars planitis (peripheral uveitis), Pemphigus, Peripheral neuropathy, Perivenous encephalomyelitis, Pernicious anemia, POEMS syndrome, Polyarteritis nodosa, Type I, II, & III autoimmune poly glandular syndromes, Polymyalgia rheumatica, Polymyositis, Postmyocardial infarction syndrome, Postpericardiotomy syndrome, Progesterone dermatitis, Primary biliary cirrhosis, Primary sclerosing, cholangitis, Psoriasis, Psoriatic arthritis, Idiopathic pulmonary fibrosis, Pyoderma gangrenosum, Pure red cell aplasia, Raynauds phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Reiter's syndrome, Relapsing polychondritis, Restless legs syndrome, Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sjogren's syndrome, Sperm & testicular autoimmunity, Stiff person syndrome, Subacute bacterial endocarditis (SBE), Susac's syndrome, Sympathetic ophthalmia, Takayasu's arteritis, Temporal arteritis/Giant cell arteritis, Thrombocytopenic; purpura (TTP), Tolosa-Hunt syndrome, Transverse myelitis, Ulcerative colitis, Undifferentiated connective tissue disease (UCTD), Uveitis, Vasculitis, Vesiculobullous dermatosis, Vitiligo, and Wegener's granulomatosis (now termed Granulomatosis with Polyangiitis (GPA).

    [0481] Various kidney diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting, example, the kidney disease Abderhalden-Kaufmann-Lignac syndrome (Nephropathic Cystinosis), Abdominal Compartment Syndrome, Acute Kidney Failure/Acute Kidney Injury, Acute Lobar Nephronia, Acute Phosphate Nephropathy, Acute Tubular Necrosis, Adenine Phosphoribosyltransferase Deficiency, Adenovirus Nephritis, Alport Syndrome, Amyloidosis, ANCA Vasculitis Related to Endocarditis and Other Infections, Angiomyolipoma, Analgesic-Nephropathy, Anorexia Nervosa and Kidney Disease, Angiotensin Antibodies and Focal Segmental Glomerulosclerosis, Antiphospholipid Syndrome, Anti-TNF- Therapy related Glomerulonephritis, APOL1 Mutations, Apparent Mineralocorticoid Excess Syndrome, Aristolochic Acid Nephropathy, Chinese Herbal Nephropathy, Balkan Endemic Nephropathy, Bartter Syndrome, Beeturia, -Thalassemia Renal Disease, Bile Cast Nephropathy, BK Polyoma Virus Nephropathy in the Native Kidney, Bladder Rupture, Bladder Sphincter Dyssynergia, Bladder Tamponade, Border-Crossers' Nephropathy, Bourbon Virus and Acute Kidney Injury, Burnt Sugarcane Harvesting and Acute Renal Dysfunction, Byetta and Renal Failure, C1q Nephropathy, Cannabinoid Hyperemesis Acute Renal Failure, Cardiorenal syndrome, Carfilzomib-Induced Renal Injury, CFHR5 nephropathy, Charcot-Marie-Tooth Disease with Glomerulopathy, Cherry Concentrate and Acute Kidney Injury, Cholesterol Emboli, Churg-Strauss syndrome, Chyluria, Colistin Nephrotoxicity, Collagenofibrotic Glomerulopathy, Collapsing Glomerulopathy, Collapsing Glomerulopathy Related to CMV, Congenital Nephrotic Syndrome, Conorenal syndrome (Mainzer-Saldino Syndrome or Saldino-Mainzer Disease), Contrast Nephropathy, Copper Sulpfate Intoxication, Cortical Necrosis, Crizotinib-related Acute Kidney Injury, Cryoglobulinemia, Crystalglobulin-Induced Nephropathy, Crystal-Induced Acute Kidney injury, Cystic Kidney Disease, Acquired, Cystinuria, Dasatinib-Induced Nephrotic-Range Proteinuria, Dense Deposit Disease (MPGN Type 2), Dent Disease (X-linked Recessive Nephrolithiasis), Dialysis Disequilibrium Syndrome, Diabetes and Diabetic Kidney Disease, Diabetes Insipidus, Dietary Supplements and Renal Failure, Drugs of Abuse and Kidney Disease, Duplicated Ureter, EAST syndrome, Ebola and the Kidney, Ectopic Kidney, Ectopic Ureter, Edema, Swelling, Erdheim-Chester Disease, Fabry's Disease, Familial Hypocalciuric Hypercalcemia, Fanconi Syndrome, Fraser syndrome, Fibronectin Glomerulopathy, Fibrillary Giomerulonephritis and Immunotactoid Glomerulopathy, Fraley syndrome, Focal Segmental Glomeruloscierosis, Focal Sclerosis, Focal Glomerulosclerosis, Galloway Mowat syndrome, Giant Cell (Temporal) Arteritis with Kidney Involvement, Gestational Hypertension, Gitelman Syndrome, Glomerular Diseases, Glomerular Tubular Reflux, Glycosuria, Goodpasture Syndrome, Hair Dye Ingestion and Acute Kidney Injury, Hantavirus Infection Podocytopathy, Hematuria (Blood in Urine), Hemolytic Uremic Syndrome (HUS). Atypical Hemolytic Uremic Syndrome (aHUS), Hemophagocytic Syndrome, Hemorrhagic Cystitis, Hemorrhagic Fever with Renal Syndrome (HFRS, Hantavirus Renal Disease, Korean Hemorrhagic Fever, Epidemic Hemorrhagic Fever, Nephropathis Epidemica), Hemosiderosis related to Paroxysmal Nocturnal Hemoglobinuria and Hemolytic Anemia, Hepatic Glomerulopathy, Hepatic Veno-Occlusive Disease, Sinusoidal Obstruction Syndrome, Hepatitis C-Associated Renal Disease, Hepatorenal Syndrome, Herbal Supplements and Kidney Disease, High Blood Pressure and Kidney Disease, HIV-Associated Nephropathy (HIVAN), Horseshoe Kidney (Renal Fusion), Hunner's Ulcer, Hyperaldosteronism, Hypercalcemia, Hyperkalemia, Hypermagnesemia, Hypernatremia, Hyperoxaluria, Hyperphosphatemia, Hypocalcemia, Hypokalemia, Hypokalemia-induced renal dysfunction, Hypokalemic Periodic Paralysis, Hypomagnesemia, Hyponatremia, Hypophosphatemia, IgA Nephropathy, IgG4 Nephropathy, interstitial Cystitis, Painful Bladder Syndrome (Questionnaire), interstitial Nephritis, Ivemark's syndrome, Ketamine Associated Bladder Dysfunction, Kidney Stones, Nephrolithiasis, Kombucha Tea Toxicity, Lead Nephropathy and Lead-Related Nephrotoxicity, Leptospirosis Renal Disease, Light Chain Deposition Disease, Monoclonal Immunoglobuliti Deposition Disease, Liddle Syndrome, Lightwood-Albright Syndrome, Lipoprotein Glomerulopathy, Lithium Nephrotoxicity, LMX1B Mutations Cause Hereditary FSGS, Loin Pain Hematuria, Lupus, Systemic Lupus Erythernatosis, Lupus Kidney Disease, Lupus Nephritis, Lupus Nephritis with Antineutrophil Cytoplasmic Antibody Seropositivity, Lyme Disease-Associated Giomerulonephritis, Malarial Nephropathy, Malignancy-Associated Renal Disease, Malignant Hypertension, Malakoplakia, Meatal Stenosis, Medullary Cystic Kidney Disease, Medullary Sponge Kidney, Megaureter, Melamine Toxicity and the Kidney, Membranoproliferative Glomerulonephritis, Membranous Nephropathy, MesoAmerican Nephropathy, Metabolic Acidosis, Metabolic Alkalosis, Methotrexate-related Renal Failure, Microscopic Polyangiitis, Milk-alkalai syndrome, Minimal Change Disease, MDMA (Molly; Ecstacy; 3,4-Methylenedioxymethamphetamine) and Kidney Failure, Multicystic dysplastic kidney, Multiple Myeloma, Myeloproliferative Neoplasms and Glomerulopathy, Nail-patella Syndrome, Nephrocalcinosis, Nephrogenic Systemic Fibrosis, Nephroptosis (Floating Kidney, Renal Ptosis), Nephrotic Syndrome, Neurogenic Bladder, Nodular Glomerulosclerosis, Non-Gonococcal Urethritis, Nutcracker syndrome, Orofaciodigital Syndrome, Orotic Aciduria, Orthostatic Hypotension, Orthostatic Proteinuria, Osmotic Diuresis, Ovarian Hyperstimulation Syndrome, Page Kidney, Papillary Necrosis, Papillorerial Syndrome, (Renal-Coloboma Syndrome, Isolated Renal Hypoplasia), Parvovirus B19 and the Kidney, The Peritoneal-Renal Syndrome, Posterior Urethral Valve, Post-infectious Glomerulonephritis, Post-streptococcal Glomerulonephritis, Polyarteritis Nodosa, Polycystic Kidney Disease, Posterior Urethral Valves, Preeclampsia, Propofol infusion syndrome, Proliferative Glomerulonephritis with Monoclonal IgG Deposits (Nasr Disease), Propolis (Honeybee Resin) Related Renal Failure, Proteinuria (Protein in Urine), Pseudohyperaldosteronism, Pseudohypobicarbonaternia, Pseudohypoparathyroidism, Pulmonary-Renal Syndrome, Pyelorieplaritis (Kidney infection), Pyonephrosis, Radiation Nephropathy, Ranolazine and the Kidney, Refeeding syndrome, Reflux Nephropathy, Rapidly Progressive Glomerulonephritis, Renal Abscess, Peripnephric Abscess, Renal Agenesis, Renal Arcuate Vein Microthrombi-Associated Acute Kidney injury, Renal Artery Aneurysm, Renal Artery Stenosis, Renal Cell Cancer, Renal Cyst, Renal Hypouricernia with Exercise-induced Acute Renal Failure, Renal Infarction, Renal Osteodystrophy, Renal Tubular Acidosis, Renin Secreting Tumors (Juxtagloinerular Cell Tumor), Reset Osinostat, Retrocaval Ureter, Rotroperitoneal Fibrosis, Rhabdomyolysis, Rhabdomyolysis related to Bariatric Surgery, Rheumatoid Arthritis-Associated Renal Disease, Sarcoidosis Renal Disease, Salt Wasting, Renal and Cerebral, Schistosomiasis and Glomerular Disease, Schipke immuno-osseous dysplasia, Scleroderma, Renal Crisis, Serpentine Fibula-Polycystic Kidney Syndrome, Exner Syndrome, Sickle Cell Nephropathy, Silica Exposure and Chronic Kidney Disease, Sri Lankan Farmers' Kidney Disease, Sjogren's Syndrome and Renal Disease, Synthetic Cannabinoid Use and Acute Kidney Injury, Kidney Disease Following Hematopoietic Cull Transplantation, Kidney Disease Related to Stem Cell Transplantation, Thin Basement Membrane Disease, Benign Familial Hematuria, Trigonitis, Tuberculosis, Genitourinary, Tuberous Sclerosis, Tubular Dysgenesis, immune Complex Tubulointerstitial Nephritis Due to Autoantibodies to the Proximal Tubule Brush Border, Tumor Lysis Syndrome, Uremia, Uremic Optic Neuropathy, Ureteritis Cystica, Ureterocele, Urethral Caruncle, Urethral Stricture, Urinary Incontinence, Urinary Tract Infection, Urinary Tract Obstruction, Vesicointestinal Fistula, Vesicoureteral Reflux, Volatile Anesthetics and Acute Kidney Injury, Von Hippel-Lindau Disease, Waldenstrom's Macroglobulinernic Glomerulonephritis, Warfarin-Related Nephropathy, Wasp Stings and Acute Kidney Injury, Wegener's Granulomatosis, Granulomatosis with Polyangiitis, West Nile Virus and Chronic Kidney Disease, and Wunderlich syndrome.

    [0482] Various cardiovascular diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the cardiovascular disease may be Ischemic heart disease also known as coronary artery disease, cerebrovascular disease (Stroke), Peripheral vascular disease, Heart failure, Rheumatic heart disease, and Congenital heart disease.

    [0483] Various antibody deficiencies may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the antibody deficiencies may be X-Linked Agammaglobulinemia (XLA), Autosomal Recessive Agammaglobulinemia (ARA), Common Variable Immune Deficiency (CVID), IgG (IgG1 IgG2, IgG3 and IgG4) Subclass Deficiency, Selective IgA. Deficiency, Specific Antibody Deficiency (SAD), Transient Hypogammaglobulinemia of infancy, Antibody Deficiency with Normal or Elevated Immunoglobulins, Selective IgM Deficiency, Immunodeficiency with Thymoma (Good's Syndrome), Transcobalamin II Deficiency, Warts, Hypogammaglobulinemia Infection, Myelokathexis (WHIM) Syndrome, Drug-Induced Antibody Deficiency, Kappa Chain Deficiency, Heavy Chain Deficiencies, Post-Meiotic Segregation (PMS2) Disorder, and Unspecified Hypogammaglobulinemia.

    [0484] Various ocular diseases may he treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the ocular disease may be thyroid eye disease (TED), Graves' disease (GD) and orbitopathy, Retina Degeneration, Cataract, optic atrophy, macular degeneration, Leber congenital amaurosis, retinal degeneration, cone-rod dystrophy. Usher syndrome, leopard syndrome, photophobia, and photoaversion.

    [0485] Various neurological diseases may he treated with pharmaceutical compositions. AAV particles, of the present invention. As a non-limiting example, the neurological disease may be Absence of the Septum Pellucidum, Acid Lipase Disease, Acid Maltase Deficiency, Acquired Epileptiform Aphasia, Acute Disseminated Encephalomyelitis, Attention Deficit-Hyperactivity Disorder (ADHD), Adie's Pupil, Adie's Syndrome, Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Agnosia, Aicardi Syndrome, Aicardi-Goutieres Syndrome Disorder, AIDSNeurological Complications, Alexander Disease, Alpers' Disease, Alternating Hemiplegia, Alzheimer's Disease, Amyotrophic Lateral Sclerosis (ALS), Anencephaly, Aneurysm, Angelman Syndrome, Angiomatosis, Anoxia, Antiphospholipid Syndrome, Aphasia, Apraxia, Arachnoid Cysts, Arachnoiditis, Arnold-Chiari Malformation, Arteriovenous Malformation, Asperger Syndrome, Ataxia, Ataxia Telangiectasia, Ataxias and Cerebellar or Spinocerebellar Degeneration, Atrial Fibrillation and Stroke, Attention Deficit-Hyperactivity Disorder, Autism Spectrum Disorder, Autonomic Dysfunction, Back Pain, Barth Syndrome, Batten Disease, Becker's Myotonia, Behcet's Disease, Bell's Palsy, Benign Essential Blepharospasm, Benign Focal Amyotrophy, Benign intracranial Hypertension, Bernhardt-Roth Syndrome, Binswanger's Disease, Blepharospasm, Bloch-Sulzherger Syndrome, Brachial Plexus Birth Injuries, Brachial Plexus Injuries, Bradbury-Eggleston Syndrome, Brain and Spinal Tumors, Brain Aneurysm, Brain Injury, Brown-Sequard Syndrome, Bulbospinal Muscular Atrophy, Cerebral Autosortial Dominant Arteriopathy with Sub-cortical infarcts and Leukoencephalopathy (CADASJL), Canavan Disease, Carpal Tunnel Syndrome, Causalgia, Cavernomas, Cavernous Angioma, Cavernous Malformation, Central Cervical Cord Syndrome, Central Cord Syndrome, Central Pain Syndrome, Central Pontine Myelinolysis, Cephalic Disorders, Ceramidase Deficiency, Cerebellar Degeneration, Cerebellar Hypoplasia, Cerebral Aneurysms, Cerebral Arteriosclerosis, Cerebral Atrophy, Cerebral Beriberi, Cerebral Cavernous Malformation, Cerebral Gigantism, Cerebral Hypoxia, Cerebral Palsy, Cerebro-Oculo-Facia-Skeletal Syndrome (COPS), Charcot-Mane-Tooth Disease, Chian Malformation, Cholesterol Ester Storage Disease, Chorea, Choreoacanthocytosis, Chronic Inflammatory Demyelinating Polyneuropathy (CIDP), Chronic Orthostatic Intolerance, Chronic Pain, Cockayne Syndrome Type II, Coffin Lowry Syndrome, Colpocephaly, Coma, Complex Regional Pain Syndrome, Congenital Facial Diplegia, Congenital Myasthenia, Congenital Myopathy, Congenital Vascular Cavernous Malformations, Corticobasal Degeneration, Cranial Arteritis, Craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob Disease, Cumulative Trauma Disorders, Cushing's Syndrome, Cytomegalic Inclusion Body Disease, Cytomegalovirus Injection, Dancing Eyes-Dancing Feet Syndrome, Dandy-Walker Syndrome, Dawson Disease, De Morsier's Syndrome, Dejerine-Klumpke Palsy, Dementia, DementiaMulti-infarct, DementiaSemantic, DementiaSubcortical, Dementia With Lewy Bodies, Dentate Cerebellar Ataxia, Dentatorubral Atrophy, Dennatomyositis, Developmental Dyspraxia, Devic's Syndrome, Diabetic Neuropathy, Diffuse Sclerosis, Dravet Syndrome, Dysautonomia, Dysgraphia, Dyslexia, Dysphagia, Dyspraxia, Dyssynergia Cerebellaris Myoclonica, Dyssynergia Cerebellaris Progressiva, Dystonias, Early Infantile Epileptic Encephalopathy, Empty Sella Syndrome, Encephalitis, Encephalitis Lethargica, Encephaloceles, Encephalopathy, Encephalopathy (familial infantile), Encephalotrigeminal Angiomatosis, Epilepsy, Epileptic Hemiplegia, Erb's Palsy, Erb-Duchenne and Dejerine-Klumpke Palsies, Essential Tremor, Extrapontine Myelinolysis, Fabry Disease, Fahr's Syndrome, Fainting, Familial Dysautonomia, Familial Hemangioma, an ilial Idiopathic Basal Ganglia Calcification, Familial Periodic Paralyses, Familial Spastic Paralysis, Farber's Disease, Febrile Seizures, Fibromuscular Dysplasia, Fisher Syndrome, Floppy infant Syndrome, Foot Drop, Friedreich's Ataxia, Frontotemporal Dementia, Gaucher Disease, Generalized Gangliosidoses, Gerstmann's Syndrome, Gerstmann-Straussler-Scheinker Disease, Giant Axonal Neuropathy, Giant Cell Arteritis, Giant Cell Inclusion Disease, Globoid Cell Leukodystrophy, Glossopharyngeal Neuralgia, Glycogen Storage Disease, Guillain-Barre Syndrome, Hallervorden-Spatz Disease, Head Injury, Headache, Hemicrania Continua, Hemifacial Spasm, Hemiplegia Aiterans, Hereditary Neuropathies, Hereditary Spastic Paraplegia, Heredopathia Atactica Polyneuritiformis, Herpes Zoster, Herpes Zoster Oticus, Hirayama Syndrome, Holmes-Adie syndrome, Holoprosencephaly, HTLV-I Associated Myelopathy, Hughes Syndrome, Huntington's Disease, Hydranencephaly, Hydrocephalus, HydrocephalusNormal Pressure, Hydromyelia, Hypercortisolism, Hypersomnia, Hypertonia, Hypotonia, Hypoxia, Immune-Mediated Encephalomyelitis, inclusion Body Myositis, Incontinentia Pigmenti, Infantile Hypotonia, infantile Neuroaxonal Dystrophy, Infantile Phytanic Acid Storage Disease, Infantile Refsum Disease, Infantile Spasms, Inflammatory Myopathies, Iniencephaly, Intestinal Lipodystrophy, Intracranial Cysts, Intracranial Hypertension, Isaacs' Syndrome, Joubert Syndrome, Kearns-Sayre Syndrome, Kennedy's Disease, Kinsbourne syndrome, Kleine-Levin Syndrome, Klippel-Feil Syndrome, Klippel-Trenaunay Syndrome (KTS), Klver-Bucy Syndrome, Korsakofis Amnesic Syndrome, Krabbe Disease, Kugelberg-Welander Disease, Kuru, Lambert-Eaton Myasthenic Syndrome, Landau-Kleffner Syndrome, Lateral Femoral Cutaneous Nerve Entrapment, Lateral Medullary Syndrome, Learning Disabilities, Leigh's Disease, Lennox-Gastaut Syndrome, Lesch-Nyhan Syndrome, Leukodystrophy, Levine-Critchley Syndrome, Lewy Body Dementia, Lipid Storage Diseases, Lipoid Proteinosis, Lissencephaly, Locked-in Syndrome, Lou Gehrig's Disease, LupusNeurological Sequelae, Lyme DiseaseNeurological Complications, Machado-Joseph Disease, Macrencephaly, Megalencephaly, Meikersson-Rosenthal Syndrome, Meningitis, Meningitis and Encephalitis, Menkes Disease, Meralgia Paresthetica, Metachromatic Leukodystrophy, Microceplialy, Migraine, Miller Fisher Syndrome, Mini Stroke, Mitochondrial Myopathy, Moebius Syndrome, Monomelic Amyotrophy, Motor Neuron Diseases, Moyamoya Disease, Mucolipidoses, Mucopolysaccharidoses, Multi-Infarct Dementia, Multifocal Motor Neuropathy, Multiple Sclerosis, Multiple System Atrophy, Multiple System Atrophy with Orthostatic Fly potension, Muscular Dystrophy, MyastheniaCongenital, Myasthenia Gravis, Myelinoclastic Diffuse Sclerosis, Myoclonic Encephalopathy of Infants, Myoclonus, Myopathy, MyopathyCongenital, MyopathyThyrotoxic, Myotonia, Myotonia Congenita, Narcolepsy, Neuroacanthocytosis, Neurodegeneration with Brain Iron Accumulation, Neurofibromatosis, Neuroleptic Malignant Syndrome, Neurological Complications of AIDS, Neurological Complications of Lyme Disease, Neurological Consequences of Cytomegalovirus Infection, Neurological Manifestations of Pompe Disease, Neurological Sequelae Of Lupus, Neuromyelitis Optica, Neuromyotonia, Neuronal Ceroid Lipofuscniosis, Neuronal Migratioft Disorders, NeuropathyHereditary, Neurosarcoidosis, Neurosyphilis, Neuratoxicity, Nevus Cavernosus, Niemann-Pick Disease, O'Sullivan-McLeod Syndrome, Occipital Neuralgia, Ohtahara Syndrome, Olivopontocerebellar Atrophy, Opsoclonus Myoclonus, Orthostatic Hypotension, Overuse Syndrome, Pain -Chronic, Pantothenate Kinase-Associated Neurodegeneration, Paraneoplastic Syndromes, Paresthesia, Parkinson's Disease, Paroxysmal Choreoathetosis, Paroxysmal Hemicrania, Party-Romberg, Pelizaeus-Merzbacher Disease, Pena Shokeir II Syndrome, Perineural Cysts, Periodic, Paralyses, Peripheral Neuropathy, Peri Vefitricular Letikomalacia, Persistent Vegetative State, Pervasive Developmental Disorders, Phylanic Acid Storage Disease, Pick's Disease, Pinched Nerve, Piriformis Syndrome, Pituitary Tumors, Polymyositis, Pompe Disease, Porencephaly, Post-Polio Syndrome, Postherpetic Neuralgia, Postinfectious Encephalomyelitis, Postural Hypotension, Postural Orthostatic Tachycardia Syndrome, Postural Tachycardia Syndrome, Primary Dentatum Atrophy, Primary-Lateral Sclerosis, Primary Progressive Aphasia, Prion Diseases, Progressive Hemifacial Atrophy, Progressive Locomotor Ataxia, Progressive Multifocal Leukoencephalopathy, Progressive Sclerosing Poliodystrophy, Progressive Supranuclear Palsy, Prosopagnosia, Pseudo-Torch syndrome, Pseudotoxoplasniosis syndrome, Pseudotumor Cerebri, Psychogenic Movement, Ramsay Hunt Syndrome I, Ramsay Hunt Syndrome II, Rasmussen's Encephalitis, Reflex Sympathetic Dystrophy Syndrome, Refsum Disease, Refsum DiseaseInfantile, Repetitive Motion Disorders, Repetitive Stress Injuries, Restless Legs Syndrome, Retrovirus-Associated Myelopathy, Rett Syndrome, Reye's Syndrome, Rheumatic Encephalitis, Riley-Day Syndrome, Sacral Nerve Root Cysts, Saint Vitus Dance, Salivary Gland Disease, Sandhoff Disease, Schilder's Disease, Schizencephaly, Seitelberger Disease, Seizure Disorder, Semantic Dementia, Septo-Optic Dysplasia, Severe Myoclonic Epilepsy of Infancy (SMEI), Shaken Baby Syndrome, Shingles, Shy-Drager Syndrome, Sjgrens Syndrome, Sleep Apnea, Sleeping Sickness, Sotos Syndrome, Spasticity, Spina Bifida, Spinal Cord Infarction, Spinal Cord injury, Spinal Cord Tumors, Spinal Muscular Atrophy, Spinocerebellar Atrophy, Spinocerebellar Degeneration, Steele-Richardson-Olszewski Syndrome, Stiff-Person Syndrome, Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute Sclerosing Panencephalitis, Subcortical Arteriosclerotic Encephalopathy, Short-lasting, Unilateral, Neuralgiform (SUNCT) Headache, Swallowing Disorders, Sydenham Chorea, Syncope, Syphilitic Spinal Sclerosis, Syringohydromyelia, Syringomyelia, Systemic Lupus Erythematosus, Tabes Dorsalis, Tardive Dyskinesia, Tarlov Cysts, Tay-Sachs Disease, Temporal Arteritis, Tethered Spinal Cord Syndrome, Thomsen's Myotonia, Thoracic Outlet Syndrome, Thyrotoxic Myopathy, Tic Douloureux, Todd's Paralysis, Tourette Syndrome, Transient Ischemic Attack, Transmissible Spongiform Encephalopathies, Transverse Myelitis, Traumatic Brain Injury, Tremor, Trigeminal Neuralgia, Tropical Spastic Paraparesis, Troyer Syndrome, Tuberous Sclerosis, Vascular Erectile Tumor, Vasculitis Syndromes of the Central and Peripheral Nervous Systems, Von Economo's Disease, Von Hippel-Lindau Disease (VEIL), Von Recklinghausen's Disease, Wallenberg's Syndrome, Werdnig-Hoffman Disease, Wernicke-Korsakoff Syndrome, West Syndrome, Whiplash, Whipple's Disease, Williams Syndrome, Wilson Disease, Wolman's Disease, X-Linked Spinal and Bulbar Muscular Atrophy.

