Monoclonal Antibodies That Specifically Recognize Canine DLA-DR Antigen and Their Uses

Abstract

Disclosed are monoclonal antibodies and their fragments that specifically recognize canine DLA-DR antigen and their use in the treatment, prevention, or diagnosis of leukemias and lymphomas, especially canine.

Claims

1. A polypeptide that is a heavy chain variable region of an antibody specifically interacting with canine lymphoma and leukemia cells, comprising CDR region having a sequence selected from SEQ ID Nos. 1-6.

2. A polypeptide that is a light chain variable region of an antibody specifically interacting with canine lymphoma and leukemia cells, comprising CDR region having a sequence selected from SEQ ID Nos. 9-14.

3. An antibody specifically interacting with canine lymphoma and leukemia cells, the antibody comprising: A) an antibody heavy chain comprising CDR regions designated as SEQ ID Nos. 1-3, and an antibody light chain comprising CDR regions designated as SEQ ID Nos. 9-11 or B) an antibody heavy chain comprising CDR regions designated as SEQ ID Nos. 4-6, and an antibody light chain comprising CDR regions designated as SEQ ID Nos. 12-14.

4. The antibody of claim 3, wherein the antibody is a chimeric murine-canine antibody comprising: an antibody heavy chain comprising a heavy chain constant region derived from a canine immunoglobulin, and an antibody light chain comprising a light chain constant region derived from a canine immunoglobulin.

5. The antibody of claim 3, wherein the antibody is produced by a hybridoma selected from cell lines deposited in DSM under access numbers DSM ACC3287 and DSM ACC3288.

6. (canceled)

7. (canceled)

8. Hybridoma selected from cell lines deposited in DSM under access numbers DSM ACC3287 and DSM ACC3288.

9. The polypeptide of claim 1, comprising CDR regions designated as SEQ ID Nos. 1-3 or comprising CDR regions designated as SEQ ID Nos. 4-6.

10. The polypeptide of claim 1, comprising the amino acid sequence designated as SEQ ID No. 7 or 8.

11. The polypeptide of claim 2, comprising CDR regions designated as SEQ ID Nos. 9-11 or comprising CDR regions designated as SEQ ID Nos. 12-14.

12. The polypeptide of claim 2, comprising the amino acid sequence designated as SEQ ID No. 15 or 16.

13. The polypeptide of claim 3, comprising a heavy chain variable region having the amino acid sequence designated as SEQ ID No. 7.

14. The polypeptide of claim 3, comprising a light chain variable region having the amino acid sequence designated as SEQ ID No. 15.

15. The polypeptide of claim 3, comprising a heavy chain variable region having the amino acid sequence designated as SEQ ID No. 8.

16. The polypeptide of claim 3, comprising light chain variable region having an amino acid sequence designated as SEQ ID No. 16.

17. A method for treating or preventing leukemia or lymphoma, the method comprising administering to a canine subject the antibody of claim 3.

18. A method for diagnosing leukemia or lymphoma in a canine subject, the method comprising detecting whether DLA-DR antigens are present in a sample from the subject by contacting the sample with the antibody of claim 3, and diagnosing the subject with leukemia or lymphoma when the presence of DLA-DR is detected.

Description

EXAMPLE 1

Hybridoma Generation and DNA Sequencing of Genes Encoding Light and Heavy Chain Variable Regions of the Secreted Antibodies, Specifically Interacting with Canine B-Cell Lymphoma Cells

[0040] A standard, commonly described procedure of mice immunization and splenocyte fusion was used to generate monoclonal antibody-producing hybridomas. Briefly, 610.sup.6 cells of canine B-cell lymphoma (CLB70) were suspended in 300 microliters of saline and emulsified in 300 microliters of incomplete Freund's adjuvant. Such prepared antigen was administered in three intraperitoneal injections of 200 microliters/injection to CD-1 mice at two-week intervals. Four days after the last injection, splenocytes of the immunized mice were fused in the presence of polyethylene glycol (PEG 1500) with myeloma SP2.0 line and cultured in the presence of selection medium containing hypoxanthine, aminopterin and thymidine at 37 C. in atmosphere containing 5% CO.sub.2. Supernatants from hybridoma culture (500 clones) were screened for reactivity with CLB70 cells using flow cytometry.

[0041] In the pool of the analyzed hybridomas, unexpectedly, two lines were identified that produced monoclonal antibodies with very high affinity to canine B-cell lymphomas (CLB70). These antibodies were named B5 and E11, and hybridomas producing themIITD PAN B5 and IITD PAN E11, respectively. These hybridomas were deposited in accordance with the Budapest Treaty in the DSMZ (German Collection of Microorganisms and Cell Cultures) under the following access numbers: DSM ACC3287 (line IITD PAN B5) and DSM ACC3288 (line IITD PAN E11).

[0042] mRNAs were isolated from selected hybridomas producing the antibodies of interest, which, following transcription into cDNA using standard methods of molecular biology, were amplified with oligonucleotide primers of sequences complementary to the regions:

TABLE-US-00001 V.sub.k (5-CCAGTTCCGAGCTCGTGCTCACCCAGTATACA) and V.sub.H (5-AGGTCCAGCTGCTCGAGTCTGG) and C.sub.H 5-GCGTCTAGAAYCTCCACACACAGGRRCCAGTGGATAGAC and C.sub.k 5-GCGTCTAGAACTGGATGGTGGGAAGATGG
of murine immunoglobulin. The obtained cDNA fragments were cloned and sequenced using Sanger method. FIGS. 1 and 2 show DNA sequences encoding the heavy chain VH and light chain Vk variable regions of B5 and E11 immunoglobulin. Kabat nomenclature was used in the positioning of amino acids corresponding to variable regions of immunoglobulins. Hypervariable regions in the amino acid sequence are given in bold type and CDR-1, -2, -3 were described accordingly.

EXAMPLE 2

Reactivity Analysis of B5 and E11 Antibodies with Surface Antigens Present on Selected Canine and Human Cell Lines by Flow Cytofluorimetry

[0043] Biotinylated B5 and E11 antibodies or biotinylated mouse anti-DNP control antibody in amount of 1.5 micrograms per 100 microliters of buffered saline (PBS) supplemented with 2% fetal bovine serum (FBS) were incubated with suspensions of 10.sup.5 cells indicated in FIG. 3 on ice for 30 minutes. After washing of unbound antibodies with PBS+2% FBS, the cells were incubated in 100 microliters per sample with a fluorescent conjugate of streptavidin with phycoerythrin (Streptavidin PE, eBioscience) diluted 1:1000. Cytofluorimetry was performed using BD Calibur device. Results are shown as histograms (gray fill) referring to fluorescence of cells stained with control antibody (no fill). These analyzes have shown that antigens recognized by B5 and E11 antibodies are present on the surface of the canine (CLBL1 and CLB70) and human (Raji) lines of B-cell lymphomas, which have, documented in other publications, expression of MHC II haplotype DRB antigens; however, the antigens are absent on canine (GL-1) and human (Jurkat) T-cell lines and canine mastocytoma line (NL-1). Canine GL-1 line with B and T lymphocyte markers, but lacking MHC class II antigens, interacts poorly with B5 antibody and does not interact with E11 at all.

EXAMPLE 3

Reactivity Analysis of B5 and E11 Antibodies with Blood Samples and Dog Lymph Node Biopsies

[0044] The obtained suspensions of mononuclear cells from peripheral blood (PBMCs) (Table 1) or from lymph node biopsies (Table 2) of dogs with diagnosed lymphomas or enlarged as a result of confirmed Borrelia burgdorferi infection were stained as in Example 2 and subjected to FACS cytofluorimetry. Percentage of PBMCs with B5 and E11 mAb reactivity was the highest for B-cell lymphoma cases and was three out of three analyzed for B5 mAb and two out of three for E1 mAb, respectively (Table 1). However, no reactivity of either antibody was reported for samples from healthy dogs, dogs infected with Borrelia burgdorferi or diagnosed with T-cell lymphomas. Percentage of lymph node cells with specific fluorescence, above the isotype control fluorescence (>15% positive cells), are summarized in Table 2, separately for each dog. For 13 patients with confirmed B-cell lymphomas, 11 (84.6%) and 12 (92.3%) showed reactivity with B5 and E11 antibodies, respectively. Among dogs with T-cell lymphomas these values were respectively 1 in 5 with B5 mAb (20%) and 0 in 5 with E11 mAb. For 5 analyzed lymphomas of mixed B/T-cell phenotype, 5 (100%) were positive for B5 mAb and 4 (80%) for E11 inAb. Table 3 evaluates the expression level of antigens recognized by B5 and E11 mAbs. It was demonstrated that the highest mean fluorescence intensity (MFI) of 539 and 294 was shown by mixed B/T-cell and B-cell lymphomas stained with B5 antibody, respectively. For E11 antibody, these values were respectively 308 and 162. The MFI for T-cell lymphomas was 23 and 15 for B5 and E11 antibodies, respectively. The MFI values for PBMCs from healthy dogs or patients with Lyme disease did not exceed 10.5.

EXAMPLE 4

Identification of Antigens Recognized by B5 and E11 Antibodies

[0045] Based on the sequencing of immunoprecipitated proteins from CLBL1 line lysates by mass spectrometry, histocompatibility class II antigen dimers, DLA-DRs, were provisionally pre-selected as specifically bound by B5 and E11 antibodies. In order to confirm this identification, human fetal carcinoma line (HEK293) was transfected with gene constructs encoding canine DLA-DR and DLA-DR histocompatibility antigen chains in pcDNA3 expression vector or control empty expression vector. Briefly, 3 g of purified plasmid DNA were incubated with Metafecten Pro reagent (Biontex) according to the manufacturer's protocol and then DNA/Metafecten Pro mixture was introduced into 210.sup.5 HEK293 cells cultured on a 12-well plate in 1 ml of OptiMEM medium (Life Technologies). 24 hours after transfection, the cells were analyzed with FACS cytofluorimetry using B5 and E11 antibodies as described in Example 2. FIG. 4a shows an exemplary, representative FACS analysis of cells after transfection. Cells transfected with single control constructs (pcDNA3) or encoding either DLA-DR or DLA-DR chains did not stain with fluorescent conjugates of B5 and E11 antibodies, while staining was demonstrated for both antibodies in case of co-transfection of HEK293 cells with constructs coding for DLA-DR and DLA-DR chains. Using Western blotting technique on protein lysates from cells transfected with the gene constructs described above, that B5 and E11 antibodies have been shown to recognize the DLA-DR dimer with a molecular weight of 55 kD, but do not recognize single DLA-DR or DLA-DR chains (FIG. 4b). Furtheimore, reactivity of both antibodies in Western blotting with lysates from B-cell lymphoma lines (CLBL1 and CLB70) was demonstrated, but not with lysates from B-cell line (GL-1) lacking DLA-DR antigens, as well as with lysates from peripheral blood mononuclear cells PBMCs, FIG. 4b. Moreover, it has been established that the epitopes recognized by B5 and E11 antibodies are conformational, as the treatment of protein lysates with 6 M urea solution or boiling them at temperatures above 70 C. abolished the antibody-antigen interaction.

EXAMPLE 5

DLA-DR and s-DLA-DR ELISA on Cell Lysates and Body Fluids Based on the Use of B5 and E11 Antibodies.

[0046] ELISA plates (Maxisorp, Nunc) were coated with a solution of E11 antibody at 2 g/ml PBS at 4 C. for 12 hours. After blocking the plate with 1% solution of casein in TBS buffer (50 mM Tris-Cl, pH 7.5, 150 mM NaCl) with 0.05% Tween-20 detergent for 1 hour at 37 C., plates were incubated with test solutions (cell lysate, blood serum) for 1 hour at 37 C., then washed 3 times with TBS+0.05% Tween-20 and incubated with biotinylated B5 antibody (1.5 g/ml) for 1 hour at 37 C. After washing three times, as described above, plates were incubated with streptavidin-horseradish peroxidase conjugate (1:1000, eBioscience) for 1 hour at 37 C., followed by a colored reaction by adding TMB substrate. Table 4 shows that lysates from cells expressing DLA-DR histocompatibility antigens demonstrate approximately 40 times higher specific ELISA absorbance versus control cells, and that blood sera from dogs with lymphoma show on average twice higher specific absorbance in this assay in relation to the controls. FIG. 5 shows results of the ELISA test with lysates from lymph node biopsies from healthy dogs and patients with B-cell, T-cell and B/T lymphomas. More than 85% of the lysates from diseased dogs give a positive result.

EXAMPLE 6

Complement-Dependent Cytotoxicity Analysis for B5 and E11 Antibodies Against Canine Lymphoma CLEL1.

[0047] Canine CLBL-1 lymphoma cells (210.sup.5) were incubated with B5 or E11 antibodies at a concentration of 1 g/100 l for 1 hour on ice in RPMI medium without serum. After centrifugation of the cells (300g for 5 minutes) and antibody washing (5 ml of RPMI medium), the cells were suspended in 1 ml of RPMI medium supplemented with 50 l of non-toxic rabbit complement (Sigma). Cells with complement were incubated for 40 minutes in 37 C. water bath with periodic mixing of the sample every 10 minutes. After incubation, the cells were centrifuged (300g for 5 minutes), washed with PBS+2% FBS and the viability was assayed by incubation with propidium iodide (50 ng/ml) in a FACS cytofluorimetic assay. Dead and live cells were also counted in Burker's chamber using trypan blue staining. Table 5 shows that B5 and E11 antibodies, but not a murine control antibody of the same isotype as 135 and E11, exhibit a complement-dependent cytotoxic effect.

Example 7

Construction Method and Specificity Analysis of Murine-Canine Chimeric Antibody (cE11) Based on Sequences Using Variable Regions of Murine E11 Antibody

[0048] mRNA molecules encoding heavy and light chain variable regions were isolated from the E11 hybridoma using Trizol reagent (Thermofisher Scientific). Rapid reaction of mRNA transcription into cDNA was performed using MMLV reverse transcriptase enzyme using oligonucleotide primers complementary to 3 portions of heavy chain VH 5-GCGTCTAGAAYCTCCACACACAGGRRCCAGTGGATAGAC or light chain VL 5-GCGTCTAGAACTGGATGGTGGGAAGATGG variable regions of murine immunoglobulins. The resulting PCR products were cloned by TA method into pGEM T-easy vector (Promega) and sequenced.

[0049] Fragments of mRNA molecules encoding constant regions of canine immunoglobulins were obtained by mRNA isolation from dog peripheral blood leukocytes with Trizol reagent (Thermofisher Scientific), transcription into cDNA and amplification by PCR using the following oligonucleotide primers:

TABLE-US-00002 HeavychainconstantregionofcanineIg(cIgH) HCANISF 5-CTCAGCCTCCACCACG HCANISR 5-CAGGATCCTCATTTACCCGGAGAATGG LightchainconstantregionofcanineIg(cIgL) LCANISF 5-CTTGTTCCAACCATCTCCAG LCANISR 5-CACTTGCTAGCTTAGTCCACTCTCTGACACTCG

[0050] Using the PCR described below, murine and canine cDNA regions encoding immunoglobulin variable and constant chains were amplified. Murine and canine amplicons contained complementary regions which allowed to produce chimeric molecules in subsequent amplification cycles using the following oligonucleotide primers:

TABLE-US-00003 HeavychainvariableregionofmurineIg(mIgH) HE11F CTTCCGGAATGGGATGGAGCTGGATC HEIR CGTGGTGGAGGCTGAGGAGACGGTGACTGAGGTTC(thefragment complementarytoHCANISFprimerisgivenin italicfont) LightchainvariableregionofmurineIg(mIgL) LE11F GCCAGATCTATGAGTGTGCCCACTC LE11R CTGGAGATGGTTGGAACAAGGATACAGTTGGTGCAGC(thefrag- mentcomplementarytoLCANISFprimerisgivenin italicfont)

[0051] The PCR reaction using high-fidelity KapaTaq HiFi polymerase (Kapa Biosystems) was performed under the following temperature conditions:

[0052] 98 C. 3 min

[0053] 95 C. 20 sec.

[0054] 52 C. 15 sec.

[0055] 72 C. 20 sec.

[0056] 72 C. 1 minute

[0057] 10 C.

[0058] Amplified DNA fragments were cloned into pVitro neo vector (Invivogen) using BspEI and BamHJ restriction sites for the heavy chain and BglII and NheI for the light chain and taking advantage of the presence of suitable restriction sites in amplified cDNA fragments for murine-canine immunoglobulins.

[0059] The amino acid sequences of both chains of the resulting chimeric cE11 antibody (i.e., the caninized E11 antibody) and the nucleotide sequences encoding them are shown in FIG. 6. Moreover, the sequence listing shows the heavy chain constant region of canine immunoglobulin and the light chain constant region of canine immunoglobulin, which were used to obtain the chimeric cE11 antibody.

[0060] The generated constructs were transfected into cells of CHO line by lipofection with Lipofectamine 2000 (Life Technologies). After 48 hours, supernatants from the cultures were screened for antibodies interacting with canine lymphoma lines (FIG. 7).