RNA virus-derived plant expression system

Abstract

A process of expressing a sequence of interest in a plant, plant part, or plant cell culture, comprising: (a) providing a plant, plant part, or plant cell culture containing in cell nuclei a heterologous DNA having a sequence encoding an RNA replicon operably linked or linkable to a transcription promoter, wherein said sequence encoding an RNA replicon contains (i) sequences for replicon function of said RNA replicon, said sequences being derived from a sequence of a plant RNA virus, (ii) a sequence of interest, whereby said sequences for replicon function exhibit at selected localities of said sequences of said plant RNA virus function-conservative differences from said sequence of said plant RNA virus, said differences causing an increased frequency of replicon formation compared to an RNA replicon not exhibiting said differences; and (b) causing expression of said sequence of interest.

Claims

1. A process of expressing a sequence of interest in a plant, plant part, or plant cell culture, comprising: transforming a plant, plant part, or plant cell culture with a suspension of Agrobacteria, said Agrobacteria containing in T-DNA a heterologous DNA having a sequence encoding a replicon operably linked or linkable to a transcription promoter, wherein said sequence encoding a replicon contains (i) sequences that have a replicon function of a plant RNA viral replicon, and (ii) a sequence of interest, wherein said suspension of Agrobacteria has a concentration of cells of said Agrobacteria corresponding to a calculated optical density at 600 nm of at most 0.004, wherein said calculated optical density is defined by an at least 250-fold dilution of a suspension of said Agrobacteria of an OD at 600 nm of 1.0.

2. The process of claim 1, wherein said suspension of Agrobacteria has a concentration of cells of said Agrobacteria corresponding to a calculated optical density at 600 nm of at most 0.001, wherein said calculated optical density is defined by an at least 1000-fold dilution of a suspension of said Agrobacteria of an OD at 600 nm of 1.0.

3. The process of claim 1, which is a process of transiently expressing said sequence of interest and comprises transient transformation of said plant, plant part, or plant cell culture with a nucleic acid molecule containing said heterologous DNA.

4. The process of claim 1, wherein said transforming is done by infiltrating said plant or said plant part with said suspension of Agrobacteria.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 depicts the general principle of the invention, based on increased frequency of RNA virus-based replicon formation.

(2) FIGS. 2A and 2B show the intron prediction profile of transcribed region of vector pICH8543. Nucleotide numbers are given on the horizontal axis. The vertical axis shows the probability for corresponding sequence/sequence region to be a coding sequence (coding), to serve as donor site (Donor) or as acceptor site (Acceptor). Circled parts correspond to selected localities where said function conservative differences should be introduced.

(3) FIG. 3 shows the intron prediction profile of the first half of the transcribed region of vector pICH15466. The circled regions were modified (compare FIG. 2A) with function-conservative differences according to the invention.

(4) FIG. 4 shows the intron prediction profile of the second half of the transcribed region of pICH1590. The circled regions were modified (compare with FIG. 2B) with function-conservative differences according to the invention.

(5) FIGS. 5A and 5B show the intron prediction profile of the transcribed region of pICH15499. The circled regions correspond to six inserted plant nuclear introns.

(6) FIGS. 6A and 6B are schematic representations of the T-DNA regions of vectors with and without function-conservative differences according to the invention.

(7) FIGS. 7A, 7B, and 7C show GFP expression after agroinfiltration of viral constructs in Nicotiana benthamiana and Nicotiana tabacum leaves. The vector (pICH) identification number for each infiltrated area is indicated.

(8) FIG. 7ANicotiana benthamiana, 8 days after agroinfiltration;

(9) FIG. 7BNicotiana tabacum, 8 days after agroinfiltration;

(10) FIG. 7CNicotiana benthamiana protoplasts isolated 5 days after agroinfiltration. Many light spots in the right picture indicate an extremely high frequency of replicon formation and GFP expression.

(11) FIG. 8 is a schematic representation of an RNA virus-based replicon precursor designed according to the present invention, which gives zero expression level of the gene of interest (GFP, indicated by G) in the non-induced state.

(12) Ptranscription promoter; Ttranscription termination region; SMselectable marker gene; Ac2promoter of Arabidopsis ACTIN2 gene; RdRP viral RNA-dependent RNA polymerase; MPviral movement protein; NTRviral 3 non-translated region.

(13) FIG. 9 shows an intron prediction profile for Arabidopsis thaliana meiosis-specific gene AtDMC1 (GenBank Acc. No U76670), using the direct strand (+ strand). The intron-coding regions are circled.

