IMMORTALISED CHICKEN EMBRYONIC EPITHELIAL KIDNEY CELLS

Abstract

The present invention relates to immortalised chicken embryonic epithelial kidney cells, to cell cultures comprising such immortalised cells, to vaccines comprising such cells, to methods for the replication of avian viruses on such cells, and to methods for the preparation of such cells and such vaccines.

Claims

1. (canceled)

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. (canceled)

13. (canceled)

14. A stably transfected immortalised chicken embryonic epithelial kidney cell (CEEK cell), wherein said immortalised CEEK cell comprises; a) a gene encoding SV40 T antigen under the control of a suitable promoter; b) a gene encoding chicken telomerase (cTERT) under the control of a suitable promoter; and c) does not comprise exogenous retroviral Long Terminal Repeat (LTR) DNA.

15. A cell culture comprising immortalised CEEK cells of claim 14.

16. The cell culture of claim 15, wherein the cell culture is infected with an avian virus or avian viral vector.

17. The cell culture of claim 16, wherein the avian virus or avian viral vector is selected from the group consisting of Marek's Disease virus (MDV), the MDV-related Herpes virus of turkey (HVT), Newcastle Disease virus (NDV), Infectious Bronchitis virus (IBV), Infectious Bursal Disease virus (IBDV), Egg Drop Syndrome virus (EDSV), Turkey Rhinotracheitis virus (TRT), Reovirus (RV) and a HVT vector comprising an IBDV VP2-gene, an IBV-spike protein gene, an avian influenza HA gene, an ILT gD/gI protein gene or an NDV F-gene.

18. A method for the preparation of the immortalised CEEK cell of claim 14, wherein said method comprises; a) obtaining primary CEEK cells; b) transfecting said primary CEEK cells with; 1) a DNA molecule free of the LTR sequences, comprising transposon inverted repeats and comprising a gene encoding the SV40 T antigen under the control of a suitable promoter; 2) a DNA molecule free of the LTR sequences, comprising transposon inverted repeats and comprising a gene encoding chicken telomerase (cTERT) under the control of a suitable promoter; and 3) a DNA molecule comprising a gene encoding transposase under the control of a suitable promoter; and c) selecting CEEK cells that have been cultured for at least 25 cell cycles.

19. The method for the preparation of the immortalised CEEK cell of claim 14, wherein said method comprises; a) obtaining primary CEEK cells; b) transfecting said primary CEEK cells with a single DNA molecule free of the LTR sequences, comprising transposon inverted repeats, comprising a gene encoding the SV40 T antigen under the control of a suitable promoter, comprising a gene encoding chicken telomerase under the control of a suitable promoter; and comprising a gene encoding transposase under the control of a suitable promoter; and c) selecting CEEK cells that have been cultured for at least 25 cell cycles.

20. The method for the preparation of the immortalised CEEK cell of claim 14, wherein said method comprises; a) obtaining primary CEEK cells; b) transfecting said primary CEEK cells with; 1) a DNA molecule free of the LTR sequences, comprising transposon inverted repeats, and comprising a gene encoding the SV40 T antigen under the control of a suitable promoter and a gene encoding chicken telomerase under the control of a suitable promoter; and 2) a DNA molecule comprising a gene encoding transposase under the control of a suitable promoter; c) selecting CEEK cells that have been cultured for at least 25 cell cycles.

21. The method of claim 18 wherein cells in step c) have been cultured for at least 50 cell cycles.

22. A method for the replication of an avian virus or avian viral vector, said method comprises; a) culturing the immortalised CEEK cell of claim 14; b) contacting the immortalised CEEK cell with the avian virus or avian viral vector; and c) allowing the avian virus or avian viral vector to replicate.

23. The method of claim 22, wherein the avian virus or avian viral vector is selected from the group of avian viruses consisting of Marek's Disease virus (MDV), the MDV-related Herpes virus of turkey (HVT), Newcastle Disease virus (NDV), Infectious Bronchitis virus (IBV), Infectious Bursal Disease virus (IBDV), Egg Drop Syndrome virus (EDSV), Turkey Rhinotracheitis virus (TRT), Reovirus (RV) and a HVT vector comprising an IBDV VP2-gene, an IBV-spike protein gene, an avian influenza HA gene, an ILT gD/gI protein gene or an NDV F-gene.

24. A method for the preparation of a vaccine comprising an avian virus or an avian viral vector, wherein the method comprises the step of mixing a cell culture of claim 16 with a pharmaceutically acceptable carrier.

25. A vaccine comprising the cell culture of claim 16, and a pharmaceutically acceptable carrier.

26. A method for the preparation of a vaccine comprising an avian virus or an avian viral vector, wherein the method comprises the steps of; a) infecting the cell culture of claim 14 with an avian virus or an avian viral vector; b) replicating said avian virus or an avian viral vector; c) isolating the progeny virus; and d) mixing the progeny virus with a pharmaceutically acceptable carrier.

Description

LEGEND TO THE FIGURES

[0085] FIG. 1: Vector maps for Plasmid #02 (pPB-CAG-ChTERT) (A) and Plasmid #03 (pPB-CAG-SV40 T Ag) (B).

[0086] FIG. 2: cTERT amino acid sequence. * indicates stop codon.

[0087] FIG. 3: indication of the location of the cells in the high density F4 band of a Percoll gradient.

[0088] FIG. 4: Growth curve of the various transfected CEEK cells. It is indicated in the figure which plasmid(s) has/have been use for the transfection of the respective cells. Cell numbers were determined at each passage to calculate the population doublings per passage.

[0089] FIG. 5: This figure shows the epithelial morphology of primary CEEK cells that were transformed with Plasmid #03 (and Plasmid #04) in their 5.sup.th passage, and of primary CEEK cells that were transformed with Plasmid #03 followed by a further transfection with Plasmid #02 (and Plasmid #04) after 17 passages, in their 25.sup.th passage.

[0090] FIG. 6: This figure shows the epithelial morphology of primary CEEK cells that were transformed with Plasmid #03 (and Plasmid #04) in their 5.sup.th passage, and of primary CEEK cells that were transformed with Plasmid #02 and Plasmid #03 (and Plasmid #04), in their 25.sup.th passage.

ABBREVIATIONS

[0091] Corning BioCoat Collagen I Rectangular Canted Neck Cell Culture Flask with Vented Cap

[0092] Corning BioCoat Collagen I coated T25 culture flask #356484

TABLE-US-00001 356484 50/Cs. 70 mL 25 cm.sub.2 356485 50/Cs. 250 mL 75 cm.sub.2 356486 40/Cs. 600 mL 150 cm.sub.2 356487 40/Cs. 750 mL 175 cm.sub.2

[0093] Corning BioCoat Collagen I Multiwell Plates

TABLE-US-00002 356400 50/Cs. 6 well 356500 50/Cs. 12 well 356408 50/Cs. 24 well 356407 50/Cs. 96 well

[0094] Nomenclature of Cells:

[0095] CEK: Primary ex-vivo Chicken Embryonic Kidney cells

[0096] CEEK-TT1: Chicken Embryonic Epithelial Kidney cellsSV40 T Ag & ChTERT no. 1

[0097] CEEK-TT2: Chicken Embryonic Epithelial Kidney cellsSV40 T Ag & ChTERT no. 2

[0098] Nomenclature of the Plasmids Used: [0099] Plasmid #01: pPB-CAG-EBNXN (Yusa et al., 2011): empty piggyBac transposon plasmid [0100] Plasmid #02: pPB-CAG-ChTERT: piggyBac transposon plasmid containing Gallus gallus telomerase reverse transcriptase (ChTERT; # AAS75793.1|seq: 1-1346) followed by a feline herpesvirus polyA signal sequence (CAATAAACATAGCATACGTTATGACATGGTCTACCGCGTCTTA TATGGGGACGAC) (Willemse et al., 1995) [0101] Plasmid #03: pPB-CAG-SV40 T Ag: piggyBac transposon plasmid containing Simian Virus 40 large T antigen (#EF579663.1|seq: 2619-5091) [0102] Plasmid #02 & #03: Simultaneous transfection of plasmid #02 and #03 (CEEK-TT1) [0103] Plasmid #03 p17 & #02: Initially transfection of plasmid #03, passaged 17 times, and subsequently transfection with plasmid #02 (CEEK-TT2) [0104] Plasmid #04: pPB-CMV-hyPBase (Yusa et al., 2011), encodes for transposase

EXAMPLES

Example 1: Immortalization of Chicken Embryonic Epithelial Kidney Cells

[0105] Plasmids

[0106] The sequence encoding ChTERT (Accession number #AAS75793.1) followed by a stop codon and a feline herpesvirus polyA signal sequence (CAATAAACATAGCATACGTTATGACATGGTCTACCGCGTCTTATATGGGGACGAC) (Willemse et al., 1995) was generated synthetically, sequenced and cloned into pPB-CAG-EBNXN (Yusa et al., 2009), henceforward called plasmid #01, subsequently using the XhoI-ClaI sites to create pPB-CAG-ChTERT, henceforward called plasmid #02 (FIG. 1A). Plasmid DNA for transfection into CEEK cells was isolated using the Qiagen EndoFree plasmid maxi kit (Qiagen).

[0107] To construct pPB-CAG-SV40 T Ag, henceforward called plasmid #03, XhoI and BglII sites were added to SV40 T Ag by PCR using primers W40 Tag 5-BII (5-GGCGAGATCTACCATGGATAAAGTTTTAAACAG-3) and W40 Tag 3-XI (5-GGCGCTCGAGTTATGTTTCAGGTTCAGGGG-3). Phusion DNA polymerase was used for PCR according to the manufacturer's protocol (New England Biolabs). The fragment was cloned into pCR-Blunt (Life Technologies) and verified by sequencing. Next, SV40 T Ag was excised from pCR-Blunt and cloned into plasmid #01 using the BglII-XhoI sites to create plasmid #03 (FIG. 1B). The final construct was verified by sequencing.

[0108] Isolation, Purification and Growth of CEEK Cells.

[0109] Ten fertilized SPF eggs were incubated at 37 C. for nineteen days and used for isolation of primary chicken embryonic kidney cells. Embryos were harvested from the eggs under sterile conditions. The kidneys were removed and washed in sterile PBS and dissociated using a trypsin solution. After dissociation, fetal calf serum was added to inactivate trypsin. The isolated cells were centrifuged for 10 minutes at 600g at 4 C. Pelleted cells were resuspended in 199/F10 medium containing N.P.P.T., stained for viability, and counted. 1.7*10.sup.6 cells/cm2 were plated in culture flasks and incubated at 37 C. and 5% CO.sub.2.

[0110] The 199/F10 medium contains: [0111] 0.5 concentrated medium 199 (MP BIOMEDICALS #091020122) [0112] 0.5 concentrated HAM's F-10 nutrient mix (MP BIOMEDICALS #091040122) [0113] 1.48 gram/litre Tryptose phosphate broth (BECTON DICKINSON BV #260200) [0114] 1.10 gram/litre Sodium Bicarbonate (MERCK CHEMICALS BV #1063232500) [0115] 1.00 gram/litre HEPES (MERCK CHEMICALS BV #1101101000)

[0116] N.P.P.T. solution consists of 7.35 g/l Neomycin sulphate, 0.63 g/l Polymyxin B sulphate, 0.25 mg/l Pimafucin, 1.0 g/l Tylosin tartrate.

[0117] After 2 hours the non-attached cells were removed from the culture flask and centrifuged for 10 minutes at 400g at 4 C. The pelleted cells were resuspended in 11 ml 1:1 Percoll (GE Healthcare)/2 concentrated Krebs-Henseleit buffer (Sigma) and centrifuged for 30 minutes at 17.500g at 4 C. (Sutterlin, 1998). Cells in the high-density F4 band (Sutterlin, 1998) were removed using a needle and syringe and then washed three times in HBSS-buffer (Sigma). The cells were stained for viability and counted before being seeded in 199/F10 medium containing: 2% FCS (Moregate), 1% Chicken serum (Sigma), 4.2 mg/litre Insulin (Sigma), 3.8 mg/litre Transferrin (Sigma), 5 g/litre Selenite (Sigma), 2 mM L-Glutamin, N.P.P.T. solution, 1.1 g/l Sodium Benzyl Penicillin, 1.9 g/l Dihydrostreptomycin sulfate, Renal Epithelial Cell Growth medium 2 Supplement Pack, without FCS (Promocell C-39605). The cells were seeded at a density of 5.000-30.000 cells/cm2 in Corning BioCoat Collagen I coated culture flasks #356484-356487 and incubated at 40 C. and 5% CO.sub.2. Supplement Pack was added to the culture medium during the first 3 passages of the cell culture, but was omitted from the medium from passage 4 onwards.

[0118] Transfection

[0119] Immediately after isolation and purification of primary CEEK cells 1.0*10.sup.6 viable cells were transfected in 100 l Primary cell buffer P1+supplement (Lonza Cologne AG) using program CM-102 of the Nucleofector 4D device (Lonza Cologne AG). Cells were transfected with 1.6 g plasmid #02, 1.6 g plasmid #03 or with both plasmids (2*1.6 g), and with 0.4 g plasmid #04 or, as a control, with 1.6 g plasmid #01 and 0.4 g plasmid #04. After the pulse, cells were left at RT for 10 min. Next, 500 l RPMI-1640 (40 C.) was slowly added to the cells and cells were incubated at 40 C. for 5 minutes. Then, cells were carefully resuspended, seeded in Corning BioCoat Collagen I coated T25 culture flasks #356484 in 199/F10 medium containing: 2% FCS (Moregate), 1% Chicken serum (Sigma), 4.2 mg/litre Insulin (Sigma), 3.8 mg/litre Transferrin (Sigma), 5 g/litre Selenite (Sigma), 2 mM L-Glutamin, N.P.P.T. solution (7.35 g/l Neomycin sulphate, 0.63 g/l Polymyxin B sulphate, 0.25 mg/l Pimafucin, 1.0 g/l Tylosin tartrate), 1.1 g/l Sodium Benzyl Penicillin, 1.9 g/l Dihydrostreptomycin sulfate, Renal Epithelial Cell Growth medium 2 Supplement Pack, without FCS (Promocell C-39605) and incubated at 40 C. and 5% CO.sub.2.

[0120] In addition, CEEK cells stably transfected with plasmid #03 were transfected after 17 passages with 1.6 g Plasmid #02 (pPB-CAG-ChTERT) and 0.4 g plasmid #04 using the same protocol (for a motivation, see under results; CEEK-TT2).

[0121] Tissue Culture

[0122] After transfection, cultures were grown in growth medium (199/F10 medium containing: 2% FCS (Moregate), 1% Chicken serum (Sigma), 4.2 mg/litre Insulin (Sigma), 3.8 mg/litre Transferrin (Sigma), 5 g/litre Selenite (Sigma), 2 mM L-Glutamin, N.P.P.T. solution (7.35 g/l Neomycin sulphate, 0.63 g/l Polymyxin B sulphate, 0.25 mg/l Pimafucin, 1.0 g/l Tylosin tartrate), 1.1 g/l Sodium Benzyl Penicillin, 1.9 g/l Dihydrostreptomycin sulfate, Renal Epithelial Cell Growth medium 2 Supplement Pack, without FCS (Promocell C-39605) and routinely passaged upon 80-100% confluency. Supplement Pack was added to the culture medium during the first 3 passages of the cell culture, but was omitted from the medium from passage 4 onwards. After removal of the medium, cells were washed with PBS and detached using Accutase (Sigma) at 37 C. Cells were resuspended in growth medium and centrifuged for 5 minutes at 300g RT. The pelleted cells were resuspended in growth medium and counted using a Brker-Trk counting chamber. Cells were plated in fresh medium in Corning BioCoat Collagen I coated culture flasks #356484-356487 and incubated at 40 C. and 5% CO.sub.2. Transfected CEEK cells were frozen for liquid nitrogen storage at different passages in standard medium containing 10% dimethylsulfoxide and 10% FCS. The number of population doublings was calculated using the following equation:

[00001]$\mathrm{Population}.Math..Math.\mathrm{doublings}=\frac{\mathrm{Log}.Math..Math.\mathrm{Nt}-\mathrm{Log}.Math..Math.N}{\mathrm{Log}.Math..Math.2}$

[0123] where Nt was the number of viable cells at the end of the growth period and N the number of plated cells (Venkatesan and Price, 1998). Cells were photographed using an Olympus DP21 camera coupled to an Olympus CKX41 microscope.

[0124] Results

[0125] Immortalization of Primary CEEK Cells by Co-Expression of SV40 T Antigen and ChTERT.

[0126] Primary CEEK cells transfected with plasmid #01 & #04 could be cultured for 10 passages, however the morphology of these cells quickly adapted a senescent morphology and cells proliferated slowly. After 14 population doublings the cells stopped proliferating and died. Primary CEEK cells transfected with plasmid #02 & #04 showed a comparable phenotype and stopped proliferating and died after 21 population doublings. In contrast, when transfected with plasmid #03 & #04, the cells proliferated well with a high proliferation rate and could be kept in culture for at least 45 population doublings. Although these plasmid #03 & #04 transfected cells clearly had an extended lifespan compared to the plasmid #01 & #04 and plasmid #02 & #04 transfected cells, they eventually stopped proliferating and died at the end of the extended lifespan, i.e. they went into mitotic crisis. Only primary CEEK cells stably transfected with plasmid #02 & #03 & #04 continued to proliferate indefinitely. These cells have been passaged at least 35 times by now and have performed at least 100 PDs (FIG. 4 growth curve). After 35 passages the cells are still proliferating vigorously and have an epithelial-like morphology Therefore, it can be concluded that they represent an immortalized cell line of chicken embryonic epithelial kidney cells. This cell line is referred to as CEEK-TT1 (Chicken Embryonic Epithelial Kidney cellsSV40 T Ag & ChTERT no. 1).

[0127] The cells have an epithelial-like morphology which remains constant during passaging (FIG. 6).

[0128] CEEK-TT1 cells of different passages have been frozen down in ampoules for liquid nitrogen storage. These cells could easily be regrown after removal from the liquid nitrogen storage.

[0129] CEEK-TT2

[0130] The observation that only CEEK cells that were co-transfected with plasmids #02 & #03 & #04 were immortalized (FIG. 4) indicates that expression of both SV40 T Ag and ChTERT are required for immortalization of CEEK cells. Therefore, cells that were initially transfected using only plasmids #03 & #04 were transfected a second time after culturing for 17 passages after initial transfection. The second transfection was performed with plasmids #02 & #04 in order to add stable expression of ChTERT to these cells. In contrast to the control (cells transfected using only plasmids #03 & #04) that went into crisis and died around passage 21, the twice transfected cells stably expressing SV40 T Ag and ChTERT continued to divide and proliferated well. These cells have been passaged for at least 17+21 passages and have performed at least 104 PDs. These cells continue to proliferate vigorously after passage 17+21 (104 PDs). The cells also have an epithelial-like morphology which remains constant during passaging (FIG. 5). Therefore, it is concluded that a second immortalized CEEK cell line was created, henceforward called CEEK-TT2 (Chicken Embryonic Epithelial Kidney cellsSV40 T Ag & ChTERT no. 2). CEEK-TT2 cells of different passages have been frozen down in ampoules for liquid nitrogen storage. These cells could easily be regrown after removal from the liquid nitrogen storage.

REFERENCE LIST

[0131] Venkatesan, R. N. and Price, C. (1998). Telomerase expression in chickens: constitutive activity in somatic tissues and down-regulation in culture. Proc. Natl. Acad. Sci. U.S.A 95, 14763-14768. [0132] Willemse, M. J., Strijdveen, I. G., van Schooneveld, S. H., van den Berg, M. C., and Sondermeijer, P. J. (1995). Transcriptional analysis of the short segment of the feline herpesvirus type 1 genome and insertional mutagenesis of a unique reading frame. Virology 208, 704-711. [0133] Yusa, K., Rad, R., Takeda, J., and Bradley, A. (2009). Generation of transgene-free induced pluripotent mouse stem cells by the piggyBac transposon. Nat. Methods 6, 363-369. [0134] Yusa, K., Zhou, L., Li, M. A., Bradley, A., and Craig, N. L. (2011). A hyperactive piggyBac transposase for mammalian applications. Proc. Natl. Acad. Sci. U.S.A 108, 1531-1536. [0135] Sutterlin, G. G. and Laverty, G (1998). Characterization of a primary cell culture model of the avian renal proximal tubule. Am. J. Physiol. 275 (regulatory Integrative Comp. Physiol. 44): R220-R226.