Attenuation system and use thereof

Abstract

Disclosed are an attenuation system and the use thereof for attenuating plasmodia, specifically the use of an EF1g gene for attenuating plasmodia. The attenuation system regulates the expression or degradation of the EF1g gene by using a regulatory system, thereby controlling the growth of plasmodia and achieving the attenuation of plasmodia.

Claims

1. An attenuation system, which comprises a modified genome of Plasmodium with an exogenous nucleotide sequence encoding a regulatory element upstream of the EF1g gene in a genome of Plasmodium, wherein said exogenous nucleotide sequence is as shown in SEQ. ID NO. 2, and wherein the EF1g gene has the nucleotide sequence as shown in SEQ ID NO. 1.

2. A host cell of Plasmodium, which comprises the attenuation system according to claim 1.

3. The host cell according to claim 2, wherein the host cell is selected from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium malariea, Plasmodium ovale, and Plasmodium knowlesi.

4. A vaccine, comprising the attenuation system according to claim 1 or the host cell according to claim 2.

5. A method for attenuating Plasmodium, comprising: infecting an animal with the attenuation system according to claim 1, and controlling the addition of trimethoprim (TMP) to achieve attenuation.

6. The method according to claim 5, wherein the Plasmodium is any one or a combination of at least two of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium malariea, Plasmodium ovale, or Plasmodium knowlesi, preferably Plasmodium berghei.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a schematic diagram of the pBC-DHFR-GFPm3-EF1g-tar vector.

(2) FIG. 2 shows the results of fluorescence observation through a fluorescence microscope, where BF is short for bright field, GFP is short for green fluorescent protein, and hoechst is a dye for labelling a nucleus.

(3) FIG. 3 shows a change curve of a Plasmodium infection rate after TMP withdrawal.

(4) FIG. 4 shows the results of the infection rate of DDD-EF1g strain detected after a second-round of TMP administration followed by withdrawal.

(5) FIG. 5 shows change curves of Plasmodium infection rates and survival rates of groups in a TMP withdrawal experiment.

(6) FIG. 6 shows the results of fluorescence of G1 and a wild-type P.b A strain detected through a fluorescence microscope, where BF is for bright field, and FL demotes results under a fluorescent light.

(7) FIG. 7 shows the results of fluorescence of G1 detected through a fluorescence microscope after TMP withdrawal, where BF is for bright field, FL demotes results under a fluorescent light, and D denotes the number of days after TMP withdrawal.

(8) FIG. 8 (A) shows Plasmodium infection rates of groups in a TMP withdrawal experiment, and FIG. 8 (B) shows change curves of Plasmodium survival rates of the groups in the TMP withdrawal experiment.

(9) FIG. 9 is a schematic diagram of a Plasmodium inoculation and administration process in a challenge experiment.

(10) FIG. 10 shows change curves of infection rates of mice inoculated with DDD-EF1g (experimental group).

(11) FIG. 11 shows change curves of infection rates of mice inoculated with P.b ANKA (control group).

(12) FIG. 12 shows survival rates of mice after a Plasmodium challenge.

DETAILED DESCRIPTION

(13) To further elaborate on the technical means adopted and the effects achieved in the present disclosure, the solutions of the present disclosure are further described below with reference to the drawings and embodiments, but the present disclosure is not limited to the scope of the examples.

Example 1 Construction of a Strain that Adopts DDD to Regulate the EF1g Gene in P.bANKA

(14) In this example, a Cas9 knock-in vector pBC-DHFR-GFPm3-EF1g-Tar was constructed. The schematic diagram of the vector is shown in FIG. 1. The vector had Amp resistance and contained a gene encoding Cas9 protein and a hDHFR gene conferring Plasmodium pyrimethamine resistance which were expressed in tandem, where pbeef1aa was used as a promoter, the Cas9 gene and the hDHFR gene were linked by a 2A peptide, and 3′Pb dhfr/ts was used as a terminator. In addition, the vector further included a fusion expression cassette that included successive sequences of an EF1g homologous arm 1, a regulatory element DHFR, a reporter protein GFP, and an EF1g downstream homologous arm, with pbeef1aa as the promoter and 3′Pb dhfr/ts as the terminator. The vector further included a P.b U6 promoter to express sgRNA.

(15) Homologous arms of the EF1g gene are shown in SEQ ID NO. 4 and SEQ ID NO. 5, and sgRNA primers are shown in SEQ ID NO. 6 and SEQ ID NO. 7. The specific sequences are shown in Table 1.