(14) FIGS. 10A and 10B show the prediction of potential problematic regions (circled) within the direct strand (+ strand) of Potato Virus X (PVX) genome (GenBank Acc. No. AF172259). FIGS. 11A, 11B, and 11C show the prediction of potential problematic regions (circled) of the direct strand (+ strand) of alfalfa mosaic virus genomes of RNA1 (GenBank Acc. No K02703), RNA2 (GenBank Acc. No K02702) and RNA3 (GenBank Acc. No L00163), respectively.

(15) FIG. 12 depicts T-DNA regions of constructs pICH12691 and pICH16888.

(16) Ptranscription promoter; Ttranscription termination region; SMselectable marker gene; Ac2promoter of Arabidopsis ACTIN2 gene; RdRP viral RNA-dependent RNA polymerase; MPviral movement protein; NTRviral 3 non-translated region.

(17) FIG. 13 shows leaves under UV light of different stably transformed N. benthamiana lines carrying the T-DNA regions of either pICH12691 (left panel) or pICH16888 (right panel). The leaves were agro-infiltrated with vectors (pICH10881 or pICH14313) providing integrase.

(18) FIG. 14 shows leaves of Beta vulgaris one week after agro-infiltration with pICH18711 at day light (left) and UV (right) illumination. Light patches in the right photograph indicate GFP fluorescence. Introns (spotted boxes) in the construct shown at the bottom are numbered.

DETAILED DESCRIPTION OF THE INVENTION

(19) We have surprisingly found that the incorporation of plant introns into certain regions of plant viral RNA vectors and removal or replacement of cryptic introns within sequences for replicon function can dramatically increase (at least 10.sup.2 folds) the efficiency of the appearance of said RNA replicons in the cytoplasm of host plants. Such increase in efficiency was reflected in at least one easily measurable parameter: relative proportion of cells showing replication of said vector, e.g. in increased frequency of replicon formation. Such optimisation of initiation of RNA replicon formation led to the ability of synchronized switching on of expression of a sequence of interest in a whole plant, resulting in dramatically increased yield of recombinant protein of interest in shorter time than for a non-modified vector.

(20) Despite of publications concerning the increase of nuclear transgene expression by incorporation of introns in coding regions of recombinant DNA (Mascarenhas et al., 1990, Plant Mol. Biol., 15, 913-920; Bourdon et al., 2001, EMBO Reports, 2, 394-398; Rose, A B., 2002, RNA, 8, 1444-1453; U.S. Pat. No. 5,955,330), there is no hint in the prior art showing that incorporation of introns into viral RNA replicons would have any positive effect on the frequency of viral replicon formation and subsequently, on the level of expression of a sequence of interest provided by said replicon. This effect is surprising considering that nuclear mRNA transcription and viral RNA replication take place in different sub-cellular compartments. Even if the cDNA copy of a viral replicon is placed in the nucleus, only the first copy of the viral replicon precursor is produced in nucleus and then amplified in the cytoplasm under conditions different from those in the nucleus. In the prior art, the use of introns for preventing the cytotoxic effect of leaky expression of viral genes in E. coli during cloning with wild type virus cDNAs was described (Johansen, I. E. 1996, Proc. Natl. Acad. Sci. USA, 93, 12400-12405; Yang et al., 1998, Arch. Virol., 143, 2443-2451; Lopez-Moya & Garcia, 2000, Virus Res., 68, 99-107). There is no hint that intron inclusion can increase the frequency of replicon formation from a viral cDNA clone. The results obtained for wild type RNA viruses and their cDNA copies cannot be compared with virus-derived expression vectors designed for the expression of a heterologous sequence of interest in plants, predominantly at the expense of other properties of wild type viruses like high infectivity and stability of said viruses. Infectivity is not an issue in the present invention. Notably, infectivity is not an issue in a process of expressing a sequence of interest in a stably transformed plant. Infectivity of a viral DNA vector or its transcript is also not an issue when a plant is transformed with Agrobacteria containing the DNA vector in T-DNA.

(21) The present invention provides a method for increasing fundamentally the frequency of RNA virus-derived replicon formation, said replicons are derived upon transcription of DNA precursor and designed for the expression of sequences of interest. This method overcomes the limitations of existing viral vector-based expression systems, such as size limitation for heterologous sequences to be expressed and high instability of said vectors. Further, said method offers better biosafety characteristics, allows to design leakage-proof control over transgene expression (zero expression level in non-induced state), as such design can be an integrated part of the strategy for said RNA virus-derived replicon design. By providing high frequency of RNA virus-derived replicon formation, the approach described herein allows for a rapid initiation of the expression of a sequence of interest in a whole plant, part of plant or plant cell culture containing in cell nuclei a heterologous DNA encoding said RNA replicon. By practicing the invention, the performance of practically any plant RNA virus-derived replicon designed for the expression of a heterologous sequence of interest can be improved significantly through dramatic increase of the frequency of replicon formation.

