METHOD FOR GENERATING PROGENITOR T CELLS FROM STEM AND/OR PROGENITOR CELLS AND USE OF SAME
20190142867 ยท 2019-05-16
Inventors
Cpc classification
A61K2239/26
HUMAN NECESSITIES
C12N2501/125
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N2501/165
CHEMISTRY; METALLURGY
C12N2533/90
CHEMISTRY; METALLURGY
C12N2501/58
CHEMISTRY; METALLURGY
A61P7/00
HUMAN NECESSITIES
C12N5/0607
CHEMISTRY; METALLURGY
C12N5/0647
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C12N5/0696
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
A61K39/464466
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K39/4611
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
Abstract
The present disclosure provides a method for generating progenitor T cells from stem and/or progenitor cells comprising exposing the stem and/or progenitor cells to Notch ligand Delta-like-4 (DL4) and vascular adhesion molecule 1 (VCAM-1) under conditions suitable to generate progenitor T cells. The method provided is suitable for in vitro and in vivo pro-T cell generation. In vitro, the pro-T cells are generated under serum-free conditions. Cells produced using the method are provided as well as methods of using same.
Claims
1. A method of generating progenitor T cells from stem and/or progenitor cells, the method comprising: culturing stem and/or progenitor cells in the presence of at least a portion of Notch ligand Delta-like-4 (DL4) and at least a portion of vascular adhesion molecule 1 (VCAM-1) under serum-free conditions to generate progenitor T cells.
2. The method of claim 1, wherein the culturing step further comprises generating derivatives of the generated progenitor T cells.
3. The method of claim 1, wherein the portion of DL4 comprises the extracellular domain of DL4, and/or wherein the portion of VCAM-1 comprises the Phe25 to Glu698 of SEQ ID NO: 4 fused with the Fc region of human IgG1.
4. The method of claim 1, wherein at least one of the portion of DL4, or the portion of VCAM-1 is adsorbed or immobilized to a substrate.
5. (canceled)
6. (canceled)
7. The method of claim 1, wherein the portion of DL4 is provided in a concentration in the range of 7.5 to 20 ?g/mL.
8. (canceled)
9. (canceled)
10. (canceled)
11. The method of claim 1, wherein the culturing of the stem and/or progenitor cells comprises exposing the stem and/or progenitor cells to a hematopoietic differentiation medium comprising SCF, FLT3L and IL-7.
12. The method of claim 1, wherein the stem and/or progenitor cells are human cells.
13. The method of claim 1, wherein the stem and/or progenitor cells are pluripotent stem cells or hematopoietic stem and progenitor cells.
14. An isolated population of progenitor T cells generated by the method of claim 1.
15. The isolated population of claim 14, wherein the isolated population comprises derivatives of the progenitor T cells.
16. The isolated population of claim 14, wherein the population comprises at least 20% CD7+ progenitor T cells.
17. (canceled)
18. The isolated population of claim 14, wherein the progenitor T cells are human cells that express CD7.
19. (canceled)
20. A method for increasing the number of T cells in a subject in need thereof, the method comprising administering to the subject an effective number of progenitor T cells according to claim 14.
21. The method of claim 20, wherein the subject is a human.
22. The method of claim 21, wherein the administered progenitor T cells are autologous.
23. The method of claim 21, wherein the administered progenitor T cells are allogeneic.
24. The method of claim 20, wherein the subject in need of the increased number of T cells has a medical condition causing or resulting in lymphopenia.
25. The method of claim 24, wherein the medical condition is cancer, HIV infection, partial thymectomy, autoimmune disease, and/or organ transplant.
26. The method of claim 1, wherein the at least a portion of DL4 is the full-length DL4 polypeptide and/or the at least a portion of VCAM-1 is the full length VCAM-1 polypeptide.
27. The method of claim 11, wherein the hematopoietic differentiation medium further comprises thrombopoietin.
Description
DESCRIPTION OF THE DRAWINGS
[0022] These and other features of the disclosure will become more apparent in the following detailed description in which reference is made to the appended drawings wherein:
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
DETAILED DESCRIPTION OF THE DISCLOSURE
[0124] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
Definitions
[0125] As used herein, the term stem cell refers to a cell that can differentiate into more specialized cells and has the capacity for self-renewal. Stem cells include pluripotent stem cells (PSCs), such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), and multipotent stem cells, such as cord blood stem cells, and adult stem cells, which are found in various tissues.
[0126] As used herein, the term progenitor cell refers to a cell that can differentiate into one or more types of cells, but does not typically have the capacity for self-renewal. Progenitor cells are derivatives of stem cells and have more limited potency relative to their corresponding source stem cells. For example, hematopoietic stem cells (HSCs), found in adult bone marrow, peripheral blood (in smaller numbers) and in umbilical cord blood, have the capacity to give rise to all other blood cells. Hematopoietic progenitor cells are multipotent or lineage-committed cells derived from HSCs that have the capacity to give rise to a more limited or specific type of blood cell. Hematopoietic stem and progenitor cells (HSPCs) typically exist as a heterogeneous population in vivo and have use as a heterogeneous population as described herein.
[0127] As used herein, the terms progenitor T cell and pro-T cell refer to a cell that is derived from a pluriportent stem cell or a CD34+ hematopoietic stem and/or progenitor cell and expresses CD7+(human system) or CD25+CD90+(mouse system), and has the capacity to differentiate into one or more types of mature T cells. A mature T cell includes cells that express a combination of CD4, CD8 and CD3 cell surface markers.
[0128] As used herein, a defined culture medium refers to a chemically-defined formulation comprised solely of chemically-defined constituents. A defined medium may include constituents having known chemical compositions. Medium constitutents may be synthetic and/or derived from known non-synthetic sources. For example, a defined medium may include one or more growth factors secreted from known tissues or cells. However, the defined medium will not include the conditioned medium from a culture of such cells. A defined medium may include specific, known serum components isolated from an animal, including human serum components, but the defined medium will not include serum. Any serum components provided in the defined medium such as, for example, bovine serum albumin (BSA), are preferably substantially homogeneous.
[0129] As used herein, serum-free medium refers to a cell culture medium that lacks animal serum. Serum-free medium may include specific, known serum components isolated from an animal (including human animals), such as, for example, BSA.
[0130] As used herein, Delta-like-4, DL4 and Notch ligand DL4 refer to a protein that in humans is encoded by the DLL4 gene. DL4 is a member of the Notch signaling pathway and is also referred to in the art as Delta like ligand 4 and DLL4. Herein, reference to DL4 is not limited to the entire DL4 protein, but includes at least the signaling peptide portion of DL4. For example, a commercially available product (Sino Biologicals) comprising the extracellular domain (Met 1-Pro 524) of human DLL4 (full-length DLL4 accession number NP_061947.1; SEQ ID NO: 1) fused to the Fc region of human IgG1 at the C-terminus is a DL4 protein suitable for use herein.