    [0486] Various psychological disorders may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the psychological disorders may be Aboulia, Absence epilepsy, Acute stress Disorder, Adjustment Disorders, Adverse effects of medication NOS, Age related cognitive decline, Agoraphobia, Alcohol Addiction, Alzheimer's Disease, Amnesia (also known as Amnestic Disorder), Amphetamine Addiction, Anorexia Nervosa, Anterograde amnesia, Antisocial personality disorder (also known as Sociopathy), Anxiety Disorder (Also known as Generalized Anxiety Disorder), Anxiolytic related disorders, Asperger's Syndrome (now part of Autism Spectrum Disorder), Attention Deficit Disorder (Also known as ADD), Attention Deficit Hyperactivity Disorder (Also known as ADHD), Autism Spectrum Disorder (also known as Autism), Autophagia, Avoidant Personality Disorder, Barbiturate related disorders, Benzodiazepine related disorders, Bereavement, Bibliomania, Binge Eating Disorder, Bipolar disorder (also known as Manic Depression, includes Bipolar I and Bipolar II), Body Dysmorphic Disorder, Borderline intellectual functioning, Borderline Personality Disorder, Breathing-Related Sleep Disorder, Brief Psychotic Disorder, Bruxism, Bulimia Nervosa, Caffeine Addiction, Cannabis Addiction, Catatonic disorder, Catatonic schizophrenia, Childhood amnesia, Childhood Disintegrative Disorder (now part of Autism Spectrum Disorder), Childhood Onset Fluency Disorder (formerly known as Stuttering), Circadian Rhythm Disorders, Claustrophobia, Cocaine related disorders, Communication disorder, Conduct Disorder, Conversion Disorder, Cotard delusion, Cyclothymia (also known as Cyclothymic Disorder), Delerium, Delusional Disorder, dementia, Dependent Personality Disorder (also known as Asthenic Personality Disorder), Depersonalization disorder (now known as Depersonalization/Derealization Disorder), Depression (also known as Major Depressive Disorder), Depressive personality disorder, Derealization disorder (now known as Depersonalization/Derealization Disorder), Dermotillomania, Desynchronosis, Developmental coordination disorder Diogenes Syndrome, Disorder of written expression, Dispareunia, Dissocial Personality Disorder, Dissociative Amnesia, Dissociative Fugue, Dissociative Identity Disorder (formerly known as Multiple Personality Disorder), Down syndrome, Dyslexia, Dyspareunia, Dysthymia (now known as Persistent Depressive Disorder), Eating disorder NOS, Ekbom's Syndrome (Delusional Parasitosis), Emotionally unstable personality disorder, Encopresis, Enuresis (bedwetting), Erotomania, Exhibitionistic Disorder, Expressive language disorder, Factitious Disorder, Female Sexual Disorders, Fetishistic Disorder, Folie deux, Fregoli delusion, Frotteuristic Disorder, Fugue State, Ganser syndrome, Gambling Addiction, Gender Dysphoria (formerly known as Gender Identity Disorder), Generalized Anxiety Disorder, General adaptation syndrome, Grandiose delusions, Hallucinogen Addiction, Haltlose personality disorder, Histrionic Personality Disorder, Primary hypersomnia, Huntington's Disease, Hypoactive sexual desire disorder, Hypochondriasis, Hypomania, Hyperkinetic syndrome, Hypersomnia, Hysteria, Impulse control disorder, Impulse control disorder NOS, Inhalant Addiction, Insomnia, Intellectual Development Disorder, Intermittent Explosive Disorder, Joubert syndrome, Kleptomania, Korsakoff's syndrome, Lacunar amnesia, Language Disorder, Learning Disorders, Major Depression (also known as Major Depressive Disorder), major depressive disorder, Male Sexual Disorders, Malingering, Mathematics disorder, Medication-related disorder, Melancholia, Mental Retardation (now known as Intellectual Development Disorder), Misophonia, Morbid jealousy, Multiple Personality Disorder (now known as Dissociative Identity Disorder), Munchausen Syndrome, Munchausen by Proxy, Narcissistic Personality Disorder, Narcolepsy, Neglect of child, Neurocognitive Disorder (formerly known as Dementia), Neuroleptic-related disorder, Nightmare Disorder, Non Rapid Eye Movement, Obsessive-Compulsive Disorder, Obsessive-Compulsive Personality Disorder (also known as Anankastic Personality Disorder), Oneirophrenia, Onychophagia, Opioid Addiction, Oppositional Defiant Disorder, Orthorexia (ON), Pain disorder, Panic attacks, Panic Disorder, Paranoid Personality Disorder, Parkinson's Disease, Partner relational problem, Passive-aggressive personality disorder, Pathological gambling, Pedophilic Disorder, Perfectionism, Persecutory delusion, Persistent Depressive Disorder (also known as Dysthymia), Personality change due to a general medical condition, Personality disorder, Pervasive developmental disorder (PDD), Phencyclidine related disorder, Phobic disorder, Phonological disorder, Physical abuse, Pica, Polysubstance related disorder, Postpartum Depression, Post-traumatic embitterment disorder (PLED), Post Traumatic Stress Disorder, Premature ejaculation, Premenstrual Dysphoric Disorder, Psychogenic amnesia, Psychological factor affecting medical condition, Psychoneurotic personality disorder, Psychotic disorder, not otherwise specified, Pyromania, Reactive Attachment Disorder, Reading disorder, Recurrent brief depression, Relational disorder, REM Sleep Behavior Disorder, Restless Leg Syndrome, Retrograde amnesia, Retts Disorder (now part of Autism Spectrum Disorder), Rumination syndrome, Sadistic personality disorder, Schizoaffective Disorder, Schizoid Personality Disorder, Schizophrenia, Schizophreniform disorder, Schizotypal Personality Disorder, Seasonal Affective Disorder, Sedative, Hypnotic, or Anxiolytic Addiction, Selective Mutism, Self-defeating personality disorder, Separation Anxiety Disorder, Sexual Disorders Female, Sexual Disorders Male, Sexual Addiction, Sexual Masochism Disorder, Sexual Sadism Disorder, Shared Psychotic Disorder, Sleep Arousal Disorders, Sleep Paralysis, Sleep Terror Disorder (now part of Nightmare Disorder, Social Anxiety Disorder, Somatization Disorder, Specific Phobias, Stendhal syndrome, Stereotypic movement disorder, Stimulant Addiction, Stuttering (now known as Childhood Onset Fluency Disorder), Substance related disorder, Tardive dyskinesia, Tobacco Addiction, Tourettes Syndrome, Transient tic disorder, Transient global amnesia, Transvestic Disorder, Trichotillomania, Undifferentiated Somatoform Disorder, Vaginismus, and Voyeuristic Disorder.

    [0487] Various lung diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the lung diseases may be Asbestosis, Asthma, Bronchiectasis, Bronchitis, Chronic Cough, Chronic Obstructive Pulmonary Disease (COPD), Croup, Cystic Fibrosis, Hantavirus, Idiopathic Pulmonary Fibrosis, Pertussis, Pleurisy, Pneumonia, Pulmonary Embolism, Pulmonary Hypertension, Sarcoidosis, Sleep Apnea, Spirometry, Sudden Infant Death Syndrome (SIDS), Tuberculosis, Alagille Syndrome, Autoinilinine Hepatitis, Biliary Atresia, Cirrhosis, ERCP (Endoscopic Retrograde Cholangiopancreatography), and Hemochromatosis. Nonalcoholic Steatohepatitis, Porphyria, Primary Biliary Cirrhosis, Primary Sclerosing Cholangitis.

    [0488] Various bone diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the bone diseases may be osteoporosis, neurofibromatosis, osteogenesis imperfecta (OI), rickets, osteosarcoma, achondroplasia, fracture, osteomyelitis, Ewing tumour of bone, osteomalacia hip dysplasia, Paget disease of bone, marble bone disease, osteochondroma, bone cancer, bone disease, osteochondrosis, osteoma, fibrous dysplasia, cleidocranial dysostosis, osteoclastoma, bone cyst, metabolic bone disease, melorheostosis, callus, Caffey syndrome, and mandibulofacial dysostosis.

    [0489] Various blood diseases may be treated with pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the blood diseases ma be Anemia and CKD (for health care professionals), Aplastic Anemia and Myelodysplastic Syndromes, Deep Vein Thrombosis, Hemochromatosis, Hemophilia, Henoch-Schnlein Purpura, Idiopathic Thrombocytopenic Purpura, Iron-Deficiency Anemia, Pernicious Anemia, Pulmonary Embolism, Sickle Cell Anemia, Sickle Cell Trait and Other Hemoglobinopathies, Thalassemia, Thrombotic Thrombocytopenic Purpura, and Von Willebrand Disease.

    [0490] Various diseases associated with TNF-alpha may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may be respiratory disorder; asthma; allergic and nonallergic asthma; asthma due to infection; asthma due to infection with respiratory syncytial virus (RSV); chronic obstructive pulmonary disease (COPD), a condition involving airway inflammation, eosinophilia; fibrosis and excess mucus production; cystic fibrosis; pulmonary fibrosis; an atopic disorder; atopic dermatitis; urticaria; eczema; allergic rhinitis; allergic enterogastritis; an inflammatory and/or autoimmune condition of the skin; an inflammatory and/or autoimmune condition of gastrointestinal organs, inflammatory bowel diseases (IBD); ulcerative colitis; Crohn's disease; an inflammatory and/or autoimmune condition of the liver; liver cirrhosis; liver fibrosis; liver fibrosis caused by hepatitis B and/or C virus, scleroderma; tumors or cancers; hepatocellular carcinoma; glioblastoma; lymphoma; Hodgkin's lymphoma; a viral infection; a bacterial infection; a parasitic infection; HTLV-1 infection; suppression of expression of protective type 1 immune responses, and suppression of expression of a protective type 1 immune response during vaccination, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, septic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondyloarthropathy, systemic lupus erythematosus, Crohn's disease, ulcerative colitis, inflammatory bowel disease, insulin dependent diabetes mellitus, thyroiditis, asthma, allergic diseases, psoriasis, dermatitis scleroderma, graft versus host disease, organ transplant rejection, acute or chronic immune disease associated with organ transplantation, sarcoidosis, atherosclerosis, disseminated intravascular coagulation, Kawasaki's disease, Grave's disease, nephrotic syndrome, chronic fatigue syndrome, Wegener's granulomatosis, Henoch-Schoenlein purpurea, microscopic vasculitis of the kidneys, chronic active hepatitis, uveitis, septic shock, toxic shock syndrome, sepsis syndrome, cachexia, infectious diseases, parasitic diseases, acquired immunodeficiency syndrome, acute transverse myelitis, Huntington's Chorea, Parkinson's disease, Alzheimer's disease, stroke, primary biliary cirrhosis, hemolytic anemia, malignancies, heart failure, myocardial infarction Addison's disease, sporadic, polyglandular deficiency type I and poly glandular deficiency type II, Schmidt's syndrome, adult (acute) respiratory distress syndrome, alopecia, alopecia greata, seronegative arthropathy, arthropathy, Reiter's disease, psoriatic arthropathy, ulcerative colitic arthropathy, enteropathic synovitis, chlamydia, yersinia and salmonella associated arthropathy, spondyloarthropathy, atheromatous disease/arteriosclerosis, atopic allergy, autoimmune bullous disease, pemphigus vulgaris, pemphigus foliaceus, pemphigoid, linear IgA disease, autoimmune haemolytic anaemia, Coombs positive haemolytic anaemia, acquired pernicious anaemia, juvenile pernicious anaemia, myalgic encephalitis/Royal Free Disease, chronic mucocutaneous candidiasis, giant cell arteritis, primary sclerosing hepatitis, cryptogenic autoimmune hepatitis, Acquired Immunodeficiency Disease Syndrome, Acquired Immunodeficiency Related Diseases, hepatitis B, hepatitis C, common varied immunodeficiency (common variable hypogammagiobulinaemia), dilated cardiomyopathy, female infertility, ovarian failure, premature ovarian failure, fibrotic lung disease, cryptogenic fibrosing alveolitis, post-inflammatory interstitial lung disease, interstitial pneumonitis, connective tissue disease associated interstitial lung disease, mixed connective tissue disease associated lung disease, systemic sclerosis associated interstitial lung disease, rheumatoid arthritis associated interstitial lung disease, systemic lupus erythematosus associated lung disease, dermatomyositis/polymyositis associated lung disease, Sjgren's disease associated lung disease, ankylosing spondylitis associated lung disease, vasculitic diffuse lung disease, haemosiderosis associated lung disease, drug-induced interstitial lung disease, fibrosis, radiation fibrosis, bronchiolitis obliterans, chronic eosinophilic pneumonia, lymphocytic infiltrative lung disease, postinfectious interstitial lung disease, gouty arthritis, autoimmune hepatitis, type-1 autoimmune hepatitis (classical autoimmune or lupoid hepatitis), type-2 autoimmune hepatitis (anti-LKM antibody hepatitis), autoimmune mediated hypoglycaemia, type B insulin resistance with acanthosis nigricans, hypoparathyroidism, acute immune disease associated with organ transplantation, chronic immune disease associated with organ transplantation, osteoarthrosis, primary sclerosing Cholangitis, psoriasis type I, psoriasis type 2, idiopathic leucopaenia, autoimmune neutropaenia, renal disease NOS, glomerulonephritides, microscopic vasculitis of the kidneys, Lyme, disease, discoid lupus erythematosus, male infertility idiopathic or NOS, sperm autoimmunity, multiple sclerosis (all subtypes), sympathetic ophthalmia, pulmonary hypertension secondary to connective tissue disease, Goodpasture's syndrome, pulmonary manifestation of polyarteritis nodosa, acute rheumatic fever, rheumatoid spondylitis. Still's disease, systemic sclerosis, Sjrgren's syndrome, Takayasu's disease/arteritis, autoimmune thrombocytopaenia, idiopathic thrombocytopaenia, autoimmune thyroid disease, hyperthyroidism, goitrous autoimmune hypothyroidism (Hashimoto's disease), atrophic autoimmune hypothyroidism, primary myxoedema, phacogenic uveitis, primary vasculitis, vitiligo acute liver disease, chronic liver diseases, alcoholic cirrhosis, alcohol-induced liver choleostasis, idiosyncratic liver disease, drug-Induced hepatitis, non-alcoholic steatohepatitis, allergy and asthma, group B streptococci (GBS) infection, mental disorders (e.g., depression and schizophrenia), Th2 Type and Th1 Type mediated diseases, acute and chronic pain (different forms of pain), and cancers such as lung, breast, stomach, bladder, colon, pancreas, ovarian, prostate and rectal cancer and hematopoietic malignancies (leukemia and lymphoma) abetalipoproteinemia, acrocyanosis, acute and chronic parasitic or infectious processes, acute leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute or chronic bacterial infection, acute pancreatitis, acute renal failure, adenocarcinomas, aerial ectopic beats, AIDS dementia complex, alcohol-induced hepatitis, allergic conjunctivitis, allergic contact dermatitis, allergic rhinitis, allograft rejection, alpha-1-antitrypsin deficiency, amyotrophic lateral sclerosis, anemia, angina pectoris, anterior horn cell degeneration, anti-CD3 therapy, antiphospholipid syndrome, anti-receptor hypersensitivity reactions, aortic and peripheral aneurysms, aortic dissection, arterial hypertension, arteriosclerosis, arteriovenous fistula, ataxia, atrial fibrillation (sustained or paroxysmal), atrial flutter, atrioventricular block, B cell lymphoma, bone graft rejection, bone marrow transplant (BMT) rejection, bundle branch block, Burkitt's lymphoma, burns, cardiac arrhythmias, cardiac stun syndrome, cardiac tumors, cardiomyopathy, cardiopulmonary bypass inflammation response, cartilage transplant rejection, cerebellar cortical degenerations, cerebellar disorders, chaotic or multifocal atrial tachycardia, chemotherapy associated disorders, chronic Myelocylic leukemia (CML), chronic alcoholism, chronic inflammatory pathologies, chronic lymphocytic leukemia (CLL), chronic obstructive pulmonary disease (COPD), chronic salicylate intoxication, colorectal carcinoma, congestive heart failure, conjunctivitis, contact dermatitis, corpulmonale, coronary artery disease, Creutzfeldt-Jakob disease, culture negative sepsis, cystic fibrosis, cytokine therapy associated disorders, dementia pugilistica, demyelinating diseases, dengue hemorrhagic fever, dermatitis, dermatologic conditions, diabetes, diabetes mellitus, diabetic arteriosclerotic disease, Diffuse Lewy body disease, dilated congestive cardiomyopathy, disorders of the basal ganglia, Down's Syndrome in middle age, drug-induced movement disorders induced by drugs which block CNS dopamine receptors, drug sensitivity, eczema, encephalomyelitis, endocarditis, endocrinopathy, epiglottitis, Epstein-Barr virus infection, erythromelalgia, extrapyramidal and cerebellar disorders, familial hemophagocytic lymphohistiocytosis, fetal thymus implant rejection. Friedreich's ataxia, functional peripheral arterial disorders, fungal sepsis, gas gangrene, gastric ulcer, glomerular nephritis, graft rejection of any organ or tissue, gram negative sepsis, gram positive sepsis, granulomas due to intracellular organisms, hairy cell leukemia, Hallervorden-Spatz disease, Hashimoto's thyroiditis, hay fever, heart transplant rejection, hemochromatosis, hemodialysis, hemolytic uremic syndrome/thrombolytic thrombocytopenic purpura, hemorrhage, hepatitis (A), His bundle arrhythmias, HIV infection/HIV neuropathy, Hodgkin's disease, hyperkinetic movement disorders, hypersensitivity reactions, hypersensitivity pneumonitis, hypertension, hypokinetic movement disorders, hypothalamic-pituitary-adrenal axis evaluation, idiopathic Addison's disease, idiopathic pulmonary fibrosis, antibody mediated cytotoxicity, asthenia, infantile spinal muscular atrophy, inflammation of the aorta, influenza a, ionizing radiation exposure, iridocyclitis/uveitis/optic neuritis, ischemia-reperfusion injury, ischemic stroke, juvenile rheumatoid arthritis (JRA), juvenile spinal muscular atrophy, Kaposi's sarcoma, kidney transplant rejection, legionella leishmaniasis, leprosy, lesions of the corticospinal system, lipedema, liver transplant rejection, lymphederna, malaria, malignant lymphoma, malignant histiocytosis, malignant melanoma, meningitis, meningococcemia, metabolic/idiopathic, migraine headache, mitochondrial multi-system disorder, mixed connective tissue disease, monoclonal gammopathy, myeloma, multiple systems degenerations (Menzel, Dejerine-Thomas, Shy-Drager, and Machado-Joseph), myasthenia gravis, mycobacterium avium intracellulare, mycobacterium tuberculosis, myelodysplastic syndrome, myocardial infarction, myocardial ischemic disorders, nasopharyngeal carcinoma, neonatal chronic lung disease, nephritis, nephrosis, neurodegenerative diseases, neurogenic I muscular atrophies, neutropenic fever, non-Hodgkins lymphoma, occlusion of the abdominal aorta and its branches, occlusive arterial disorders, OKT3 therapy, orchitis/epidydimitis, orchitis/vasectomy reversal procedures, organomegaly, osteoporosis, pancreas transplant rejection, pancreatic carcinoma, paraneoplastic syndrome/hypercalcemia of malignancy, parathyroid transplant rejection, pelvic inflammatory disease, perennial rhinitis, pericardial disease, peripheral atherosclerotic disease, peripheral vascular disorders, peritonitis, pernicious anemia, pneumocystis carinii pneumonia, pneumonia, POEMS syndrome (polyneuropathy, organomegaly, endocrinopathy, monoclonal gammopathy, and skin changes syndrome), post perfusion syndrome, post pump syndrome, post-MI cardiotomy syndrome, preeclampsia, progressive supranucleo palsy, primary pulmonary hypertension, radiation therapy, Raynaud's phenomenon and disease, Raynaud's disease, Refsum's disease, regular narrow QRS tachycardia, renovascular hypertension, reperfusion injury, restrictive cardiomyopathy, sarcomas, scleroderma, senile chorea, senile dementia of Lewy body type, seronegative arthropathies, shock, sickle cell anemia, skin allograft rejection, skin changes syndrome, small bowel transplant rejection, solid tumors, specific arrhythmias, spinal ataxia, spinocerebellar degenerations, streptococcal myosins, structural lesions of the cerebellum, subacute sclerosing panencephalitis, syncope, syphilis of the cardiovascular system, systemic anaphylaxis, systemic inflammatory response syndrome, systemic onset juvenile rheumatoid arthritis, T-cell or FAB ALL, telangiectasia, thromboangitis obliterans, thrombocytopenia, toxicity, transplants, trauma/hemorrhage, type III hypersensitivity reactions, type IV hypersensitivity, unstable angina, uremia, urosepsis, urticaria, valvular heart diseases, varicose veins, vasculitis, venous diseases, venous thrombosis, ventricular fibrillation, viral and fungal infections, viral encephalitis/aseptic meningitis, viral-associated hemophagocytic syndrome, Wernicke-Korsakoff syndrome, Wilson's disease, xenograft rejection of any organ or tissue, acute coronary syndromes, acute idiopathic polyneuritis, acute inflammatory demyelinating polyradiculoneuropathy, acute ischemia, adult Still's disease, alopecia greata, anaphylaxis, anti-phospholipid antibody syndrome, aplastic anemia, arteriosclerosis, atopic eczema., atopic dermatitis, autoimmune dermatitis, autoimmune disorder associated with streptococcus infection, autoimmune enteropathy, autoimmune hearing loss, autoimmune lymphoproliferative syndrome (ALPS), autoimmune myocarditis, autoimmune premature ovarian failure, blepharitis, bronchiectasis, bullous pemphigoid, cardiovascular disease, catastrophic antiphospholipid syndrome, celiac disease, cervical spondylosis, chronic ischernia cicatricial pemphigoid, clinically isolated syndrome (CIS) with risk for multiple sclerosis, conjunctivitis, childhood onset psychiatric disorder, chronic obstructive pulmonary disease (COPD), dacryocystitis, dermatomyositis, diabetic retinopathy, diabetes mellitus, disk herniation, disk prolapse, drug induced immune hemolytic anemia, endocarditis, endometriosis, endophthalmitis, episcleritis, erythema multiforme, erythema multiforme major, gestational pemphigoid, Guillain-Barre syndrome (GBS), hay fever, Hughes syndrome, idiopathic Parkinson's disease, idiopathic interstitial pneumonia, IgE-mediated allergy, immune hemolytic anemia, inclusion body myositis, infectious ocular inflammatory disease, inflammatory demyelinating disease, inflammatory heart disease, inflammatory kidney disease, IPF/UIP, iritis, keratitis, keratojunctivitis, Kussmaul disease or Kussmaul-Meier disease, Landry's paralysis, Langerhan's cell histiocytosis, livedo reticularis, macular degeneration, microscopic polyangiitis, morbus bechterev, motor neuron disorders, mucous membrane pemphigoid, multiple organ failure, myasthenia gravis, myelodysplastic syndrome, myocarditis, nerve root disorders, neuropathy, non-A non-B hepatitis, optic neuritis, osteolysis, ovarian cancer, pauciarticular JRA, peripheral artery occlusive disease (PAOD), peripheral vascular disease (PVD), peripheral artery disease (PAD), phlebitis, polyarteritis nodosa (or periarteritis nodosa), polychondris, polymyalgia rheumatica, poliosis, polyarticular JRA, polyendocrine deficiency syndrome, polymyositis, polymyalgia rheumatica (PMR), post-pump syndrome, primary Parkinsonism, prostate and rectal cancer and hematopoietic malignancies (leukemia and lymphoma), prostatitis, pure red cell aplasia, primary adrenal insufficiency, recurrent neuronwelitis optica, restenosis, rheumatic heart disease, sapho (synovitis, acne, pustulosis, hyperostosis, and osteitis), scleroderma, secondary amyloidosis, shock lung, scleritis, sciatica, secondary adrenal insufficiency, silicone associated connective tissue disease, Sneddon-Wilkinson dermatosis, spondylitis ankylosans, Stevens-Jonson syndrome (SJS), systemic inflammatory response syndrome, temporal arteritis, toxoplasmic retinitis, toxic epidermal necrolysis, transverse myelitis, TRAPS (tumor necrosis factor receptor associated periodic syndrome), type I allergic reaction, type II diabetes, urticaria, usual interstitial pneumonia (LIP), vasculitis, vernal conjunctivitis, viral retinitis, Vogt-Koyanagi-Harada syndrome (VKH syndrome), wet macular degeneration, wound healing, yersinia or salmonella associated arthropathy.