(22) RNA viruses belonging to different taxonomic groups are suitable for constructing RNA replicons according to this invention. A list of RNA viruses to which this invention can be applied, is presented below. Taxa names in quotes (and not in italic script) indicate that this taxon does not have an ICTV international approved name. Species (vernacular) names are given in regular script. Viruses with no formal assignment to genus or family are indicated):

(23) RNA Viruses:

(24) ssRNA Viruses: Family: Bromoviridae, Genus: Alfamovirus, Type species: alfalfa mosaic virus, Genus: Ilarvirus, Type species: tobacco streak virus, Genus: Bromovirus, Type species: brome mosaic virus, Genus: Cucumovirus, Type species: cucumber mosaic virus;

(25) Family: Closteroviridae, Genus: Closterovirus, Type species: beet yellows virus, Genus: Crinivirus, Type species: Lettuce infectious yellows virus, Family: Comoviridae, Genus: Comovirus, Type species: cowpea mosaic virus, Genus: Fabavirus, Type species: broad bean wilt virus 1, Genus: Nepovirus, Type species: tobacco ringspot virus;

(26) Family: Potyviridae, Genus: Potyvirus, Type species: potato virus Y, Genus: Rymovirus, Type species: ryegrass mosaic virus, Genus: Bymovirus, Type species: barley yellow mosaic virus;

(27) Family: Sequiviridae, Genus: Sequivirus, Type species: parsnip yellow fleck virus, Genus: Waikavirus, Type species: rice tungro spherical virus; Family: Tombusviridae, Genus: Carmovirus, Type species: carnation mottle virus, Genus: Dianthovirus, Type species: carnation ringspot virus, Genus: Machiomovirus, Type species: maize chlorotic mottle virus, Genus: Necrovirus, Type species: tobacco necrosis virus, Genus: Tombusvirus, Type species: tomato bushy stunt virus, Unassigned Genera of ssRNA viruses, Genus: Capillovirus, Type species: apple stem grooving virus;

(28) Genus: Carlavirus, Type species: carnation latent virus; Genus: Enamovirus, Type species: pea enation mosaic virus,

(29) Genus: Furovirus, Type species: soil-borne wheat mosaic virus, Genus: Hordeivirus, Type species: barley stripe mosaic virus, Genus: Idaeovirus, Type species: raspberry bushy dwarf virus;

(30) Genus: Luteovirus, Type species: barley yellow dwarf virus; Genus: Marafivirus, Type species: maize rayado fino virus; Genus: Potexvirus, Type species: potato virus X; Genus: Sobemovirus, Type species: Southern bean mosaic virus, Genus: Tenuivirus, Type species: rice stripe virus,

(31) Genus: Tobamovirus, Type species: tobacco mosaic virus,

(32) Genus: Tobravirus, Type species: tobacco rattle virus,

(33) Genus: Trichovirus, Type species: apple chlorotic leaf spot virus; Genus: Tymovirus, Type species: turnip yellow mosaic virus; Genus: Umbravirus, Type species: carrot mottle virus; Negative ssRNA Viruses: Order: Mononegavirales, Family: Rhabdoviridae, Genus: Cytorhabdovirus, Type Species: lettuce necrotic yellows virus, Genus: Nucleorhabdovirus, Type species: potato yellow dwarf virus;

(34) Negative ssRNA Viruses: Family: Bunyaviridae, Genus: Tospovirus, Type species: tomato spotted wilt virus;

(35) dsRNA Viruses: Family: Partitiviridae, Genus: Aiphacryptovirus, Type species: white clover cryptic virus 1, Genus: Betacryptovirus, Type species: white clover cryptic virus 2, Family: Reoviridae, Genus: Fijivirus, Type species: Fiji disease virus, Genus: Phytoreovirus, Type species: wound tumor virus, Genus: Oryzavirus, Type species: rice ragged stunt virus;

(36) Unassigned Viruses:

(37) Genome: ssRNA, Species Garlic viruses A, B, C, D, Species grapevine fleck virus, Species maize white line mosaic virus, Species olive latent virus 2, Species: ourmia melon virus, Species Pelargonium zonate spot virus.