(16) TABLE-US-00004 TABLE 1 Primer Name Use Primer Sequence (5′ .fwdarw. 3′) SEQ EF1g ACTCCTATAGGCTTAATAATTATAAGCGCTATATATATCACAT ID NO.  homologous GCAACTTAAAAAAAAATATGCATATATATAATTTTTCATGATT 4 arm 1 GCAAAAAGAAGTTTGAAATATTTAAAAAATAAAACACATTCC AATTATTTGTCGCTAAATTTTATTTTTAATTAAATATATCGCA CAAAAGTATAAACACATATAGTATTTTTCGTGTTAATAAAAT AACAATAGTTGAACTACAAAACGAACTATTTTATTAGTCAAT TAATTTAGGATATTTTTCCTTAAAAAAACTAAATATATATTAT ACCAAATATTTTCCATCATAATTGTAGATTTACTTTTTATTTA AACTAGGGAAAATGGATTTAGTAAGAAAAAAAAAAAAAAAA AAACATATATATTGTATGTTCTAAATATGTTTATAATTTGAGT AAATAAAAATAAAATTTCACATAATATCAGCAATGCATAGTA TAAAAAAAAAACATCAAATTAAAAAATATATATTATTATACA ATTTAAAAAATGAGCATACAACATTTAGTTCATGATATATGC ATAATTATATTATATGTTCATAAAATAATTTTTCTTTATTTTTT TTTCTTAATTTTCATAGAAACTTCTTGGCCCAAAAAATGATAT CAGATGTTTGAAGGTGCAAACAGTTGCTTCTTTTTGTAATATA AAACTAAATATCCCAACATTTGAAATCGGTATTGATGATAAT AAAGATGAATTTATAAAAGAATCGCCA SEQ EF1g AATGCTATAGGAAAATATTTATGCAGTATAAGAAGTGAACAT ID NO.  homologous AATTTATTGGGAAATGGAATTTTTGAAGAAGGGCAAGTAAAT 5 arm 2 ATGTGGGTAGATTTTTGTACATTTGAATTAGAAATTCCAGTAT GCTGTTATATTAGTAATAAGTTGAATGAAAAATCGTTAAAAC ATATTCAAGATACATTTAGTTGTTTAAATAAACACTTACTATT AAATCAGTATATGGTAGGTAACAACATAACTATTGTTGATAT TTTTATGTCTGTAATTATAAATTTTTGTATAAAATCGGGAAAA ATGACTGAAGCCTTTTTAAAACAATATGGAAACTTATACAGA TTATATACAACTATAATAAATCAGAAACAATTTAAATATGTT ATGGGTTCAGGATCAGCTGTAAATAATAAAAAAACACCTACT CAACCCAAACAGCCAAATAATAAGGAAAAAAAAAAACCAAA AGAAGATGCAGATGATGATATTAATCTATTTAGTGATGATGG ACTTAATGAAAAAAAAACAAAAAAGACAAACCCTTTAGATTT ATTACCTCCATCAAAATTTTCTTTAGATAACTGGAAATATAAA TTTAGTAATGAAAAGGATTTATTAAAAAATGCAATGCCCACA TTTTGGGAAACTTATGATAGTAATGGATTTTCATTATATTATA TGAAATATGATAAATTAGAAGATGAATGCCAAATATCTTTTG TTGCTTGTAATATGGCTAGTGGG SEQ EF1-g-tar1- tattggagacgCTTTCAAATAAGCTTCCTTGcgtctca ID NO. F 6 SEQ EF1-g-tar1- ID NO. R aaactgagacgCAAGGAAGCTTATTTGAAAGcgtctcc 7

(17) Plasmid was extracted and linearized, and Pb ANKA was transfected with the plasmid. After electroporation, mixed TMP/pyrimethamine was administrated. The manner for administering to mice infected with Plasmodium after electroporation is described below.

(18) Pyrimethamine solution: Pyrimethamine powder was dissolved in DMSO and prepared as a mother liquor with a final concentration of 7 mg/mL (shook and mixed uniformly), and the mother liquor was stored at 4° C. The mother liquor was diluted by a factor of 100 with distilled water, and adjusted to a pH within a range of 3.5 to 5.0 to prepare a working solution which was replaced every seven days.

(19) Administration of mixed TMP/pyrimethamine: 100 mg of TMP was dissolved in 2 mL of DMSO and then added with 1 mL of pyrimethamine mother liquor, and the volume was adjusted to be 100 ml with distilled water, the pH was adjusted to be within a range of 3.5 to 5.0, and the mixed solution was replaced every three days.

(20) Balb/c (8w, female) mice were inoculated with P. berghei electroporated with the plasmid, so that the strain P.bANKA/pBC-DHFR-GFPm3-EF1g-Tar (simply referred to as a DDD-EF1g strain) was successfully obtained. After electroporation, the strain was observed with a fluorescence microscope, and the results are shown in FIG. 2. The strain underwent drug withdrawal experiments (administration of mixed TMP/pyrimethamine, followed by administration of only pyrimethamine once the infection rate exceeded 10%). The change of the infection rate of the strain was observed, and the results are shown in FIG. 3. The transferred second-passage strain underwent TMP withdrawal experiments (administration of mixed TMP/pyrimethamine, followed by administration of only pyrimethamine once Plasmodium was found through microscopic examination), and the results are shown in FIG. 4.

(21) It can be seen from FIG. 2 that GFP initiated by the promoter of EF1g has obvious fluorescence whose positions are consistent with those of Plasmodium nuclei labelled with Hoechst, and it is determined that GFP was correctly expressed. It can be seen from FIG. 3 that the infection rate decreased from 32.6% to 0.09% after 120 h of withdrawal, and became 0 after 144 h of withdrawal. It can be seen from FIG. 4 that the infection rate increased slightly after 24 h of withdrawal due to residual TMP and decreased to 0 after TMP withdrawal.

(22) It is found from the results of the two experiments that Plasmodium can survive only when TMP is administered, which proves that the DDD regulatory system can control the expression of the necessary gene of Plasmodium by administering TMP or not to control the survival of Plasmodium and adjust the toxicity of Plasmodium.

Example 2 Verification of the Effect of DDD in Regulating EF1g Gene in P.bANKA

(23) Two Balb/c (8w, female) mice were inoculated with the P.bNAKA/pBC-DHFR-GFPm3-EF1g-Tar strain, and one mouse was inoculated with P. berghei whose non-necessary gene NT1 was knocked out by using a CRISPR-Cas9 system as a control group. Mixed TMP/pyrimethamine was initially administrated, and TMP withdrawal experiments were carried out after the Plasmodium infection rate exceeded 1%. After TMP withdrawal, blood was collected from mice and smears were prepared to calculate the infection rate. The results are shown in FIG. 5.

(24) It can be seen from FIG. 5 that the mouse in the control group NT1 died 7 days after TMP withdrawal, while the infection rates of all mice in DDD-EF1g group decreased to 0; after TMP withdrawal (administration of mixed TMP/pyrimethamine at first, followed by administration of pyrimethamine after TMP withdrawal), the infection rate of the mouse in the control group NT1 continued increasing and the mouse died 5 days later, while the infection rates of the two mice in DDD-EF1g group decreased to 0.5 days after TMP withdrawal, and the mice survived.

(25) It can be seen that after TMP withdrawal, Plasmodium in the mice infected with the DDD-EF1g strain died, indicating that the DDD can regulate the expression of the EF1g gene, control the survival of Plasmodium, and attenuate Plasmodium.

Example 3 Effect of DDD in Regulating EF1g Gene in P.bANKA

(26) In this example, a Balb/c (8w, female) mouse was inoculated with a DDD-GFP strain constructed by our company (the DDD regulates GFP expression and does not regulate any necessary gene) to verify whether TMP remains after TMP withdrawal. In addition, 6 Balb/c (8w, female) mice were inoculated with the DDD-EF1g strain. The administration method for mice is shown in Table 2.

(27) TABLE-US-00005 TABLE 2 Administration of mice in groups Strain DDD-GFP DDD-EF1g Group No. G1 G2 G3 Administration Administration of TMP Continuous Administration of TMP followed by withdrawal administration of followed by withdrawal TMP Number of mice 1 2 2 Purpose Determine whether TMP Determine an Determine whether remains after withdrawal effect of TMP EF1g is necessary Administration Description (administration by drinking water with a pH of 3.5 to 5) Administration of 1 mg of TMP and 0.07 mg of pyrimethamine/ TMP followed by mL of water.fwdarw.infection rate reaching 1%.fwdarw.0.07 mg withdrawal of pyrimethamine/mL of water Continuous 1 mg of TMP and 0.07 mg of pyrimethamine/mL of water administration of TMP

(28) After the Plasmodium infection rate exceeded 1%, TMP was withdrawn for groups G1 and G3. Before TMP withdrawal, GFP fluorescence of the DDD-EF1g strain was observed, and the results are shown in FIG. 6. After the TMP withdrawal, the fluorescence of G1 was observed, and the results are shown in FIG. 7. The results of the infection rate and the survival rate of the mice in all groups are shown in FIG. 8 (A) and FIG. 8 (B).

(29) It can be seen from FIG. 6 that the administration of TMP can stimulate the fluorescence of the strain in G1 before TMP withdrawal, which proves that TMP works. It can be seen from FIG. 7 that the fluorescence of the DDD-GFP strain in G1 increased on the third day after withdrawal, and no GFP fluorescence was detected on the fifth day and the seventh day after withdrawal. It is considered that TMP remained in the mouse on the third day after withdrawal, and TMP was consumed on the fifth day after withdrawal.

(30) It can be seen from FIG. 8 (A) and FIG. 8 (B) that except those in G3, all mice in G1 and G2 died, the infection rate of one of the two mice in G3 decreased to 0, and the infection rate of the other mouse remained 50% to 60%, but no mice died; all mice in G2 died, which proved that the continuous administration of TMP cannot cause the death of the DDD-EF1g strain, and the withdrawal of TMP is a key factor affecting the death of the DDD-EF1 g strain; the death of the mouse in G1 proved that the strain where the DDD regulated a non-necessary gene would not die after withdrawal of TMP following TMP administration, and only the strain whose necessary gene was regulated by the DDD was affected by regulation of TMP administration.

(31) To conclude, this example proves that the growth of the DDD-EF1g strain is affected by regulating TMP, and that the regulation of DDD in the expression of the EF1g gene of Plasmodium is an effective means to achieve the survival of Plasmodium and the attenuation of Plasmodium through external regulation.

Example 4 Verification of the Effect of a DDD-Regulated Attenuated Vaccine in Preventing Plasmodium Infection

(32) Balb/c (female, 8w) mice were inoculated with the P.bNAKA/pBC-DHFR-GFPm3-EF1g-Tar strain constructed in Example 1 (experimental group) and a wild-type P.bANKA strain (control group). The mice were administrated with TMP (1 mg of TMP/mL of water, administration by drinking water) for 3 days before inoculated with Plasmodium (8 mice in the experimental group and 6 mice in the control group), and then administered with TMP/pyrimethamine (1 mg of TMP and 0.07 mg of pyrimethamine/mL of water with a pH of 3.5 to 5, administration by drinking water). After the Plasmodium infection rate exceeded 1%, TMP was withdrawn (0.07 mg of pyrimethamine/mL of water with a pH of 3.5 to 5, administration by drinking water). The Plasmodium infection rate of the experimental group decreased to 0. The mice were inoculated with 1×10.sup.5 P.bANKA one month later for challenge experiments. The mice in the experimental group and the control group were administered and inoculated according to the process in FIG. 9. The change curves of the infection rates of the mice in the experimental group and the control group are shown in FIGS. 10 to 12.

(33) It can be seen from FIGS. 10 to 12 that Plasmodium in all mice in the experimental group died and the infection rate decreased to 0 after TMP withdrawal. 8 mice in the experimental group and the mice in the control group were inoculated with 1×10.sup.5 P.bANKA, and the Plasmodium infection rates were calculated. After inoculation with 1×10.sup.5 P.bANKA, no growth of Plasmodium was observed in the mice in the experimental group and all the mice survived (FIGS. 10 and 12), while the mice in the control group all died from a high infection rate 22 days after inoculation (FIGS. 11 and 12) and all showed Plasmodium growth. It is proved that the Plasmodium vaccine where the necessary gene is controlled using the DDD regulatory system has obvious preventive and protective effects, and can effectively prevent the vaccinated mice from being infected by Plasmodium and is valuable for serving as a Plasmodium vaccine.

(34) To conclude, as a new and feasible Plasmodium attenuation strategy, the present disclosure adopts the DDD to regulate the EF1g gene accurately and controllably with a good regulatory effect, and the DDD regulatory system has a low background, is convenient for regulation, and controls the growth of Plasmodium in conjunction with TMP, and can be directly used in the human body to attenuate Plasmodium after the human body is infected with Plasmodium.

(35) The applicant has stated that although the detailed method of the present disclosure is described through the examples described above, the present disclosure is not limited to the detailed method described above, which means that the implementation of the present disclosure does not necessarily depend on the detailed method described above. It should be apparent to those skilled in the art that any improvements made to the present disclosure, equivalent replacements of various raw materials of the product, the addition of adjuvant ingredients, and the selection of specific manners, etc. in the present disclosure all fall within the protection scope and the scope of disclosure of the present disclosure.