    [0491] Various receptor for advanced glycation endproducts (RAGE) diseases may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may be Amyotrophic Lateral Sclerosis, Brachial Plexus Injury, Brain Injury, including traumatic brain injury, Cerebral Palsy, Friedrich's Ataxia, Guillain Barre, Leukodystrophies, Multiple Sclerosis, Post Polio, Spina Bifida, Spinal Cord Injury, Spinal Muscle Atrophy, Spinal Tumors, Stroke, Transverse Myelitis, dementia, senile dementia, mild cognitive impairment, Alzheimer-related dementia, Huntington's chorea, tardive dyskinesia, hyperkinesias, manias, Morbus Parkinson, steel-Richard syndrome, Downs syndrome, myasthenia ciravis, nerve trauma, vascular amyioidosis, cerebral hemorrhage I with amyloidosis, brain inflammtion, Friedrich's ataxia, acute confusion disorder, amyotrophic lateral sclerosis, glaucoma, Alzheimer's disease, diabetic nephropathy, sepsis, rheumatoid arthritis and related inflammatory diseases.

    [0492] Various neurite degenerative diseases may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may he multiple sclerosis. Parkinson's disease, Alzheimer's disease, Tay-Sachs disease, Niemann-Pick disease, Gaucher's disease, Hurler's syndrome, Huntington's disease, amyotrophic lateral sclerosis, idiopathic inflammatory demyelinating diseases, vitamin B12 deficiency, central pontine myelinolysis, tabes dorsalis, transverse myelitis, Devic's disease, progressive multifocal leukoencephalopathy, optic neuritis, traumatic injury to the CNS, an ischemic cerebral stroke, glaucoma, diabetic retinopathy, age-dependent macular degeneration, and a leukodystrophy.

    [0493] Various neurological diseases may be treated with the pharmaceutical compositions, AAV particles, of the present invention. As a non-limiting example, the disease may be Amyotrophic Lateral Sclerosis, Brachial Plexus Injury, Brain Injury, including traumatic brain injury, Cerebral Palsy, Guillain Barre, Leukodystrophies, Multiple Sclerosis, Post Polio, Spina Bifida, Spinal Cord Injury, Spinal Muscle Atrophy, Spinal Tumors, Stroke, Transverse Myelitis; dementia, senile dementia, mild cognitive impairment, Alzheimer-related dementia, Huntington's chorea, tardive dyskinesia, hyperkinesias, manias, Morbus Parkinson, steel-Richard syndrome, Down's syndrome, myasthenia gravis, nerve trauma, vascular amyloidosis, cerebral hemorrhage I with amyloidosis, brain inflammation, acute confusion disorder, amyotrophic lateral sclerosis, glaucoma and Alzheimer's disease.

    [0494] Various cancers may be treated with pharmaceutical compositions, AAV particles, of the present invention. As used herein, the term cancer refers to any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites and also refers to the pathological condition characterized by such malignant neoplastic growths. Cancers may be tumors or hematological malignancies, and include but are not limited to, all types of lymphomas/leukemias, carcinomas and sarcomas, such as those cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon/rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal marrow, tailbone, testicles, thyroid and uterus.

    [0495] Types of carcinomas which may be treated with the AAV particles of the present invention include, but are not limited to, papilloma/carcinoma, choriocarcinoma, endodermal sinus tumor, teratoma, adenoma/adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma, angioma, osteoma, chondroma, glioma, lymphornalleukemia, squamous cell carcinoma, small cell carcinoma, large cell undifferentiated carcinomas, basal cell carcinoma and sinonasal undifferentiated carcinoma.

    [0496] Types of sarcomas which may be treated with the AAV particles of the present invention include, but are not limited to, soft tissue sarcoma such as alveolar soft part sarcoma, angiosarcoma, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, and Askin's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma.

    [0497] As a non-limiting example, the cancer which may be treated may be Acute granulocytic leukemia, Acute lymphocytic leukemia, Acute elogenous leukemia, Adenocarcinoma, Adenosarcoma, Adrenal cancer, Adrenocortical carcinoma, Anal cancer, Anaplastic astrocytoma, Angiosarcoma, Appendix cancer, Astrocytoma, Basal cell carcinoma, B-Cell lymphoma), Bile duct cancer, Bladder cancer, Bone cancer, Bowel cancer, Brain cancer, Brain stein glioma, Brain tumor, Breast cancer, Carcinoid tumors, Cervical cancer, Cholangiocarcinoma, Chondrosarcoma, Chronic lymphocytic leukemia, Chronic myelogenous leukemia, Colon cancer, Colorectal cancer, Craniopharyngioma, Cutaneous lymphoma, Cutaneous melanoma, Diffuse astrocytoma, Ductal carcinoma in situ, Endometrial cancer, Ependymoma, Epithelioid sarcoma, Esophageal cancer, Ewing sarcoma, Extrahepatic bile duct cancer, Eye cancer, Fallopian tube cancer, Fibrosarcoma, Gallbladder cancer, Gastric cancer, Gastrointestinal cancer, Gastrointestinal carcinoid cancer, Gastrointestinal stromal tumors, General, Genn cell tumor, Glioblastoma multiforme, Glioma, Hairy cell leukemia, Head and neck cancer, Hemangioendothelioma, Hodgkin lymphoma, Hodgkins disease, Hodgkin's lymphoma, Hypopharyngeal cancer, infiltrating ductal carcinoma, infiltrating lobular carcinoma, Inflammatory breast cancer, Intestinal Cancer, Intrahepatic bile duct cancer, invasive/infiltrating breast cancer, Islet cell cancer, Jaw cancer, Kaposi sarcoma, Kidney cancer, Laryngeal cancer, Leiomyosarcoma, Leptomeningeal metastases, Leukemia, Lip cancer, Liposarcoma, Liver cancer, Lobular carcinoma in situ, Low-grade astrocytoma, Lung cancer, Lymph node cancer, Lymphoma, Male breast cancer, Medullar carcinoma, Medulloblastoma, Melanoma, Meningioma, Merkel cell carcinoma, Mesenchymal chondrosarcoma, Mesenchymous, Mesothelioma, Metastatic breast cancer, Metastatic melanoma, Metastatic squamous neck cancer, Mixed gliomas, Mouth cancer, Mucinous carcinoma, Mucosal melanoma, Multiple myeloma, Nasal cavity cancer, Nasopharyngeal cancer, Neck cancer, Neuroblastoma, Neuroendocrine tumors, Non-Hodgkin lymphoma, Non-Hodgkin's lymphoma, Non-small cell lung cancer, Oat cell cancer, Ocular cancer, Ocular melanoma, Oligodendroglioma, Oral cancer, Oral cavity cancer, Oropharyngeal cancer, Osteogenic sarcoma, Osteosarcoma, Ovarian cancer, Ovarian epithelial cancer, Ovarian germ cell tumor, Ovarian primary peritoneal carcinoma, Ovarian sex cord stromal tumor, Paget's disease, Pancreatic cancer, Papillary carcinoma, Paranasal sinus cancer, Parathyroid cancer, Pelvic cancer, Penile cancer, Peripheral nerve cancer, Peritoneal cancer, Pharyngeal cancer, Pheochromocytoma, Pilocytic astrocytoma, Pineal region tumor, Pineoblastoma, Pituitary gland cancer, Primary central nervous system lymphoma, Prostate cancer, Rectal cancer, Renal cell cancer, Renal pelvis cancer, Rhabdomyosarcoma, Salivary gland cancer, Sarcoma, Sarcoma, bone, Sarcoma, soft tissue, Sarcoma, uterine, Sinus cancer, Skin cancer, Small cell lung cancer, Small intestine cancer, Soil tissue sarcoma, Spinal cancer, Spinal column cancer, Spinal cord cancer, Spinal tumor, Squamous cell carcinoma, Stomach cancer, Synovial sarcoma, T-cell lymphoma), Testicular cancer, Throat cancer, Thymoma/thymic carcinoma, Thyroid cancer, Tongue cancer, Tonsil cancer, Transitional cell cancer, Transitional cell cancer, Transitional cell cancer, Triple-negative breast cancer, Tubal cancer, Tubular carcinoma, Ureteral cancer, Ureteral cancer, Urethral cancer, Uterine adenocarcinoma, Uterine cancer, Uterine sarcoma, Vaginal cancer, and Vulvar cancer.

    Diagnostic Applications

    [0498] The AAV particles of the present invention may be used for diagnostic purposes or as diagnostic tools for any of the aforementioned diseases or disorders. As a non-limiting example, the AAV particles of the present invention or the antibodies encoded within the viral genome therein may be used as a biomarker for disease diagnosis. As a second non-limiting example, the AAV particles of the present invention or the antibodies encoded within the viral genome therein may be used for diagnostic imaging purposes, e.g., Mill PET, CT or ultrasound.

    Preventative Applications

    [0499] The AAV particles of the present invention or the antibodies encoded by the viral genome therein may be used to prevent disease or stabilize the progression of disease. In one embodiment, the AAV particles of the present invention are used to as a prophylactic to prevent a disease or disorder in the future. In one embodiment, the AAV particles of the present invention are used to halt further progression of a disease or disorder. As a non-limiting example, the AAV particles of the invention may be used in a manner similar to that of a vaccine.

    Research Applications

    [0500] The AAV particles of the present invention or the antibodies encoded by the viral genome therein may also be used as research tools. The AAV particles of the invention may be used as in any research experiment, e.g., in vivo or in vitro experiments. In a non-limiting example, the AAV particles of the invention may be used in cultured cells. The cultured cells may be derived from any origin known to one with skill in the art, and may be as non-limiting examples, derived from a stable cell line, an animal model or a human patient or control subject. In a non-limiting example, the AAV particles of the invention may be used in in vivo experiments in animal models (i.e., mouse, rat, rabbit, dog, cat, non-human primate, guinea pig, tenet, c-elegans, drosophila, zebrafish, or any other animal used for research purposes, known in the art) in another non-limiting example, the AAV particles of the invention may be used in human research experiments or human clinical trials.

    Combination Applications

    [0501] The AAV particles of the invention may be used as a combination therapy with any other therapeutic molecule known in the art. The therapeutic molecule may be approved by the US Food and Drug Administration or may be in clinical trial or at the preclinical research stage. The therapeutic molecule may utilize any therapeutic modality known in the art, with non-limiting examples including gene silencing or interference (i.e., miRNA, siRNA, RNAi, shRNA), gene editing (i.e., TALEN, CRISPR/Cas9 systems, zinc finger nucleases), and gene, protein or enzyme replacement.

    Therapeutic Applications

    [0502] The present disclosure additionally provides a method for treating non-infectious diseases and/or disorders in a mammalian subject, including a human subject, comprising administering to the subject any of the AAV particles or pharmaceutical compositions of the invention. In some embodiments, non-infectious diseases and/or disorders treated according to the methods described herein include, but are not limited to, Parkinson's Disease (PD), Dementia with Lewy Bodies (DLB), Multiple System Atrophy (MSA), Decreased muscle mass, Spinal muscular atrophy (SMA) Alzheimer's disease (AD), Amyotrophic lateral sclerosis (ALS), Huntington's Disease (HD), Multiple sclerosis (MS), Stroke, Migraine, Pain, Neuropathies, Psychiatric disorders including schizophrenia, bipolar disorder, and autism, Cancer, ocular diseases, systemic diseases of the blood, heart and bone, Immune system and Autoimmune diseases and inflammatory diseases.

    [0503] In some embodiments, methods of treating non-infectious diseases and/or disorders in a subject in need thereof may comprise the steps of: (1) deriving, generating and/or selecting an antibody, antibody-based composition or fragment thereof that targets the antigen of interest; (2) producing an AAV particle with a viral genome that includes a payload region encoding the selected antibody of (1); and (3) administering the AAV particle (or pharmaceutical composition thereof) to the subject.

    [0504] The present disclosure provides a method for administering to a subject in need thereof, including a human subject, a therapeutically effective amount of the AAV particles of the invention to slow, stop or reverse disease progression. As a non-limiting example, disease progression may be measured by tests or diagnostic tool(s) known to those skilled in the art. As another non-limiting example, disease progression may be measured by change in the pathological features of the brain, CSF or other tissues of the subject.

    Parkinson's Disease

    [0505] Parkinson's Disease (PD) is a progressive disorder of the nervous system affecting especially the substantia nigra of the brain. PD develops are a result of the loss of dopamine producing brain cells. Typical early symptoms of PD include shaking or trembling of a limb, e.g. hands, arms, legs, feet and face. Additional characteristic symptoms are stiffness of the limbs and torso, slow movement or an inability to move, impaired balance and coordination, cognitional changes, and psychiatric conditions e.g. depression and visual hallucinations. PD has both familial and idiopathic forms and it is suggestion to be involved with genetic and environmental causes. PD affects more than 4 million people worldwide. In the US, approximately 60, 000 cases are identified annually. Generally, PD begins at the age of 50 or older. An early-onset form of the condition begins at age younger than 50, and juvenile-onset PD begins before age of 20.

    [0506] Death of dopamine producing brain cells related to PD has been associated with aggregation, deposition and dysfunction of alpha-synuclein protein (see, e.g. Marques and Outeiro. 2012, Cell Death Dis. 3:e350, Jenner, 1989, J Neural Neurosurg Psychiatry. Special Supplement, 22-28, and references therein). Studies have suggested that alpha-synuclein has a role in presynaptic signaling, membrane trafficking and regulation of dopamine release and transport. Alpha-synuclein aggregates, e.g. in forms of oligomers, have been suggested to be species responsible for neuronal dysfunction and death. Mutations of the alpha-synuclein gene (SNCA) have been identified in the familial forms of PD, but also environmental factors, e.g. neurotoxin affect alpha-synuclein aggregation. Other suggested causes of brain cell death in PD are dysfunction of proteosomal and lysosomal systems, reduced mitochondrial activity.

    [0507] PD is related to other diseases related to alpha-synuclein aggregation, referred to as synucleinopathies. Such diseases include, but are not limited to, Parkinson's Disease Dementia (PDD), multiple system atrophy (MSA), dementia with Lewy bodies, juvenile-onset generalized neuroaxonal dystrophy (Hallervorden-Spatz disease), pure autonomic failure (PAF), neurodegeneration with brain iron accumulation (NBIA-1) and combined Aliheimer's and Parkinson's disease.

    [0508] As of today, no cure or prevention therapy for PD has been identified. A variety of drug therapies available provide relief to the symptoms. Non-limiting examples of symptomatic medical treatments include carbidopa and levodopa combination reducing stiffness and slow movement, and anticholinergics to reduce trembling and stiffness. Other optional therapies include e.g. deep brain stimulation and surgery. There remains a need for therapy affecting the underlying pathophysiology. For example, antibodies targeting alpha.-synuclein. protein, or other proteins relevant for brain cell death in PD, may be used to prevent and/or treat PD.

    [0509] In some embodiment, methods of the present invention may be used to treat subjects suffering from PD and other synucleinopathies. In some cases, methods of the present invention may be used to treat subjects suspected of developing PD and other synucleinopathies.

    [0510] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat PD. As a non-limiting, example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 3 (SEQ ID NO: 2948-17938).

    Dementia with Lewy Bodies

    [0511] Dementia with Lewy Bodies (DLB), also known as diffuse Lewy body disease, is a form of progressive dementia, characterized by cognitive decline, fluctuating alertness and attention, visual hallucinations and parkinsonian motor symptoms. DLB may be inherited by an autosomal dominant pattern. DLB affects more than I million individuals in the US. The condition typically shows symptoms at the age of 50 or older.

    [0512] DLB is caused by the abnormal build-up of Lowy bodies, aggregates of the alpha-synuclein protein, in the cytoplasm of neurons in the brain areas controlling memory and motor control. The pathophysiology of these aggregates is very similar to aggregates observed in Parkinson's disease and DLB also has similarities to Alzheimer's disease. Inherited DLB has been associated with gene mutations in SNCA and SNCB genes, producing synuclein proteins.

    [0513] As of today, there is no cure or prevention therapy for DLB. A variety of drug therapies available are aimed at managing the cognitive, psychiatric and motor control symptoms of the condition. Non-limiting examples of symptomatic medical treatments include e.g. acetylchohnesterase inhibitors to reduce cognitive symptoms, and levodopa to reduce stiffness and loss of movement. There remains a need for therapy affecting the underlying pathophysiology. Antibodies targeting alpha-synuclein protein may be used to prevent and/or treat DLB.

    [0514] In some embodiment, methods of the present invention may be used to treat subjects suffering from DLB. In some cases, methods of the present invention may be used to treat subjects suspected of developing DLB.