(38) The general principle of the invention is shown in FIG. 1. It is known that plant RNA viruses (an exception are viroidssmall non-coding RNAs amplifying in plant cell nucleifor a review see Diener, T. O., 1999, Arch. Virol. Suppl., 15, 203-220; Flores, R., 2001, CR Acad. Sci. III, 324, 943-952) never occur in the plant nucleus, but in the cytoplasm. Therefore, the sequences of RNA viruses might not be adapted to withstand nuclear RNA processing events due to the presence of motifs that might be involved in complex series of processing steps including transport of processed RNA in cytoplasm, in which pre-mRNAs, rRNA and tRNA precursors are involved. The processing events, such as 5 end capping, splicing, 3 end generation, polyadenylation, degradation, base and sugar modification as well as editing (in plastids and mitochondria) are intensively studied. However, many elements of such events still remain unclear. The most dramatic changes to pre-mRNA in the nucleus happen during pre-mRNA splicing, the process by which intervening RNA sequences (introns) are removed from the initial transcript and exons are concomitantly ligated. Splicing is mediated by the splicesome, a complex structure comprising uridilate-rich small nuclear ribonucleoprotein particles. The splicesome carries out the splicing reaction in two consecutive steps: the first onecleavage at the 5 splice site of upstream exon/intron junction leading to lariat formation, and second stepcleavage at the 3 splice site of intron/downstream exon junction followed by upstream and downstream exons ligation (for review see: Kramer, A., 1996, Annu. Rew. Biochem., 65, 367-409; Simpson, G G. & Filipowicz, W. 1996, Plant. Mol. Biol., 32, 1-41). The 5 and 3 splice site dinucleotides (5/GU; AG/3) flanking the intron sequences are highly conserved in higher plants and single G replacement might abandon the splicing activity at the site concerned. It is surprising that despite of a high conservation of splice sites between plants and animals, heterologous introns in plants are usually not spliced or spliced incorrectly (van Santen, V L. et al., 1987, Gene, 56, 253-265; Wiebauer, K., Herrero, J. J., Filipowicz, W. 1988, Mol. Cel. Biol., 8, 2042-2051). Considering that plant viral RNAs were not under evolutionary pressure to resist nuclear RNA processing machinery, these RNAs are very likely to become subject of such processing, including splicing, once they are placed into the nuclear environment. This situation is completely different from that of RNA transcripts encoded by nuclear genes, as the latter transcripts are evolutionary adapted to preserve their functionality, despite of series of RNA modifications taking place in the nucleus. However, such modifications can have dramatic consequences for viral RNA replicon formation. Re-engineering of the plant virus in order to make expression vectors for heterologous genes might further add to the instability of RNA virus-based replicons, as it would add further elements that might interact with RNA sequences of viral origin, producing defective RNA that is unable to replicate. Our invention addresses these problems by subjecting the expression vector to modifications that significantly increase the frequency of functional RNA replicon formation, when the expression vector is introduced as a DNA precursor into plants or plant cells to provide for transient expression or for stable integration into plant chromosomal DNA. We believe that modifications of virus-derived sequences shall be the most profound solution for increasing the efficiency of RNA virus-based replicons. In this invention we predominantly focus on modifications (said function-conservative differences) within the plant RNA virus derived sequences, as they are crucial for increasing the efficiency of RNA replicon formation.

(39) Surprisingly, our first attempt to find evidence that potentially problematic regions do exist, was successful and even more surprisingly, we obtained experimental confirmation by finding unexpectedly an improvement of orders of magnitude. An analysis of the sequence derived from the RNA virus of expression vector pICH8543 (EXAMPLE 1, FIG. 6A) using the NetgeneII server program (http://www.cbs.dtu.dk/services/NetGene2/) for the presence of cryptic introns and RNA splicing sites showed the presence of intron-like regions that might be spliced by the nuclear RNA processing machinery (see circled regions in FIG. 2). There are many other programs that can be used to identify potentially problematic regions (said selected localities) within plant viral RNA sequences, such as exon/intron prediction program (http://genes.mit.edu/GENSCAN.html) or splicing signal prediction program (http://125.itba.mi.cnr.it/webgene/wwwspliceview.html) for variety of organisms.

