NICOTINAMIDE PHOSPHORIBOSYLTRANSFERASE (NAMPT) MUTANT AND USE THEREOF

20190153407 ยท 2019-05-23

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a Nicotinamide phosphoribosyltransferase (nampt) mutant and use thereof. The present invention relates to a nicotinamide phosphoribosyltransferase (Nampt) mutant artificially obtained through genic site-directed mutation. An object of the present invention is to provide a Nampt mutant having a catalytic activity higher than that of a conventional wild type parent, wherein the enzymatic activity of the Nampt mutant provided in the present invention is 1.2-6.9 times of the enzymatic activity of the parent.

Claims

1. A nicotinamide phosphoribosyltransferase (Nampt) mutant, wherein the Nampt mutant is a protein having an amino acid sequence selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46.

2. A biological material selected from the group consisting of expression vector and viable cell, comprising a polynucleotide sequence encoding the Nampt mutant of claim 1.

3. A preparing method of nicotinamide mononucleotide, comprising catalyzing substrate to convert into nicotinamide mononucleotide with biological enzyme, wherein, the biological enzyme comprises the Nampt mutant of claim 1, the substrate comprises one or more selected from the group consisting of 5-phosphoribosyl-1-pyrophosphate (PRPP), nicotinamide and precursors able to be converted into PRPP or nicotinamide.

4. The preparing method of claim 3, comprising the following steps: step 1) adding a substrate solution to a reactor, and adjusting pH of the substrate solution to 7.0-7.5 to obtain a first solution; step 2) adding the biological enzyme to the first solution to obtain a system, stirring the system until uniform and then reacting the system, during a reaction process of the reacting, stirring continuously, controlling a temperature of the system in the reaction process at 37 C., maintaining a pH of the system in the in the reaction process at 7.0-8.0; step 3) after a period of reaction process, obtaining a crude nicotinamide mononucleotide product solution, then filtering, purifying and drying the crude nicotinamide mononucleotide product solution to obtain the nicotinamide mononucleotide.

5. The preparing method of claim 3, wherein, the substrate consists of nicotinamide and phosphoribosyl pyrophosphate; and the biological enzyme is the Nampt mutant.

6. The preparing method of claim 3, wherein, the substrate consists of nicotinamide, ATP and xylose; and the biological enzyme consists of the Nampt mutant, ribose phosphate pyrophosphokinase, ribose-5-phosphate isomerase, ribulose-3-phosphate isomerase, xylulose kinase and xylose isomerase.

7. The preparing method of claim 3, wherein, the substrate consists of nicotinamide, ATP, and ribose; and the biological enzymes comprise the Nampt mutant, ribose phosphate pyrophosphokinase and ribokinase.

8. The preparing method of claim 3, wherein, the substrate consists of nicotinamide, pyrophosphate or a salt of the pyrophosphate, and AMP; and the biological enzyme consists of the Nampt mutant and adenine phosphoribosyltransferase.

9. The preparing method of claim 3, wherein, the substrate consists of nicotinamide, ATP, and AMP; and the biological enzyme consists of the Nampt mutant, ribose phosphate pyrophosphokinase and AMP nucleosidase.

10. The preparing method of claim 3, wherein, the substrate consist of nicotinamide, pyrophosphate or a salt of the pyrophosphate, and inosinic acid or a salt of the inosinic acid; and the biological enzyme consists of the Nampt mutant, hypoxanthine phosphoribosyltransferase and xanthine oxidase.

11. The preparing method of claim 3, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

12. The preparing method of claim 4, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

13. The preparing method of claim 5, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

14. The preparing method of claim 6, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

15. The preparing method of claim 7, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

16. The preparing method of claim 8, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

17. The preparing method of claim 9, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

18. The preparing method of claim 10, wherein, the biological enzyme is used in a form selected from the group consisting of an enzyme solution, an enzyme lyophilized powder, enzyme-containing cells, an immobilized enzyme, and immobilized enzyme-containing cells.

Description

DETAILED DESCRIPTION

[0029] The present invention will be described in further detail with reference to specific examples. The following examples are illustrative of the present invention and the present invention is not limited thereto. Where no specific conditions are given in the examples, conventional conditions or conditions recommended by a manufacturer are adopted.

[0030] A process for preparing the Nampt mutant provided in the present invention was substantially as follows. A plasmid vector containing parent Nampt gene was constructed. Then a site for site-directed mutation and the type of the amino acid after mutation were determined. Suitable primers were synthesized, DNA fragments were amplified by PCR using the plasmid vector containing parent Nampt gene as a template, the amplified DNA fragments were assembled, and the full-length mutant gene was amplified by PCR. Then, the full-length mutant gene was cloned onto a suitable vector, then transformed into suitable host cells, and incubated, to screen out positive clones having Nampt activity. Plasmid DNA was extracted from the positive clones, and sequenced, to determine the mutation introduced. After a fragment of interest is determined to be inserted into the vector, the clones were screened in a LB+ Kanamycin medium, to obtain a series of Nampt mutants having high catalytic activity.

[0031] In the preparation method, any suitable vectors may be used, for example, prokaryotic expression vectors such as pRSET, pES21, and the like; and cloning vectors such as pUC18/19 and pBluscript-SK. In the present invention, pRSET-A is preferably used as a vector. The host cell to which the vector is transferred may be a prokaryotic cell including Escherichia coli or an eukaryotic cell including Saccharomyces cerevisiae and Pichia pastoris.

[0032] For the enzymes used in the following examples, except that the Nampt mutant is obtained through artificially induced site-directed mutation of parent Nampt gene derived from Meiothermus ruber DSM 1279 and having a nucleotide sequence as shown in SEQ ID NO: 1, the remaining enzymes are all enzyme lyophilized powders directly purchased from the market.

EXAMPLE 1

Construction of Plasmid Vector Containing Parent Nampt Gene

[0033] Whole sequence artificial synthesis was performed on the parent Nampt gene sequence publicized in the Genebank (GenBank Accession No.: CP001743.1) derived from Meiothermus ruber DSM 1279 (by a commercial synthesis company). The synthesized product was enzymatically cleaved by the restriction endonucleases NdeI and BamHI, and then ligated to the vector pRSET-A (available from Invitrogen, USA) that was also enzymatically cleaved by the restriction endonucleases NdeI and BamHI, to obtain plasmid pRSET-nampt. After DNA sequencing, it is determined that the nucleotide sequence of the cloned parent Nampt gene is as shown in SEQ ID NO: 1, and the amino acid sequence is as shown in SEQ ID NO: 2.

EXAMPLE 2

Preparation of Nampt Mutants

[0034] PCR amplification reaction system: 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 50 mM dATP, 50 mM dTTP, 50 mM dCTP, 50 mM dGTP, 1.5 U Pfu DNA polymerase (Promega, USA), 20 ng DNA template, and 400 nM upstream primer, and 400 nM downstream primer, where the reaction volume was adjusted to 50 l with sterile water.

[0035] PM amplification reaction conditions: 3 min at 95 C.; 35 cycles of: 50 s at 95 C., 30 s at 52 C., and 3 min at 72 C.; and finally 5 min at 72 C.

[0036] 1. Preparation of F180A Mutant

[0037] The primer pair SEQ ID NO: 4_F180A-F: 5 GTTCAAACTGCACGACGCGGGTGCTCGTGGTGTTTC 3 and SEQ ID NO: 5_F180A-R: 5 GAAACACCACGAGCACCCGCGTCGTGCAGTTTGAAC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The F180A mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-F180A. The plasmid pRSET-F180A was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-F180A DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the F180A mutant is as shown in SEQ ID NO: 3, and has a mutation of Phe (F) to Ala (A) at position 180.

[0038] 2. Preparation of F180W Mutant

[0039] The primer pair SEQ ID NO: 6_F180W-F: 5 GTTCAAACTGCACGACTGGGGTGCTCGTGGTGTTTC 3 and SEQ ID NO: 7_F180W-R: 5 GAAACACCACGAGCACCCCAGTCGTGCAGTTTGAAC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The F180W mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-F180W. The plasmid pRSET-F180W was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-F180W DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the F180W mutant as shown in SEQ ID NO: 30 has a mutation of Phe (F) to Trp (W) at position 180.

[0040] 3. Preparation of A182Y mutant

[0041] The primer pair SEQ ID NO: 8_A182Y-F: 5 CAAACTGCACGACTTCGGTTATCGTGGTGTTTCTTCTCTG 3 and SEQ ID NO: 1_A182Y-R: 5 CAGAGAAGAAACACCACGATAACCGAAGTCGTGCAGTTTG 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The A182Y mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-A182Y. The plasmid pRSET-A182Y was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-A182Y DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of A182Y mutant as shown in SEQ ID NO: 31 has a mutation of Ala (A) to Tyr (Y) at position 182.

[0042] 4. Preparation of E231A Mutant

[0043] The primer pair SEQ ID NO: 10_E231A-F: 5 CTATCCCGGCTATGGCGCACTCTACCGTTAC 3 and SEQ ID NO: 11_E231A-R: 5 GTAACGGTAGAGTGCGCCATAGCCGGGATAG 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The E231A mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-E231A. The plasmid pRSET-E231A was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-E231A DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the E231A mutant as shown in SEQ ID NO: 32 has a mutation of Glu (E) to Ala (A) at position 231.

[0044] 5. Preparation of E231Q Mutant

[0045] The primer pair SEQ ID NO: 12 E231Q-F: 5 CTCTATCCCGGCTATGCAGCACTCTACCGTTACC 3 and SEQ ID NO: 13_E231Q-R: 5 GGTAACGGTAGAGTGCTGCATAGCCGGGATAGAG 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The E231Q mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-E231Q. The plasmid pRSET-E231Q was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-E231Q DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of E231 Q mutant as shown in SEQ ID NO: 33 has a mutation of Glu (E) to Gln (Q) at position 231.

[0046] 6. Preparation of D298A Mutant

[0047] The primer pair SEQ ID NO: 14_D298A-F: 5 TATCCGTCCGGCGTCTGGTGACCC 3 and SEQ ID NO: 15_D298A-R: 5 GGGTCACCAGACGCCGGACGGATA 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D298A mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D298A. The plasmid pRSET-D298A was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D298A DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D298A mutant as shown in SEQ ID NO: 34 has a mu to on of Asp (D) to Ala (A) at position 298.

[0048] 7. Preparation of D298N Mutant

[0049] The primer pair SEQ ID NO: 16_D298N-F: 5 GTTGTTATCCGTCCGAATTCTGGTGACCCGCCG 3 and SEQ ID NO: 17_D298N-R: 5 CGGCGGGTCACCAGAATTCGGACGGATAACAAC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D298N mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D298N. The plasmid pRSET-D298N was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D298N DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D298N mutant as shown in SEQ ID NO: 35 has a mutation of Asp (D) to Asn (N) at position 298.

[0050] 8. Preparation of D298E Mutant

[0051] The primer pair SEQ ID NO: 18_D298E-F: 5 GTTGTTATCCGTCCGGAATCTGGTGACCCGCCGTTC 3 and SEQ ID NO: 19_D298E-R: 5 GAACGGCGGGTCACCAGATTCCGGACGGATAACAAC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D298E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D298E. The plasmid pRSET-D298E was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D298E DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D298E mutant as shown in SEQ ID NO: 36 has a mutation of Asp (D) to Glu (E) at position 298.

[0052] 9. Preparation of D338N Mutant

[0053] The primer pair SEQ NO: 20_D338N-F: 5 GTTCGTGTTATCCAGGGTAATGGTGTTAACGCTGACTC 3 and SEQ ID NO: 21_D338N-R: 5 GAGTCAGCGTTAACACCATTACCCTGGATAACACGAAC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D338N mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D338N. The plasmid pRSET-D338N was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D338N DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D338N mutant as shown in SEQ ID NO: 37 has a mutation of Asp (D) to

[0054] Asn (N) at position 338.

[0055] 10. Preparation of D338E Mutant

[0056] The primer pair SEQ ID NO: D338E-F: 5 GTTATCCAGGGTGAAGGTGTTAACGCTGAC 3 and SEQ ID NO: 23_D338E-R: 5 GTCAGCGTTAACACCTTCACCCTGGATAAC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D338E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D338E. The plasmid pRSET-D338E was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D338E DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D338E mutant as shown in SEQ ID NO: 38 has a mutation of Asp (D) to Glu (E) at position 338.

[0057] 11. Preparation of D377A Mutant

[0058] The primer pair SEQ NO: 24_D377A-F: 5 CACCCGCACCGTGCGACCCAGAAATTC 3 and SEQ ID NO: 25_D377A-R: 5 GAATTTCTGGGTCGCACGGTGCGGGTG 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D377A mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D377A. The plasmid pRSET-D377A was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D377A DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D377A mutant as shown in SEQ ID NO: 39 has a mutation of Asp (D) to Ala (A) at position 377.

[0059] 12. Preparation of D377N Mutant

[0060] The primer pair SEQ ID NO: 26_D377N-F: 5 GCAACACCCGCACCGTAATACCCAGAAATTCGCTC 3 and SEQ ID NO: 27_D377N-R: 5 GAGCGAATTTCTGGGTATTACGGTGCGGGTGTTGC 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D377N mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D377N. The plasmid pRSET-D377N was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D377N DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D377N mutant as shown in SEQ ID NO: 40 has a mutation of Asp (D) to Asn (N) at position 377.

[0061] 13. Preparation of D377E Mutant

[0062] The primer pair SEQ ID NO: 28_D377E-F: 5 CCCGCACCGTGAAACCCAGAAATTCG 3 and SEQ ID NO: 29_D377E-R: 5 CGAATTTCTGGGTTTCACGGTGCGGG 3 were used. The plasmid pRSET-nampt constructed in Example 1 was used as a template. The D377E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-D377E. The plasmid pRSET-D377E was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-D377E DNA was extracted from the clones, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D377E mutant as shown in SEQ ID NO: 41 has a mutation of Asp (D) to Glu (E) at position 377.

[0063] 14. Preparation of E231Q/D338E Mutant

[0064] The primer pair SEQ ID NO: 22_D338E-F: 5 GTTATCCAGGGTGAAGGTGTTAACGCTGAC 3 and SEQ ID NO: 23_D338E-R: 5 GTCAGCGTTAACACCTTCACCCTGGATAAC 3 were used. The plasmid pRSET-E231Q constructed in Section 5 in Example 2 was used as a template. The E231Q/D338E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-21. The plasmid pRSET-21 was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-21 DNA was extracted from the clone, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the E231Q/D338E mutant as shown in SEQ D NO: 42 has a mutation of Glu (E) to Gln (Q) at position 231, and a mutation of Asp (D) to Glu (E) at position 338.

[0065] 15. Preparation of E231Q/D377E Mutant

[0066] The primer pair SEQ ID NO: 28_D377E-F: 5 CCCGCACCGTGAAACCCAGAAATTCG 3 and SEQ ID NO: 29_D377E-R: 5 CGAATTTCTGGGTTTCACGGTGCGGG 3 were used. The plasmid pRSET-E231Q constructed in Section 5 in Example 2 was used as a template. The E231Q/D377E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-22. The plasmid pRSET-22 was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-22 DNA was extracted from the clone, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the E231Q/D377E mutant as shown in SEQ ID NO: 43 has a mutation of Glu (E) to Gln (Q) at position 231 and a mutation of Asp (D) to Glu (E) at position 377.

[0067] 16. Preparation of D338E/D377E Mutant

[0068] The primer pair SEQ ID NO: 28_D377E-F: 5 CCCGCACCGTGAAACCCAGAAATTCG 3 and SEQ ID NO: 29_D377E-R: 5 CGAATTTCTGGGTTTCACGGTGCGGG 3 were used. The plasmid pRSET-D338E constructed in Section 10 in Example 2 was used as a template. The D338E/D377E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-23. The plasmid pRSET-23 was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-23 DNA was extracted from the clone, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the D338E/D377E mutant as shown in SEQ ID NO: 44 has a mutation of Asp (D) to Glu (E) at position 338 and a mutation of Asp (D) to Glu (E) at position 377.

[0069] 17. Preparation of E231Q/D338E/D377E Mutant

[0070] The primer pair SEQ ID NO: 28_D377E-F: 5 CCCGCACCGTGAAACCCAGAAATTCG 3 and SEQ ID NO: 29_D377E-R: 5 CGAATTTCTGGGTTTCACGGTGCGGG 3 were used. The plasmid pRSET-21 constructed in Section 14 in Example 2 was used as a template. The E231Q/D338E/D377E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-31. The plasmid pRSET-31 was transformed into competent bacterial cells E. coli BL21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-31 DNA was extracted from the clone, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the E231Q/D338E/D377E mutant as shown in SEQ ID NO: 45 has a mutation of Glu (E) to Gln (Q) at position 231, a mutation of Asp (D) to Glu (E) at position 338, and a mutation of Asp (D) to Glu (E) at position 377.

[0071] 18. Preparation of E231Q/D298A/D338E/D377E Mutant

The primer pair SEQ ID NO: 14_D298A-F: 5 TATCCGTCCGGCGTCTGGTGACCC 3 and SEQ ID NO: 15_D298A-R: 5 GGGTCACCAGACGCCGGACGGATA 3 were used. The plasmid pRSET-31 constructed in Section 17 in Example 2 was used as a template. The E231Q/D298A/D338E/D377E mutant gene was amplified by high-fidelity PCR using the above PCR amplification reaction system and PCR amplification reaction conditions. The amplified product was isolated by electrophoresis on 1% agarose gel, recovered using a commercial kit, and ligated to the vector pRSET-A (See Example 1 for details) to obtain plasmid pRSET-41. The plasmid pRSET-41 was transformed into competent bacterial cells E. coli B21, and clones having Nampt activity were screened out on a Luria broth (LB) plate (containing 50 mg/L Kanamycin). Plasmid pRSET-41 DNA was extracted from the clone, and sequenced to determine that the point mutation introduced was correct. Compared with the parent amino acid sequence as shown in SEQ ID NO: 2, the amino acid sequence of the E231Q/D298A/D338E/D377E mutant as shown in SEQ ID NO: 46 has a mutation of Glu (E) to Gln (Q) at position 231, a mutation of Asp (D) to Ala (A) at position 298, a mutation of Asp (D) to Glu (E) at position 338, and a mutation of Asp (D) to Glu (E) at position 377.

EXAMPLE 3

Extraction of Enzymes

[0072] The plasmid pRSET-nampt containing parent Nampt gene and the plasmid pRSET-F80A, pRSET-F180W, pRSET-A182Y, pRSET-E231A, pRSET-E231Q, pRSET-D298A, pRSET-D298N, pRSET-D298E, pRSET-D338N, pRSET-D338E, pRSET-D377A, pRSET-D377N, pRSET-D377E, pRSET-21, pRSET-22, pRSET-23, pRSET-31, and pRSET-41 containing Nampt mutant genes were respectively transformed into competent bacterial cells E. coli BL21, and incubated for 24 hrs on a Luria broth (LB) plate (containing 50 mg/L Kanamycin) at 37 C. Individual clones were inoculated in 50 ml of LB liquid medium (containing 50 mg/L Kanamycin), and incubated for 16-20 hrs at 30 C. The bacterial cells were collected by centrifugation, and the same amount of cells were weighed and suspended in a cell lysis buffer (pH 7.5) at a ratio of 1:4. The bacterial cells were ultrasonically lyzed. After centrifugation (4-10 C., 12000 rpm, 10 min), the supernatant was collected, that is, the protein supernatant of parent Nampt and a series of Nampt mutants was obtained respectively, which could be used in the enzyme activity assay and in the preparation of NMN by biocatalysis.

EXAMPLE 4

Enzyme Activity Assay

[0073] A substrate solution containing 60 mM nicotinamide, 25 mM PRPP, 18 mM MgCl.sub.2, 15 mM KCl, and 100 mM Tris buffer was formulated and adjusted to pH 7.5. 19 portions of the substrate solution (each 900 l) were taken, then added respectively to 100 l of equal concentration of the protein supernatant of parent Nampt and a series of Nampt mutants obtained in Example 3, and reacted for 10 min at 37 C. The reaction was terminated by adding 100 L of 25% trichloroacetic acid. The NMN content in the reaction solution was determined by HPLC, and the specific activity of each enzyme was calculated. Where the specific activity of parent Nampa was assumed to be 100, the relative specific activity of the parent and the mutants are as shown in Table 1.

TABLE-US-00001 TABLE 1 Enzyme activity of Nampt Name of enzyme Relative specific activity Parent 100 F180A mutant 118 F180W mutant 122 A182Y mutant 187 E231A mutant 221 E231Q mutant 529 D298A mutant 236 D298N mutant 238 D298E mutant 149 D338N mutant 194 D338E mutant 516 D377A mutant 204 D377N mutant 279 D377E mutant 274 E231Q/D338E mutant 593 E231Q/D377E mutant 546 D338E/D377E mutant 601 E231Q/D338E/D377E mutant 654 E231Q/D298A/D338E/D377E mutant 691

EXAMPLE 5

Preparation of Nicotinamide Mononucleotide

[0074] A substrate solution containing 30 mM nicotinamide, 20 mM ATP, 30 mM xylose, 12 mM MgCl.sub.2, 10 mM KCl, 10 mM ZnCl.sub.2, and 100 mM Tris-HCl buffer was added to a reactor, and adjusted to pH 70-7.5. Then, various catalytic enzymes were added, in amounts of 10 ml of the protein supernatant of Nampt mutant (F180A) prepared in Example 3/L of substrate solution, 6 g of ribose phosphate pyrophosphokinase/L of substrate solution, 10 g of ribose-5-phosphate isomerase/L of substrate solution, 11 g of ribulose-3-phosphate isomerase/L of substrate solution, 10 g of xylulose kinase/L of substrate solution, 10 g of xylose isomerase/L of substrate solution. The system was stirred until uniform and then reacted. During the reaction process, stirring was continued (at a stirring speed of 50 rpm), the reaction temperature was controlled at 37 C., and the pH was maintained at 7.0-7.5. After 6 hrs of reaction, a crude nicotinamide mononucleotide product solution (containing 10 mM NMN) was obtained, which was filtered, purified, and dried, to obtain nicotinamide mononucleotide.

EXAMPLE 6

Preparation of Nicotinamide Mononucleotide

[0075] A substrate solution containing 30 mM nicotinamide, 20 mM ATP, 30 mM ribose, 15 mM MgCl.sub.2, 15 mM KCl, and 100 mM Tris-HCl buffer was added to a reactor, and adjusted to pH 7.0-7.5. Then, various catalytic enzymes were added to the substrate solution in amounts of: 10 ml of the protein supernatant of Nampt mutant (F180A) prepared in Section III of Example 6L of substrate solution, 20 g of ribose phosphate pyrophosphokinase/L of substrate solution, and 20 g of ribokinase/L of substrate solution. The system was stirred until uniform and then reacted. During the reaction process, stirring was continued (at a stirring speed of 50 rpm), the reaction temperature was controlled at 37 C., and the pH was maintained at 7.0-7.5. After 4 hrs of reaction, a crude nicotinamide mononucleotide product solution (containing 10 mM NMN) was obtained, which was filtered, purified, and dried, to obtain a product nicotinamide mononucleotide.

EXAMPLE 7

Preparation of Nicotinamide Mononucleotide

[0076] A substrate solution containing 75 mM nicotinamide, 75 mM disodium pyrophosphate, 50 mM AMP, 15 mM MgCl.sub.2, 10 mM KCl, and 100 mM Tris-HCl buffer was added to a reactor, and adjusted to pH 7.0-7.5. Then, various catalytic enzymes were added in amounts of: 10 ml of the protein supernatant of Nampt mutant (F180A) prepared in Section III of Example 6/L of substrate solution, and 20 g of adenine phosphoribosyltransferase/L of substrate solution. The system was stirred until uniform and then reacted. During the reaction process, stirring was continued (at a stirring speed of 50 rpm), the reaction temperature was controlled at 37 C., and the pH was maintained at 7.0-8.0. After 5 hrs of reaction, a crude nicotinamide mononucleotide product solution (containing 49.6 mM NMN) was obtained, which was filtered, purified, and dried, to obtain a product nicotinamide mononucleotide.

EXAMPLE 8

Preparation of Nicotinamide Mononucleotide

[0077] A substrate solution containing 60 mM nicotinamide, 10 mM ATP, 20 mM AMP, 15 MgCl.sub.2, 15 mM KCl, and 100 mM Tris-HCl buffer was added to a reactor, and adjusted to pH 7.0-7.5. Then, various catalytic enzymes were added to the substrate solution in amounts of: 10 ml of the protein supernatant of Nampt mutant (F180A) prepared in Section III of Example 6/L of substrate solution, 15 g of ribose phosphate pyrophosphokinase/L of substrate solution, and 15 g of AMP nucleosidase/L of substrate solution. The system was stirred until uniform and then reacted. During the reaction process, stirring was continued (at a stirring speed of 50 rpm), the reaction temperature was controlled at 37 C., and the pH was maintained at 7.0-7.5. After 3 hrs of reaction, a crude NMN product solution (containing 9.8 mM NMN) was obtained, which was filtered, purified, and dried, to obtain a product NMN.

EXAMPLE 9

Preparation of Nicotinamide Mononucleotide

[0078] A substrate solution containing 60 mM nicotinamide, 30 mM disodium pyrophosphate, 20 mM disodium inosinate, 20 mM MgCl.sub.2, 20 mM ZnCl.sub.2, 35 mM sodium bisulfite and 100 mM Tris-HCl buffer was added to a reactor, and adjusted to pH 7.0-7.5. Then, various catalytic enzymes were added to the substrate solution in amounts of: 10 ml of the protein supernatant of Nampt mutant (F180A) prepared in Section III of Example 6/L of substrate solution/L of substrate solution, 10 g of hypoxanthine phosphoribosyltransferase/L of substrate solution, 20 g of xanthine oxidase/L of substrate solution. The system was stirred until uniform and then reacted. During the reaction process, stirring was continued (at a stirring speed of 50 rpm), the reaction temperature was controlled at 37 C., and the pH was maintained at 7.0-7.5. After 5 hrs of reaction, a crude nicotinamide mononucleotide product solution (containing 19.8 mM NMN) was obtained, which was filtered, purified, and dried, to obtain a product nicotinamide mononucleotide.