[0131] As used herein, Vascular cell adhesion molecule 1 and VCAM-1 refer to a protein that in humans is encoded by the VCAM1 gene. VCAM-1 is a cell surface sialoglycoprotein, a type I membrane protein that is a member of the Ig superfamily. VCAM-1 is also referred to in the art as vascular cell adhesion protein 1 and cluster of differentiation 106 (CD106). Herein, reference to VCAM-1 is not limited to the entire VCAM-1 protein, but includes at least the signaling peptide portion of VCAM-1 (QIDSPL (SEQ ID NO: 2) or TQIDSPLN (SEQ ID NO: 3)). For example, a commercially available mouse VCAM-1 Fc chimeric protein (R&D) that comprises (Phe25-Glu698) region of mouse VCAM-1 (full-length murine VCAM-1 accession number CAA47989; SEQ ID NO: 4) fused with the Fc region of human IgG1 is a VCAM-1 protein suitable for use herein. Use of at least a portion of human VCAM-1 (full-length human VCAM-1 accession number P19320, NP001069, EAW72950; SEQ ID NO: 5) may also be suitable for use in the method provided herein.
GENERAL DESCRIPTION OF THE DISCLOSURE
[0132] As described herein, the inventors have determined an in vitro method for generating progenitor T cells (pro-T cells) in a serum-free system. The method involves culturing stem and/or progenitor cells in the presence of the Notch ligand Delta-like-4 (DL4) and VCAM-1 in serum-free medium to generate pro-T cells. In an embodiment, the inventors found that DL4 and VCAM-1 synergistically enhance Notch signaling and promote pro-T cell differentiation and migration.
[0133] Pro-T cells generated using the method provided herein are provided. The cells provided herein may be used, for example, to treat a subject in need of pro-T cells and/or more mature T cells, as described further below. For example, a host in need of additional pro-T cells and/or mature T cells may be subjected to a cell transplant that comprises an effective amount of the pro-T cells provided herein or an effective amount of the pro-T cells provided herein in combination with stem cells (e.g., HSPCs).
[0134] Method of Generating Progenitor T Cells In Vitro
[0135] Generally, the in vitro method of generating pro-T cells involves culturing stem and/or progenitor cells in the presence of DL4 and VCAM-1 in serum-free medium under conditions and for a time suitable for differentiation into pro-T cells. To confirm generation of pro-T cells, the cells may be analyzed for one or more features indicative of pro-T cells, such as, for example, one or more cell surface markers.
[0136] In an embodiment, the stem and/or progenitor cells are pluripotent stem cells, such as ESCs or iPSCs. In an embodiment, the stem and/or progenitor cells are HSPCs. For example, the HSPCs may be obtained from cord blood, peripheral blood or bone marrow or they may be derived in vitro from ESCs, iPSCs or other intermediate stem cells. In a preferred embodiment, the stem and/or progenitor cells are human cells.
[0137] In an embodiment, the method is performed in a two dimensional (2D) culture system. For example, one or more wells of a standard tissue culture plate are coated with DL4 and VCAM-1. In an embodiment, the DL4 and VCAM-1 are provided as adsorbed proteins. Stem cells and/or progenitor cells are then seeded into the 2D DL4? and VCAM-1-coated wells in serum-free hematopoietic differentiation medium and cultured for a time and under conditions suitable for generating pro-T cells. Media generally suitable for hematopoietic differentiation are known to those of skill in the art and are commercially available. In an embodiment, a preferred medium for hematopoietic differentiation suitable for use in the method provided herein is described herein.
[0138] In an embodiment, wells of a standard 96-well tissue culture plate are coated overnight with about 50 ?L/well of DL4-Fc at a concentration in the range of 7.5-20 ?g/mL (preferably about 15-20 ?g/mL) and VCAM-1-Fc at a concentration in the range of 0.15-5.3 ?g/mL (preferably about 2.3-5.3 ?g/mL). Coated wells are then washed to remove unbound ligand and seeded with stem cells in serum-free hematopoietic differentiation medium at a density of, for example, about 1000-4000 cells/well in a 96 well plate. In a preferred embodiment, the serum-free hematopoietic differentiation medium is a defined medium, such as, for example, Iscove's Modified Dulbecco's Medium with 20% bovine serum albumin, insulin, and transferrin serum substitute (IMDM+BIT). In a preferred embodiment, the seeded cells are cultured in the presence of growth factors that facilitate pro-T cell differentiation, such as, for example, Stem Cell Factor (SCF), FMS-like Tyrosine Kinase 3 Ligand (Flt3L), thrombopoietin (TPO) and Interleukin 7 (IL7). The seeded cells are cultured at an appropriate temperature, e.g., 37? C., and for a time sufficient to generate pro-T cells, such as, for example, 9-21 days (human) or 7-14 days (mouse). To confirm generation of pro-T cells, the cells cultured in the 2D system may be analyzed for one or more features indicative of pro-T cells, such as, for example, specific molecular markers.
[0139] In general, pro-T cell development in the thymus is characterized by four sequential stages commonly referred to as DN1, DN2, DN3 and DP (DN=double negative and DP=double positive for CD4 and CD8 expression). Murine pro-T cells can be tracked via expression of CD25 and CD44 on the cell surface progressing via successive double-negative (DN; CD4?CD8?) stages: DN1 (CD25?CD44+CD90?), DN2 (CD25+CD44+CD90+), DN3 (CD25+CD44?CD90+/?) and finally maturing to double-positive (DP; CD4+CD8+) and single-positive (SP; CD4+CD3+ or CD8+CD3+) T cells. Human pro-T cells can be tracked via expression of CD4 and CD8 on the cell surface progressing via successive double-negative (DN; CD4?CD8?) stages: CD7+CD34+ primitive progenitor T cells followed by CD7+ and/or CD34? and/or CD5+ and/or CD45RA+ pro-T cells and finally maturing to double-positive (DP; CD4+CD8+) and single-positive (SP; CD4+CD3+ or CD8+CD3+) T cells. In an embodiment, the method provided herein may be used to generate CD25+CD90+ murine pro-T cells. In an embodiment, the method provided herein may be used to generate CD7+ human pro-T cells.
[0140] Progenitor T Cells Generated Using the In Vitro Method Provided Herein
[0141] Pro-T cells generated using the method provided herein are provided. Preferably, the pro-T cells are human. In an embodiment, the human pro-T cells may be characterized phenotypically via expression of CD4 and CD8 on the cell surface progressing via successive double-negative (DN; CD4?CD8?) stages: CD7+CD34+ primitive progenitor T cells followed by CD7+ and/or CD34? and/or CD5+ and/or CD45RA+ pro-T cells and finally maturing to double-positive (DP; CD4+CD8+) and single-positive (SP; CD4+CD3+ or CD8+CD3+) T cells. In an embodiment, the human pro-T cells provided herein may be characterized by CD7 expression. In general, lymphoid cells may be identified by their small and round morphology and by blue colour in a Giemsa stain. In an embodiment, the pro-T cells provided herein may be functionally characterized. For example, CD7+ pro-T cell transplantation in vivo should result in the transplanted cells homing to the thymus, engrafting in the thymus, and then rapidly dividing to generate DP and SP T cells.
[0142] In an embodiment, the stem and/or progenitor cells are pluripotent stem cells, such as ESCs or iPSCs. In an embodiment, the stem and/or progenitor cells are HSPCs. For example, the HSPCs may be obtained from cord blood, peripheral blood or bone marrow or they may be derived in vitro from ESCs, iPSCs or other intermediate stem cells. In a preferred embodiment, the stem and/or progenitor cells are human cells.
[0143] In an embodiment, the pro-T cells generated using the method provided herein are autologous.
[0144] In an embodiment, the pro-T cells generated using the method provided herein are allogeneic.
[0145] It is contemplated that the allogeneic pro-T cells provided herein could be transferred to an irradiated subject in need of pro-T cells irrespective of major histocompatibility complex (MHC) disparities. Without being bound by theory, it is thought that pro-T cells, unlike mature T cells, do not cause graft versus host disease (GVHD), at least because pro-T cell precursors complete their differentiation in the thymus, where they become restricted to host MHC and yield T lymphocytes that are host tolerant. Thus, strict histocompatibility would not be required in therapeutic use of the pro-T cells provided herein.
[0146] The cells provided herein may be used, for example, to treat a subject in need of pro-T cells and/or more mature T cells. By treat we mean administering to the subject and effective amount of cells, as provided herein, under conditions suitable for increasing the number of T cells in the subject, which may result in prevention, inhibition and/or therapeutic treatment of a medical condition associated with insufficient T cells. By effective amount we mean a therapeutically effective amount such as, for example, the amount of cells that, upon administration to a subject, is sufficient to achieve the intended purpose (e.g., treatment). The amount may vary from one subject to another and may depend upon one or more factors, such as, for example, subject gender, age, body weight, subject's health history, and/or the underlying cause of the condition to be prevented, inhibited and/or treated.
[0147] For example, subjects afflicted with a medical condition causing or resulting in lymphopenia may benefit from administration of a pro-T transplant as described herein. For example, subjects who are post-chemotherapy and/or post-irradiation, such as those receiving treatment for cancer, subjects having HIV infection, partial thymectomy, autoimmune diseases, such as lupus or rheumatoid arthritis, or diabetes may benefit from administration of the pro-T cells provided herein. In an embodiment, the administered cells may be autologous. In an embodiment, the administered cells may be allogeneic. In an embodiment, the cells provided herein may be used to induce host tolerance upon organ transplant.
[0148] Kits for Generating Progenitor T Cells
[0149] The present disclosure contemplates kits for carrying out the methods provided herein. Such kits typically comprise two or more components required for generation of pro-T cells. Components of the kit include, but are not limited to, one or more of compounds, reagents, containers, equipment and instructions for using the kit. Accordingly, the methods described herein may be performed by utilizing pre-packaged kits provided herein.
[0150] In an embodiment, a kit for use to generate pro-T cells from PSCs or HSPCs in vitro is provided. The kit comprises DL4 and VCAM-1. In an embodiment, the DL4 is adsorbed or immobilized to a substrate. In an embodiment, the VCAM-1 is adsorbed or immobilized to a substrate. In an embodiment, the kit further comprises a hematopoietic differentiation medium, preferably comprising growth factors, such as SCF, Flt3L, IL7 and/or TPO, in hematopoietic amounts. For example, amounts the growth factors may be as follows: 10-50 ng/mL (mouse cultures) and about 100 ng/mL (human cultures). In some embodiments, instructions for use of the kit to generate pro-T cells from stem and/or progenitor cells, such as PSCs or HSPCs, in vitro are provided. The instructions may comprise one or more protocols for: preparing DL4 and, optionally, preparing VCAM-1 components; providing DL4 and/or VCAM-1 components to a culture system; culture conditions, such as time, temperature, and/or gas incubation concentrations; harvesting protocols; and protocols for identifying pro-T cells and, optionally, more mature T cells.
[0151] The kit may further include materials useful for conducting the present method such as, for example, culture plates, welled plates, petri dishes and the like.
[0152] Non-limiting embodiments are described by reference to the following examples which are not to be construed as limiting.
Example 1: Methods
[0153] In Example 1, the methods used in the subsequent Examples are described.
[0154] Fetal-Liver Isolation and HSPC Sorting.
[0155] Untimed pregnant (E13-14) female CD-1 mice were purchased from Charles River Laboratories (Wilmington, Mass.). Animal use and experimental protocols were approved by the University of Toronto Animal Care Committee in accordance with the Guidelines of the Canadian Council on Animal Care. Fetal livers were isolated from the decapitated mouse embryos (E14-15) using surgical forceps. The fetal livers were placed in Hank's Balanced Salt Solution (HBSS; Invitrogen, Carlsbad, Calif.) containing 2% fetal bovine serum (FBS; Invitrogen) (or HF) and disrupted by using a 16-gauge blunt-end needle (Stemcell Technologies). To obtain single cell suspension, cells were gently passed through a 21-gauge needle three times. Cells were spun down at 1500 rpm for 5 min at 4? C. and washed twice with HF. Subsequently, cells were subjected to two rounds of Ter119 depletion by EasySep? magnetic sorting (Stemcell Technologies, Vancouver, BC, Canada) according to the manufacturer's instructions. Ter119? fetal liver cells were stained for HSPC sorting in ice cold HF at 1?10.sup.7 cells/mL. Cells were blocked against non-specific binding with 1% anti-Fc receptor antibody (Fc-block, BD Biosciences, San Jose, Calif.) and stained with anti-Sca-1-PE and anti-cKit-APC (BD Biosciences, San Jose, Calif.) for 20 minutes on ice. Dead cells were excluded from live cell sorting using 7-aminoactinomycin D (7-AAD; Invitrogen). Cells were sorted at 1?10.sup.6 cells/mL using either FACSAria? II (Becton Dickinson), MoFlo? Astrios? (Beckman Coulter) or MoFIo? XDP flow cytometers (Beckman Coulter). Isotype controls and singly stained compensation controls were used to set threshold gates for sorting such that the negative controls contained 99.5% negative cells.
[0156] DL4-Fc Production and Coated DL4-Fc Plate Preparation.
[0157] Commercially available DL4-Fc was purchased and used for experiments from Sino Biologicals (Cedarlane Labs, Burlington, Ontario, Canada) or manufactured in-house as described below. DL4-Fc was diluted in chilled phosphate-buffered saline (PBS) at 10 ?g/mL or 20 ?L/well and 50 ?L/well was coated in standard tissue-culture 96-well plates overnight at 4? C. Wells were washed once with PBS prior to seeding cells to remove any unbound ligand from the wells. For certain experiments, wells were also coated overnight with 50 ?L/well PBS containing DL4-Fc and VCAM-1-Fc (R&D) or fibronectin (Sigma) at concentrations described herein.
[0158] Genetically engineered DL4-Fc was generated by fusing the coding sequence of the extracellular domain of murine D114 (amino acid residues 1-529 of SEQ ID NO: 1) to the Fc portion of human IgG1 (including the hinge region) and inserting it into pIRESpuro2 mammalian expression plasmid (Clontech, Mountainview, Calif.). HEK-293T cells were transfected using standard CaPO.sub.4 transfection methods and cells were selected with stably integrated plasmid based on their resistance to 2 ?g/mL of puromycin added to the medium, DMEM [supplemented with 10% (v/v) FBS, 2 mM Glutamax, Penicillin (100 U/ml)/Streptomycin (100 mg/ml) (all products of Thermo Fisher Scientific, Rockford, Ill.), 2 mM 2-mercaptoethanol (Sigma-Aldrich, St. Louis, Mich.)]. Cells were expanded and transferred to grow in FreeStyle? 293 expression media (Thermo Fisher Scientific). DL4-Fc fusion protein secreted into the media was purified using HiTrap? Protein G affinity column (GE Healthcare Life Sciences, Marlborough, Mass.) attached to the AKTAprime Plus? (GE Health) automated chromatography system. For certain experiments, DL1-Fc was produced as previously described.sup.8.
[0159] Sorted HSPC Seeding and In Vitro Culture.
[0160] Sorted sca1+ckit+ HSPCs were cultured at 1000 cells/well (corresponding to 3.1?10.sup.3 cells/cm.sup.2) in DL4-coated 96-well plates in serum-free Iscove modified Dulbecco medium (Gibco, Rockville, Md.) with 20% bovine serum albumin, insulin, and transferrin serum substitute (BIT; Stemcell Technologies), 1% GlutaMAX? (Gibco) and 1 ?g/mL low-density lipoproteins (Calbiochem, La Jolla, Calif.) [IMDM+BIT]. For positive control cultures, OP9 serum medium was used, composed of ?MEM medium (Gibco) and 16% FBS (Hyclone?, GE Health). Serum-free ?MEM+BIT medium was prepared exactly as IMDM+BIT medium except using ?MEM (Gibco) as the base medium. OP9 serum medium, ?MEM+BIT or IMDM+BIT serum free medium was added at 200 ?L/well supplemented with 25 ng/mL Stem Cell Factor (SCF; R&D Systems, Minneapolis, Minn.), 5 ng/mL FMS-like Tyrosine Kinase 3 Ligand (Flt3L; R&D Systems) and 1 ng/mL Interleukin-7 (IL-7; R&D Systems) with a 50% medium exchange step at day 4 containing 2-fold concentrated cytokines as described previously.sup.9. Design of Experiment (DOE) in silico modeling was performed using Design-Expert? (v10) using response surface method to investigate the combinatorial desirability of different concentrations of SCF, Flt3L and IL-7 for maximizing DN3 T-cell yield and minimizing the volume of IMDM+BIT medium. After DOE optimization, IMDM+BIT serum-free medium was added at 50 ?L/well supplemented with 50 ng/mL SCF (R&D Systems), 10 ng/mL Flt3L (R&D Systems) and 10 ng/mL IL-7 (R&D Systems) unless described otherwise in the text with no medium exchange for the length of the assay. For the candidate factor screening in serum-free IMDM+BIT medium, the following proteins or small molecules were used at the concentrations listed: JAK inhibitor I (50 nM; EMD Millipore), IL-11 (10, 50, and 100 ng/mL; R&D Systems), IL-6 (10, 50, and 100 ng/mL; R&D Systems), IL-6R (100 ng/mL; R&D Systems), Ccl25 (1.5 ?g/mL; R&D Systems), IL-7 (50, 100, and 200 ng/mL; R&D Systems), SDF1? (Cxcl12; 200 ng/mL; R&D Systems), and Leukemia Inhibitory Factor (LIF; 0.1, 1, and 10 ng/mL; EMD Millipore).
[0161] For human HSPC culture, umbilical cord blood samples were collected from consenting donors according to ethically approved procedures at Mount Sinai Hospital. CD34+ cells were isolated from the red blood cell (RBC)-lysed cord blood fraction using the EasySep? Human CD34 Positive Selection Kit (Stemcell Technologies) according to the manufacturer's instructions. Flow cytometry was performed after every enrichment to ensure CD34 frequencies were greater than 95%. CD34+ HSPCs were cultured for 14 days on DL4 and VCAM-1 coated 96-well plates at higher seeding densities of 12,500 HSPCs/cm.sup.2 (corresponding to 4000 cells/well). One complete medium exchange was performed at day 7 of culture and cells were returned to the same DL4 and VCAM-1 coated plates. For certain experiments, DL4-Fc was coated alone or with RetroNectin? (Takara Shuzo) or fibronectin (Sigma Aldrich) as described in the text. CD34+ cells were cultured in serum-free Iscove modified Dulbecco medium (Gibco) with 20% bovine serum albumin, insulin, and transferrin serum substitute (BIT; Stemcell Technologies), 1% GlutaMAX? (Gibco) and 1 ?g/mL low-density lipoproteins (Calbiochem). The medium was added at 50 ?L/well supplemented with 100 ng/mL SCF (R&D Systems, Minneapolis, Minn.), 100 ng/mL Flt3L (R&D Systems), 100 ng/mL Tpo (R&D Systems) and 100 ng/mL IL-7 (R&D Systems).
[0162] Flow Cytometry.
[0163] Surface marker staining was performed with conjugated rat anti-mouse antibodies (BD Biosciences, San Jose, Calif., Table 1). All samples were analyzed on a FACSCanto? or FACS LSRFortessa? flow cytometer (BD Biosciences). At day 7 of culture, cells were lifted off the plate with multiple HF rinses, stained at 1:400 dilution with antibodies against CD45, CD25, CD44, CD90, CD11 b and CD19 for 20 minutes on ice. Human progenitor T-cells were stained at 1:100 dilution with antibodies against CD34, CD7, CD5 and CD45RA. Integrin expression was analyzed using antibodies against ?4, ?1, and ?7 integrin subunits on Sca-1+cKit+ mouse HSPCs and CD34+ human umbilical blood cells. For intracellular cytokine staining, splenocytes were harvested, washed, and stained with fluorochrome-conjugated anti-human antibodies to CD45 and CD3 and subsequently fixed and permeabilized using the Cytofix/Cytoperm? kit (BD Biosciences) with IL-2, IFN-? and TNF-?-specific antibodies. All mouse anti-human antibodies were purchased as described in Table 1. Cells were washed twice with HF and dead cells were excluded using 7-AAD (Life Technologies) at 1:1000 dilution. Flow data was analyzed and batch processed using FlowJo? software and further analyzed in Python (version 2.7.10).
TABLE-US-00001 TABLE 1 Antibodies Catalog Antibody Reactivity Fluorophore Company Number CD25 Mouse APC BD Biosciences 557192 CD44 Mouse PE BD Biosciences 553134 CD45 Mouse APCCy7 BD Biosciences 557659 CD90.2 Mouse V450 BD Biosciences 561643 CD19 Mouse PECy7 BD Biosciences 552854 CD11b Mouse FITC BD Biosciences 557396 Sca-1 Mouse PE BD Biosciences 553108 cKit Mouse APC BD Biosciences 553356 CD49d (?4) Mouse PE BioLegend 103607 CD29 (?1) Mouse APC BioLegend 102215 ?7 Mouse APC BioLegend 321207 7-AAD Mouse/Human PerCP-Cy5-5 Life Technologies A1310 CD45 Human APCCy7 BD Biosciences 557833 CD7 Human APC BD Biosciences 561604 CD5 Human PECy7 eBioscience 25-0059-42 CD34 Human PE BD Biosciences 555822 CD34 Human PECy7 BD Biosciences 560710 CD45RA Human FITC BioLegend 304106 CD8 Human PE BD Biosciences 555367 CD3 Human FITC BD Biosciences 555332 CD1a Human APC BD Biosciences 559775 CD4 Human PECy7 BD Biosciences 557852 CD7 Human Alexa Fluor 700 BD Biosciences 561603 CD49d (?4) Human APC BD Biosciences 561892 CD29 (?1) Human PE BD Biosciences 561795 ?7 Human PE BD Bioscience 555945 IFN-? Human PE BD Biosciences 554552 TNF-? Human PECy7 BD Biosciences 557647 IL-2 Human APC BD Biosciences 561054
[0164] NIH3T3 Luciferase Assay for Measuring Notch Activation.
[0165] NIH3T3 cells were seeded at 125,000 cells/well in a 6-well plate on the previous day and transiently transfected overnight with Notch1, CBF1-Firefly and constitutively active Renilla plasmids using FuGENE? HD transfection reagent (Promega Corporation, Madison Wis. USA) as per the manufacturer's instructions. Transfected NIH3T3 cells were either seeded on DL4-coated plates or in DL4-conjugated MC for 24 hours prior to measuring Firefly activation normalized to Renilla expression using the dual-luciferase reporter assay system (Promega Corporation, Madison Wis. USA) according to the manufacturer's instructions.
[0166] Live Imaging
[0167] Sorted Sca-1+cKit+ HSPCs were seeded at low density (200 cells/well) into triplicate wells of 96-well plates coated with different substrates. After 6 days of culture, cells were stained with conjugated antibodies for CD25-APC and CD44-PE (1:500 dilution) at 37? C. for 1 hour. Live cell imaging was then performed without washing on the AxioObserver Z1 (Zeiss) platform in 5% CO2 and 37? C. controlled conditions. Brightfield images were captured at 5-minute (or 10-minute) intervals over 24 hours using a 10?0.3 NA air objective. To minimize phototoxicity and photobleaching, images in the fluorescent APC and PE channels were acquired at longer 30-minute (or 60-minute) intervals. Image acquisition and processing was performed using ZEN 2012 blue edition software (Zeiss). Manual tracking was performed using Image-J software. Cells were tracked within 3 unique DL4 only wells and 3 unique DL4+VCAM-1 wells. Manual tracking was performed on 43 cells in the DL4 only condition (15, 10 and 18 cells per well) and 69 cells in DL4+VCAM-1 condition (30, 14 and 25 cells per well).
[0168] Quantitative Real-Time PCR
[0169] Sorted Sca-1+cKit+ murine HSPCs were seeded on no coating, 10 ?g/mL DL4, 2.32 ?g/mL VCAM-1, and DL4+VCAM-1 at 20,000 cells/well in 96-well plates and were collected at 24 and 48 hours of culture using multiple PBS rinses. CD34+ human umbilical blood cells were seeded in the same conditions and were collected after 24, 48, and 96 hours of culture. Cells were lysed and RNA was isolated using the PureLink? RNA Micro Kit (Invitrogen) according to the manufacturer's protocol. RNA was converted to cDNA using SuperScript? III Reverse Transcriptase (Invitrogen) according to the manufacturer's protocol, and amplified together with respective primers in FastStart SYBR Green Master Mix (Roche). Thermocycling and quantification was performed using the QuantStudio? 6 Flex (Applied Biosystems). Relative expression of individual genes was calculated by the delta cycle threshold (?-Ct) method with the expression of ?-actin as an internal reference. PCR primer sequences are available in Table 2.
TABLE-US-00002 TABLE2 qRT-PCRPrimerSequences Target Species ForwardPrimer ReversePrimer ?-actin Mouse GAAATCGTGCGTGACATCAAA TGTAGTTTCATGGATGCCACA G(SEQIDNO:6) G(SEQIDNO:7) Bcl11b Mouse GGGCGATGCCAGAATAGAT GGTAGCCTCCACATGGTCAG (SEQIDNO:8) (SEQIDNO:9) Deltex Mouse GAGGATGTGGTTCGGAGGTA CCCTCATAGCCAGATGCTGT (SEQIDNO:10) (SEQIDNO:11) E2a Mouse TTTGACCCTAGCCGGACATAC GCATAGGCATTCCGCTCAC (SEQIDNO:12) (SEQIDNO:13) Gata3 Mouse CTCGGCCATTCGTACATGGAA GGATACCTCTGCACCGTAGC (SEQIDNO:14) (SEQIDNO:15) Hes1 Mouse TCAACACGACACCGGACAAAC ATGCCGGGAGCTATCTTTCTT (SEQIDNO:16) (SEQIDNO:17) Notch1 Mouse CCCTTGCTCTGCCTAACGC GGAGTCCTGGCATCGTTGG (SEQIDNO:18) (SEQIDNO:19) Pu.1 Mouse ATGTTACAGGCGTGCAAAATG TGATCGCTATGGCTTTCTCCA G(SEQIDNO:20) (SEQIDNO:21) Tcf7 Mouse AGCTTTCTCCACTCTACGAAC AATCCAGAGAGATCGGGGGTC A(SEQIDNO:22) (SEQIDNO:23 ?-actin Human CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT (SEQIDNO:24) (SEQIDNO:25) Bcl11b Human TCCAGCTACATTTGCACAACA GCTCCAGGTAGATGCGGAAG (SEQIDNO:26) (SEQIDNO:27) Deltex Human ATCGGAGAAGGCTCTACAGG CGTCTGGCCTCCTTTCTAACT (SEQIDNO:28) (SEQIDNO:29) E2a Human CCGACTCCTACAGTGGGCTA CGCTGACGTGTTCTCCTCG (SEQIDNO:30) (SEQIDNO:31) Gata3 Human GTTGGCCTAAGGTGGTTGTG ACAGGCTGCAGGAATAGGGA (SEQIDNO:32) (SEQIDNO:33) Hes1 Human CCTGTCATCCCCGTCTACAC CACATGGAGTCCGCCGTAA (SEQIDNO:34) (SEQIDNO:35) Notch1 Human GAGGCGTGGCAGACTATGC CTTGTACTCCGTCAGCGTGA (SEQIDNO:36) (SEQIDNO:37) Pu.1 Human TGCAATGTCAAGGGAGGGGG AAACCCTTCCATTTTGCACGC (SEQIDNO:38) (SEQIDNO:39) Tcf7 Human TGCACATGCAGCTATACCCAG TGGTGGATTCTTGGTGCTTTT (SEQIDNO:40) C(SEQIDNO:41)
[0170] Mice.
[0171] hSIRP?.sup.tg RAG2.sup.?/? ?c.sup.?/? (SRG) mice were purchased from The Jackson Laboratory (Bar Harbor, Me.) and housed and bred in a pathogen-free facility. All animal procedures were approved by the Sunnybrook Health Sciences Centre Animal Care Committee.
[0172] Fed-Batch Bioreactor Expansion Culture of Human CD34+ HSPCs
[0173] Umbilical cord blood samples were collected from consenting donors according to ethically approved procedures at Mt. Sinai Hospital (Toronto, ON, Canada). Cells were red blood cell (RBC) depleted as previously described.sup.10, using HetaSep (StemCell Technologies). CD34+ progenitor cells were selected with the EasySep system using a human CD34+ enrichment kit (StemCell Technologies), according to the manufacturer's protocol. Freshly isolated CD34+ cells were seeded at a density of 1?10.sup.5 total cells/mL. Cells were seeded in StemSpan-ACF medium (StemCell Technologies), supplemented with 100 ng/mL Stem Cell Factor (SCF, R&D Systems or CellGenix), 100 ng/mL FMS-like Trysine Kinase 3 Ligand (Flt3L, R&D Systems or CellGenix), 50 ng/mL Thrombopoietin (TPO, R&D Systems or CellGenix), 2 mM GlutaMAX (GIBCO) and/or 500 nM UM729 small molecule. Cells were cultured for 12 days with minimal manual manipulation during the culture period, as previously described.sup.11.
[0174] Cells were harvested from either fed-batch or fed-batch+UM729 at day 12 and sorted for CD34+ and CD34? populations. Sorted CD34+ and CD34? cells from both culture methods were seeded along with thawed unexpanded day 0 CD34+ HSPCs at 4000 cells/96-well coated overnight with 20 ?g/mL DL4 and 2.3 ?g/mL VCAM-1 in serum-free IMDM+BIT medium containing 100 ng/mL SCF, Tpo, Flt3L and IL-7. Cultures were fed once 7 days later and harvested 14 days later for FACS analysis of lymphoid and myeloid lineage cell surface markers.
[0175] Engraftment of Human Progenitor T-Cells into Immunodeficient Mice.
[0176] Human CD34.sup.+ HSPCs were cultured for 14 days in an engineered thymic niche. CD7.sup.+ progenitor T-cells were sorted, resuspended in a mixture of PBS containing recombinant human interleukin 7 (rhIL-7; 0.5 ?g) with an IL-7 antibody M25 (2.5 ?g), and injected intrahepatically into 2-5 day old SRG neonatal mice. Each mouse received 4?10.sup.5 CD7.sup.+ progenitor T-cells in a 30 ?l total volume. As controls, mice were injected with CD7.sup.+ cells from a day 14 HSPC/OP9DL4 co-culture, as previously described.sup.2. Mice were boosted intraperitoneally with an IL-7/M25 mixture every 4 days. Thymus, spleen, and peripheral blood were harvested at 4-12 weeks after intrahepatic transplant and cells were analyzed with CD3, CD1a, CD7, CD5, CD4, CD8 and CD45 anti-human antibodies. For intracellular cytokine staining, splenocytes were harvested from SRG mice 10-12 weeks after intrahepatic injection of OP9-DL4 or DL4-VCAM-derived CD7+ cells. Cells were seeded at a density of 1?10.sup.5 cells/well in OP9-media, and were incubated for 6 hours with 50 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma Aldrich), 500 ng/mL ionomycin (Sigma Aldrich) and 3 ?g/mL Brefeldin A (eBioscience). Cells were washed with PBS post-stimulation and stained for intracellular cytokine staining as described above.
[0177] Generation of Human Pluripotent Stem Cell (hPSC)-Derived Hemogenic Endothelium.
[0178] Aggrewells? (24 well, StemCell Technologies) were manufactured in-house using 400 ?m polydimethylsiloxane inserts cast from a silicone master mold and sterilized as previously described (Ungrin et al., 2008). For hemogenic endothelium differentiation, hPSCs on MEFs were dissociated with 5 minute TrypLE? Express treatment and plated onto Geltrex? (diluted 1:50) or Matrigel? (diluted 1:30) coated 6-well plates at a split ratio of 1:3 for 48 hours of MEF depletion. The MEF-depleted hPSCs were treated with TrypLE? Express followed by scraping and mechanical dissociation. Single cell suspensions were transferred to Aggrewell? plates in hemogenic endothelium inducing medium supplemented with ROCK inhibitor Y-27632 (RI) (1:1000, Sigma Aldrich), and the plates were then centrifuged at 1500 rpm for 5 minutes to form cell aggregates in individual microwells. Hemogenic endothelium-inducing media comprised of BMP4 (40 ng/ml, R&D), VEGF (50 ng/ml, R&D), SCF (40 ng/ml, R&D), and bFGF (5 ng/ml, Peprotech). Base media comprised of StemPro?-34 (Invitrogen), ascorbic acid (50 ?g/ml; Sigma), L-glutamine (1% v/v, Invitrogen), penicillin/streptomycin (1% v/v), 1-monothioglycerol (4?10.sup.?4 M; Sigma), and transferrin (150 ?g/ml; Roche).
[0179] At day 6 of culture, cells were harvested and dissociated using TrypLE? Express. CD34+ cells were enriched using an EasySep? Human CD34 Positive Selection Kit (Stem Cell Technologies). Cells were characterized for CD34+ expression post-selection and seeded on DL4-Fc and VCAM-Fc coated plates for two weeks in serum-free IMDM base medium (Gibco, Rockville, Md.) containing BIT 9500 Serum Substitute (20% v/v, Stem Cell Technologies), penicillin/streptomycin (1% v/v), GlutaMAX? (1% v/v, Gibco), low-density lipoproteins (1 ?g/mL, Calbiochem, La Jolla, Calif.) and 100 ng/mL each of SCF, Flt3L, Tpo and IL-7 (R&D). Cells were re-fed once at day 7 of culture and harvested for analysis via flow cytometry at the end of 14 days for progenitor T cell surface markers.
[0180] Scaled Progenitor T Cell Differentiation
[0181] Umbilical-cord blood derived CD34+ cells were differentiated in OP9DL4 stromal co-cultures and compared with defined serum-free differentiation cultures in 96-well plates or 6-well plates coated with DL4+VCAM-1. Half of a 96-well plate (15.4 cm.sup.2) was compared with two wells in a 6-well plate (19.0 cm.sup.2) or 12 cm?2 cm clipped surface area in an adherent culture bioreactor bag (24 cm.sup.2). Frequencies of CD7+, CD7+CD34+, CD7+CD34? and CD7+CD5+ progenitor T-cells were analyzed after 14 days.
Example 2: Identification of a Defined, Serum-Free Medium for Efficient T-Cell Differentiation
[0182] Progenitor T cell development in the thymus is characterized by four sequential stages commonly referred to as DN1, DN2, DN3 and DP (DN=double negative and DP=double positive for CD4 and CD8 expression). An ideal defined progenitor T cell differentiation assay should aim to support the expansion of DN3 T cells that are exclusively committed to the T lymphoid lineage. Additionally, CD90 must be upregulated on DN2 and DN3 T cells and co-expressed with CD25 to confirm their progenitor T cell identity. Conventional in vitro T cell differentiation is carried out on an OP9 stromal feeder layer in serum-containing medium. The obvious first step in developing a defined assay for T cell differentiation is to establish conditions that eliminate the requirements for both serum and feeders. To replace the OP9 feeder layer, DL4-Fc protein was generated and the purity and functionality of the ligand to bind DN T cells and not DP T cells was verified, as these cell types differentially express the Notch-1 receptor (
[0183] Next, each medium was evaluated for progenitor T cell differentiation potential by quantifying the frequency of each DN subset and its contribution to the live cell yield. Of the serum-free medium candidates, IMDM+BIT medium retained the lowest frequencies of DN1 cells after 7 days of differentiation, comparable to the OP9 stromal medium control (
Example 3: Optimization of Key Assay Design Criteria to Engineer the Thymic Niche
[0184] The next step in assay development was to evaluate the effects of varying key culture parameters on in vitro T cell development. Seeding density, DL4 ligand concentration and presentation, and medium utilization were optimized in order to build a strategy to increase the robustness, reproducibility and yield of T cell production in the system.
[0185] First, the cell seeding density of sorted sca1+ckit+ HSPCs was modulated on 10 ?g/mL adsorbed DL4 ligand in serum-free IMDM+BIT medium. At cell densities below 1000 cells/well (3125 cells/cm.sup.2), high variability in the total cell expansion was observed (
[0186] Next, the concentration of adsorbed DL4 ligand in the assay was varied to determine the minimum concentration of Notch ligand needed for robust T cell differentiation. 7.5 ?g/mL DL4 was the minimum concentration that supported the generation of T lineage-committed DN3 cells at levels equivalent to the standard 10 ?g/mL DL4 condition after 7 days of culture (
[0187] It has been previously shown that the soluble form of DL1 is inhibitory to Notch function in C2C12 myoblasts.sup.8. Therefore, the possible inhibitory effect of soluble DL4 on T cell development was investigated. Accordingly, the frequency of each DN subset, as well as myeloid and B lymphoid cells, was measured after 7 days of culture on adsorbed DL4, in soluble DL4 or in a mixture of adsorbed and soluble DL4. Not only was soluble DL4 ligand insufficient to support T cell development to the DN2 and DN3 subsets, but in fact the presence of soluble DL4 ligand completely inhibited the inductive effects of adsorbed DL4 ligand (
[0188] Next, the possibility of eliminating the day 4 medium exchange was studied in order to improve reproducibility by reducing user manipulation and medium costs while maintaining or enhancing progenitor T cell yield (
Example 4: Cellular Matrix VCAM-1 Enhances DN3 Yield in the Defined T Cell Differentiation Assay
[0189] As the next step in engineering our thymic niche, the incorporation of the extracellular matrix protein fibronectin or the thymic epithelial cell-presented matrix protein VCAM-1 was examined to determine whether DN3 yields in the defined T cell differentiation assay could be improved. Both proteins have been shown to play pleiotropic roles in progenitor T cell proliferation, survival, homing and specification.sup.16,17. As fibronectin and VCAM-1 are ligands for ?4 and ?5 integrins when paired with ?1 or ?7 integrins.sup.17, the expression of these integrin receptors on the sorted sca1+ckit+ HSPC compartment was first confirmed. Indeed, ?4?1 and ?5?1 were expressed at very high levels while ?4?7 was expressed at low levels in HSPCs (
[0190] Next, the effect of increasing immobilized concentrations of VCAM-1 was studied in the defined T cell differentiation assay. VCAM-1 significantly decreased the DN1 frequency while increasing CD25+CD90+ frequency in a dose-dependent manner (
[0191] Next, the effect of VCAM-1 on the motility of DN T cells using live cell imaging was investigated, as it has been implicated as a stromal matrix for thymic migration in vivo.sup.22. The random migration patterns of single cells from day 5 to day 7 were manually tracked in the defined T cell differentiation assay and DN1, DN2 and DN3 phenotypes were discriminated using surface marker staining for CD25 and CD44 (data not shown). VCAM-1 was found to significantly increase the velocity of all three DN1-3 subtypes compared to the velocity of these subtypes cultured on DL4 alone (
Example 5: Human CD34+ HSPCs can Generate Progenitor T Cells in the Engineered Thymic Niche
[0192] The development of a defined T cell differentiation assay described to this point represents an engineered thymic niche that has been optimized to differentiate mouse HSPCs to DN3 committed T cells. The translation of the engineered thymic niche to the human system was confirmed by differentiating human umbilical cord blood-derived CD34+ HSPCs to progenitor T cells. The desired human equivalent of T lineage-committed murine DN3 T cells is CD7+CD5+CD45RA+co-expressing progenitor T cells that have been shown to engraft thymi of immunodeficient mice more rapidly than CD34+ HSPCs.sup.1. To date, only stromal co-culture systems or serum-based undefined medium have been used to produce progenitor T cells from CD34+ cells.sup.23,24. Prior to initiation of each culture, we verified the purity of the input HSPCs to be greater than 95% CD34+(
[0193] DL4 and VCAM-1 synergistically enhanced Notch target gene expression compared to DL4 alone (
[0194] Next, a comparison of our engineered thymic niche with the gold standard OP9DL4 stromal co-culture assay was performed. OP9DL4 was found to enable similar total live cell expansion to the engineered thymic niche (
Example 6: Cultured CD34+ Cells can Generate Progenitor T Cells in the Engineered Thymic Niche
[0195] Once it was established that human umbilical cord blood-derived CD34+ cells (or day 0 CD34+ cells) could generate functional progenitor T cells in the engineered thymic niche, the culture of CD34+ cells was tested to determine if these cells had T lymphoid potential that was equivalent to their day 0 CD34+ cell counterparts. Growing CD34+ cells in fed-batch bioreactor is one way of culturing CD34+ cells. Specifically, it has been previously demonstrated that fed-batch bioreactor technology can be used to yield a rapid (12-day) 11-fold increase of CD34+ HSPCs with self-renewing, multi-lineage repopulating ability. The generation of progenitor T cells from sorted day 12 CD34+ cells derived from fed-batch (FB) or fed-batch with UM-729 small molecule supplementation (FB+UM) as compared to their starting input population of day 0 CD34+ cells was tested (
[0196] Sorted CD34+ cells from FB culture generated the maximum frequency of CD7+ proT cells and CD7+CD56+NK cells after 14 days in the engineered thymic niche as compared to day 0 CD34+ cells and day 12 FB+UM-derived CD34+ cells (
[0197] Next, the yield of CD7+ proT cells generated from CD34+ cells was quantified. Day 12 FB generated the highest yield of CD7+ cells per input CD34+ cell in the engineered thymic niche while day 0 CD34+ and day 12 FB+UM generated equivalent CD7+ yield per input CD34+ in the proT assay (
Example 7: Pluripotent Stem Cell (PSC)-Derived CD34+ Cells Generate CD7+ Cells in the Engineered Thymic Niche
[0198] PSCs were differentiated for 6 days in a serum-free, defined aggregate size-based mesoderm differentiation protocol to generate CD34+ hemogenic endothelial cells that co-express CD43 and CD73 (
Example 9: Scalable Progenitor T Cell Differentiation
[0199] Umbilical cord blood derived CD34+ cells were differentiated in parallel either in OP9DL4 stromal co-cultures compared with serum-free differentiation cultures in 96-well plates, 6-well plates, or adherent culture bioreactor bags coated with DL4+VCAM-1. The DL4+VCAM-1 coated surface area compared was kept roughly equivalent; half of a 96-well plate (15.4 cm.sup.2) was compared with two wells in 6-well plate (19 cm.sup.2) and 12 cm?2 cm bioreactor bag (24 cm.sup.2). Total cell expansion after 14 days was found to be similar for all test conditions and ?25-fold expansion was observed from either 96-well, 6-well or bioreactor DL4+VCAM-1 coated format (
[0200] Although the disclosure has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art. Any examples provided herein are included solely for the purpose of illustrating the disclosure and are not intended to limit the disclosure in any way. Any drawings provided herein are solely for the purpose of illustrating various aspects of the disclosure and are not intended to be drawn to scale or to limit the disclosure in any way. The scope of the claims appended hereto should not be limited by the preferred embodiments set forth in the above description, but should be given the broadest interpretation consistent with the present specification as a whole. The disclosures of all prior art recited herein are incorporated herein by reference in their entirety.
DOCUMENTS CITED
[0201] 1. Awong G, Herer E, Surh C D, Dick J E, La Motte-Mohs R N, Z??iga-Pfl?cker J C. Characterization in vitro and engraftment potential in vivo of human progenitor T cells generated from hematopoietic stem cells. Blood. 2009; 114(5):972-982. doi:10.1182/blood-2008-10-187013. [0202] 2. La Motte-Mohs R N, Herer E, Z??iga-Pfl?cker J C. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood. 2005; 105(4):1431-1439. doi: 10.1182/blood-2004-04-1293. [0203] 3. Ikawa T, Hirose S, Masuda K, et al. An essential developmental checkpoint for production of the T cell lineage. Science. 2010; 329(5987):93-96. doi:10.1126/science. 1188995. [0204] 4. Taqvi S, Dixit L, Roy K. Biomaterial-based notch signaling for the differentiation of hematopoietic stem cells into T cells. J Biomed Mater ResPart A. 2006; 79(3):689-697. doi:10.1002/jbm.a.30916. [0205] 5. Roccio M, Gobaa S, Lutolf M P. High-throughput clonal analysis of neural stem cells in microarrayed artificial niches. Integr Biol. 2012; 4(4):391. doi:10.1039/c2ib00070a. [0206] 6. Mohtashami M, Shah D K, Nakase H, Kianizad K, Petrie H T, Z??iga-Pfl?cker J C. Direct comparison of DII1- and DII4-mediated Notch activation levels shows differential lymphomyeloid lineage commitment outcomes. J Immunol. 2010; 185(2):867-876. doi:l 0.4049/jimmunol.1000782. [0207] 7. Milne C D, Zhang Y, Paige C J. Stromal Cells Attract B-Cell Progenitors to Promote B-Cell-B-Cell Contact and Maturation. Scand J Immunol. 2005; 62(sl):67-72. doi:10.1111/j.1365-3083.2005.01612.x. [0208] 8. Varnum-Finney B, Wu L, Yu M, et al. Immobilization of Notch ligand, Delta-1, is required for induction of notch signaling. J Cell Sci. 2000; 113 Pt 23:4313-4318. [0209] 9. Holmes R, Z??iga-Pfl?cker J C. The OP9-DL1 system: Generation of T-lymphocytes from embryonic or hematopoietic stem cells in vitro. Cold Spring Harb Protoc. 2009; 4(2):1-13. doi:10.1101/pdb.prot5156. [0210] 10. Kirouac D C, Madlambayan G J, Yu M, Sykes E A, Ito C, Zandstra P W. Cell-cell interaction networks regulate blood stem and progenitor cell fate. Mol Syst Biol. 2009; 5:293. doi: 10.1038/msb.2009.49. [0211] 11. Csaszar E, Gavigan G, Ungrin M, et al. An automated system for delivery of an unstable transcription factor to hematopoietic stem cell cultures. Biotechnol Bioeng. 2009; 103(2):402-412. doi: 10.1002/bit.22297. [0212] 12. Csaszar E, Kirouac D C, Yu M, et al. Rapid expansion of human hematopoietic stem cells by automated control of inhibitory feedback signaling. Cell Stem Cell. 2012; 10(2):218-229. doi:10.1016/j.stem.2012.01.003. [0213] 13. Purpura K A, Bratt-Ieal A M, Hammersmith K A, Mcdevitt T C, Zandstra P W. Biomaterials Systematic engineering of 3D pluripotent stem cell niches to guide blood development. Biomaterials. 2011:1-10. doi:10.1016/j.biomaterials.2011.10.051. [0214] 14. Besseyrias V, Fiorini E, Strobl L J, et al. Hierarchy of Notch-Delta interactions promoting T cell lineage commitment and maturation. J Exp Med. 2007; 204(2):331-343. doi:10.1084/jem.20061442. [0215] 15. Andrawes M B, Xu X, Liu H, et al. Intrinsic Selectivity of Notch 1 for Delta-like 4 Over Delta-like 1. J Biol Chem. 2013; 288(35):25477-25489. doi: 10.1074/jbc.M113.454850. [0216] 16. Salomon D, Crisa L, Mojcik C, Ishii J, Klier G, Shevach E. Vascular cell adhesion molecule-1 is expressed by cortical thymic epithelial cells and mediates thymocyte adhesion. Implications for the function of alpha4beta1 (VLA4) integrin in T-cell development. Blood. 1997; 89(7):2461-2471. [0217] 17. Prockop S E, Palencia S, Ryan C M, Gordon K, Gray D, Petrie H T. Stromal cells provide the matrix for migration of early lymphoid progenitors through the thymic cortex. J Immunol. 2002; 169:4354-4361. doi: 10.4049/jimmunol. 169.8.4354. [0218] 18. Calder?n L, Boehm T. Synergistic, context-dependent, and hierarchical functions of epithelial components in thymic microenvironments. Cell. 2012; 149(1):159-172. doi:10.1016/j.cell.2012.01.049. [0219] 19. Csaszar E, Wang W, Usenko T, et al. Blood stem cell fate regulation by Delta-1-mediated rewiring of IL-6 paracrine signaling. Blood. 2014; 123(5):650-658. doi: 10.1182/blood-2013-08-520445. [0220] 20. Hong C, Luckey M A, Park J H. Intrathymic IL-7: The where, when, and why of IL-7 signaling during T cell development. Semin Immunol. 2012; 24(3):151-158. doi:10.1016/j.smim.2012.02.002. [0221] 21. Frasca D, Pioli C, Guidi F, et al. IL-11 synergizes with IL-3 in promoting the recovery of the immune system after irradiation. Int Immunol. 1996; 8(11):1651-1657. doi:10.1093/intimm/8.11.1651. [0222] 22. Petrie H T, Z??iga-Pfl?cker J C. Zoned out: functional mapping of stromal signaling microenvironments in the thymus. Annu Rev Immunol. 2007; 25:649-679. doi:10.1146/annurev.immunol.23.021704.115715. [0223] 23. Reimann C, Six E, Dal-Cortivo L, et al. Human T-lymphoid progenitors generated in a feeder-cell-free Delta-like-4 culture system promote T-cell reconstitution in NOD/SCID/?c(?/?) mice. Stem Cells. 2012; 30(8):1771-1780. doi:10.1002/stem.1145. [0224] 24. Awong G, Singh J, Mohtashami M, et al. Human proT-cells generated in vitro facilitate hematopoietic stem cell-derived T-lymphopoiesis in vivo and restore thymic architecture. Blood. 2013; 122(26):4210-4219. doi:10.1182/blood-2012-12-472803.