(40) Considering that all existing programs are not ideal and are subject to mistakes, the potential problematic regions can also be determined experimentally. This can be done by analyzing the transcripts derived from a DNA vector under test in a nuclear environment with the help of such a routine technique as RT-PCR (Frohman, M A., 1989, Methods Enzymol., 218, 340-356) or its more advanced version suitable for precise quantification of the concentration of different transcripts called real-time PCR (Gibson et al., 1996, Genome Res., 6, 995-1001), preferably followed by sequencing of the PCR-amplified products. The function-conservative differences of the invention change dramatically the RNA profile, for example by replacing intron-like sequences with exon-like ones, e.g. by introducing silent mutations with replacement of A/U-rich regions (intron-like) with G/C-rich regions (exon-like) (see FIG. 3, circled regions). Plant introns, unlike exons, are usually A/T(U) rich (Lorkovic, Z J. et al., 2000, Trends Plant Sci., 5, 160-167; Brown, J W. & Simpson, C G. 1998, Annu. Rev. Plant Physiol. Plant Mol. Biol., 49, 77-95; Csank, C. et al., 1990, Nucl. Acid Res., 18, 5133-5141; Goodall & Filipowicz, 1989, Cell, 58, 473-483), but there are exceptions, for example when in monocotyledonous plants G/C rich introns were found (Goodall & Filipowicz, 1989, Cell, 58, 473-483; Goodall & Filipowicz, 1991, EMBO J., 10, 2635-2644). For practicing this invention, selected localities of high A/T(U) content include not only sequence stretches of at least 20 nucleotides in length with at least 55%, preferably at least 65%, most preferably 80% or a higher of A/T(U) content, but also shorter stretches (islands) of 6-19 nucleotides in a row of purely A/T(U)-containing sequences. Herein, localities of high A/U content include sequences which are more A- than U-rich, sequences which are A-rich, sequences which are more U- than A-rich, and sequences which are U-rich. Additionally, any transcribed sequence of interest can be tested for post-transcriptional modifications that cause a change in nucleic acids sequences (e.g. RNA splicing) by RT-PCR (Frohman, M A. 1989, Methods Enzymol., 218, 340-356). It is a trivial task for those familiar with the art to use RT-PCR for detecting the regions within RNA that are subject to post-transcriptional modifications like deletions of sequences from the original RNA transcript. In EXAMPLE 2 we demonstrate that the modification of A/U rich region increases the number of GFP expressing cells at least 10-fold. This is clearly demonstrated in FIG. 7 by comparing the areas agroinfiltrated with pICH15466 (modified vector, FIG. 6A) and pICH14833 (control vector, FIG. 6A). Removing the movement protein (MP) allows for an accurate count of primary cells possessing functional RNA replicons, as cell-to-cell movement from the site of primary infection to neighbouring cells does not take place. In EXAMPLE 3, the modification of another U-rich intron-like region containing many cryptic splice sites (FIG. 2B) and covering the subgenomic promoter of the movement protein (MP) was performed (FIG. 4, circled). This modification gave a dramatic effect on the increase of the frequency of replicon formation from viral vector pICH1590. As it was established in protoplast counting experiments (EXAMPLE 3), the increase was approximately 100-fold in comparison with unmodified vector pICH14833 for both tested Nicotiana speciesN. benthamiana and N. tobacco (see the corresponding infiltrated areas in FIG. 7, A, B). In general, by using the approaches described in this invention, the frequency of RNA replicon formation can be increased approx. 300-fold, i.e. increasing the proportion of cells with functional replicons from about 0.2% (control vector) to more than 50% (modified vector). We believe this is not the limit and reaching a frequency of 100% is very realistic.

(41) Such a high efficiency of replicon formation opens the door for expressing two or more different genes from two different RNA replicons within the same plant cell, e.g. co-expressing different genes by using plant RNA virus based vectors. The achievement of synchronized release of two or more replicons at same time in the same cell is crucial for such co-expression, as the principle first come, first served is especially true for viral vectors. Systemic or cell-to-cell movement does not help, as different viral vectors do normally not overlap in their areas of spread or such overlap is insignificant. Simple calculations demonstrate the importance of the technology described in this invention for achieving co-expression of two sequences of interest in the same plant cell from two replicons. In the case of a non-optimised viral vector with a frequency of functional replicon formation of only 0.2% of all cells, the proportion of cells co-expressing two genes from two different RNA replicons will be 0.20.2=0.04%, while for the construct with increased frequency of functional RNA replicon formation (50% or of all cells), said proportion of cells will be 0.50.5=0.25 or 25%, e.g. about 625-fold higher. With some of the best performing vectors (e.g. pICH16191, FIG. 7C) the proportion of cells having the functional replicon reaches ca. 90% (FIG. 7C, top right). This means that using such a vector for expressing two different sequences of interest from two independent replicons, co-expression can take place in about 80% of all cells. It appears very likely that the technology can be further improved and that 100% co-expression can be reached.

(42) It is worth to note that function-conservative differences in heterologous sequences of interest to be expressed from said RNA replicon might also be used to increase the frequency of RNA replicon formation, notably in combination with differences in sequences for replicon function. For example, modifications within said sequences of interest can be introduced that are necessary for formation and/or processing of said replicon.

(43) In an important embodiment of this invention, the frequency of replicon formation is improved by inserting nuclear introns in said sequences for replicon function (EXAMPLE 4). The incorporation of introns into the coding region of viral RNA-dependent RNA polymerase (RdRP) (EXAMPLES 4 and 8) resulted in a significant (at least 50-fold) increase in the frequency of replicon formation from (FIG. 7A,B) vectors carrying function-conservative differences as defined herein (pICH15034, pICH15025, pICH15499 in FIG. 6 A,B). The RNA profile for a vector containing 6 inserted introns from Arabidopsis is shown in FIG. 5. In another example (EXAMPLE 7), insertion of introns in MP sequences increases the frequency of replicon formation at least 100 times.

(44) Many nuclear introns can be used to practice this invention. Examples of such introns include but are not limited to the introns from rice tpi Act1, and salT genes (Rethmeier et al., 1997, Plant J., 12, 895-899; Xu et al., 1994, Plant Physiol., 100, 459-467; McElroy et al., 1990, Plant Cell, 2, 163-171); from the maize Adh1, GapA1, actin and Bz1 genes (Callis et al., 1987, Genes Dev., 1, 1183-11200; Donath et al., 1995, Plant Mol. Biol., 28, 667-676; Maas et al., 1991, Plant Mol. Biol., 16, 199-207; Sinibaldi & Mettler, 1992, in W E Cohn, K Moldave, eds, Progress in Nucleic Acids Research and Molecular Biology, vol 42, Academic Press, New York, pp 229-257), from petunia rubisco gene SSU301 (Dean et al., 1989, Plant Cell, 1, 201-208), Arabidopsis A1 EF1, UBQ10, UBQ3, PAT1 genes (Curie et al., 1993, Mol. Gen. Genet. 228, 428-436; Norris et al., 1993, Plant Mol. Biol., 21, 895-906; Rose & Last, 1997, Plant J., 11, 455-464) and many others. Synthetic introns can also be used for this invention. The smallest usable introns or their parts may be limited to splice donor and acceptor sites which usually flank the internal intron sequences. Preferably, the introns should have a size of at least 50 nt., more preferably a size of 100 to 200 nt., but actually there are no limitations regarding the size of the introns. However, the size of the construct should be kept suitable for manipulations. The origin of the intron, its structure and size may be selected individually depending on the nature of the vector. Transient expression experiments may be used for testing the efficiency of a chosen intron or the corresponding intron parts.

(45) The modifications described above have a cumulative effect, e.g. if intron insertion(s) are combined with a modification of the MP subgenomic promoter, the increase in frequency of replicon formation can be approx. 300-fold (EXAMPLE 5). The preferred regions for intron insertions in order to have an increase in the frequency of RNA replicon formation are called selected localities herein. Such localities may contain intron-like structures. This is confirmed by the insertion of introns in MP, actually in close proximity to such a problematic region as the MP subgenomic promoter (EXAMPLE 7). A 100-fold increase in frequency of replicon formation was observed. Insertion of introns into exon-like regions does not have such a pronounced effect as insertion in said intron-like regions (EXAMPLE 6).

(46) The experiments discussed above were done with transient expression systems based on Agrobacterium-mediated DNA precursor delivery into plant cells. However, the most useful application of this invention will be for transgenic plants with a DNA precursor of said RNA replicon stably incorporated into a plant nuclear chromosome. This allows to overcome many limitations of plant viral vector-based systems, such as the restrictions to the maximal size of heterologous sequences viral vectors can tolerate. As the DNA precursor will be present in each cell of the transgenic plant, there is no absolute requirement for systemic movement or for cell to cell movement of the RNA replicon (replicon spreading). This can be compensated by the high efficiency of formation and transport of the RNA replicons of the invention into the cytoplasm. However, the ability of the vector for cell-to-cell movement can be of an additional value, as RNA replicon formation does not always occur in all cells.

(47) Different methods may be used for providing a plant cell with said heterologous DNA. Said vectors may be transformed into plant cells by a Ti-plasmid vector carried by Agrobacterium (U.S. Pat. Nos. 5,591,616; 4,940,838; 5,464,763) or particle or microprojectile bombardment (U.S. Pat. No. 5,100,792; EP 00444882B1; EP 00434616B1). Other plant transformation methods can also be used like microinjection (WO 09209696; WO 09400583A1; EP 175966B1), electroporation (EP00564595B1; EP00290395B1; WO 08706614A1) or PEG-mediated transformation of protoplasts etc. The choice of the method for vector delivery may depend on the plant species to be transformed. For example, microprojectile bombardment is generally preferred for monocot transformation, while for dicots, Agrobacterium-mediated transformation gives better results in general.

(48) In the examples described below, we used Agrobacterium-mediated delivery of vectors (said heterologous DNA) into Nicotiana cells. However, said vectors may be introduced into the plants in accordance with any of the standard techniques suitable for stable or transient transformation of the plant species of interest. Transformation techniques for dicotyledonous are well known in the art and include Agrobacterium-based techniques and techniques which do not require Agrobacterium. Non-Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. These techniques include PEG or electroporation mediated uptake, particle bombardment-mediated delivery and microinjection. Examples of these techniques are described in Paszkowski et al., EMBO J 3, 2717-2722 (1984), Potrykus et al., Mol. Gen. Genet. 199, 169-177 (1985), Reich et al., Biotechnology 4:1001-1004 (1986), and Klein et al., Nature 327, 70-73 (1987). In each case, the transformed cells are regenerated to whole plants using standard techniques.

(49) Agrobacterium-mediated transformation is a preferred technique for the transformation of dicotyledons because of its high transformation efficiency and its broad utility with many different species. The many crop species which may be routinely transformed by Agrobacterium include tobacco, tomato, sunflower, cotton, oilseed rape, potato, soybean, alfalfa and poplar (EP 0 317 511 (cotton), EP 0 249 432 (tomato), WO 87/07299 (Brassica), U.S. Pat. No. 4,795,855 (poplar)).

(50) Agrobacterium transformation typically involves the transfer of the binary vector carrying the foreign DNA of interest into an appropriate Agrobacterium strain which may depend on the complement of vir genes carried by the host Agrobacterium strain either on a co-resident plasmid or chromosomally (Uknes et al., Plant Cell 5:159-169 (1993). The transfer of the recombinant binary vector to Agrobacterium may be accomplished by a triparental mating procedure using E. coli carrying the recombinant binary vector, a helper E. coli strain which carries a plasmid such as pRK2013, which is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector may be transferred to Agrobacterium by DNA transformation (Hofgen & Willmitzer, Nucl. Acids Res. 16, 9877 (1988)).

(51) Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant following protocols known in the art. Transformed tissue carrying an antibiotic or herbicide resistance marker present between the binary plasmid T-DNA borders may be regenerated on selectable medium. This allows the generation of transgenic plants stably transformed on a nuclear chromosome with in T-DNA containing said heterologous DNA of the invention.

(52) In the examples of this invention, in parallel with stable agro-transformation we used agro-inoculation, a method of Agrobacterium-mediated delivery of T-DNA for transient expression of gene(s) of interest (Vaquero et al., 1999, Proc. Natl. Acad. Sci. USA, 96, 11128-11133). Agro-inoculation is an extremely useful tool not only for small-to-middle scale recombinant protein production systems, but as an element of a vector optimisation system, allowing to obtain fast results with different variants of constructs.

(53) The invention can also be used for large-scale/industrial production of recombinant proteins. Overnight cultures of Agrobacterium were used in our experiments. The overnight culture was prepared for agro-infiltration, as described in the prior art (Marillonnet et al., 2004, Proc. Natl. Acad. Sci. USA., 101, 6853-6857). Usually, an overnight culture reaches an optical density (O.D.) of 3-3.5 units at a wavelength 600 nm and is diluted 3-5 times before agro-infiltration, yielding in general 5-910.sup.9 colony forming units (Turpen et al., 1993, J. Virol. Methods, 42, 227-240). We have found that a 10.sup.2, preferably a 10.sup.3 and more preferably a 10.sup.4 fold dilution of auch an overnight culture works very efficiently, especially in combination with sequences for replicon function having said function-conservative differences as described herein. Surprisingly, the vectors in infiltrated tobacco leaves further improved their performance giving better yield of GFP with increasing dilutions of the transforming Agrobacteria. For example, a 10.sup.3-fold dilution gave better result than a 10.sup.2-fold dilution. A 10.sup.2-fold dilution provides better GFP yield than a 10-fold dilution. A possible explanation for this phenomenon is the negative effect of highly concentrated Agrobacterium suspension on the function of a viral vector, e.g. on cell-to-cell movement, possibly as the result of a plant response to high concentrations of pathogenic bacteria. This phenomenon is of special value for large-scale industrial protein expression processes, as it allows to reduce the amount of agrobacteria required for recombinant protein production via agro-infiltration by at least one order of magnitude compared to prior art processes.

(54) In EXAMPLE 9 of this invention, a DNA precursor of an inactivated viral RNA-based replicon is stably incorporated into chromosomal DNA. Said replicon is optimised according to the invention. In addition, the replicon contains a structure preventing expression of the sequence of interest. Expression as well as formation of the functional RNA replicon can be triggered by flipping one part of the construct with the help of site-specific recombination. Said flipping can lead to the formation of two introns as well as to the assembly of a functional sequence of interest. The system described in EXAMPLE 9 shows not only the optimisation of a viral vector but also the solution for avoiding leakiness of constructs stably integrated into chromosomal DNA, including the leaky expression of the gene of interest from said construct. In many applications, it is crucial to have zero level expression in the uninduced state, especially for cytotoxic proteins or for achieving high biosafety standards with plant expression systems for expressing technical or pharmaceutical proteins.

(55) Transcription of the heterologous DNA and/or of said recombinase can be under the control of an inducible or any other regulated (e.g. developmentally regulated) promoter. Inducible promoters can be divided into two categories according to their induction conditions: those induced by abiotic factors (temperature, light, chemical substances) and those that can be induced by biotic factors, for example, pathogen or pest attack. Examples of the first category are heat-inducible (U.S. Pat. No. 5,187,287) and cold-inducible (U.S. Pat. No. 5,847,102) promoters, a copper-inducible system (Mett et al., 1993, Proc. Natl. Acad. Sci., 90, 4567-4571), steroid-inducible systems (Aoyama & Chua, 1997, Plant J., 11, 605-612; McNellis et al., 1998, Plant J., 14, 247-257; U.S. Pat. No. 6,063,985), an ethanol-inducible system (Caddick et al., 1997, Nature Biotech., 16, 177-180; WO09321334), and a tetracycline-inducible system (Weinmann et al., 1994, Plant J., 5, 559-569). One of the latest developments in the area of chemically inducible systems for plants is a chimaeric promoter that can be switched on by glucocorticoid dexamethasone and switched off by tetracycline (Bohner et al., 1999, Plant J., 19, 87-95). For a review on chemically inducible systems see: Zuo & Chua, (2000, Current Opin. Biotechnol., 11, 146-151) and Padidam, M (2003, Curr. Opin. Plant Biol., 6, 169-177). Other examples of inducible promoters are promoters which control the expression of patogenesis-related (PR) genes in plants. These promoters can be induced by treatment of a plant with salicylic acid, an important component of plant signaling pathways in response to pathogen attack, or other chemical compounds (benzo-1,2,3-thiadiazole or isonicotinic acid) which are capable of triggering PR gene expression (U.S. Pat. No. 5,942,662).

(56) This invention is not limited to TMV-based vectors described in examples 1-9, but can be extended to replicons based on other plant RNA viruses. The analysis of other plant viral RNA sequences (EXAMPLE 10, FIGS. 10, 11) shows selected localities very similar to those described for TMV and the sequences of pre-mRNA of plant nuclear genes (FIG. 9). This is strong evidence supporting the suggestion that, using the approaches described in this invention, practically any plant RNA virus-derived replicon can be improved fundamentally by removing/replacing problematic regions and/or inserting nuclear introns.

(57) The present invention is preferably carried out with higher multi-cellular plants, parts thereof, or cell cultures thereof. Plants for the use in this invention include any plant species with preference given to agronomically and horticulturally important species. Common crop plants for the use in present invention include alfalfa, barley, beans, canola, cowpeas, cotton, corn, clover, lotus, lentils, lupine, millet, oats, peas, peanuts, rice, rye, sweet clover, sunflower, sweetpea, soybean, sorghum triticale, yam beans, velvet beans, vetch, wheat, wisteria, and nut plants. The plant species preferred for practicing this invention include, but not restricted to, representatives of Gramineae, Compositeae, Solanaceae and Rosaceae.

(58) Further preferred species for the use in this invention are plants from the following genera: Arabidopsis, