Candida carbonyl reductase and method for preparing (R)-lipoic acid precursor

Abstract

Disclosed herein is Candida parapsilosis CGMCC 9630, the carbonyl reductase expressed by said strain and the encoding gene and amino acid sequence thereof, the recombinant expression vector and recombinant expression transformant containing said gene sequence, and use of whole cells of Candida parapsilosis, carbonyl reductase or corresponding recombinant transformant thereof as catalyst in catalyzing asymmetric reduction of prochiral carbonyl compounds, particularly reduction of 6-carbonyl-8-halogenocaprylate to prepare the synthetic precursor of (R)--lipoic acid, (R)-6-hydroxy-8-halogenocaprylate. In comparison to other methods of asymmetric reduction for preparing (R)-6-hydroxy-8-halogenocaprylate, the disclosure has advantages of high substrate concentration, mild reaction conditions, environmental friendship, high yield, and high optical purity of the product, and thus has good prospect in industrial production of (R)---lipoic acid.

Claims

1. A Candida parapsilosis with the deposit number CGMCC 9630, wherein the Candida parapsilosis recombinantly expresses a carbonyl reductase, wherein the amino acid sequence of the carbonyl reductase is as set forth in SEQ ID Nos. 2, 4 or 6.

2. A recombinant and isolated carbonyl reductase encoding gene, wherein the gene is: (1) a nucleotide sequence as set forth in SEQ ID Nos. 1, 3 or 5; (2) an encoding gene of a protein with an amino acid sequence as set forth in SEQ ID Nos. 2, 4 or 6.

3. A recombinant expression vector, wherein the vector comprises the gene according to claim 2, and optionally an encoding gene of a glucose dehydrogenase, wherein the glucose dehydrogenase is as set forth in SEQ ID No. 14.

4. A recombinant expression transformant, wherein the transformant comprises the recombinant expression vector according to claim 3.

5. A method of preparing a carbonyl reductase, wherein the method comprises a step of culturing the Candida parapsilosis according to claim 1.

6. The method of claim 5, further comprising catalyzing an asymmetric reduction reaction of prochiral carbonyl compounds using the carbonyl reductase as a catalyst in the reduction reaction in vitro.

7. The method according to claim 6, wherein the concentration of the prochiral carbonyl compounds is 1 to 1500 mmol/L, and the amount of the carbonyl reductase is 8.0-800 U per mmol of prochiral carbonyl compounds.

8. The method according to claim 6, wherein in the asymmetric reduction reaction, the following is further added: (1) 0 to 10 mmol/L of coenzyme NADPH; or (2) 0 to 340 U of glucose dehydrogenase per mmol of prochiral carbonyl compounds, 0 to 0.3 g of glucose per mmol of prochiral carbonyl compounds, and 0 to 1.0 mmol/L of NADP.sup.+.

9. The method according to claim 6, wherein the prochiral carbonyl compounds are selected from the followings: ##STR00018## wherein R.sub.1 is selected from CH.sub.2(CH.sub.3).sub.2, 2-ClC.sub.6H.sub.4 and (CH.sub.2).sub.2C.sub.6H.sub.5; R.sub.2 is CH.sub.3 or CH.sub.2CH.sub.3; R.sub.3 is CH.sub.2C.sub.1, CH.sub.2CH.sub.3 or (CH.sub.2).sub.2CH.sub.3; R.sub.4 is CH.sub.3 or CH.sub.2CH.sub.3.

10. The method according to claim 9, wherein the prochiral carbonyl compound is ethyl 6-carbonyl-8-chlorocaprylate.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is the representation of catalytic synthesis of ethyl (R)-6-hydroxy-8-chlorocaprylate with carbonyl reductase CgKR.

(2) FIG. 2 is the representation of the construction of plasmid pET28a-CpKR.

DESCRIPTION OF THE INVENTION

(3) Disclosed herein is Candida parapsilosis CGMCC 9630. Such strain is originally designated as ECU 6481, which is isolated in East China University of Science and Technology in Fengxian and identified as Candida parapsilosis by classification experiments and 16S rDNA analysis. When screening with the strains preserved in the research group for reduction activity with ethyl 6-carbonyl-8-chlorocaprylate as a substrate, we found the resting cells of said strain can catalyze asymmetric reduction of ethyl 6-carbonyl-8-chlorocaprylate to produce ethyl (R)-6-hydroxy-8-chlorocaprylate, and the ee value of the produce was 97%. Such strain has been deposited on Sep. 1, 2014 in China General Microbiological Culture Collection Center with the deposit number CGMCC 9630.

(4) Based on the obtained Candida parapsilosis CGMCC 9630 with high activity and stereoselectivity after screening, in combination with common technical means in the art, the inventor designed primers to conduct molecular cloning based on the sequences derived from Candida parapsilosis and predicted as carbonyl reductase associated sequences available in NCBI database, and the obtained fragments were recombinantly expressed in E. coli. The recombinantly expressed carbonyl reductase was used to catalyze the reduction of ethyl 6-carbonyl-8-chlorocaprylate, and the catalytic activity and the ee value of the reduced product were determined. The ee value of the final product was 97%, and the carbonyl reductase with the highest enzymatic reductive activity was CpKR, which has an amino acid sequence as set forth in SEQ ID No. 2. Based on that, the mutants with amino acid sequences as set forth in SEQ ID Nos.4 and 6 were obtained by replacing one or more amino acid residues in the amino acid sequence SEQ ID No.2, with the provision that the enzymatic activity thereof was maintained.

(5) The carbonyl reductase CpKR and the mutants thereof can be encoded by the nucleic acid sequences as set forth in SEQ ID Nos. 1, 3 and 5. Based on the disclosed amino acid sequence of the carbonyl reductase, it is not difficult to prepare the encoding gene of the carbonyl reductase (CpKR) of the disclosure with common technical means in the art. The nucleic acid molecule containing said encoding gene includes but not limited to: a CpKR-encoding nucleic acid molecule naturally generated and extracted from an organism, or a CpKR-encoding nucleic acid molecule obtained by engineering of an existing nucleic acid fragment with gene cloning, or a CpKR enzyme-encoding nucleic acid molecule obtained by artificial synthesis. Term nucleic acid and nucleic acid molecule as used herein can be interchanged and refer to deoxynucleoside or nucleoside in single chain or double chain and a polymer thereof.

(6) A skilled person in the art knows that because of the degeneracy of codon, the nucleic acid molecule encoding the carbonyl reductase (amino acid sequences as set forth in SEQ ID Nos. 2, 4 and 6 in sequence listing) is not limited to the nucleic acid sequences as set forth in SEQ ID Nos. 1, 3 and 5, but also includes the homologues of a nucleic acid molecule obtained by introducing replacement, as long as that the nucleic acid molecule encodes the protein having the amino acid sequence as set forth in SEQ ID Nos. 2, 4 and 6.

(7) The nucleic acid molecule encoding the carbonyl reductase of the disclosure is preferably derived from: with the genomic DNA of Candida parapsilosis CGMCC 9630 as a template, obtaining the entire nucleic acid molecule encoding the carbonyl reductase with common technical means in the art such as polymerase chain reaction (PCR), wherein the related synthetic primers are preferably set forth in SEQ ID No. 7 and SEQ ID No. 8:

(8) TABLE-US-00001 ForwardprimerSEQIDNo.7: CCGGAATTCATGACAGTATTTGTCTCAGGTGCA ReverseprimerSEQIDNo.8: CCGCTCGAGTTACTTGGCATCGAGAAGTTGTTT

(9) Wherein, the EcoRI restriction site is underlined in the forward primer, and the XhoI restriction site is underlined in the reverse primer.

(10) Also disclosed herein is a recombinant expression vector containing the gene of carbonyl reductase. Term expression vector refers to a vector, plasmid or vehicle that can be designed for inserting and expressing a nucleic acid sequence. The expression vector can provide regulatory sequences for transcription and translation for inducible or constitutive expression, wherein the encoding region is operably placed in the transcription initiation region (e.g., a promoter or enhancer) and under the transcription control of transcription and translation termination regions. Said expression vector can be a conventional vector in the art, such as commercial plasmid, cosmid, phage or virus vector. The recombinant expression vector can be constructed by introducing the nucleotide sequence encoding the carbonyl reductase into various expression vectors by common technical means in the art. The vector of the disclosure is preferably plasmid pET-28a. The nucleic acid product and expression vector pET-28a obtained by PCR amplification can undergo double digestion with restriction enzymes such as EcoRI and XhoI respectively, forming complementary sticky ends, before being linked with ligase such as T4 DNA ligase to form the recombinant expression vector containing the carbonyl reductase CpKR encoding gene of the disclosure, such as pET28a-CpKR (the plasmid representation is seen in FIG. 2).

(11) Also disclosed herein is a recombinant expression transformant containing the carbonyl reductase gene or the recombinant expression vector thereof. The recombinant expression transformant can be prepared by transferring the recombinant expression vector of the disclosure into a host cell. The host cell of the disclosure is preferably a common host micro-organism in the art, with the provision that the recombinant expression vector can self-replicate stably and express the carbonyl reductase gene effectively. The host cell is preferably E. coli, more preferably E. coli BL21 (DE3) or E. coli DH 5a. In the description herein, terms recombinant micro-organism, recombinant cell and recombinant host cell are interchanged and refer to those that undergoes genetic modification to replicate and express or overexpress an endogenous polynucleotide or express a non-endogenous sequence such as the sequence contained in a vector, including the progeny thereof.

(12) Also disclosed herein is a method of preparing the recombinant carbonyl reductase. The carbonyl reductase CpKR with asymmetric reduction activity of catalyzing 6-carbonyl-8-chlorocaprylate can be obtained by culturing above recombinant expression transformant. The used culture medium can be selected from conventional culture mediums in the art, such as LB culture medium (peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, pH 7.0) and the like. The culture of transformant can refer to common operation in the art. For example, in the embodiment that the contained expression vector provides inducible expression, the culture condition of the recombinant expression transformant can be: culturing at 37 C. to OD.sub.600 of about 0.6 and adding isopropyl--D-thiogalacto-pyranoside (IPTG) to induce, the concentration of the inducer is optionally from 0.05 to 1.0 mmol/L (e.g. 0.2 mmol/L), and the induction temperature is optionally from 16 to 25 C. (e.g., 20 C.), and the induction can last for from 12 to 24 h (e.g., 16 h). Above carbonyl reductase can be expressed effectively by culturing the recombinant expression transformant of the disclosure in a suitable culture medium and under appropriate conditions and inducing with suitable agents and conditions as desired.

(13) In the asymmetric reduction of the disclosure, the pellet precipitation obtained by culturing Candida parapsilosis CGMCC 9630 or the corresponding recombinant reansformant is used as catalyst, and the obtained pellet precipitation is optionally lyophilized for long storage for subsequent use. Another advantage of asymmetric reduction with the pellet is that the coenzyme NADPH required for CpKR catalytic reaction is also provided in addition to the catalyst, which eliminates the addition of expensive reductive coenzyme and helps to reduce the cost of reaction.

(14) Similarly, in order to control cost, oxidative coenzyme NADP.sup.+ can also be added to the reaction system, while auxiliary glucose dehydrogenase and cheap co-substrate glucose are added simultaneously to provide NADPH necessary for CpKR reaction by generating NADPH from catalyzing the reduction of NADP.sup.+. The auxiliary glucose dehydrogenase can be added directly as an active protein. The auxiliary glucose dehydrogenase can be provided as recombinant product in same or different host cell with CpKR, which means that CpKR and glucose dehydrogenase can be expressed from two host cells respectively, or from the same or different expression vectors in a same host cell. The co-expression of these two enzymes allows simplified fermentation production process, simplified reaction system, reduced amount of biological catalyst, and increased reduction and regeneration efficiency of coenzyme NADP.sup.+. Therefore, also disclosed herein is a method of co-expressing the carbonyl reductase CpKR and glucose dehydrogenase. The amino acid sequence of the glucose dehydrogenase can be set forth in SEQ ID No. 14, which can be encoded by the nucleotide sequence as set forth in SEQ ID No. 13.

(15) In one embodiment, two host cells can be used to express the carbonyl reductase CpKR and glucose dehydrogenase respectively, and then the obtained cells can be used in catalytic reaction in proper ratio as desired. In another embodiment, the carbonyl reductase CpKR and glucose dehydrogenase can be expressed with two different vectors respectively in the same host cell, and then the obtained cells are used in catalytic reaction. In another embodiment, the carbonyl reductase CpKR-encoding and glucose dehydrogenase-encoding sequences can be inserted into the same expression vector, introduced into a host cell, and then the obtained cells can be used in catalytic reaction.

(16) These recombinantly transformed host cells can be obtained with common technical means. For example, the encoding nucleic acids of the carbonyl reductase CpKR and glucose dehydrogenase can be linked into two different expression plasmids respectively, and transferred into a host cell simultaneously. Alternatively, when using a single expression vector, the encoding nucleic acids of the carbonyl reductase CpKR and glucose dehydrogenase can be linked into the expression plasmid in any order, and then transferred into a host cell. The glucose dehydrogenase can be derived from BmGDH of Bacillus megaterium; the expression plasmid can be pET28a; and the host cell can be E. coli BL21 (DE3).

(17) The carbonyl reductase can be isolated by the following process: corresponding recombinant expression transfermant cells, after centrifugation, are resuspended in 100 mM Tris-HCl buffer, pH 7.0, ultrasonicated and breaked in ice bath (e.g., with a working power of 400 W for 4 s, pause for 6 s for 99 cycles), then the cell debris is precipitated by centrifugation (e.g., centrifugation at 4 C., 12000 rpm for 10 minutes), and the supernatant is collected as the crude enzyme solution of the recombinant carbonyl reductase CpKR. The recombinantly expressed glucose dehydrogenase can be isolated and purified according to reference documents, see, e.g., Journal of Industrial Microbiology and Biotechnology 2011, 38, 633-641.

(18) In order to achieve above co-expression, suitable primers can be used to amplify and obtain the encoding sequences of the carbonyl reductase CpKR and glucose dehydrogenase. For example, the encoding sequence of the carbonyl reductase CpKR as set forth in SEQ ID No. 1 can be obtained with the following SEQ ID Nos. 9 and 10 as primers, and the encoding sequence of the glucose dehydrogenase as set forth in SEQ ID No. 13 can be obtained with the following SEQ ID Nos. 11 and 12 as primers.

(19) TABLE-US-00002 CpKR-NdeI,SEQIDNo.9: GGAATTCCATATGACAGTATTTGTCTCAGGTGC CpKR-EcoRI,SEQIDNo.10: CCGGAATTCTTACTTGGCATCGAGAAGTTGTTT BmGDH-Sal1,SEQIDNo.11: ACGCGTCGACAAGGAGATATAATGTATAAAGATTTAGAAGG BmGDH-XhoI,SEQIDNo.12: CCGCTCGAGTTATCCGCGTCCTGCTTGGAAT

(20) In above sequences, the restriction site in each primer is underlined, respectively.

(21) The activity of the carbonyl reductase can be determined with the following process: 1 mL reaction system (100 mmol/L Tris-HCl buffer, pH 7.0) containing 2 mmol/L ethyl 6-carbonyl-8-chlorocaprylate and 0.1 mmol/L NADPH is preheated to 30 C., then a suitable amount of carbonyl reductase is added, the reaction is conducted under 30 C., and the absorbance change of NADPH at 340 nm is detected in a spectrophotometer, and the absorbance change within 1 minute is recorded.

(22) The activity of the glucose dehydrogenase can be determined with the following process: 1 mL reaction system (100 mmol/L Tris-HCl buffer, pH 7.0) containing 10 mmol/L glucose, 1 mmol/L NADP.sup.+ is preheated to 30 C., then a suitable amount of glucose dehydrogenase is added. At 30 C., the reaction is carried out in a cuvette of a spectrophotometer, and the absorbance change of NADPH at 340 nm is detected in situ, and the absorbance change within 1 minute is recorded.

(23) When determining the activities of the carbonyl reductase and glucose dehydrogenase, enzyme activity can be calculated according to the following formula:
enzyme activity (U)=EWV10.sup.3/(62201)

(24) wherein, EW is absorbance change at 340 nm within 1 minute; V is the volume of reaction solution in ml; 6220 is the molar extinction coefficient of NADPH in L/(mol.Math.cm); and 1 is optical path distance in cm. With respect to the carbonyl reductase, one activity unit corresponds to the amount of enzyme necessary for oxidation of 1 mol NADPH per minute under above conditions. With respect to the glucose dehydrogenase, one activity unit corresponds to the amount of enzyme necessary for reduction of 1 mol NADP.sup.+ per minute under above conditions.

(25) Also disclosed herein is use of the carbonyl reductase CpKR in catalytic reduction of prochiral carbonyl compounds to generate optically pure secondary alcohols. The use comprises: the carbonyl reductase or recombinant expression transformant is used as catalyst, the prochiral carbonyl compounds to be converted, glucose and glucose dehydrogenase (if desired) are added to a buffer at pH 6.0 to 7.5 (e.g., pH 7.0), after biological conversion for a particular duration, and optically pure chiral hydroxyl compounds are generated, for example, (R)-6-hydroxy-8-chlorocaprylate, the synthetic precursor of (R)-lipoic acid.

(26) The used buffer of the disclosure is a common buffer in the art. In one embodiment, the buffer is Tris-HCl buffer, pH 7.0, and other buffers include sodium phosphate buffer and potassium phosphate buffer, with the provision that the buffering range thereof is pH 6.0 to 7.5. The concentration range of a buffer can be 10 to 200 mM, preferably 50 to 100 mM.

(27) When referring to compounds, term chemically pure means a purified product, wherein the compound accounts for 85% or more (e.g., 90%, 95% or more) of the total amount, compared with the undesired impurities. When referring to the chiral compounds such as the precursor of lipoic acid, term optically pure means a purified product, wherein the (R)-enantiomer accounts for 96.5% or more (e.g., 97%, 97.5%, 98%, 98.5%, 99% or more) of the total enantiomers compared with the undesired (S)-enantiomer. In the disclosure, optical purity is generally indicated as term enantiomeric excess or symbol ee, which refers to the excess amount of an enantiomer in a mixture compared with another enantiomer, such as the excess amount of (R) in the precursor compounds of lipoic acid compared with (S). Unless otherwise noted, when referring to purity or ee value in the description, >99% means that the content of a residual substrate or a certain enantiomer is lower than the low limit of detection and cannot be accurately determined. Herein, analysis of ee value can be performed by passing the acetylated products through gas chromatography (e.g., using CP-Chirasil-DEX CB column), and an exemplary condition for gas chromatography is: using nitrogen as the carrier gas, a inlet temperature of 280 C., a detector temperature of 280 C., and a column temperature of 160 C.

(28) Term prochiral carbonyl compound is a class of keto ester compounds, ester compounds containing carbonyl substituent in the back bone, wherein such compounds are not chiral natively and produce chiral hydroxyl esters after catalytic asymmetric reduction. For example, said prochiral carbonyl compound can be selected from the following formula:

(29) ##STR00003##

(30) wherein,

(31) R.sub.1 is selected from CH.sub.2(CH.sub.3).sub.2, 2-ClC.sub.6H.sub.4 or (CH.sub.2).sub.2C.sub.6H.sub.5;

(32) R.sub.2 is CH.sub.3 or CH.sub.2CH.sub.3;

(33) R.sub.3 is CH.sub.2Cl, CH.sub.2CH.sub.3 or (CH.sub.2).sub.2CH.sub.3;

(34) R.sub.4 is CH.sub.3 or CH.sub.2CH.sub.3.

(35) The asymmetric reduction is preferably conducted under proper oscillation and mixing. Reaction temperature can be from 20 to 30 C., substrate concentration can optionally be from 1 to 1500 mmol/L, amount of carbonyl reductase can optionally be from 8.0 to 800 U enzyme/mmol substrate; amount of glucose dehydrogenase can optionally be from 0 to 340 U enzyme/mmol substrate; amount of glucose can optionally be from 0 to 0.3 g/mmol substrate; amount of additional added coenzyme NADP.sup.+ can optionally be from 0 to 0.1 mmol/L; amount of additional added coenzyme NADPH can optionally be from 0 to 10 mmol/L. During the reaction, conversion rate is determined by intermittent sampling, and reaction time is determined when conversion rate achieves 99% or more and usually 2 to 12 h. Conversion rate can be analyzed by gas chromatography, for example, using Rxi-5Sil MS chromatographic column, nitrogen as the carrier gas, an inlet temperature of 280 C., a detector temperature is 280 C., and a column temperature is 160 C.

(36) When the asymmetric reduction is ended, the reaction solution is extracted with equal amount of water-insoluble organic solvents such as ethyl acetate, butyl acetate, toluene, dichloromethane, trichloromethane, isopropyl ether, and methyl ter-butyl ether, and the extraction is repeated twice. The extract is combined and dried by adding anhydrous sodium sulfate overnight. Solvent is removed through rotary evaporation and the crude extract of optically pure product is obtained. The crude extract is further purified through common technical means such as distillation under reduced pressure to obtain a highly chemically and optically pure product.

(37) The Candida parapsilosis CGMCC 9630 strain and the carbonyl reductase CpKR synthesized by the same provided herein can be used to efficiently catalyze the asymmetric reduction of 6-carbonyl-8-chlorocaprylate, and generate optically pure (R)-6-hydroxy-8-chlorocaprylate. Using such enzymic catalytic technology, substrate concentration is 1.5 mol/L (or 330 g/L), with a conversion rate of more than 99%, and an ee value of the product of more than 97%. In comparison of other preparation methods for asymmetric reduction of synthetic precursors of (R)--lipoic acid, the disclosure has higher concentration and optical purity of product, and is beneficial to achieve production of (R)--lipoic acid with high efficiency and low cost, and has the prospect of industrial application.

(38) Above reaction or detection conditions can be combined or modified according to common knowledge in the art, or may be verified through experimentation. The following examples illustrate exemplary embodiments of the disclosure, to help a skilled person in the art understand other objects, features, advantages and various aspects of the disclosure. It should be understood that though the preferable embodiments of the disclosure is described, but the following description and examples are provided for illustration only and are not limiting. The invention is defined by the appended claims.

DESCRIPTION OF EMBODIMENT

(39) Unless otherwise indicated, the specific experiments in the following examples are conducted according to common methods and conditions in the art, or the manufacturer's instructions.

(40) The origin of the materials in the following examples is:

(41) Candida parapsilosis CGMCC 9630

(42) Expression plasmid pET28a is available from Novagen.

(43) E. coli DH.sub.5 and E. coli BL21 (DE3) competent cells, 2Taq PCR MasterMix, agarose gel DNA Recovery Kit are available from Tiangen (Beijing).

(44) Restriction endonucleases EcoR I and Xho I are available from Takara.

Example 1 Culturing of Candida parapsilosis CGMCC 9630

(45) Candida parapsilosis CGMCC 9630 was inoculated in a culture media (yeast extract 3 g/L, malt extract 3 g/L, soybean peptone 5 g/L, glucose 10 g/L), and cultured at 30 C. for 1 day. After centrifugation of culture liquid at 8000 rpm, the pellet was collected. The collected pellet precipitate was used immediately or stored in a fridge at 4 C. for use within 3 days.

Example 2 Candida parapsilosis Cells Catalyze Reduction of ethyl 6-carbonyl-8-chlorocaprylate

(46) 0.2 g pellet precipitate in Example 1 was obtained, and resuspended with 2 mL Tris-HCl buffer (100 mmol/L, pH 7.0), added with 1 mM ethyl 6-carbonyl-8-chlorocaprylate, and placed on a constant temperature mixing apparatus for reaction at 30 C. and 1000 rpm for 12 h. After extraction with equal amount of ethyl acetate, the extract was dried with anhydrous sodium sulfate for more than 6 h. After acetylization of the products, through gas chromatography, the optical purity thereof was determined as 97% ee (R).

Example 3 Gene Cloning of Carbonyl Reductase CpKR

(47) According to the open reading frame of carbonyl reductase CpKR, the upstream primer and downstream primer were designed as follows:

(48) TABLE-US-00003 UpstreamprimerSEQIDNo.7: CCGGAATTCATGACAGTATTTGTCTCAGGTGCA DownstreamprimerSEQIDNo.8: CCGCTCGAGTTACTTGGCATCGAGAAGTTGTTT

(49) wherein, the underlined portion in the upstream primer is EcoRI restriction site, and the underlined portion in the downstream primer is XhoI restriction site.

(50) PCR amplification was performed with the genomic DNA of Candida parapsilosis CGMCC 9630 as the template. PCR system was: 2Taq PCR MasterMix 25 l, upstream primer and downstream primer (10 ng/l) each 2.5 l, genomic DNA (100 ng/l) 1 l and ddH.sub.2O 19 l. PCR amplification procedure was: a pre-denaturing for 5 minutes at 95 C., followed by 32 cycles, containing denaturing at 94 C. for 30 seconds, annealing at 50 C. for 30 seconds, and extension at 72 C. for 1 minute; finally extension at 72 C. for 10 minutes. After gel electrophoresis purification of PCR products, target fragments were recovered with a DNA Recovery Kit. After DNA sequencing, the whole length of the open reading frame encoded in the sequence was 1002 bp and its base sequence is set forth in SEQ ID No. 1.

Example 4 Preparation of Recombinant Expression Plasmid and Recombinant Expression Transformant of Carbonyl Reductase

(51) The fragments of carbonyl reductase obtained by PCR amplification in Example 3 and pET 28a blank plasmid were subjected to double digestion with restriction endonucleases EcoR I and Xho I simultaneously overnight, and then gel electrophoresis purification and recovery with a DNA kit. The recovered digested fragments and blank plasmid were linked with the action of T4 DNA ligase at 4 C. for 12 h and the recombinant plasmid pET28a-CpKR was obtained.

(52) The obtained recombinant plasmid was transformed into E. coli DH 5, which was plated onto LB medium plate containing 50 g/ml kanamycin, and cultured at 37 C. for 8 h, and the colonies are verified through colony PCR and those with a target band of about 1000 bp after PCR amplification was picked as positive clones. After verification through sequencing, corresponding plasmids were extracted and transformed into E. coli BL21, and the positive clones were picked, which means that the recombinant expression transformant E. coli BL21 (DE3)/pET28a-CpKR was obtained.

Example 5 Inducible Expression of Carbonyl Reductase CpKR

(53) The recombinant expression transformant of E. coli BL21 (DE3)/pET28a-CpKR obtained in Example 4 was inoculated in LB media containing 50 g/ml kanamycin, cultured with oscillation in a shaker at 37 C. for 12 h, then inoculated in a 500 ml conical flask containing 100 ml LB media at an inoculation rate of 1% (v/v), placed in a shaker at 37 C. and cultured with oscillation at 180 rpm. When the OD.sub.600 of culture liquid reached 0.7, IPTG was added to the final concentration of 0.2 mmol/L for inducing, and after induction at 16 C. for 24 h, the culture liquid was centrifugated at 8000 rpm, and the cells were collected and washed with normal saline, and the resting cells were obtained. The obtained cells were resuspended in 10 ml Tris-HCl buffer (100 mM, pH 7.0), ultrasonicated in ice bath as follows: working power of 400 W for 4 s, pause for 6 s, for 99 cycles, centrifugated at 4 C. and 10000 rpm for 10 minutes, and the supernatant was collected and determined for activity according to the above methods. The determined enzyme activity was 81.3 U/ml lysate.

Example 6 Preparation of Recombinant Carbonyl Reductase Mutant CpKRG86E

(54) The whole length gene sequence of the carbonyl reductase CpKR obtained in Example 3 (SEQ ID No.1) was subjected to base mutation with mutating positions 257 (G.fwdarw.A) and 258 (G.fwdarw.A) respectively in the reductase gene encoding sequence to obtain the base sequence of the mutant gene as set forth in SEQ ID No.3. The encoded amino acid sequence is set forth in SEQ ID No.4, i.e., mutating position 86 (Gly.fwdarw.Glu) of the carbonyl reductase CpKR (SEQ ID No.2), and the carbonyl reductase encoded by the mutant gene is designated as CpKR.sub.G86E. The recombinant expression plasmid and recombinant expression transformant containing the mutant gene DNA was prepared by the method as described in Example 4, and cultured according to the method of Example 5, after inducible expression, the lysate obtained after ultrasonication was taken and the enzyme activity was determined to be 122 U/ml lysate.

Example 7 Preparation of Recombinant Carbonyl Reductase Double Mutant CpKRG86E/A163S

(55) The whole length gene sequence of the carbonyl reductase CpKR obtained in Example 3 (SEQ ID No.1) was subjected to base mutation with mutating positions 257 (G.fwdarw.A), 258 (G.fwdarw.A), 487 (G.fwdarw.T), and 489 (T.fwdarw.G) in the reductase gene encoding sequence to obtain the base sequence of the mutant gene as set forth in SEQ ID No.5. The encoded amino acid sequence is set forth in SEQ ID No.6, i.e., mutating position 86 (Gly.fwdarw.Glu) and 163 (Ala.fwdarw.Ser) of the carbonyl reductase CpKR (SEQ ID No.2), and the carbonyl reductase encoded by the mutant gene is designated as CpKR.sub.G86E/A163S. The recombinant expression plasmid and recombinant expression transformant containing the mutant gene DNA sequence were prepared by the method as described in Example 4, and cultured according to the method of Example 5, after inducible expression, the lysate obtained after ultrasonication was taken and the enzyme activity was determined to be 181 U/ml lysate.

Example 8 CpKR Catalyzes Asymmetric Reduction of ethyl 6-carbonyl-8-chlorocaprylate

(56) 0.1 ml culture liquid in Example 5 was taken and centrifugated at 10000 rpm for 5 minutes, and precipitated cells were resuspended in 1 ml potassium phosphate buffer (100 mM, pH 7.0), and 0.01 mmol ethyl 6-carbonyl-8-chlorocaprylate (i.e., concentration is 10 mM) was added and NADPH was added to the final concentration of 10 mmol/L, then placed on a constant temperature mixing apparatus for reaction at 30 C. and 1000 rpm for 12 h. Sampling, and extracting with equal volume of ethyl acetate, the extract was dried with anhydrous sodium sulfate for 8 h, analyzed through gas chromatography with a conversion rate of 98.7%. The product was acetylized prior to gas chromatography and the optical purity thereof was determined to be 97% ee (R).

Example 9 CpKR Catalyzes Asymmetric Reduction of ethyl 6-carbonyl-8-chlorocaprylate

(57) Reaction was conducted in a 2 mL centrifuge tube. 20 mmol/L substrate ethyl 6-carbonyl-8-chlorocaprylate, 6 g/L glucose, 1 U glucose dehydrogenase and NADP.sup.+ with a final concentration of 1.0 mM were added into 1 mL Tris-HCl buffer (100 mmol/L, pH 7.0), and the resting cells that recombinantly expressing CpKR as described in Example 5 were added with an amount of 53 U enzyme/mmol substrate. Reaction was conducted on a mixing apparatus at 1000 rpm and 30 C. After conversion for 10 h, the conversion rate of substrate was determined to be 99.2%, and the ee value of the product was 99.7% (R).

Example 10 Asymmetric Reduction of Ethyl 6-Carbonyl-8-Chlorocaprylate by Recombinant Reductase CpKRG86E

(58) Reaction was conducted in a 2 mL centrifuge tube. 20 mmol/L substrate ethyl 6-carbonyl-8-chlorocaprylate, 6 g/L glucose and 1 U glucose dehydrogenase were added into 1 mL Tris-HCl buffer (100 mmol/L, pH 7.0), and the resting cells that recombinantly expressing CpKR.sub.G86E as described in Example 6 were added with an amount of 10 U enzyme/mmol substrate. Reaction was conducted on a mixing apparatus at 1000 rpm and 30 C. After conversion for 8 h, the conversion rate of substrate was determined to be 99.1%, and the ee value of the product was 97.3% (R).

Example 11 Asymmetric Reduction of Ethyl 6-Carbonyl-8-Chlorocaprylate by Recombinant Reductase CpKRG86E/A163S

(59) Reaction was conducted in a 2 mL centrifuge tube. 20 mmol/L substrate ethyl 6-carbonyl-8-chlorocaprylate, 6 g/L glucose and 1 U glucose dehydrogenase were added into 1 mL Tris-HCl buffer (100 mmol/L, pH 7.0), and the resting cells that recombinantly expressing CpKR.sub.G86E/A163S as described in Example 7 were added with the amount of 8 U enzyme/mmol substrate. Reaction was conducted on a mixing apparatus at 1000 rpm and 30 C. After conversion for 10 h, the conversion rate of substrate was determined to be 99.5%, and the ee value of the product was 99.6% (R).

Example 12 Gene Tandem Co-Expression of Carbonyl Reductase and Glucose Dehydrogenase

(60) According to conventional PCR amplification and enzyme digestion and ligation, the carbonyl reductase CpKR.sub.G86E/A163S gene as set forth in SEQ ID No. 6 was amplified with primers CpKR-Nde I and CpKR-EcoR I; the target gene and plasmid pET 28a were subjected to double digestion with Nde I/EcoR I, then linked and transformed into E. coli BL21 (DE3), and plasmid pET28-CpKR.sub.G86E/A163S was extracted; the target gene of glucose dehydrogenase BmGDH as set forth in SEQ ID No. 14 was amplified with primers BmGDH-Sal I and BmGDH-Xho I; after Sal I/Xho I double digestion of BmGDH and plasmid pET28-CpKR.sub.G86E/A163S containing CpKR fragments, they were linked and transformed into E. coli BL21 (DE3), i.e., the recombinant expression transformant E. coli BL21 (DE3) containing CpKR.sub.G86E/A163S and BmGDH (pET28-CpKR.sub.G86E/A163S-BmGDH) was obtained.

(61) E. coli BL21 (DE3) (pET28-CpKR.sub.G86E/A163S-BmGDH) was inoculated in LB culture media containing 50 g/ml kanamycin, and cultured in a shaker at 37 C. for 12 h, then inoculated in a 500 ml conical flask containing 100 ml LB media at the inoculation rate of 1% (v/v), placed in a shaker at 37 C. and cultured with oscillation at 180 rpm. When the OD.sub.600 of culture liquid reached 0.7, IPTG was added to the final concentration of 0.2 mmol/L for inducing, after induction at 16 C. for 24 h, the culture liquid was centrifugated at 8000 rpm, the cells were collected and washed with normal saline, and the resting cells were obtained. After lyophilization, the lyophilizated recombinant expression transformant (E. coli BL21/pET28a-CpKR.sub.G86E/A163S-BmGDH) was obtained and the CpKR.sub.G86E/A163S activity thereof was determined to be 8.0 U/mg lyophilizated cells, and BmGDH activity was 3.4 U/mg lyophilizated cells.

Examples 1319 Carbonyl Asymmetric Reduction by Co-Expression Whole Cells

(62) 0.1 g of the lyophilizated cells of the recombinant expression transformant (E. coli BL21/pET28a-CpKR.sub.G86E/A163S-BmGDH) in Example 12 were added into 10 mL Tris-HCl buffer (100 mmol/L, pH 7.0), and corresponding carbonyl compound substrate was added to reach the final concentration of 100 mmol/L, and glucose was added to reach 150 mmol/L and NADP.sup.+ was added to reach 0.1 mmol/L. Reaction solution was subjected to magnetic stirring at 30 C., and 1 mol/L sodium carbonate solution was fed to maintain pH at 7.0. After reaction for 1 h, the reaction was stopped and extracted with equal volume of ethyl acetate twice, and the extract was combined and dried with anhydrous sodium sulfate overnight, and the conversion rate of substrate and the ee value of the product were determined. Analysis conditions for the conversion rate and ee value can refer to Adv Synth Catal 2012, 354, 1765-1772; Appl Microbiol Biotechnol. 2007, 76, 237-248. The results are shown in Table 1:

(63) TABLE-US-00004 TABLE 1 Results of carbonyl reduction reaction catalyzed by CpKR Example Substrate Product Conversion ee value (%) 13 >99% 99 (R) 14 >99% 93 (R) 15 >99% 100 (R) 16 0 >99% 100 (R) 17 >99% 97 (R) 18 >99% 93 (R) 19 >99% 93 (R)

Example 20 Catalytic Reduction of 100 mmol/L ethyl 6-carbonyl-8-chlorocaprylate with Lyophilizated Cells

(64) To 10 mL Tris-HCl buffer (100 mmol/L, pH 7.0) containing 100 mmol/L substrate ethyl 6-carbonyl-8-chlorocaprylate (22 g/L) and 150 mmol/L glucose, 0.1 g of the lyophilizated cells of the recombinant expression transformant (E. coli BL21/pET28a-CpKR.sub.G86E/A163S-BmGDH) as described in Example 12 were added. Reaction was subjected to magnetic stirring at 30 C., 1 mol/L sodium carbonate solution was fed through an automatic potentiometric titrator to maintain pH at 7.0. After reaction for 3 h, the reaction was extracted with equal volume of ethyl acetate twice, and the extract was combined and dried with anhydrous sodium sulfate overnight. The conversion rate of substrate was 99.4% and the ee value of the product was 99.8%, as determined by gas chromatography.

Example 21 Catalytic Reduction of 1.5 mol/L ethyl 6-carbonyl-8-chlorocaprylate with Lyophilizated Cells

(65) To 10 mL Tris-HCl buffer (100 mmol/L, pH 7.0) containing 1.5 mol/L substrate ethyl 6-carbonyl-8-chlorocaprylate and 2.25 mol/L glucose, 0.3 g of the lyophilizated cells of the recombinant expression transformant (E. coli BL21/pET28a-CpKR.sub.G86E/A163S-BmGDH) as described in Example 12 were added. Reaction was subjected to magnetic stirring at 30 C., 1 mol/L sodium carbonate solution was fed through an automatic potentiometric titrator to maintain pH at 7.0. After reaction for 12 h, the reaction was extracted with equal volume of ethyl acetate twice, and the extract was combined and dried with anhydrous sodium sulfate overnight. The conversion rate of substrate was 99.9% and the ee value of the product was 99.8%, as determined by gas chromatography. Solvent was removed through rotary evaporation and 2.93 g product was obtained with an isolation yield of 88%.

Example 22 Reduction of Ethyl 6-Carbonyl-8-Chlorocaprylate with 1-L Scale of Whole Cells

(66) To 1 L Tris-HCl buffer (100 mmol/L, pH 7.0) containing 1 mol/L substrate ethyl 6-carbonyl-8-chlorocaprylate and 1.5 mol/L glucose, 10 g of the lyophilizated cells of the recombinant expression transformant (E. coli BL21/pET28a-CpKR.sub.G86E/A163S-BmGDH) as described in Example 6 were added. Reaction was subjected to mechanical stirring at 30 C. in a water bath, and 1 mol/L sodium carbonate solution was fed through an automatic potentiometric titrator to maintain the pH at 7.0. After reaction for 8 h, the conversion rate was determined to be 99.9% and the ee value of the product was 99.8%. The reaction was extracted with equal volume of ethyl acetate twice, and the extract was combined and dried with anhydrous sodium sulfate overnight. Solvent was removed through rotary evaporation and 198 g product was obtained with an isolation yield of 90%. The specific rotation of the product was determined as [].sub.25.sup.D=21.0 (c 1.0, ethanol).

Comparative Example 1

(67) The effect of asymmetric reduction of ethyl 6-carbonyl-8-chlorocaprylate by the carbonyl reductase CpKR of the disclosure was compared with the catalytic effects reported in references. Comparison of reaction system and catalytic results was summarized in Table 2.

(68) TABLE-US-00005 TABLE 2 Comparison of the catalytic reaction effects of ethyl 6-carbonyl-8-chlorocaprylate by CpKR with the the reported levels in references Substrate Additional Bioligical Concentration Coenzyme Time Conversion ee Catalyst (g/L) (mM) (h) (%) (%) Data Resource Geotrichum 5 0 24 62 88 (R) U.S. Pat. No. 7,135,328 B2 candidum TbADH 2 0.5 >85 >99.5 (R) U.S. Pat. No. 7,157,253 B2 NgADH 44 4 24 95 WO 2007028729A1 MzCR 85 0.1 24 55 >97 (R) WO 2005049816 A2 Rhodococcus 66 0 36 >99 93 (R) CN103451124 A baikonurensis CpKR 330 0 12 >99 99.8 (R) Present invention, Example 21

(69) Particularly, Olbrich et al. used the whole cells of Geotrichum candidum to catalyze asymmetric reduction of methyl 6-carbonyl-8-chlorocaprylate to methyl (R)-6-hydroxy-8-chlorocaprylate, and the cultured Geotrichum candidum cells were suspended in buffer containing 5 g/L glucose with equal volume of fermentation liquid for reaction, wherein the concentration of substrate was only 5 g/L. After reaction for 24 h, the yield was only 62% and the ee value of the product was only 88% (see in U.S. Pat. No. 7,135,328 B2).

(70) Mller et al. used alcohol dehydrogenase TbADH from Thermoanaerobium brokii to catalyze asymmetric reduction of 6-carbonyl-8-chlorocaprylate to generate (R)-6-hydroxy-8-chlorocaprylate, coenzyme regeneration was performed by formate dehydrogenase. The concentration of alcohol dehydrogenase TbADH and formate dehydrogenase were both 4 kU/L, and the substrate concentration was only 2 g/L. The reaction was conducted at 37 C., the optical purity of the generated (R)-6-hydroxy-8-chlorocaprylate can be 99.5%, but its conversion was only 85%, and 0.5 mM coenzyme and 1 mM dithiothreitol (DTT) were also required in the reaction system (see in U.S. Pat. No. 7,157,253 B2).

(71) Werner et al. used NgADH from Nocardia globulera to prepare (R)-6-hydroxy-8-chlorocaprylate. The substrate concentration can be 44 g/L and the concentration of dehydrogenase was 58 U/mmol substrate. The reaction was conducted at 30 C. for 24 h, the conversion was 95%, but the ee value of the product thereof is not shown (see in WO 2007/028729 A1, 2007).

(72) Gupta et al. used an oxidoreductase from Metschnikowia zobellii to catalyze reaction in a two-phase system, and 25 U/ml recombinant oxidoreductase MzCR, 5 U/ml alcoholdehydrogenase and 0.1 mM NADP.sup.+ were added to the reaction system. The reaction was conducted at 25 C., which catalyzes the conversion of 85 g/L substrate 6-carbonyl-8-chlorocaprylate into the product (R)-6-hydroxy-8-chlorocaprylate, and the ee value of the product was 97%, and after reaction for 24 h, the conversion was only 55% (see in WO 2005049816 A2).

(73) Chen et al. used 300 g/L Rhodococcus baikonurensis resting cells and crude enzyme solution of 60 kU/L glucose dehydrogenase, at 30 C. and pH 6.0, and the reaction for 36 h only catalyzed conversion of 300 mM ethyl 6-carbonyl-8-chlorocaprylate, and the ee value of the product was only 93% (see in CN103451124A).

(74) As illustrated in various examples of the disclosure, particularly in Table 2, the technology of the disclosure can be used to catalyze a substrate with a concentration (e.g., 330 g/L) that is much higher than the highest one reported (85 g/L) in the prior art, and the conversion rate and the optical purity of the product are also very high.

(75) After reading the above description, a person skilled in the art will appreciate that changes and modifications may be made thereto, and it is intended to include all such changes and modifications as fall within the true scope of the invention.