    [0515] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat DLB. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 3 (SEQ ID NO: 2948-17938).

    Multiple System Atrophy

    [0516] Multiple system atrophy (MS), also known as Shy-Drager Syndrome, is a progressive neurodegenerative disorder. The characteristic symptoms are associated with failure of autonomic nervous system causing dizziness, fainting, bladder control problems, and problems regulating heart rate, blood pressure and breathing, accompanied by motor control symptoms similar to Parkinson's disease, e.g. tremor, rigidity and loss of muscle coordination. The symptoms are a reflection of the loss of nerve cells in certain areas of the brain and spinal cord. The disease typically develops around ages of 50 or 60 years. MSA affects approximately 50,000 individuals in the US.

    [0517] MSA belongs to the synucleinopathies and is characterized by the appearance of glial cytoplasmic inclusions (Gus) in oligodendrocytes, which are the myelin producing support cells of the central nervous system (see, e.g. Teasel et al. 2014, Acta Neuropatholagica Communications, 2014, 2:15, and references therein). GCIs comprise insoluble proteinaceous filaments composed of the alpha-synuclein protein. Also, tau proteins have been identified in GCIs. The pathophysiology of the CGIs is not yet fully understood but alpha-synuclein and tau proteins are suggested to have a role in the development and progression of SMA.

    [0518] As of today, there is no cure or prevention therapy for MSA. A variety of drug therapies available are aimed at managing the symptoms. Non-limiting examples of symptomatic medical treatments include those used for Parkinson's disease to relief symptoms related motor movement, increased salt intake and steroid hormones for increasing blood pressure. There remains a need for therapy affecting the underlying pathophysiology. Antibodies targeting tau and alpha.-synuclein proteins may be used to prevent and/or treat MSA.

    [0519] In some embodiment, methods of the present invention may be used to treat subjects suffering from MSA. In some cases, methods of the present invention may be used to treat subjects suspected of developing MSA.

    [0520] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat MSA. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 6 (SEQ ID NO: SEQ ID NO: 2948-2970, 3018-3046, 3056-3076, 3110-3130, 3132-3177, 3181-3196, 32.42-3268, 3275-3285, 3315-3336, 3338-3371, 3375-3382, 4268-4494).

    Decreased Muscle Mass, Muscle Strength and Muscle Function

    [0521] A number of diseases, disorders and condition are associated with muscle weakness, which refers to reduced muscle mass, muscle strength and muscle function. For example, such disorders include myopathies, which are neuromuscular disorders characterized by muscle weakness due to dysfunction of muscle fiber. Myopathies include, but are not limited to, congenital myopathies, muscular dystrophies, mitochondrial myopathies, glycogen storage diseases of muscle, myoglobinurias, dermatomyositis, myositis ossificans, familial periodic paralysis, polymyositis, inclusion body myositis, and related myopathies, neurornyotonia, stiff-man syndrome, common muscle cramps and stiffness, and tetany. Muscle weakness may also be caused by ageing, diabetes, obesity, chronic pain, peripheral vascular disease, chronic lung diseases, heart diseases, cancers, anemia, arthritis, chronic renal failure and renal diseases, chronic obstructive pulmonary disease, multiple sclerosis (MS), stroke, muscular dystrophy, motor neuron neuropathy, amyotrophic lateral sclerosis (ALS), Parkinson's disease, osteoporosis, osteoarthritis, fatty acid liver disease, liver cirrhosis, Addison's disease. Cushing's syndrome, acute respiratory distress syndrome, steroid induced muscle wasting, myositis, scoliosis, or infections e.g influenza, Epstein-Barr virus infection, HIV/AIDS, Lyme disease, and hepatitis C infection. Muscle weakness may occur after surgery, bum trauma, medical treatment, or trauma through an injury. Severity of muscle weakness varies. In many cases the condition reduces the quality of life significantly, or may be even life-threatening.

    [0522] A regulator protein associated with muscles is Myostatin (MSTN), also known as growth and differentiation factor 8 (GDF-8). Myostatin is a protein encoded by the MSTN gene, released in the myocytes. Myostatin and myostatin receptors (e.g. ACVR2A aud ACVR2B), have a role in suppressing the growth and development of muscle tissue in the body.

    [0523] Treatment of muscle weakness depends on the underlying disease or condition, and may include e.g. drug therapy, good nutrition, physiotherapy, mechanical support for weakened muscles and/or surgery. However, efficient therapy to treat a combination of loss of muscle Mass, muscle strength and muscle function are needed. Antibodies targeting myostatin be used in the treatment and prophylaxis of diseases associated with such conditions. For example, himagrumab (developed by Novartis) is a monoclonal antibody targeting ACVR2B myostatin receptor, and used for therapy of musculoskeletal diseases and domagrozumab (developed by Pfizer) is an antibody targeting triyostatin, and used for therapy of muscle degeneration and muscle weakness.

    [0524] In some embodiment, methods of the present invention may be used to treat subjects suffering from loss of muscle mass, muscle strength and muscle function. In some cases, methods of the present invention may he used to treat subjects suspected of developing such conditions.

    [0525] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat MSA. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 6 (SEQ ID NO: SEQ ID NO: 2948-2970, 3018-3046, 3056 3076, 3110-3130, 3132-3177, 3181-3196, 3242-3268, 3275-3285, 3315-3336, 3338-3371, 3375-3382, 4268-4494).

    Spinal Muscular Atrophy

    [0526] Spinal muscular atrophy (SMA) is a hereditary disease causing weakness and wasting of the voluntary muscles in the arms and legs of infants and children. SMA is associated with abnormalities in the protein production of the survival motor neuron gene 1 (SMN1). Lack of the protein affects degeneration and death of lower motor neurons. Typical symptoms include floppy limbs and trunk, feeble movement of the arms and legs, difficulties in swallowing and eating, and impaired breathing. SMA is the most common genetic disorder leading to death of children under 2 years of age. SMA affects one in 6,000 to 10,000 people.

    [0527] As of today, there is no cure for SMA. Therapies available are aimed at management of the symptoms and prevention of additional complications. Such therapies are associated e.g. with cardiology, movement management, respiratory care and mental health. There remains a need for therapy affecting the underlying pathophysiology of SMA.

    [0528] In some embodiment, methods of the present invention may be used to treat subjects suffering from SMA. In some cases, methods of the present invention may he used to treat subjects suspected of developing SMA.

    [0529] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat SMA. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 6 (SEQ ID NO: SEQ ID NO: 2948-2970, 3018-3046, 3056-3076, 3110-3130, 3132-3177, 3181-3196, 3242-3268, 3275-3285, 3315-3336, 3338-3371, 3375-3382, 4268-4494).

    Alzheimer's Disease

    [0530] Alzheimer's Disease (AD) is a debilitating neurodegenerative disease and the most common form of dementia affecting the memory, thinking and behavior. Typical early symptom is difficulty of remembering newly learned information. As the disease adsances, symptoms include disorientation, changes in sleep, changes in mood and behavior, confusion, unfound suspicions and eventually difficulty to speak, swallow and walk. AD currently afflicts more than 35 million people worldwide, with that number expected to double in coming decades.

    [0531] As of today, no cure or prevention therapy for AD has been identified. Drug therapy to treat memory loss, behavioral changes and sleep changes, and to slow down the progression of AD are available. However, these symptomatic treatments do not address the underlying pathophysiology.

    [0532] The AD brain is characterized by dual aggregates, the extracellular -amyloid plaques and the intracellular neurofibrillary tangles (NFT) of misfolded, hyperphosphorylated microtubule associated, tau proteins. The -amyloid plaques may lead to pathological cascades that are associated with a number of proteins, such as, but not limited to, APP (amyloid beta (A4) precursor protein), A beta (amyloid beta), BACE (Beta-secretases), and APOE (apolipoprotein E). Historically, it has been thought that amyloid pathology precedes the appearance of NET, and therefore, that tau pathology in the form of aggregates is symbolic of impending cell death (Selkoe, D.J., 2001, Physiological Reviews, 81(2):741-66). However, clinical trials addressing amyloid pathology have largely failed thus far and advances in the field suggest that targeting tau aggregates may be advantageous and lead to improved cognitive

    [0533] In some embodiment, methods of the present invention may be used to treat subjects suffering from AD. In some cases, methods of the present invention may be used to treat subjects suspected of developing AD.

    [0534] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat AD. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 4 (SEQ ID NO: 2948-2970, 2977-2998, 3018-3046, 3056-3076, 3110-3177, 3181-3196, 3205-3226, 3242-3268, 3275-3285, 3315-3371, 3375-3382, 3385-4258).

    Huntington's Disease

    [0535] Huntington's disease (HD) is a rare, inherited disorder causing degeneration of neurons in the motor control region of the brain, as well as other areas. Typical symptoms of the disease include uncontrolled movements (chorea), abnormal postures, impaired coordination, slurred speech and difficulty of feeding and swallowing accompanied by changes in behavior, judgment and cognition. HD is caused by mutations in the gene associated with the huntingtin (HTT) protein. The mutation causes the (CAG) blocks of DNA to repeat abnormally many times. HD affects approximately 30, 000 individuals in the US.

    [0536] HD is characterized by mutations of the huntingtin (HTT) protein with abnormal expansions of polyglutamine tracts, e.g. expansion of the length of glutamine residues encoded by CAG repeats. The expansion threshold for occurrence of the disease is considered to be approximately 35-40 residues. HD is also associated with beta sheet rich aggregates in striatal neurons formed by N-terminal region of HTT. The expansions and aggregates lead to gradual loss of neurons as HD progresses. Additionally, the cell death in HD is associated with death receptor 6 (DR6) which is known to induce apoptosis.

    [0537] As of today, there is no therapy to cure, or prevent the progression of the disease. Drug therapies available are aimed at management of the symptoms. For example, FDA has approved tetrabenazine to be prescribed for prevention of chorea. Additionally, e.g. antipsychotic drugs may help to control delusions, hallucinations and violent outbursts. There remains a need for therapy affecting the underlying pathophysiology, such as antibody therapies targeting the HTT protein, DR6 protein, and/or other HD associated proteins.

    [0538] In some embodiment, methods of the present invention may be used to treat subjects suffering from HD. In some cases, methods of the present invention may be used to treat subjects suspected of developing HD.

    [0539] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat HD. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Tables (SEQ ID NO: 2948-2970, 3018-3021, 3031-3046, 3056-3076, 3110-3130, 3132-3160, 3164-3177, 3181-3196, 3242-3246, 3257-3268, 3275-3285, 3315-3336, 3338-3371, 3375-3382 4259-4267).

    Multiple Sclerosis

    [0540] Multiple sclerosis is a disease of the central nervous system (CNS). The typical early symptoms occurring between the ages of 20 to 40 include blurring vision, red-green color distortion, partial blindness, extreme muscle weakness, feeling of numbness or prickling, difficulties with coordination and balance. In severe cases MS may lead to a partial or complete paralysis. MS is believed to be an autoimmune disease as the communication between the brain and other parts of the body being disrupted as the immune system causes an inflammation within the central nervous system. MS is caused by both genetic and environmental factors, e.g. viral infections. MS is the most common neurological condition of young adults globally, affecting more than 2.3 million individuals.

    [0541] At present time, the pathophysiology of MS is not full understood. The disease is associated with a complex combination related to formation of lesions in the central nervous system, inflammation and demyelination (destruction of the protective myelin surrounding the nerve fibers) in white matter and cortex, and axon destruction (see, e.g. Longbrake et al., 2013, Curr Neural Neurasci Rep., 13(11), and references therein). A number of myelin inhibitory proteins have been characterized in association with MS, including, but not limited to, NogoA ((Neurite outgrowth inhibitor A), Nogo receptor-1 (NgR1), Myelin associated glycoprotein (MAG), oligodendrocyte glycoprotein (OM-gp), LINGO-1 (Leucine rich repeat and immunoglobin-like domain-containing protein 1), and MAI (myelin associated inhibitor). MS is also affiliated with many immune response related proteins. Non-limiting examples of such proteins include e.g. B-cell and T-cell associated proteins, such as, hut not limited to, leukocyte surface antigen CD52, alpha chain of the IL-2 receptor CD25, B-cell surface molecule CD20, T helper cell CD4, and/or cytokine IL-12/23. Alpha 4-integrin, has been associated with inflammation of CNS, as it has a role in leukocyte adhesion and migration to the inflamed CNS. Additionally, MS patients have been characterized with elevated tumor necrosis factor (TNF) levels.

    [0542] As of today, there is no prevention therapy or cure for MS. Patients in need of medical therapy may be treated with e.g. synthetic form of myelin basic protein. (Copaxone, copolymer 1), antiviral proteins knows a as interferons, or immunosuppressant drugs e.g. mitoxantore. Some drugs are aimed at treating a symptom of MS, such as dalapridine, which is aimed at improving walking of individuals with MS. Antibodies for MS have been developed. For example, natalizumab is a monoclonal antibody targeting alpha 4 integrin, (developed by Elan Pharmaceuticals and Biogen) approved by the FDA for treatment of relapsing MS under treatment guidelines to monitor patients by physicians. Other non-limiting examples for MS antibody drugs include alerntuzurnab (CD52), dacliziunab (CD25), rituximab (CD20), ocrelizumab (CD20), ofahimumab (CD20), (see. e.g Longbrake et al., 2013, Curr Neurol Neurosci Rep., 13(11), and references therein). However, many current medications have serious side effects, and there remains a need for therapy affecting the underlying pathophysiology, such as improved antibody therapies.

    [0543] In some embodiment, methods of the present invention may be used to treat subjects suffering from MS. In some cases, methods of the present invention may be used to treat subjects suspected of developing MS.

    [0544] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat MS. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 6 (SEQ ID NO: 2948-2970, 3018-3046, 3056-3076, 3110-3130, 3132-3177, 3181-31%, 3242-3268, 3275-3285, 331.5-3336, 3338-3371, 3375-3382, 4268-4494).

    Amyotrophic Lateral Sclerosis

    [0545] Amyotrophic Lateral Sclerosis (ALS), also known as Lou Gehrig's disease or classical motor neuron disease, is a rapidly progressive and fatal neurological disease. ALS is associated with cell degeneration and death of the upper and lower motor neurons, leading to enablement of muscle movement, weakening, wasting and loss of control over voluntary muscle movement. Early symptoms include muscle weakness of hands, legs and swallowing muscles, eventually progressing to inability to breathe due to diaphragm failure. According to Centers for Disease Control and Prevention (CDC), ALS affects an estimated 12,000-15,000 individuals in the About 5-10% of cases are familial.

    [0546] ALS, as other non-infectious neurodegenerative diseases, has been characterized by presence of misfolded proteins, including, but not limited to, tan, amyloid-beta (A beta), alpha-synuclein, HTT (humingtin) or SOD1 (superoxide dismutase 1 protein), and myelin associated inhibitors and their receptors, (see, e.g., Krishnamurday and Sigurdsson, 2011, N Biotechnol. 28(51:511-7, and Musaro, 2013, FEBS J.;280(17):431.5-22, and references therein). Familial ALS has been associated with mutations of TAR DNA-binding protein 43 (TDP-43) and RNA-binding protein FUS/TLS. Some proteins have been identified to slow down progression of ALS, such as, but not limited, to growth factors, e.g. insulin-like growth factor 1 (IGF-1), glial cell line-derived growth factor, brain-derived growth factor, vascular Ofidothelial growth factor and ciliary neurotrophic factor, or growth factors promoting muscle growth, e.g. myostatin.

    [0547] As of today, there is no prevention or cure for ALS. FDA approved drug niluzole has been approved to prolong the life, but does not have an effect on symptoms. Additionally, drugs and medical devices are available to tolerate pain and attacks associated with ALS. There remains a need for therapy affecting the underlying pathophysiology.

    [0548] In some embodiment, methods of the present invention may be used to treat subjects suffering from ALS. In some cases, methods of the present invention may be used to treat subjects suspected of developing ALS.

    [0549] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat MS. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 6 (SEQ ID NO: 2948-2970, 3018-3046, 3056-3076, 3110-3130, 3132-3177, 3181-3196, 3242-3268, 3275-3285, 3315-3336, 3338-3371, 3375-3382, 4268-4494).

    Stroke

    [0550] Stroke is a medical emergency characterized by a burst of a blood vessel in the brain, referred to as hemorrhagic stroke, or an interruption of blood supply in the brain, referred to as ischemic stroke. Stroke triggers an inflammation, and causes brain cell death, as the oxygen and nutrient supply is impaired suddenly. Typical symptoms include numbness or weakness, especially on one side of the body, confusion, trouble speaking and understanding speech, vision problems, dizziness and loss of balance. Typically, patients recovering from stroke have permanent disabilities, e.g. affecting movement, speech, coordination, vision and balance. Medical conditions, e.g. diabetes, high blood pressure, high cholesterol, and obesity, as well as, cigarette smoking and poor nutrition, increase susceptibility to a stroke. According to CDC, stroke affects about 800,000 people in the US annually and is the fifth most common cause of death.

    [0551] Typical recovery from a stroke is slow or impartial. The inability of the central nervous system to repair after injury has been associated with inhibitory proteins associated with CNS. For example, myelin associated proteins, such as, but not limited to, myelin associated glycoprotein (MAG), myelin associated inhibitor (MAI), and their receptors, proteogly cans, versican V2, oligodendrocyte myelin glycoprotein (Omgp), and neurite outgrowth inhibitor (Nogo) have been identified to inhibit neurite outgrowth (see, e.g. Yu et al., 2013, Transl Stroke Res, 4(5):477-83, and references therein). Cell death in ischemic stroke has been associated with excessive activation of glutamate receptors, involved with glutamate receptors such as, but not limited to, N-methyl-D-aspartic acid (NMDA) receptors and DL--amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (RMPA). Inflammatory signaling triggered after stroke has been associated with adhesion molecules of the endothelial cells, such as, but not limited to, selectin family, intercellular adhesion molecule-1 (ICAM-1, also known as CD54), and 2-integrins.

    [0552] Therapies to prevent stroke are typically focused on treatment of underlying medical conditions. Acute treatment after stroke involves dissolving blood clot in the case of an ischemic stroke e.g. by antiplatelet agents, anticoagulants and thrombolytics, or quenching of bleeding in the case of a hemorrhagic stroke. As of today, there is no effective prevention therapy for a stroke. There remains a need for therapy affecting the underlying pathophysiology of a stroke. Antibodies targeting the stroke associated proteins have been developed. For example, Refanezumab is a monoclonal antibody targeting myelin-associated glycoprotein, MAO, for improvement and recovery of motor function after stroke.

    [0553] In some embodiment, methods of the present invention may be used to prevent a stroke, or treat individuals recovering from a stroke.

    [0554] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat stroke. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described herein.

    Migraine

    [0555] Migraine is a neurological condition characterized by reoccurring attacks of severe headache, accompanied by nausea, light visions, and sensitivity to light, sound and movement. Migraine attacks may last from hours to days. The cause of migraine is unknown, but it is associated with some underlying diseases, as well as environmental and genetic factors. Migraine affects about 12% of population in the US.

    [0556] Present methods for management and treatment of migraine include medical therapies (e.g. analgesics, triptans, ergotamines), surgery, and neurostimulation. As of today, there is no therapy to prevent or cure migraine, and a need for medical therapy focusing on the pathophysiology of migraine remains. CGRP (calcitonin gene-related peptide) vasodilatation has been associated with migraine and photophobia, which is a typical symptom of a migraine attach. Antibodies targeting CGRP may be used for treatment and/or management of migraine, e.g. as described in U.S. Pat. Nos. 9,115,194, and 9,102,731, and US Patent application US20120294802, the contents of which are herein incorporated by reference in their entirety.

    [0557] In some embodiment, methods of the present invention may be used to treat subjects suffering from migraine. In sonic cases, methods of the present invention may he used to treat subjects suspected of developing migraine.

    [0558] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat migraine. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 10 (SEQ ID NO: 3453-3459, 3856, 3890-3898, 4232-4237, 5220-5239, 6406-6429, 6454-6639, 6955-6956, 7905, 8797-8821, 8842-9026, 9288, 17659-17755).

    Pain

    [0559] Pain is a complex symptom associated with a variety of diseases and disorders and may be acute or chronic. Pain is challenging to treat, and many anti-pain medications have side effects, and/or they can be addictive. There remains a need for pain medications affecting the underlying pathophysiology of a pain. Antibodies for treatment for pain are on the market. For example, fasinumab (developed by Regeneron Pharmaceuticals Inc.), Fulranumab (developed by Johnson & Johnson) and tanezumab (developed by Pfizer) are antibodies against NGF (nerve growth factor) for treatment of pain, such as, osteoarthritis knee pain, chronic low back pain, bone cancer pain and/or pain associated with interstitial cystitis.

    [0560] in some embodiment, methods of the present invention may be used to treat subjects suffering from pain. In some cases, methods of the present invention may be used to treat subjects suspected of developing pain.

    [0561] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat pain. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 10 (SEQ ID NO: 3453-3459, 3856, 3890-3898, 4232-4237, 5220-5239, 6406-6429. 6454-6639, 6955-6956, 7905, 8797-8821, 8842-9026, 9288, 17659-17755).

    Neuropathies

    [0562] Neuropathies are a group of diseases or conditions affecting the nerves. Typical symptoms of neuropathies include impaired movement and sensation, cramping, pain and abnormal organ functions. Neuropathies include e.g. diabetic neuropathy, cisplatin-induced neuropathy, mononeuropathy, pyridoxine-induced neuropathy, peripheral neuropathy, small fiber peripheral neuropathy, polyneuropathy and cisplatin/pyridoxine-induced neuropathy.

    [0563] As of today, there is no prevention or treatment therapy specific for neuropathies on the market. Typical treatment involves with treatment of underlying diseases, e.g. diabetes, or management of the symptoms. Therefore, there remains a need for therapy affecting the underlying pathophysiology of neuropathies, such as efficient antibody therapies. Tyrosine kinases, such as Trk receptors, have a role in regulation of the nervous system, neuronal survival and signal cascades. Antibodies targeting e.g. Trk C may be used for prevention, treatment and/or management of neuropathies., as described in U.S. Pat. No. 7,615,383, the contents of which are herein incorporated by reference in their entirety.

    [0564] In some embodiment, methods of the present invention may be used to treat subjects suffering from neuropathies. In some cases, methods of the present invention may he used to treat subjects suspected of developing neuropathies.

    [0565] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat neuropathies. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 7 (SEQ ID NO: 3040-3046, 3076, 3124-3130, 3164-3177, 3262-3268, 3285, 3329-3336, 3358-3371. 4495-4500).

    Psychiatric Disorders

    [0566] Psychiatric disorders are characterized by behavioral or mental condition that affects individual's ordinary ability to function. Common psychiatric disorders include, but are not limited to, Tourette syndrome, bipolar disorder, schizophrenia, anxiety, depression, panic disorder, obsessive-compulsive disorder (OCD), eating disorders (e.g. anorexia, bulimia, orthorexia, obesity), substance abuse (e.g. alcohol or drug), addiction, psychosis, phobias, mood disorders, manic-depression disorder, insomnia and other sleep disorders. Psychiatric disorders may significantly affect individual's quality of life, and in severe cases lead to harmful behavior, such as suicidal or homicidal behavior. The diseases are typically managed and treated with psychotherapy, behavioral therapy, medical therapy (e.g. antipsychotic drugs), and/or other therapies. There remains a need for improved medical therapies affecting the underlying pathophysiology of psychiatric disorders, such as antibodies targeting proteins associated with such disorders.

    [0567] For example, ghrelin hormone has been associated with eating disorders, including obesity and anorexia. Antibodies targeting ghrelin may be used for prevention, management and/or treatment of eating disorders, e.g. as described in US Patent application US20060233788 the contents of which are herein incorporated by reference in their entirety.

    [0568] Depression has been associated with an inhibition of peripheral cytokine activity, especially TNFa (tumor necrosis factor alpha). Antibodies targeting TNT alpha may be used for prevention, management and/or treatment of depression, e.g. as described in US Patent application US20140296493, the contents of which are herein incorporated by reference in their entirety.

    [0569] OCD and OCD related diseases have been associated T-cell activation. Anx-A1 (annexin A1) is a protein promoting T-cell activation, and antibodies binding Annexin-1 may be used for prevention, management and/or treatment of OCD and related diseases, e.g. as described in US Patent application US20150004164, the contents of which are herein incorporated by reference in their entirety.

    [0570] In some embodiment, methods of the present invention may be used to treat subjects suffering from a psychiatric disorder. In some cases, methods of the present invention may be used to treat subjects suspected of developing a psychiatric disorder.

    [0571] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat psychiatric disorder. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 8 (SEQ ID NO: 2977-2998, 3152-3177, 3205-3226, 3350-3371 4501-4568).

    Cancer

    [0572] Cancer is a group of more than 100 diseases associated with abnormal division and cell growth with characteristic spreading in the body. Many cancers are in the form of tumors, e.g. breast cancer, lung cancer, colon cancer, ovarian cancer, renal cancer, prostate cancer, head and neck cancer, pancreas cancer, bone cancer, and thyroid cancer. Cancers associated with blood and lymphoid tissues may be referred to as liquid tumors, e.g. leukemia, lymphoma and myeloma. Cancer is caused by failure of tissue growth regulation. Genes associated with cancer include oncogenes, that promote cell growth and reproduction, and tumor suppressor genes, that inhibit cell division. Oncogenes include, but are not limited to, growth factors, receptor and cytoplasmic tyrosine kinases, transcription factors, serine/threonine kinases and regulatory GTPases. Tumor protein p53 is the most common tumor suppressor protein found in more than half ref cancer types. Susceptibility to cancer is involved with environmental factors, as well as genetic. Though progress with prevention, diagnosis and treatment of cancer has been tremendous, cancer still remains a severe and life-threatening disease. According to American Cancer Society, an estimated 1.6 cancers are diagnosed annually in the US, leading to more than a half a million deaths.

    [0573] Therapies associated with cancer treatment include surgery, chemotherapy, radiation and antibody therapies. Antibodies for treatment and/or prevention of cancers have been on the market for nearly two decades, and are considered as one of the most important strategies for treatment of e.g. hematological malignancies and solid tumors. A number of cancer-associated antigens have been identified for treatment of cancers. Antibodies tameting such antigens may be used to diagnose, prevent and/or treat the associated cancers (see, e.g. Scott et al, 2012, Nature Reviews Cancer 12, 278-287, and references therein).

    [0574] Some solid cancer tumors are associated with expressed glycoproteins antigens. Such antigens include, but are not limited to, EPCAM (Epithelial cell adhesion molecule), CEA (Carcinoembryonic antigen), gpA33 (Glycoprotein A33 (Transmembrane)), mucins, TAG-72 (Tumor-associated glycoprotein 72), CAIX (Carbonic anhydrase IX), PSMA (Prostate-specific membrane antigen), and FBP (Folate-binding protein). Antibodies targeting the expressed glycoproteins may be used to treat associated tumors. Such solid tumors include, but are not limited to, breast, colon cancer, lung, colorectal, ovarian, renal cell, and/or prostate tumors.

    [0575] Some solid cancer tumors are associated with growth factor and differentiation signaling associated antigens. Such antigens include, but are not limited to, EGFR/ERBB1/HER1 (epidermal growth factor receptor 1), ERBB2 (epidermal growth factor receptor 2), ERBB3 (piderrral growth factor receptor 3), MET (Tyrosine-Protein Kinase IGF1R (insulin-like growth factor 1 receptor), EPHA3 (EPH Receptor A3), TRAILR1, (Death receptor 4), and (Receptor activator of nuclear factor kappa-B ligand). Cancers that may be treated with antibodies targeting the growth factor and differentiation signaling include, but are not limited to, breast, colon, lung, ovarian, prostate, head and neck, pancreas, thyroid, kidney, and colon tumors, melanoma, glioma, bone metastases, and hematological malignancies.

    [0576] Some cancer tumors are associated with antigens of stromal and extracellular matrix. Such antigens include, but are not limited to, tenascin and FAP (Fibroblast Activation Protein, Alpha). Cancers that may be treated with antibodies targeting the stromal and extracellular matrix antibodies include, but are not limited to, breast, prostate, colon, lung, pancreas and head and neck tumors and glioma.

    [0577] Some cancer tumors are associated with such as Lewis-Y Le(y) antigen. Le(y) antigen has been found expressed on a number of cancers, such as, but not limited to, ovarian, breast, colon, lung and prostate cancer. Antibodies targeting Le(y) antigen may be used to treat the associated cancers.

    [0578] Some cancer tumors are associated with glycolipid antigens. Such antigens include, but are not limited to, gangliosides, such as GD2, GD3, and GM2 (monosialotetrahexosylganglioside 2). Cancers that may be treated with antibodies targeting the glycolipid antigens include, but are not limited to, epithelial tumors (e.g. breast, colon and lung tumors) and neuroectodermal tumors (tumors of the central and peripheral nervous system).

    [0579] The vasculature of solid tumors is abnormal, compared to normal vasculature. Antigens supporting the formation of abnormal microvasculature and progress of cancer include, but are not limited to, VEGF (Vascular endothelial growth factor), VEGFR (vascular endothelial growth factor receptor), integrin V3 and integrin 51. Antibodies targeting such antigens may he used to treat a number of solid tumors such as, but not limited to, lung, breast, renal, brain, eye, colorectal, melanoma, ovarian, and/or other tumors, by preventing the formation of abnormal vasculature.

    [0580] Hematopoietic and lymphoid malignancies are cancers affecting the blood, bone marrow, lymphs and lymphatic system. Such cancers include e.g. leukemias (acute and chronic lymphoblastic leukemia, acute and chronic myelogenous leukemia), lymphomas (Hodgkin's lymphoma, Non-Hodgkin's lymphoma) and myelomas. Tumors of the hematopoidic and lymphoid tissues are closely related to immune systems. Hematological tumors may be caused by chromosomal abnormalities derived from the myeloid and lymphoid cell lines. The lymphoid cell line produces T and B cells, whereas myeloid cell line produces granulocytes, erythrocytes, thrombocytes, macrophages and mast cells. T and B cell associated hematopoietic differentiation antigens are glycoproteins that are usually from cluster of differentiation (CD) group, such as, but not limited to, CD20, CD30, CD33 and CD52. Antibodies targeting such antigens may be used for prevention and/or treatment hematopoietic and lymphoid cancers.

    [0581] In some embodiment, methods of the present invention may be used to treat subjects suffering from a cancer. In some cases, methods of the present invention may he used to treat subjects suspected of developing a cancer.

    [0582] in some embodiments, methods of the present invention may be used for immuno-oncology (I-O) applications. AAV particles or pharmaceutical compsitions of the present invention may be used to develop an immunotherapy or as an immunotherapy in an I-O treatment of a subject suffering from cancer. Non-limiting examples of I-O applications include active, passive or hybrid immunotherapies, checkpoint blockade, adoptive cell transfer (ACT), cancer vaccines, CAR or CAR-T therapies, dendritic cell therapy, stem cell therapies, natural killer (NK) cell-based. therapies, and interferon or interleukin based methods.

    [0583] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat cancer. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 9 (SEQ ID NO: 2977-2998, 3031-3039, 3060-3076, 3129-3147, 3181-3196, 3205-3226, 3277-3285, 3335-3345, 3375-3382, 3453-3459, 3856, 3890-3898, 4232-4237, 4308, 4323, 4420, 4431, 4501-4504, 4512-4527, 4535-17658).

    Ocular Diseases

    [0584] Eye is an organ comprising a number of components, including the cornea, aqueous humor, lens, vitreous humor, retina, the retinal pigment epithelium, and choroid. Ocular diseases are conditions affecting the different tissues of the eye. A number of diseases and disorders affect the different components of the eye, and may cause impaired vision, full or partial blindness, irritation, dryness, sensitivity, photophobia, and/or light aversion.

    [0585] Complement in the eye has an important role in protecting the eye from infections and in modulation of the immune and inflammatory responses. In normal eye, the complement activity is at low level and is regulated by membrane bound and soluble intraocular complement regulatory proteins. Disturbance of the balance between complement activation and complement inhibition may lead to damage to self-tissue (see, e.gg, Jha et al., 2007, Mol Immunol.; 44(16); 3901-3908, and references therein). The complement system may be activated in three pathways. The classical pathway is activated by immune complexes or substances and involves e.g. complement components C1, C2, C3, C4, C3a, C5, C5a, C51) C6, C7, C8, C9 and C5b-9. The alternative pathway activates complement component C3 when in interaction with e.g. zymosan, or lipopolysaccharide surfaces, additionally involving, e.g. Factor B, Factor Ba, Factor Bb, Factor D, and Factor P. The third activation pathway is the lectin pathway, and is related to interaction of certain serum lectins, e.g. mannose binding lectin (MBL), mannose and N-acetyl glucosamine residues present in bacterial cell walls. Complement activation is associated with a number of ocular diseases, such as, but not related, age-related macular degeneration (AMD), diabetic retinopathy, choroidal neovascularization (CNV), uveitis, diabetic macular edema, pathological myopia, von Hippel-Lindau disease, histoplasmosis of the eye, Central Retinal Vein Occlusion (CRVO), corneal neovascularization, and retinal neovascularization, choroidal neovascularization, and other ocular conditions involving complement activation. Antibodies targeting the associated complement components may be used to diagnose, manage and/or treat such ocular diseases.

    [0586] Age-related macular degeneration (AMD) is a major cause of irreversible loss of central vision in the elderly worldwide. AMD leads to gradually worsening vision. AMD does not result in blindness, but may affect daily life. Wet AMD is caused by abnormal blood vessels behind the retina grow under the macula and leak blood and fluid that damage the macula. Wet AMD may be treated with laser coagulation and medication to reverse or stop the growth of blood vessels. Dry AMD is caused by break down of the light sensitive cells in the macula. As of today, there is no treatment for dry AMD.

    [0587] There remains a need for prevention, management and treatment therapies for wet and dry AMD. AMD is associated with complement components, as described above. In addition, AMD is associated with proteins such as, but not limited to, VEGF (Vascular endothelial growth factor), EPO (Erythropoietin), EPOR (EPO receptor), Interleukins IL-1, IL-17A, Il-10, TNF (tumor necrosis factor alpha), or FGFR2 (Fibroblast Growth Factor Receptor). Antibodies targeting the AMD associated complement and growth proteins may be used to treat AMD. For example, bevacizumab and ranibizumab (developed by Genentech Inc.) are antibodies targeting VEGF-A to slow down growth of new blood vessels.

    [0588] Corneal diseases affect the cornea and the conjunctiva. Cornea and conjunctiva form the outer surface of the eye, which is exposed to external environment, and are susceptible to infection agents, traum, and/or exposure to chemicals, toxins, allergens etc. Cornea is also affected by autoimmune conditions, nutritional deficiencies and cancer. Cortical diseases may cause e.g. loss of vision, blurred vision, tearing;, light sensitivity and pain. Diseases affecting cornea include, but are not limited to, keratitis, corneal dystrophy, corneal degeneration, Fuchs' dystrophy, cancer of cornea, and keratoconjuctivitis. Though surgical and medical treatment therapies for corneal diseases exist, in some cases, the diseases still remain severe and may cause blindness. There remains a need to efficient therapies for prevention, management and treatment of corneal diseases. Complement components of the cornea and the conjunctiva present in a normal eve include, but are not limited to, C1, C2, C3, C4, C5, C6, C7, Factor P (properdin) and factor B. Complement may have a role in corneal diseases, and antibodies targeting complement components of the eye may be used for prevention, treatment and/or management of corneal diseases.

    [0589] Uveitis is an inflammation of the uvea, comprising the iris, choroids, and ciliary body. Early symptoms include eye redness, pain, irritation and blurred vision. Uveitis may lead to transient or permanent loss of vision. Uveitis may be associated with other diseases and conditions, such as infections, systemic diseases, non-infectious and autoimmune diseases. Complement components associated with an autoimmune form of uveitis include C3b and C4b. Uveitis may be managed or treated with vitrectomy, immunosuppressive drugs, corticosteroids or cytotoxic medication. However, despite the existing therapies, autoimmune uveitis is a serious condition and may lead to full or partial blindness. There remains a need for therapies for prevention, management, and treatment of uveitis targeting pathophysiology of the disease.

    [0590] Retinopathy is a disease resulting from neovascularization. (excessive growth of blood vessels) in the light-sensitive tissue of the eye, retina. Retinopathy may result in impaired vision or partial or full blindness. Retinopathy may be caused by systemic diseases, e.g. diabetes, or hypertension, trauma, excessive sun light exposure or ionizing radiation. Retinopathy is often treated with laser therapy. Medical treatments, such as antibodies, to control the growth of blood vessels, are also applied. However, despite the existing treatment methods, retinopathy is still a severe condition and may lead to blindness. Diabetic retinopathy is one of the leading causes of vision loss in middle-aged individuals. There remains a need for new therapies for prevention, management and/or treatment of retinopathy. For example, antibodies targeting blood vessel growth (e.g. vascular endothelial growth factor (VEGF), complement components (e.g. C3, C4, C1q, C9, C4b), and cluster of differentiation proteins (e.g. CD55, CD59) may be used for prevention, management and/or treatment of different retinopathies.

    [0591] Photophobia is a condition referring to abnormal sensitivity or aversion to light. Photophobia is related to a number of ocular and nervous system diseases and disorders. Photophobia may he caused by damage to cornea or retina, albinism overstimulation of the photoreceptors, excessive electric pulses to the central nervous system, or optic nerve. Photophobia may be associated with migraine, nervous system disorders (e.g. autism, dyslexia, encephalitis), infections (e.g. rabies, Lyme disease, mononucleosis), eye disorders (e.g. uveitis, corneal diseases, retinal diseases, scarring or trauma to cornea). As of today, there is no medical treatment for photophobia on the market. Photophobia is associated with calcitonin gene related peptide (CORP) and CORP receptors, and antibodies targeting CGRP may be used to prevent and/or treat photophobia, as described in US Patent application US20120294802, the contents of which are herein incorporated by their reference.

    [0592] In some embodiment, methods of the present invention may be used to treat subjects suffering from ocular diseases. In some cases, methods of the present invention may be used to treat subjects suspected of developing ocular diseases.

    [0593] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat psychiatric disorder. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 11 (SEQ ID NO: 3124-3125, 3164-3177, 3329-3330, 3358-3371, 4308, 4323. 4420, 4431., 4680-4682, 4685-4728, 4735-4772, 4779-4781, 4783, 6792-6919 7022-7024, 7271-7274, 7389-7392, 7396-7439, 7446-7496, 7503-7505, 9142-9255, 9257-9269, 9350, 9466-9468, 9617-9624 9630-9633, 9655-9677, 17666-17670, 17672-17680, 17723-17736, 17756-17875).

    Systemic Diseases of the Blood, Heart and Bone

    [0594] Systemic diseases are a categoty of conditions affecting the whole body, or many tissues and organs of the body. Systemic conditions associated with the blood, blood vessels, and heart, include, but are not limited to, heart failure, acute coronary syndrome, atherosclerosis, hypertension, lung disease, cardiomyopathy, hypedipidernia, hypercholesterolemia, hypertrigiyceridemia, blood clotting, cardiopulmonary bypass, myocardial infection, platelet aggregation and hemolytic; diseases. In general, such conditions affect individual's quality of life and may be life-threatening. Cardiovascular diseases, referring to heart and blood vessels related conditions, are the leading cause of death worldwide. There remains a need for therapies affecting the pathophysiology of systemic heart, blood and blood circulation diseases. Antibodies for treating such conditions have been developed, targeting proteins such as, but not limited to, selectin P, integrin aIIb3, GPIIb/IIIa, RHD (Rh blood group, D antigen), PCSK9 (proprotein convertase subtilisin/kexin type 9), oxLDL (Oxidized low-density lipoprotein), CD20 (B-lymphocyte antigen), ANGPTL3 (Angiopoietin-Like 3). F9 (human factor 9), F10 (human factor 10), TFPI (Tissue Factor Pathway Inhibitor (Lipoprotein-Associated Coagulation Inhibitor)). CD41 (Integrin, Alpha 2b (Platelet Glycoprotein IIb Of IIb/IIIa Complex, Antigen CD41)).

    [0595] In some embodiment, methods of the present invention may be used to treat subjects suffering from blood, blood circulation and heart related systemic diseases. In some cases, methods of the present invention may be used to treat subjects suspected of developing systemic blood, blood circulation and heart related systemic diseases.

    [0596] Osteoporosis is a disease characterized by a reduced bone mineral density, and disrupted bone microarchitecture. Individuals with osteoporosis have a high susceptibility to bone fractures. Osteoporosis causes disability especially in the elderly, and may be fatal.

    [0597] There are medical therapies for management of the osteoporosis, and other conditions associated with reduced bone density, such as calcitonin, bisphosphonates, estrogen replacement and selective estrogen imdulators for prevention of bone loss, and anabolic agents to increase bone mass and bone mineral density. However, the present medical therapies have side effects and/or require frequent administration. There remains a need for efficient and long lasting medical therapy affecting the pathophysiology of osteoporosis and other conditions associated with reduced bone density, such as antibody therapies. Antibodies for treatment of osteoporosis are on the market, e.g. blosozuniab (developed by Eli Lilly and Co.) targeting sclerostin (SOST) for increasing bone density, and denosumab (developed by Amgen) targeting TNEST11 (Tumor Necrosis Factor (Ligand) Superfamily, Member 11) for treatment of bone loss.

    [0598] In some embodiment, methods of the present invention may be used to treat subjects suffering from osteoporosis and/or other conditions associated with reduced bone density. In some cases, methods of the present invention may be used to treat subjects suspected of developing osteoporosis and/or other conditions associated with reduced bone density.

    [0599] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat systemic diseases of the blood, heart and/or bone. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 12 (SEQ ID NO: 7124, 7127, 7291-7293, 9394, 9397, 9485-9487, 17876-17938).

    Immune System & Autoimmune Disease

    [0600] Human immune system is a complex mechanism for identifying and removing harmful environmental agents and repairing the harm and damage caused by them. The basis of the immune system is ability to identify body's own substances from substances acquired. The immune response system can be divided into innate and adaptive systems. The innate system is present at all times and includes macrophages, dendritic cells, myeloid cells (neutrophils, mast cells basophils eosinophils) NK cells, complement factors and cytokines. The adaptive system responses to infectious agents, and include T and B lymphocytes, antibodies and cytokines. Activation of T and B cells in the absence of an infectious agents leads to autoimmune diseases (see, e.g. Mackay et al., 2001 N Engl J Med, Vol. 34.5, No. 5, and references therein). Autoimmune diseases may affect a number of body's tissues and functions, e.g. joints, skin, blood vessels, muscles, organs, intestine etc. Autoimmune diseases arise from and overactive and misguided immune response to body's natural tissues and species. Autoimmune diseases and conditions include, but are not limited to, rheumatoid arthritis, diabetes type 1, systemic lupus erythematosus, celiac sprue, psoriasis, Graves' disease, and Lyme disease. Autoimmune diseases may be caused by infections, drugs, environmental irritants, toxins, and/or genetic factors. Autoimmune diseases affect up to 50 million individuals in the US. Two most common autoimmune diseases are rheumatoid arthritis and autoimmune thyroiditis, together affecting approximately 5% of population in Western countries.

    [0601] Though medical therapies for autoimmune diseases exits, the diseases may still significantly lower the quality of life, or even be fatal. There remains a need for medical therapies affecting the pathophysiology of autoimmune diseases. Autoimmune disease pathophysiology is associated with a number of factors and may be prevented and/or treated by antibodies targeting associated proteins. Such targets include, but are not limited to, infectious agents; environmental triggers (e.g. gliadin); targets affecting cytokinone production or signaling (e.g. TNFa (tumor necrosis factor alpha), IL-1 (interleukin 1-receptor), 1L-2 (interleukin-2), IL-2R (interleukin-2 receptor), IL-7 (interleukin-7), IL-10 (interleukin-10), IL-10R (interleukin-10 receptor), interferon-y, STAT-3 (Signal transducer and activator of transcription 3), STAT-4 (Signal transducer and activator of transcription 4), TGF beta (transforming growth factor beta), T cell trans TGF beta); T cell regulators (e.g. CTLA4 (Cytotoxic T-Lymphocyte-Associated Protein 4)); complement components (e.g. C1 and C4); TNFa (tumor necrosis factor alpha) and TNFb (tumor necrosis factor beta); T cell regulators (e.g. CD1); epitopes of B and T cells; and/or other targets, such as those associated with B and C cells. (see, e.g. Mackay et al., 2001, N Engl J Med, Vol. 345, No. 5, and references therein).

    [0602] In some embodiment, methods of the present invention may be used to treat subjects suffering from an autoimmune disease. In some cases, methods of the present invention may be used to treat subjects suspected of developing an autoimmune disease.

    [0603] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat immune system and autoimmune disease. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 9 (SEQ ID NO: 2977-2998, 3031-3039, 3060-3076, 3129-3147, 3181-3196, 3205-3226, 3277-3285, 3335-3345, 3375-3382, 3453-3459, 3856, 3890-3898, 4232-4237, 4308, 4323, 4420, 4431, 4501-4504, 4512-4527, 4535-17658).

    Inflammatory Disorders and Inflammation

    [0604] Inflammation is a natural response of the body to an irritation e.g. by infection, damaged cells or other harmful agents. The purpose of the inflammation is to remove the cause of irritation and necrotic cells and damaged tissues and initiate cell and tissue repair. Inflammation has a role in majority of diseases. Inflammatory disorders are abnormalities in the body's ability to regulate inflammation. Over 100 disorders associated with high level of inflammation have been identified, including, but not limited to, Alzheimer's, ankylosing spondylitis, arthritis (osteoarthritis, rheumatoid arthritis (RA), psoriatic arthritis), asthma, atherosclerosis, Crohn's disease, colitis, dermatitis, diverticulitis, fibromyalgia, hepatitis, irritable bowel syndrome (IBS), systemic lupus erythematous (SLE), nephritis, Parkinson's disease, and ulcerative colitis. Many inflammatory disorders are severe, and even life-threatening. Antibodies targeting proteins associated with inflammation may be used to prevent, manage or treat inflammatory disorders as well as inflammation associated diseases.

    [0605] A large number of proteins are associated in inflammation, including, but not limited to, TNF (anti-tumor necrosis factor), IL-1R (Interleukin-1 receptor), IL-6R (Interleukin-6 receptor), Alpha integrin subunit, CTLA4 (Cytotoxic T-Lymphocyte-Associated Protein 4), and CD20 (see. e.g. Kotsovilis and Andreakos 2014, Michael Steinitz (ed.), Human Monoclonal Antibodies: Methods and Protocols, Methods in Molecular Biology, vol. 1060, and references therein). For example, adalimumab (developed by Abbot Laboratories) is a TNF-targeting antibody for rheumatoid arthritis and other arthritises, psoriasis, and Crohn's disease and Natalizumab (developed by Biogen Idec) is an antibody targeting alpha 4integring for treatment of Crohn's disease. Additionally, plethora of cytokines, chemokines, adhesion and co-stimulatory molecules, receptors, as well as diverse cell types, may have a role in inflammatoly diseases.

    [0606] In some embodiment, methods of the present invention may he used to treat subjects suffering from an inflammatory disease. In some cases, methods of the present invention may be used to treat subjects suspected of developing an inflammatory disease.

    [0607] AAV Particles and methods of using the AAV particles described in the present invention may be used to prevent, manage and/or treat inflammatory disorders and inflammation. As a non-limiting example, the AAV particles of the present invention comprise a nucleic acid sequence encoding at least one of the sequences described in Table 9 (SEQ ID NO: 2977-2998, 3031-3039, 3060-3076, 3129-3147, 3181-3196, 3205-3226, 3277-3285, 3335-3345, 3375-3382, 3453-3459, 3856, 3890-3898, 4232-4237, 4308, 4323, 4420, 4431, 4501-4504, 4512-4527, 4535-1765).

    Other Therapeutic Targets

    [0608] The AAV particles or pharmaceutical compositions of the present invention useful in preventing or treating tatiopathies or tau-associated diseases may alternatively, or in combination, encode an antibody that does not bind to the tau protein (e.g., the antigen is a polypeptide other than tau). Non-limiting examples of other target antigens include any of the following, including fragments or variants thereof, ct-synuclein (monomers, oligomers, aggregates, fragments), ABCA1 (ATP-binding cassette, sub-family A, member 1), ABCA4 (ATP-binding cassette, sub-family A, member 4), ABCB1 (ATP-binding cassette, sub-family B, member 1), ACE (angiotensin 1 converting enzyme), ACKR1 (atypical chemokine receptor 1 (Duffy blood group)), AMPA (DL--amino-3-hydroxy-5-methyl-4-isoxazole propionic acid), ACTH (Adrenocorticotropic Hormone), ACVR2A (Activin receptor type-2A), ACVR2B (Activin receptor type-2B), ADDL (Adducin-Like Protein 70), ADORA2A (adenosine A2a, receptor), ADRA2A (adrenoceptor alpha 2A), AIFM1 (apoptosis-inducing factor), AKT1 (RAC-alpha serine/threonine-protein kinase), ALK-1 (activin receptor-like kinase 1), Alpha beta fibril, alpha subunit (basic helix-loop-helix transcription factor), AMT (Aminomethyltransferase), Amyloid (monomers, oligomers, aggregates, fragments), amyloid or amyloid-like proteins, ANGPTL3 (Angiopoietin-Like 3), ANGTF1 (angiopoitin 1), ANGTP2 (angiopoietin 2), ANK3 (ankyrin 3), ANKG (ankyrin G), Annexis IV, phospholipid, Anx-A1 (annexin A1), APOE (apolipoprotein B), APP (amyloid beta precursor protein), ARSD (Arylsulfatase D), ATM (Ataxia Telangiectasia Mutated serine/threonine kinase), ATXN1 (ataxin 1), ATXN2 (ataxin 2), ATXN3 (ataxin 3), ATXN7 (ataxin 7), B Lymphocyte Stimulator, BDNF (brain-derived neurotrophic factor), beta A4 peptide/Alpha beta 4, beta A4 peptide, Alpha beta 5, bAlpha beta 6, Alpha beta 7, Alpha beta 8, Alpha beta 9, Beta-secretases (BACE), BRAT (B-Raf Proto-Oncogene, Serine/Threonine Kinase), Properdin (factor P), Factors Ba and Bb, C1, C1q (complement component 1, subcomponent q), C2, C3, C4, C3a, C3b, C5, C5a, C5b, C6, C7, C8, C9 and C5b-9 (complement components), CAIX (Carbonic anhydrase IX), CA 125 (cancer antigen 125), CACNA1A (calcium channel voltage-dependent P/Q type alpha 1 A subunit), cadherins, CA-IX (carbonic anhydrase 9), CALCA (calcitonin-related polypeptide alpha), CCKBR (cholecystokinin B receptor), CCL11 (eotaxin-1), CCL2 (Chemokine (C-C Motif) Ligand 2), CD11 (integrin alpha component), CD147 (basigin), CD154 (CD40L), CD19 (Cluster of Differentiation 19), CD2 (cluster of differentiation 2), CD20 (B-lymphocyte antigen), CD200 (cluster of differentiation 200), CD22 (cluster of differentiation 22), CD221 (insulin-like growth factor 1 (IGF-1) receptor), CD248 (Endosialin), CD26 (Dipeptidyl peptidase-4), CD27 (antigen precursor), CD274 (cluster of differentiation 274), CD28 ('luster of Differentiation 28), CD29 (Integrin, Beta 1), CD3 (cluster of differentiation 3), CD30 (cluster of differentiation 30), CD31 (cluster of differentiation 31), CD33 (duster of differentiation 33), CD37 (Leukocyte antigen), CD38 (cyclic ADP ribose hydrolase), CD3E (T-Cell Surface Antigen T3/Leu-4 Epsilon Chain), CD4 (T-Cell Surface Antigen T4/Leu-3), CD40 (CD40 Molecule, TNF Receptor Superfamily Member 5), CD41 (Integrin, Alpha 2b (Platelet Glycoprotein IIb Of IIb/IIIa Complex, Antigen CD41)), CD44 (cluster of differentiation 44), CD51 (integrin alpha 1), CD52 (Human Epididymis-Specific Protein 5), CD55 (Decay Accelerating Factor For Complement (Cromer Blood Group)), CD58 (lymphocyte function-associated antigen 3), CD59 (MAC-inhibitory protein), CD6 (cluster of differentiation 6), CD 70 (cluster of differentiation 70, ligand for CD27), CD74 (HLA class II histocompatibility antigen gamma chain), CD79B (immunoglobulin-associated beta), CEA (Carcinoembryonic antigen), CFHR1 (Complement Factor H-Related 1), CGRP (Calcitonin gene-related peptide), CHMP2B (charged multivesicular body protein 2B), CHRNA4 (cholinergic receptor nicotinic alpha 4 (neuronal)), CHRNE2 (cholinergic receptor nicotinic beta 2 (neuronal)), CISD2 (CDGSH iron sulfur domain 2), CLEC16A (C-type lectin domain family 16 member A), CLRN1 (clarin 1), CNR1 (cannabinoid receptor 1), CNTNAP2 (contactin associated protein-like 2), COMT (catechol-O-methyltransferase), CRB1 (crumbs family member 1, photoreceptor morphogenesis associated), CRX (cone-rod homeobax), CRY (crystallin), CSFIR (Colony Stimulating Factor 1 Receptor), CSF2 (Colony Stimulating Factor 2 (Granulocyte-Macrophage)), CSF2RA (Colony Stimulating Factor 2 Receptor, Alpha, Low-Affinity), CTGF (Connective Tissue Growth. Factor), CTLA4 (Cytotoxic T-Lymphocyte-Associated Protein 4), CXC (chemokine receptor type 4), CXCL10 (Chemokine (C-X-C Motif) Ligand 10), DDC (dopa decarboxylase (aromatic L-amino acid decarboxylase)), DIABLO (TAP-Binding Mitochondrial Protein), differentiation factor 8 (GDF8), DISC1 (disrupted in schizophrenia 1), DLL3 (Delta-Like 3 (Drosophila)), DLL4 (Delta-Like 4 (Drosophila)), DPP4 (dipeptyl-peptidase 4), DPP6 (dipeptidyl-peptidase 6), DR6 (Death receptor 6), DRD1 (dopamine receptor D1), DRD2 (dopamine receptor D2), DRD4 (dopamine receptor D4), DRD5 (dopamine receptor 5), DRD5 (dopamine receptor D5), DTNBP1 (dystrobrevin binding protein 1), EAG1 (Ether-A-Go-Go Potassium Channel 1), EDB (fibronectin extra domain-B), EDNRA (endothelin receptor type A), EFNA1 (Ephrin-A1), EGFL7 (EGF-Like-Domain, Multiple 7), EGFR/ERBB1/HER 1 (epidermal growth factor receptor 1), EN2 (Engrailed Homeobox 2), EPCAM (Epithelial cell adhesion molecule), EPHA3 (EPH Receptor A3), episialin (a carcinoma-associated mucin, MUC-1), ERBB2 (epidermal growth factor receptor 2), ERBB3 (epidermal growth factor receptor 3), ESR1 (estrogen receptor 1), F3 (coagulation factor III), F9 (human factor 9), F10 (human factor 10), FAAH (fatty acid amide hydrolase), Factor D C3 proactivator convertase), humanized IgG1, humanized IgG2, FAP (Fibroblast Activation Protein, Alpha), FBN2 (fibrillin 2), FBP (Polate-binding protein), FcRIIB (Fc receptor gamma B), FcRIIIA (Fc receptor gamma A), FLT1 (Fms-Related Tyrosine Kinase I), FOLR1 (folate receptor alpha), Frizzled receptor, FXN (frataxin), FUS/TLS (RNA binding protein), G protein-coupled, GAA (glucosidase alpha acid), Ge-globulin (Vitamin D binding protein), Gangliosides, GD2 (ganglioside 62), GD3 (ganglioside g3), GM2 (monosialotetrahexosylganglioside 2) (GDF-8 (myostatin), GDNF (glial cell derived neurotrophic factor), GDNF (glial cell derived neurotrophic factor), GFAP (glial fibrillary acidic protein), GFR3 (GDNF family receptor alpha-3), ghrelin, GIT1 (G protein-coupled receptor kinase interacting ArfGAP 1), GJA (Gap junction protein), GLDC Glycine Dehydrogenase (Decarboxylating), glyeoprotein NMB (GPNMB), gpA33 (Glycoprotein A33 (Transmembrane)), GPC3 (glypican 3), GRIN2B (glutamate receptor ionotropic N-methyl D-aspartate 2B), GRN (granulin), GDF8 (growth differentiation factor 8), GIPases (guanosine triphosphate), GSTF1 (glutathione S-transferase pi 1), GUCA1A (guanylate cyelase activator IA (retina), GUCY2C (anti-GCC), HMCN1 (hemicentin 1), HGF (Hepatocyte Growth Factor), HIF1A (hypoxia inducible factor 1, HINT1 (histidine triad nucleotide binding protein 1), HIST3H3 (Histone H3), histone, HLA-DQB1 (major histocompatibility complex class II DQ beta 1), HLA-DR (MHC class II cell surface receptor), HLA-DRB1 (major histocompatibility complex class II DR beta 1), hNav1.7 (sodium ion channel), HTR1A (5-hydroxy tryptamine (serotonin) receptor 1A G protein-coupled), HTR2A (5-hydroxytryptamine (serotonin) receptor 2A, HTR2A (5-hydroxytryptamine (serotonin) receptor 2A G protein-coupled), HTT (huntingtin), IAP-binding mitochondrial protein, IFNAR1 (Interferon (Alpha, Beta And Omega) Receptor 1), IFNB1 (interferon beta 1 fibroblast), IFN- (Interferon gamma), IGF-1 receptor, IGF1R (insulin like growth factor 1 receptor), IGF-1 (insulin-like growth factor 1), IGG1 (inamunoglobulin subclass 1), IgG2 (immunoglobulin subclass 2), IgG4 (immunoglobulin subclass 4), IGHE (Immunoglobulin Heavy Constant Epsilon) , IL 1B (interleukin 1 beta), IL12 (interleukin 12), IL12B (interleukin 12B), IL13 (interleukin 13), IL17A (interleukin 17A), IL17F (interleukin 17F)), IL1A (interleukin 1A), IL1B (interleukin 1 beta), IL1-Ri (Interleukin 1 receptor, type I), IL20 (Interleukin 20), IL23A (interleukin 23A), IL-23p19 subunit (interleukin 23 subunit p19), IL2RA (interleukin 2 receptor alpha), IL4R (interleukin 4 receptor alpha, IL6 (interleukin 6), IL6R (interleukin 6 receptor), IL7R (interleukin 7 receptor), ILGF2 (insulin like growth factor 2), INS (insulin), Integrin 51, Integrin V3, integin IIb3/GPIIb/IIIa, IP6K2 (inositol hexakisphosphate kinase 2), ITGA4 (Integrin, Alpha 4 (Antigen CD49D, Alpha 4 Subunit Of VLA-4 Receptor)), ITGB7 (Integrin, Alpha 7 (Antigen CD49D, Alpha 4 Subunit Of VLA-7 Receptor)), ITGAL (integrin alpha L chain), ITGAV ((Vitronectin Receptor, Alpha Polypeptide, Antigen CD51), ITGB3 (Integrin alpha-V/beta-3), KCNQ2 (potassium channel voltage gated KQT-like subfamily Q member 2), KDR (Kinase Insert Domain Receptor), KIR2D (killer immunoglobulin-like receptor (KIR) 2D subtype), KLRC1 (Killer Cell Lectin-Like Receptor Subfamily C, Member 1), LAG-3 (Lymphocyte-activation gene 3), Le (y) (Lewis y) antigen, LINGO (Leucine rich repeat and Immunoglobin-like domain-containing protein 1), LOXL2 (Lysyl oxidase homolog 2), LPG (lysophosphatidylglucoside), LPS (Lipopolysaccharides), LRP1 (low density lipoprotein receptor-related protein 1), LRRC6 (Leucine Rich Repeat Containing 6), LRRK2 (leucine-rich repeat kinase 2), LTA (Lymphotoxin Alpha), MAF (maf avian musculoaponeurotic fibrosarcoma oncogene homolog), MAG (Myelin Associated Glycoprotein), MAI (myelin associated inhibitor), MAOB (monoamine oxidase B), MAPT (microtubule-associated protein tau), MBP (myelin basic protein), MCAF (monocyte chemotactic and activating factor), MCP-1 (Monocyte chemoattractant protein-1), MBL (mannose binding lectin), mannose, MET (Tyrosine-Protein Kinase Met), MIF (Macrophage Migration Inhibitory Factor (Glycosylation-Inhibiting Factor), MS4A1 (Membrane-Spanning 4-Domains, Subfamily A, Member 1), MSLN (Mesothelin), MST1R (Macrophage Stimulating 1 Receptor), MSTN (myostatin), MUC1/Episialin, MUC5AC (Mucin 5AC, Oligoinexic Mucus/Gel-Formin4 mucin CanAg (glycoform MUC-1), Mucins, myostatin, myostatin antagonists, N-acetyl glucosamine, NCAM1 (Neural Cell Adhesion Molecule 1), Neu5Gc/NGNA (Neurogenin A), neuregulin (NRG), neurokinin B, NGF (Nerve growth factor), NMDA (N-methyl-D-aspartate), NOGO (Neurite outgrowth inhibitor), NOGO receptor-1, Nogo-66, NOGOA/NiG (Neurite Outgrowth Inhibitory Fragments of NOGOA), Notch receptor, NOTCH-1 (Notch homolog 1, translocation-associated (Drosophila)), NRG1 (neuregulin 1), NRP1 (Neuropilin 1), NT-3 trkC ligand, N-terminal region of A8-x peptide, OGG1 (8-oxoguanine DNA glycosylase), oligomers of N-terminal truncated A, OPA2 (Optic Atrophy 2), OPA3 (Optic Atrophy 3), oxLDL (Oxidized low-density lipoprotein), P75 (Low-affinity Nerve Growth Factor Receptor), PAND1 9Panic disorder 1), PAND2 (Panic disorder 2), PAND3 9Panic disorder 3), PARK2 (parkin RBR E3 ubiquitin protein ligase), PCSK9 (proprotein convertase subtilisin/kexin type 9), PD-1 (Programmed cell death protein 1), PD-2 (Programmed cell death protein 2), PD-3 (Programmed cell death protein 3), PD-4 (Programmed cell death protein 4), PD-5 (Programmed cell death protein 5), PD-6 (Programmed. cell death protein 6), PD-7 (Programmed cell death protein 7), PD-8 (Programmed cell death protein 8), PDGFRA (Platelet-derived growth factor receptor alpha), PDGFRB (Platelet-derived growth factor receptor beta), PD-L1 (Programmed cell death protein 1 ligand), PEX7 ((Peroxisomal Biogenesis Factor 7), PHOBS (phobia specific), PhosphatidyL-serine, chimeric IgG1, Phosphatide L-serine, Chimeric IgG2, PINK1 (PTEN Induced putative kinase 1), platelet-derived growth factor receptor beta PDGFRB, PLAU (plasminogen activator urokinase), PLP (protelopid protein), PMP22 (peripheral myelin protein 22), POLG (polymerase (DNA directed) gamma), PRDM16 (PR domain containing 16), Prion proteins, PrP, PrPC, PrPSc, PRKCG (protein kinase C gamma), PSEN1 (presenilin 1), PSEN2 (presenilin 2), PSMA (Prostate-specific membrane antigen), PTGS2 (prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)), PTPN11 (Tyrosine-protein phosphatase non-receptor type 11), PVRL4 (Poliovirus Receptor-Related 4), PVRL5 (Poliovirus Receptor-Related 5), pyroglutamated A , RAf1 (proto-oncogene serine/threonine-protein khaase), RAGE protein, RANKL (Receptor activator of nuclear factor kappa-B ligand), RCAN1 (regulator of calcineurin 1), RDh12 (retinol dehydrogenase 12 (all-trans/9-cis/11-cis)), RGM A (Repulsive guidance molecule A), RHD (Rh blood group, D antigen), RHO (rhodopsin), RPE65 (retinal pigment epithelium-specific protein 65 kDa), RTN4 (Reticulon-4, NOGO), S100B (calcium-binding protein B), SIP4 (Type 4 sphingosine 1-phosphate G protein-coupled receptor), SCN1A (Sodium Channel, Voltage Gated, Type I Alpha Subunit) , SDC1 (Syndecan 1), selectin P, SHANK3 (SH3 And Multiple Ankyrin Repeat Domains 3), SLAM7 (SLAM Family Member 7), SLC18A2 (solute carrier family 18 (vesicular monoamine transporter, member 2), SLC1A2 (solute carrier family 1 (glial high affinity glutamate transporter, member 2), SLC34A2 (Solute Carrier Family 34 (Type II Sodium/Phosphate Cotransporter), SLC6A3 (solute carrier family 6 (neurotransmitter transporter) member 3), SLC6A4 (Solute Carrier Family 6 (Neurotransmitter Transporter), SMN1 (survival of motor neuron 1 telomeric), SMN2 (survival of motor neuron 2 centromeric), SNCA (synuclein alpha (non A4 component of amyloid precursor)), SNCA (synuclein alpha (non A4 component of amyloid precursor), SNCB (synuclein beta), SOD1 (superoxide dismutase 1 soluble), SOST (Sclerostin), sphingosine-1-phosphate, SQSTM1 (sequestosome 1), STEAP1 (Six Transmembrane Epithelial Antigen Of The Prostate 1), SULF2 (Sulfatase 2), TACR1 (tachykinin receptor 1), TAG-72 (Tumor-associated glycoprotein 72), TARDBP (TAR DNA binding protein), tau antigen, tau protein, tau pS422, TDP-43, tenascin, tenascin C, TFPI (Tissue Factor Pathway Inhibitor (Lipoprotein-Associated Coagulation Inhibitor)), TGF beta (Transforming growth factor beta), TH (Tyrosine hydroxylase), TkrC (Tropomyosin receptor kinase C), TMEFF2 (Transmembrane Protein With EGF-Like And Two Follistatin-Like Domains 2), TMEFF3 (Transmembrane Protein With EGF-Like And Two Follistatin-Like Domains 3), TNF (tumor necrosis factor), TNFa (tumor necrosis factor alpha), INFRSIF10B (Tumor Necrosis Factor Receptor Superfamily, Member 10b), TNFRSF12A (Tumor Necrosis Factor Receptor Superfamily, Member 12A), TNFRSF8 (Tumor Necrosis Factor Receptor Superfamily, Member 8), TNFRSF9 (Tumor Necrosis Factor Receptor Superfamily, Member 9), INFSF11 (Tumor Necrosis Factor Receptor Superfamily, Member 11), INFSF13B (Tumor Necrosis Factor Receptor Superfamily, Member 13b), TNF- (Tumor Necrosis Factor alpha)), TNNT2 (troponin T type 2), TOR1A (torsin family 1 member A (tocsin A)), TPBG (Trophoblast Glycoprotein), TPH2 (tryplophan hydroxylase 2), TRAILR1 (Death receptor 4), TRAILR2 (Death receptor 5), TrkA (Tropomyosin receptor kinase A), TRPV4 (Transient Receptor Potential Cation Channel, Subfamily V, Member 4), TSC2 (tuberous sclerosis 2), TULP1 (tubby like protein 1), tumor necrosis factor related protein 5 tumor specific glycosylation of MUC1, tumor-associated calcium signal transducer 2, tumor protein p53, TYRP1 (glycoprotein 75), UCHl1 (ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)), UNC-13A (unc-13 homolog A), USH1C (Usher Syndrome 1C), USH2A (Usher Syndrome 2A (Autosomal Recessive, Mild), VEGF (Vascular endothelial growth factor), VEGF A (Vascular endothelial growth factor A), C5, Factor P. Factor D, EPO (Erythropoietin), EPOR (EPO receptor), Interleukins, IL-1, IL-17A, IL-10, TNF, FGFR2 (Fibroblast Growth Factor Receptor 2), VEGFR (vascular endothelial growth factor receptor), VEGFR2 (vascular endothelial growth factor receptor 2), vimentin, voltage gated ion channels, VWF (Von Willebrand Factor), WLS1 (Wolfram syndrome 1 (wolframin)), YES1 (Yamaguchi Sarcoma Viral Oncogene Homolog 1).

    [0609] In one embodiment, the AAV particle of the present invention, useful in treating a non-infectious disease, targets an antigen considered to be useful in the treatment of a different disease. As a non-limiting example, an NAV particle or pharmaceutical composition thereof used for the treatment of cancer, immune system dysfunctions or inflammatory disease may likewise be used for the treatment of a neurodegenerative disorder such as, but not limited to, AD, PD, HD, ALS, SMA, or DLB.

    V. KITS AND DEVICES

    Kits

    [0610] In one embodiment, the invention provides a variety of kits for conveniently and/or effectively carrying out methods of the present invention. Typically, kits will comprise sufficient amounts and/or numbers of components to allow a user to perform multiple treatments of a subject(s) and/or to perform multiple experiments.

    [0611] Any of the AAV particles of the present invention may be comprised in a kit. In some embodiments, kits may further include reagents and/or instructions for creating and/or synthesizing compounds and/or compositions of the present invention. In some embodiments, kits may also include one or more buffers. In some embodiments, kits of the invention may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.

    [0612] In some embodiments, kit components may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing, sterile, pharmaceutically acceptable buffers and/or other diluents. In some embodiments, various combinations of components may be comprised in one or more vial. Kits of the present invention may also typically include means for containing compounds and/or compositions of the present invention, e.g., proteins, nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which desired vials are retained.

    [0613] In some embodiments, kit components are provided in one and/or more liquid solutions. In some embodiments, liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly preferred. In some embodiments, kit components may be provided as dried powder(s). When reagents and/or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent. In some embodiments, it is envisioned that solvents may also be provided in another container means. In some embodiments, labeling dyes are provided as dried powders. In some embodiments, it is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits of the invention. In such embodiments, dye may then be resuspended in any suitable solvent, such as DMSO.

    [0614] In some embodiments, kits may include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions may include variations that may he implemented.

    Devices

    [0615] In one embodiment, the AAV particles may delivered to a subject using a device to deliver the AAV particles and a head fixation assembly. The head fixation assembly may be, but is not limited to, any of the head fixation assemblies sold by MRI interventions. As a non-limiting example, the head fixation assembly may be any of the assemblies described, in U.S. Pat. Nos. 8,099,150, 8,548,569 and 9,031,636 and International Patent Publication Nos. WO201108495 and WO2014014585, the contents of each of which are incorporated by reference in their entireties. A head fixation assembly may be used in combination with an MRI compatible drill such as, but not limited to, the MRI compatible drills described in International Patent Publication No. WO2013181008 and US Patent Publication No. US20130325012, the contents of which are herein incorporated by reference in its entirety.

    [0616] In one embodiment, the AAV particles may be delivered using a method, system and/or computer program for positioning apparatus to a target point on a subject to deliver the AAV particles. As a non-limiting example, the method, system and/or computer program may be the methods, systems and/or computer programs described in. U.S. Pat. No. 8, 340,743, the contents of which are herein incorporated by reference in its entirety. The method may include: determining a target point in the body and a reference point, wherein the target point and the reference point define a planned trajectory line (PTL) extending through each; determining a visualization plane, wherein the PTL intersects the visualization plane at a sighting point; mounting the guide device relative to the body to move with respect to the PTL, wherein the guide device does not intersect the visualization plane; determining a point of intersection (GPP) between the guide axis and the visualization plane; and aligning the GPP with the sighting point in the visualization plane.

    [0617] In one embodiment, the AAV particles may be delivered to a subject using a convention-enhanced deliver device. Non-limiting examples of targeted delivery of drugs using convection are described in US Patent Publication Nos. US20100217228, US20130035574 and US20130035660 and International Patent Publication No. WO2013019830 and WO2008144585, the contents of each of which are herein incorporated by reference in their entireties.

    [0618] In one embodiment, a subject may be imaged prior to, during and/or after delivery of the AAV particles. The imaging method may be a method known in the art and/or described herein, such as but not limited to, magnetic resonance imaging (MRI). As a non-limiting example, imaging may be used to assess therapeutic effect. As another non-limiting example, imaging may be used for assisted delivery of AAV particles.

    [0619] In one embodiment, the AAV particles may be delivered using an MRI-guided device. Non-limiting examples of MRI-guided devices are described in U.S. Pat. Nos. 9,055,884, 9.042,958, 8,886,288, 8,768,433, 8,396,532, 8,369,930, 8,374,677 and 8,175,677 and US Patent Application No. US20140024927 the contents of each of which are herein incorporated by reference in their entireties. As a non-limiting example, the MRI-guided device may be able to provide data in real time such as those described in U.S. Pat. Nos. 8,886,288 and 8,768,433, the contents of each of which is herein incorporated by reference in its entirety. As another non-limiting example, the MRI-guided device or system may be used with a targeting cannula such as the systems described in U.S. Pat. Nos. 8,175,677 and 8,374,677, the contents of each of which are herein incorporated by reference in their entireties. As yet another non-limiting example, the MRI-guided device includes a trajectory guide frame for guiding an interventional device as described, for example, in U.S. Pat. No. 9,055,884 and US Patent Application No. US20140024927, the contents of each of which are herein incorporated by reference in their entireties.

    [0620] In one embodiment, the AAV particles may be delivered using an MRI-compatible tip assembly. Non-limiting examples of MRI-comparable tip assemblies are described in US Patent Publication No. US20140275980, the contents of which is herein incorporated by reference in its entirety.

    [0621] In one embodiment, the AAV particles may be delivered using a cannula which is MRI-compatible. Non limiting examples of MRI-compatible catheters include those taught in International Patent Publication No. WO2011130107, the contents of which are herein incorporated by reference in its entirety.

    [0622] In one embodiment, the AAV particles may be delivered using a catheter which is MRI-compatible. Non-limiting examples of MRI-compatible catheters include those taught in International Patent Publication No. WO2012116265, US Patent Publication No. 8,825,133 and US Patent Publication No. US20140024909, the contents of each of which are herein incorporated by reference in their entireties.

    [0623] In one embodiment, the AAV particles may be delivered using a device with an elongated tubular body and a diaphragm as described in US Patent Publication Nos. US20140276582 and US20140276614, the contents of each of which are herein incorporated by reference in their entireties.

    [0624] In one embodiment, the AAV particles may be delivered using an MRI compatible localization and/or guidance system such as, but not limited to, those described in US Patent Publication Nos. US20150223905 and US20150230871, the contents of each of which are herein incorporated by reference in their entireties. As a non-limiting example, the MRI compatible localization and/or guidance systems may comprise a mount adapted for fixation to a patient, a targeting cannula with a lumen configured to attach to the mount so as to be able to controllably translate in at least three dimensions, and an elongate probe configured to snugly advance via slide and retract in the targeting cannula lumen, the elongate probe comprising at least one of a stimulation or recording electrode.

    [0625] In one embodiment, the AAV particles may be delivered to a subject using a trajectory frame as described in US Patent Publication Nos. US20150031982 and US20140066750 and International Patent Publication No WO2015057807 and WO2014039481, the contents of each of which are herein incorporated by reference in their entireties.

    [0626] In one embodiment, the AAV particles may be delivered to a subject using a gene gun.

    VI. DEFINITIONS

    [0627] At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual subcombination of the members of such groups and ranges.

    [0628] About: As used herein, the term about means +/10% of the recited value.

    [0629] Adeno-associated virus: The term adeno-associated virus or AAV as used herein refers to members of the dependovirus genus comprising any particle, sequence, gene, protein, or component derived therefrom.

    [0630] AAV Particle: As used herein, an AAV particle is a virus which comprises a viral genome with at least one payload region and at least one ITR region AAV vectors of the present disclosure may be produced recombinantly and may be based on adeno-associated virus (AAV) parent or reference sequences. AAV particle may be derived from any serotype, described herein or known in the art, including combinations of serotypes (i.e., pseudotyped AAV) or from various genomes (e.g., single stranded or self complementary). In addition, the AAV particle may be replication defective and/or targeted.

    [0631] Activity: As used herein, the term activity refers to the condition in which things are happening or being done. Compositions of the invention may have activity and this activity may involve one or more biological events.

    [0632] Administered in combination: As used herein, the term administered in combination or combined administration means that two or more agents are administered to a subject at the same time or within an interval such that there may be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, the administrations of the agents are spaced sufficiently closely together such that a combinatorial a synergistic) effect is achieved.

    [0633] Amelioration: As used herein, the term amelioration or ameliorating refers to a lessening of severity of at least one indicator of a condition or disease. For example, in the context of neurodegeneration disorder, amelioration includes the reduction of neuron loss.

    [0634] Animal: As used herein, the term animal refers to any member of the animal kingdom. In some embodiments, animal refers to humans at am' stage of development. In some embodiments, animal refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g. a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically-engineered animal, or a clone.

    [0635] Antibody: As used herein, the term antibody is referred to in the broadest sense and specifically covers various embodiments including, but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies formed from at least two intact antibodies), and antibody fragments (e.g., diabodies) so long as they exhibit a desired biological activity (e.g., functional). Antibodies are primarily amino-acid based molecules but may also comprise one or more modifications (including, but not limited to the addition of sugar moieties, fluorescent moieties, chemical tags, etc.). Non-limiting examples of antibodies or fragments thereof include V.sub.H and V.sub.L domains, scFvs, Fab, Fab, F(ab).sub.2, Fv fragment, diabodies, linear antibodies, single chain antibody molecules, multispecific antibodies, bispecific antibodies, intrabodies, monoclonal antibodies, polyclonal antibodies, humanized antibodies, codon-optimized antibodies, tandem scFv antibodies, bispecific T-cell enctagers, mAb2 antibodies, chimeric antigen receptors (CAR), tetravalent bispecific antibodies, biosynthetic antibodies, native antibodies, miniaturized antibodies, unibodies, maxibodies, antibodies to senescent cells, antibodies to conformers, antibodies to disease specific epitopes or antibodies to innate defense molecules.

    [0636] Antibody-based composition: As used herein, antibody-based or antibody-derived compositions are monomeric or multi-meric polypeptides which comprise at least one amino-acid region derived from a known or parental antibody sequence and at least one amino acid region derived from a non-antibody sequence, e.g., mammalian protein.

    [0637] Approximately: As used herein, the term approximately or about, as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

    [0638] Associated with: As used herein, the terms associated with, conjugated, linked, attached, and tethered, when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An association need not be strictly through direct covalent chemical bonding. It may also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the associated entities remain physically associated.

    [0639] Bifunctional: As used herein, the term bifunctional refers to any substance, molecule or moiety which is capable of or maintains at least two functions. The functions may effect the same outcome or a different outcome. The structure that produces the function may be the same or different.

    [0640] Biocompatible: As used herein, the term biocompatible means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.

    [0641] Biodegradable: As used herein, the term biodegradable means capable of being broken down into innocuous products by the action of living things.

    [0642] Biologically active: As used herein, the phrase biologically active refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, an AAV particle of the present invention may be considered biologically active if even a portion of the encoded payload is biologically active or mimics an activity considered biologically relevant.

    [0643] Capsid: As used herein, the term capsid refers to the protein shell of a virus particle.

    [0644] Chimeric antigen receptor (CAR): As used herein, the term chimeric antigen receptor or CAR refers to an artificial chimeric protein comprising at least one antigen specific targeting region (ASTR), a transmembrane domain and an intracellular signaling domain, wherein the antigen specific targeting region comprises a full-length antibody or a fragment thereof. As a non-limiting example the ASTR of a CAR may he any of the antibodies listed in Tables 3-12, antibody-based compositions or fragments thereof. Any molecule that is capable of binding a target antigen with high affinity can be used in the ASTR of a CAR. The CAR may optionally have an extracellular spacer domain and/or a co-stimulatory domain. A CAR may also he used to generate a cytotoxic cell carrying the CAR.

    [0645] Complementary and substantially complementary: As used herein, the term complementary refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can form base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated. Perfect complementarity or 100% complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand can form hydrogen bond with a nucleotide unit of a second polynucleotide strand. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands can form hydrogen bond with each other. For example, for two 20-mers, if only two base pairs on each strand can form hydrogen bond with each other, the polynucleotide strands exhibit 10% complementarity. In the same example, if 18 base pairs on each strand can form hydrogen bonds Guth each other, the polynucleotide strands exhibit 90% complementarity. As used herein, the term substantially complementary means that the siRNA has a sequence (e.g., in the antisense strand) which is sufficient to bind the desired target mRNA, and to trigger the RNA silencing of the target mRNA.

    [0646] Compound: Compounds of the present disclosure include all of the isotopes of the atoms occurring in the intermediate or final compounds. Isotopes refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium.

    [0647] The compounds and salts of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods.

    [0648] Comprehensive Positional Evolution (CPE): As used herein, the term comprehensive positional evolution refers to an antibody evolution technology that allows for mapping of the effects of amino acid changes at every position along an antibody variable domain's sequence. This comprehensive mutagenesis technology can be used to enhance one or more antibody properties or characteristics.

    [0649] Comprehensive Protein Synthesis (CPS): As used herein, the term comprehensive protein synthesis refers to a combinatorial protein synthesis technology that can be used to optimize antibody properties or characteristics by combining the best properties into a new, high-performance antibody.

    [0650] Conditionally active: As used herein, the term conditionally active refers to a mutant or variant of a wild-type polypeptide, wherein the mutant or variant is more or less active at physiological conditions than the parent polypeptide. Further, the conditionally active polypeptide may have increased or decreased activity at aberrant conditions as compared to the parent polypeptide. A conditionally active polypeptide may be reversibly or irreversibly inactivated at normal physiological conditions or aberrant conditions.

    [0651] Conserved: As used herein, the term conserved refers to nucleotides or amino acid residues of a polynucleotide sequence or poly peptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.

    [0652] In some embodiments, two or more sequences are said to be completely conserved if they are 100% identical to one another. In some embodiments, two or more sequences are said to he highly conserved if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some enibodiments, two or more sequences are said to be highly conserved if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some embodiments, two or more sequences are said to be conserved if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be conserved if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence may apply to the entire length of an polynucleotide or polypeptide or may apply to a portion, region or feature thereof.

    [0653] Control Elements: As used herein, control elements, regulatory control elements or regulatory sequences refers to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (IRES), enhancers, and the like, which provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control elements need always be present as long as the selected coding sequence is capable of being replicated, transcribed and/or translated in an appropriate host cell.

    [0654] Controlled Release: As used herein, the term controlled release refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.

    [0655] Cytostatic: As used herein, cytostatic refers to inhibiting, reducing, suppressing the growth, division, or multiplication of a cell (e.g., a mammalian cell (e.g., a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.

    [0656] Cytotoxic: As used herein, cytotoxic refers to killing or causing injurious, toxic, or deadly effect on a cell (e.g., a mammalian cell (e.g., a human cell)), bacterium, virus, fungus, protozoan, parasite, priori, or a combination thereof.

    [0657] Delivery: As used herein, delivery refers to the act or manner of delivering an AAV particle, a compound, substance, entity, moiety, cargo or payload.

    [0658] Delivery Agent: As used herein, deliver agent refers to any substance which facilitates, at least in part, the in vivo delivery of an AAV particle to targeted cells.

    [0659] Destabilized: As used herein, the term destable, destabilize, or destabilizing region means a region or molecule that is less stable than a starting, wild-type or native form of the same region or molecule.

    [0660] Detectable label: As used herein, detectable label refers to one or more markers, signals, or moieties which are attached, incorporated or associated with another entity that is readily detected by methods known in the art including radiography, fluorescence, chemiluminescence, enzymatic activity, absorbance and the like. Detectable labels include radioisotopes, fluorophores, chromophores, enzymes, dyes, metal ions, ligands such as biotin, avidin, streptavidin and haptens, quantum dots, and the like. Detectable labels may be located at any position in the peptides or proteins disclosed herein. They may be within the amino acids, the peptides, or proteins, or located at the N- or C-termini.

    [0661] Digest: As used herein, the term digest means to break apart into smaller pieces or components. When referring to poly peptides or proteins, digestion results in the production of peptides.

    [0662] Distal: As used herein, the term distal means situated away from the center or away from a point or region of interest.

    [0663] Dosing regimen: As used herein, a dosing regimen is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care.

    [0664] Encapsulate: As used herein, the term encapsulate means to enclose, surround or encase.

    [0665] Engineered: As used herein, embodiments of the invention are engineered when they are designed to have a feature or property, whether structural or chemical, that varies from a starting point, wild type or native molecule.

    [0666] Effective Amount: As used herein, the term effective amount of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an effective amount depends upon the context in which it is being applied. For example, in the context of administering an agent that treats cancer, an effective amount of an agent is, for example, an amount sufficient to achieve treatment, as defined herein, of cancer, as compared to the response obtained without administration of the agent.

    [0667] Epitope: As used herein, an epitope refers to a surface or region on a molecule that is capable of interacting with a biomolecule. For example, a protein may contain one or more amino acids, an epitope which interacts with an antibody, e.g., a biomolecule. In some embodiments, when referring to a protein or protein module, an epitope may comprise a linear stretch of amino acids or a three-dimensional structure formed by folded amino acid chains.

    [0668] EvoMap: As used herein, an EvoMap refers to a map of a polypeptide, wherein detailed informatics are presented about the effects of single amino acid mutations within the length of the polypeptide and their influence on the properties and characteristics of that polypeptide.

    [0669] Expression: As used herein, expression of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5 cap formation, and/or 3 end processing); (3) translation of an RNA into a poly peptide or protein; and (4) post-translational modification of a polypeptide or protein.

    [0670] Feature: As used herein, a feature refers to a characteristic, a property, or a distinctive element.

    [0671] Formulation: As used herein, a formulation includes at least one AAV particle and a delivery agent.

    [0672] Fragment: A fragment, as used herein, refers to a portion. For example, fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells.

    [0673] Functional: As used herein, a functional biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.

    [0674] Gene expression: The term gene expression refers to the process by which a nucleic acid sequence undergoes successful transcription and in most instances translation to produce a protein or peptide. For clarity, when reference is made to measurement of gene expression, this should be understood to mean that measurements may be of the nucleic acid product of transcription, e.g., RNA or mRNA or of the amino acid product of translation, e.g., polypeptides or peptides. Methods of measuring the amount or levels of RNA, mRNA, polypeptides and peptides are well known in the art.

    [0675] Homology: As used herein, the term homology refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be homologous to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar. The term homologous necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). In accordance with the invention, two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% for at least one stretch of at least about 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode a stretch of at least 4-5 uniquely specified amino acids. In accordance with the invention, two protein sequences are considered to be homologous if the proteins are at least about 50%, 60%, 70%, 80%, or 90% identical for at least one stretch of at least about 20 amino acids.

    [0676] Heterologous Region: As used herein the term heterologous region refers to a region which would not be considered a homologous region.

    [0677] Homologous Region: As used herein the term homologous region refers to a region which is similar in position, structure, evolution origin, character, form or function.

    [0678] Identity: As used herein, the term identity refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g. DNA molecules andlor RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a. first and a. second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). in certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 49%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith., D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-173, which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1900)).

    [0679] Inhibit expression gfa gene: As used herein, the phrase inhibit expression of a gene means to cause a reduction in the amount of an expression product of the gene. The expression product can be an RNA transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene. Typically, a reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom. The level of expression may be determined using standard techniques for measuring mRNA or protein.

    [0680] In vitro: As used herein, the term in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

    [0681] In vivo: As used herein, the term in vivo refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

    [0682] Isolated: As used herein, the term isolated refers to a substance or entity that has been separated from at least some of the components with which it was associated (whether in nature or in an experimental setting). Isolated substances may have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is pure if it is substantially free of other components.

    [0683] Substantially isolated: By substantially isolated is meant that a substance is substantially separated from the environment in which it was formed or detected. Partial separation can include, for example, a composition enriched in the substance or AAV particles of the present disclosure. Substantial separation can include compositions containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% by weight of the compound of the present disclosure, or salt thereof. Methods for isolating compounds and their salts are routine in the art.

    [0684] Linker: As used herein linker refers to a molecule or group of molecules which connects two molecules, such as a V.sub.H chain and V.sub.L chain or an antibody. A linker may be a nucleic acid sequence connecting two nucleic acid sequences encoding two different polypeptides. The linker may or may not be translated. The linker be a cleavable linker.

    [0685] MicroRNA (miRNA) binding site: As used herein, a microRNA (miRNA) binding site represents a nucleotide location or region of a nucleic acid transcript to which at least the seed region of a miRNA binds.

    [0686] Modified: As used herein modified refers to a changed state or structure of a molecule of the invention. Molecules may be modified in many ways including chemically, structurally, and functionally.

    [0687] Naturally Occurring: As used herein, naturally occurring or wild-type means existing in nature without artificial aid, or involvenient of the hand of man.

    [0688] Non-human iertebreite: As used herein, a non-human vertebrate includes all vertebrates except Homo sapiens, including wild and domesticated species. Examples of non-human vertebrates include, but are not limited to, mammals. such as alpaca, banteng, bison, camel, cat, cattle, deer, dog, donkey, gayal, goat, guinea pig, horse, llama, mule, pig, rabbit, reindeer, sheep water buffalo, and yak.

    [0689] Off-target: As used herein, off target refers to any unintended effect on any one or more target, gene, or cellular transcript.

    [0690] Open reading As used herein, open reading frame or ORF refers to a sequence which does not contain a stop codon in a given reading frame.

    [0691] Operably linked: As used herein, the phrase operably linked refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.

    [0692] Particle: As used herein, a particle is a virus comprised of at least, two components, a protein capsid and a polynucleotide sequence enclosed within the capsid.

    [0693] Patient: As used herein, patient refers to a subject who may seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition.

    [0694] Payload: As used herein, payload or payload region refers to one or more polynucleotides or polynucleotide regions encoded by or within a viral genome or an expression product of such polynucleotide or polynucleotide region, e.g., a transgene, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory nucleic acid or regulatory nucleic acid.

    [0695] Payload construct: As used herein, payload construct is one or more polynucleotide regions encoding or comprising a payload that is flanked on one or both sides by an inverted terminal repeat (ITR) sequence. The payload construct is a template that is replicated in a viral production cell to produce a viral genome.

    [0696] Payload construct vector: As used herein, payload construct vector is a vector encoding or comprising a payload construct, and regulatory regions for replication and expression in bacterial cells.

    [0697] Payload construct expression vector: As used herein, a payload construct expression vector is a vector encoding or comprising a payload construct and which further comprises one or more polynucleotide regions encoding or comprising components for viral expression in a viral replication cell.

    [0698] Peptide: As used herein, peptide is less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

    [0699] Pharmaceutically acceptable: The phrase pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, arid/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

    [0700] Pharmaceutically acceptable excipients: The phrase pharmaceutically acceptable excipient, as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxy toluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinited starch, propyl paraben, retinylpalmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

    [0701] Pharmaceutically acceptable salts: The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, berizenesulfonate, berizerie sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesuifonate, fbmarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammoniurn, tetramethylammonium, tetraethylammonium, methylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can he synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

    [0702] Pharmaceutically acceptable solvate: The term pharmaceutically acceptable solvate, as used herein, means a compound of the invention wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), N,N-dimethylacelamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimearyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a hydrate.

    [0703] Pharmacokinetic: As used herein, pharmacokinetic refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetic is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the In rare cases, some drugs irreversibly accumulate in body tissue.

    [0704] Physicochemical: As used herein, physicochemical means of or relating to a physical and/or chemical property.

    [0705] Preventing: As used herein, the term preventing refers to partially or completely delaying onset of an infection, disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying progression from an infection, a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and/or condition.

    [0706] Proliftrate: As used herein, the term proliferate means to grow, expand or increase or cause to grow, expand or increase rapidly. Proliferative means having the ability to proliferate. Anti-proliferative means having properties counter to or inapposite to proliferative properties.

    [0707] Propkylactic: As used herein, prophylactic refers to a therapeutic or course of action used to prevent the spread of disease.

    [0708] Prophylaxis: As used herein, a prophylaxis refers to a measure taken to maintain health and prevent the spread of disease.

    [0709] Protein of interest: As used herein, the terms proteins of interest or desired proteins include those provided herein and fragments, mutants, variants, and alterations thereof.

    [0710] Proximal: As used herein, the term proximal means situated nearer to the center or to a point or region of interest.

    [0711] Purified: As used herein, purify, purified. purification means to make substantially pure or clear from unwanted components, material defilement, admixture or imperfection. Purified refers to the state of being pure. Purification refers to the process of making pure.

    [0712] Region: As used herein, the term region refers to a zone or general area. In some embodiments, when referring to a protein or protein module, a region may comprise a linear sequence of amino acids along the protein or protein module or may comprise a three-dimensional area, an epitope and/or a cluster of epitopes. In some embodiments, regions comprise terminal regions. As used herein, the term terminal region refers to regions located at the ends or termini of a given agent. When referring to proteins, terminal regions may comprise N- and/or C-termini. N-termini refer to the end of a protein comprising an amino acid with a free amino group. C-termini refer to the end of a protein comprising an amino acid with a free carboxyl group. N- and/or C-terminal regions may there for comprise the N- and/or C-termini as well as surrounding amino acids. In some embodiments, N- and/or C-terminal regions comprise from about 3 amino acid to about 30 amino acids, from about 5 amino acids to about 40 amino acids, from about 10 amino acids to about 50 amino acids, from about 20 amino acids to about 100 amino acids and/or at least 100 amino acids. In some embodiments, N-terminal regions may comprise any length of amino acids that includes the N-terminus, but does not include the C-terminus. In some embodiments, C-terminal regions may comprise any length of amino acids, which include the C-terminus, but do not comprise the N-terminus.

    [0713] In some embodiments, when referring to a polynucleotide, a region may comprise a linear sequence of nucleic acids along the polynucleotide or may comprise a three-dimensional area, secondary structure, or tertiary structure in some embodiments, regions comprise terminal regions. As used herein, the term terminal region refers to regions located at the ends or termini of a given agent. When referring to polynucleotides, terminal regions may comprise 5 and 3 termini. 5 termini refer to the end of a polynucleotide comprising a nucleic acid with a free phosphate group. 3 termini refer to the end of a polynucleotide comprising a nucleic acid with a free hydroxyl group. 5 and 3 regions may there for comprise the 5 and 3 termini as well as surrounding nucleic acids. In some embodiments, 5 and 3 terminal regions comprise from about 9 nucleic acids to about 90 nucleic acids, from about 15 nucleic acids to about 120 nucleic acids, from about 30 nucleic acids to about 150 nucleic acids, from about 60 nucleic acids to about 300 nucleic acids and/or at least 300 nucleic acids. In some embodiments, 5 regions may comprise any length of nucleic acids that includes the 5 terminus, but does not include the 3 terminus. In some embodiments, 3 regions may comprise any length of nucleic acids, which include the 3 terminus, but does not comprise the 5 terminus.

    [0714] RNA or RNA molecule: As used herein, the term RNA or RNA molecule or ribonucleic acid molecule refers to a polymer of ribonucleotides; the term DNA or DNA molecule or deoxyribonucleic acid molecule refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally, e.g., by DNA replication and transcription of DNA, respectively; or be chemically synthesized DNA and RNA can be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA, respectively). The term mRNA or messenger RNA, as used herein, refers to a single stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.

    [0715] Sample: As used herein, the term sample or biological sample refers to a subset of its tissues, cells or component parts (e.g. body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). A sample further may include a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs. A sample further refers to a medium, such as a nutrient broth or gel, which may contain cellular components, such as proteins or nucleic acid molecule.

    [0716] Self complementary viral particle: As used herein, a self-conplementaty viral particle is a particle comprised of at least two components, a protein capsid and a polynucleotide sequence encoding a self-complementary genome enclosed within the capsid.

    [0717] Signal Sequences: As used herein, the phrase signal sequences refers to a sequence which can direct the transport or localization of a protein.

    [0718] Single unit dose: As used herein, a single unit dose is a, dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event. In some embodiments, a single unit dose is provided as a discrete dosage form a tablet, capsule, patch, loaded syringe, vial, etc.).

    [0719] Similarity: As used herein, the term similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.

    [0720] Split dose: As used herein, a split dose is the division of single unit dose or total daily dose into two or more doses.

    [0721] Stable: As used herein stable refers to a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and preferably capable of formulation into an efficacious therapeutic agent.

    [0722] Stabilized: As used herein, the term stabilize, stabilized, stabilized region means to make or become stable.

    [0723] Subject. As used herein, the term subject or patient refers to any organism to which a composition in accordance with the invention may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and/or plants.

    [0724] Substantially: As used herein, the term substantially refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term substantially is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

    [0725] Substantially equal: As used herein as it relates to time differences between doses, the term means plus/minus 2%.

    [0726] Substantially simultaneously: As used herein and as it relates to plurality of doses, the term means within 2 seconds.

    [0727] Suffering from: An individual who is suffering from a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of a disease, disorder, and/or condition.

    [0728] Susceptible to: An individual who is susceptible to a disease, disorder, and/or condition has not been diagnosed with and/or may not exhibit symptoms of the disease, disorder, and/or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition (for example, cancer) may be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and/or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and/or condition; (3) increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder, and/or condition; (4) habits and/or lifestyles associated with development of the disease, disorder, and/or condition; (5) a family history of the disease, disorder, and/or condition; and (6) exposure to and/or infection with a microbe associated with development of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

    [0729] Sustained release: As used herein, the term sustained release refers to a pharmaceutical composition or compound release profile that conforms to a release rate over a specific period of time.

    [0730] Synthetic: The term synthetic means produced, prepared, and/or manufactured by the hand of man. Synthesis of polynucleotides or poly peptides or other molecules of the present invention may be chemical or enzymatic.

    [0731] Targeting: As used herein, targeting' means the process of design and selection of nucleic acid sequence that will hybridize to a target nucleic acid and induce a desired effect.

    [0732] Targeted Cells: As used herein, targeted cells refers to any one or more cells of interest. The cells may be found in vitro, in viva, in situ or in the tissue or organ of an organism. The organism may be an animal, preferably a mammal, more preferably a human and most preferably a patient.

    [0733] Therapeutic Agent: The term therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect.

    [0734] Therapeutically effective amount: As used herein, the term therapeutically effective amount means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is provided in a single dose. In some embodiments, a therapeutically effective amount is administered in a dosage regimen comprising a plurality of doses. Those skilled in the art will appreciate that in some embodiments, a unit dosage form may be considered to comprise a therapeutically effective amount of a particular agent or entity if it comprises an amount that is effective when administered as part of such a dosage regimen.

    [0735] Therapeutically effective outcome: As used herein, the term therapeutically effective outcome means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.

    [0736] Total daily dose: As used herein, a total daily dose is an amount given or prescribed in 24 hr period. It may be administered as a single unit dose.

    [0737] Transfection: As used herein, the term transfection refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.

    [0738] Treating: As used herein, the term treating refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular infection, disease, disorder, and/or condition. For example, treating cancer may refer to inhibiting survival, growth, and/or spread of a tumor. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

    [0739] Unmodified: As used herein, unmodified refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild type or native form of a biomolecule. Molecules may undergo a series of modifications whereby each modified molecule may serve as the unmodified starting molecule for a subsequent modification.

    [0740] Vector: As used herein, a vector is any molecule or moiety which transports, transduces or otherwise acts as a carrier of a heterologous molecule. Vectors of the present invention may be produced recombinantly and may be based on and/or may comprise adeno-associated virus (AAV) parent or reference sequence. Such parent or reference AAV sequences may serve as an original, second, third or subsequent sequence for engineering vectors. In non-limiting examples, such parent or reference AAV sequences may comprise any one or more of the following sequences: a polynucleotide sequence encoding a polypeptide or multi-polypeptide, which sequence may be wild-type or modified from wild-type and which sequence may encode full-length or partial sequence of a protein, protein domain, or one or more subunits of a protein a polynucleotide comprising a modulatory or regulatory nucleic acid which sequence may be wild-type or modified from wild-type, and a transgene that may or may not be modified from wild-type sequence These AAV sequences may sere as either the donor sequence of one or more codons (at the nucleic acid level) or amino acids (at the polypeptide level) or acceptor sequences of one or more codons (at the nucleic acid level) or amino acids (at the polypeptide level).

    [0741] Viral genome: As used herein, a viral genome or vector genome is a polynucleotide comprising at least one inverted terminal repeat (ITR) and at least one encoded payload. A viral genome encodes at least one copy of the payload.

    [0742] Described herein are compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of AAV particles. In some embodiments, payloads, such as but not limited to AAV polynucleotides, may be encoded by payload constructs or contained within plasmids or vectors or recombinant adeno-associated viruses (AAVs).

    [0743] The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred materials and methods are now described. Other features, of and advantages of the invention will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the case of conflict, the present description will control.

    [0744] The present invention is further illustrated by the following non-limiting examples.

    VII. EXAMPLES

    Example 1

    Production and Purification of AAV Particles

    [0745] AAV particles described herein may be produced using methods known in the art, such as, for example, triple transfection or baculovirus mediated virus production. Any suitable permissive or packaging cell known in the art may be employed to produce the vectors. Mammalian cells are often preferred. Also preferred are trans-complementing packaging cell lines that provide functions deleted from a replication-defective helper virus, e.g., 293 cells or other E1a trans-complementing cells.

    [0746] The gene cassette may contain some or all of the parvovirus (e.g., AAV) cap and rep genes. Preferably, however, some or all of the cap and rep functions are provided in trans by introducing a packaging vector(s) encoding the capsid and/or Rep proteins into the cell. Most preferably, the gene cassette does not encode the capsid or Rep proteins. Alternatively, a packaging cell line is used that is stably transformed to express the cap and/or rep genes

    [0747] Recombinant AAV virus particles are, in some cases, produced and purified from culture supernatants according to the procedure as described in US20160032254, the contents of which are incorporated by reference. Production may also involve methods known in the art including those using 2931 cell, sf9 insect cells, triple transfection or any suitable production method.

    [0748] In some cases, 293 cells are transfected with CaPO4 with plasmids required for production of AAV, i.e., AAV2 rep, an adenoviral helper construct and a HR flanked transgene cassette. The AAV2 rep plasmid also contains the cap sequence of the particular virus being studied. Twenty-four hours after transfection, which occurs in serum containing DMEM, the medium is replaced with fresh medium with or without serum. Three (3) days after transfection, a sample is taken from the culture medium of the 293 adherent cells. Subsequently cells are scraped and transferred into a receptacle. After centrifugation to remove cellular pellet, a second sample is taken from the supernatant after scraping. Next cell lysis is achieved by three consecutive freeze-thaw cycles (80 C. to 37 C.). Cellular debris is removed and sample 3 is taken from the medium. The samples are quantified for AAV particles by DNase resistant genome titration by Taqman PCR. The total production yield from such a transfection is equal to the particle concentration from sample 3.

    [0749] AAV vector titers are measured according to genome copy number (genome particles per milliliter). Genome particle concentrations are based on Taqman PCR of the vector DNA as previously reported (Clark et al. (1999) Hum. Gene Ther., 10:10314039 Veidwijk et al. (2002) Mol. Ther., 6:272-278).

    Example 2

    Tissue Specific expression

    [0750] To evaluate the expression of various encoded antibody payloads in tissues, a series of AAV particles carrying the encoded antibody sequences driven by a panel of ubiquitous and tissue-specific; promoters are made. These particles are administered to the specific tissue, e.g., intramuscularly, via an appropriate route, e.g., a single injection in the gastrocnemius muscle and expression is monitored to determine the relative expression potential of the payload as well as of each promoter in this target tissue. Measurement of antibody production is performed using standard techniques, for example by ELISA.

    [0751] In some cases, the cytomegalovirus immediate early promoter (CMV), chimeric chicken-beta-actin (CAG), and ubiquitin C (UBC), CBA, H1 promoters provide robust expression.

    Example 3

    Generation of Antibodies

    Antibody Production by Hybriclonta Technology

    [0752] Host animals (e.g. mice, rabbits, goats, and llamas) are immunized by an injection with an antigenic protein to elicit lymphocytes that specifically bind to the antigen. Lymphocytes are collected and fused with immortalized cell lines to generate hybridomas. Hybridomas are cultured in a suitable culture medium that is enriched with appropriate selection agents to promote growth.

    [0753] Antibodies produced by the cultured hybridomas are subjected to analysis to determine binding specificity of the antibodies for the target antigen. Once antibodies with desirable characteristics are identified, corresponding hybridomas are subcloned through limiting dilution procedures and grown by standard methods. Antibodies produced by these cells are isolated and purified using standard immunoglobulin purification procedures.

    Recombinant Antibody Production

    [0754] Recombinant antibodies are produced using heavy and light chain variable region cDNA sequences selected from hybridomas or from other sources. Sequences encoding antibody variable domains expressed by hybridomas are determined by extracting RNA molecules from antibody-producing hybridoma cells and producing cDNA by reverse transcriptase polymerase chain reaction (PCR). PCR is used to amplify cDNA using primers specific for heavy and light chain sequences. PCR products are then subcloned into plasmids for sequence analysis. Antibodies are produced by insertion of resulting variable domain sequences into expression vectors.

    [0755] Recombinant antibodies are also produced using phage display technology. Target antigens are screened, in vitro, using phage display libraries having millions to billions of phage particles expressing unique single chain variable fragments (scFvs) on their viral coat. Precipitated phage particles are analyzed and sequences encoding expressed scFvs are determined. Sequences encoding antibody variable domains and/or CDRs are inserted into expression vectors for antibody production.

    [0756] Recombinant antibodies are further produced using yeast surface display technology, wherein antibody variable domain sequences are expressed on the cell surface of Saccharomyces cerevisiae. Recombinant antibodies are developed by displaying the antibody fragment of interest as a fusion to e.g. Aga2p protein on the surface of the yeast, where the protein interacts with proteins and small molecules in a solution. scFvs with affinity towards desired receptors are isolated from the yeast surface using magnetic separation and flow cytometry. Several cycles of yeast surface display and isolation will be done to attain scFvs with desired properties through directed evolution.

    Example 4

    Optimization of the Encoded Antibody

    [0757] To design an optimal framework for the expression of an antibody, the heavy and light chains of several antibodies separated by an F2A self-processing peptide sequence are cloned into a mammalian expression vector under the control of the CMV promoter. 293T cells or any suitable cell line transfected with these vectors exhibit secretion of human IgG into the culture supernatant that is then detected by ELISA.

    [0758] To increase expression, the antibody chains and/or the processing peptide are codon optimized for mammalian expression. In some instances, a furin cleavage site at the N-terminus is inserted for better processing.

    [0759] To improve secretion of the antibody, the endogenous signal sequences are replaced with a sequence which may or may not be codon optimized, derived from any gene. In some cases, the human growth hormone signal sequence is used. Any of the heavy, light or both chains may be driven by any signal sequence, whether the same or different. Antibody expression is confirmed using standard immunohistochemical techniques, including ELISA.

    Example 5

    Vectored Antibodies

    [0760] Viral genomes are designed for AAV delivery of antibodies to cells. The viral genome comprises a payload region and at least one inverted terminal repeat (ITR) region. The payload region may optionally encode regulatory elements a promoter region, an intronic region, or a polyadenylation sequence. The payload region comprises a sequence encoding one or more polypeptides selected from the group consisting of those listed in Table 3. An exemplary payload region comprises a sequence encoding an antibody heavy chain, a region encoding an antibody light chain and a region encoding a linker connecting the heavy and light chain sequences or polypeptides before further processing. A promoter is selected to target the desired tissue or for desired regulation of expression, or both. The promoter may be selected from human EF1, CMV, CBA, and its derivative CAG, GUSB, UBC, or any other promoter known to one with skill in the art, or combinations thereof. The 5 and 3 ITRs may or may not be of the same serotype as the capsid of the AAV particle.

    [0761] Payload regions may optionally encode a linker between light and heavy antibody chain sequences or polypeptides. Sequence encoding linkers are derived from an internal ribosome entry site (IRES; SEQ ID NO: 899), foot and mouth disease virus 2A (F2A; SEQ ID NO: 900), porcine teschovirus-1 virus 2A (P2A; SEQ ID NO: 901), a furin cleavage site (F; SEQ ID NO: 902), or a 5xG4S (SEQ ID NO: 903) linker sequence. In various payload regions, the order of heavy and light chains is alternated with respect to 5 to 3 direction. Payloads are further designed to encode protein signal sequences (to aid in protein processing, localization, and/or secretion) as well as an untranslated poly A tail.

    [0762] Each viral genome is then incorporated into an AAV cloning vector to create payload expression vectors.

    [0763] The payload expression vectors are expressed in e.g. Expi 293 cells. The supernatants are collected and expressed antibodies are purified using protein A/G beads. Supernatants are diluted with a loading buffer and applied to a column prepared with A/G beads. Unbound proteins are washed through with loading buffer. Elution buffer is added to the column, fractions collected, and fractions containing proteins of interest are identified with absorption spectroscopy technique, pooled together, and neutralized. Western blotting techniques are used to identify payload regions producing the antibody proteins of interest. Purified antibodies are then tested for their affinity to their specific target by e.g. ELISA essay technique and antibodies with the highest affinity are identified and selected.

    [0764] Finally, the rAAVs are produced using, for example, HEK293T cells, The cells are transfected simultaneously with the viral genome of the present invention, a viral genome encoding helper proteins and a viral genome encoding replication and capsid proteins.

    Example 6

    In Vivo Expression and Efficacy of Antibody Payloads

    [0765] To determine the efficacy or comparative expression of encoded antibodies, dose-dependent expression is determined at a series of time points. Samples from mice treated with AAV particles encoding antibodies or luciferase at various levels are examined for expression using standard techniques such as nucleic acid analyses for RNA levels, protein analyses for antibody levels and compared to the expression of the luciferase control.

    Example 7

    Treatment of Non-Infectious Disease

    [0766] AAV particles of the current invention encoding an antibody are administered to a patient who has been diagnosed with a non-infectious disease, disorder or condition. The non-infectious disease, disorder or condition may be e.g. a central nervous system disease, muscular disease, neuropathy, psychiatric disorder, ocular disease, pain disorder, migraine, cancer, systemic disease, inflammation, or an immune system disease. The purpose of the treatment may be aimed to manage the disease, prevent or slow the progression of the disease, treat the symptoms associated with the disease and/or cure the disease.

    [0767] The AAV particles may be administered through an intramuscular injection to the skeletal muscle. The administration may include one or more injections over a period of time. The level and distribution of AAV particles and antibody expression is monitored by standard diagnostic techniques known in the art. Such diagnostic techniques include e.g. (e.g. from blood, urine, or saliva), cerebrospinal fluid (CSF) testing, or any other testing useful for monitoring antibody levels in the body.

    [0768] Additionally, the progression of the disease and the health of the patient is monitored by standard diagnostic techniques known in the art. Such techniques may include diagnostic imaging (e.g. X-ray, MRA scans, Ultrasound scans, PET scans, Nuclear scans, mammography), biopsy, laboratory tests (e.g. from blood, urine, or saliva), cerebrospinal fluid ((SF) testing, vital signs, clinical tests (cognitive, motor or reflex tests) and other relevant techniques. Treatment with the AAV particles may results in cure of the non-infectious disease, slowing down or stabilizing the progression of the disease, or have no effect on the progression of the disease. Additionally, the treatment may reduce severity of one or more symptoms associated with the disease, eliminate one or more symptoms associated with the disease or have no effect on the symptoms.

    VIII. EQUIVALENTS AND SCOPE

    [0769] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

    [0770] In the claims, articles such as a, an, and the may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include or between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process.

    [0771] It is also noted that the term comprising is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term comprising is used herein, the term consisting of is thus also encompassed and disclosed.

    [0772] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

    [0773] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any antibiotic, therapeutic or active ingredient any method of production; any method of use; etc.) can be excluded from any one or more claims for any reason, whether or not related to the existence of prior art.

    [0774] It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects.

    [0775] While the present invention has been described at some length and with some particularity with respect to the several described embodiments, it is not intended that it should be limited to any such particulars or embodiments or any particular embodiment, but it is to be construed with reference to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art and, therefore, to effectively encompass the intended scope of the invention.

    TABLE-US-LTS-00001 LENGTHY TABLES The patent application contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).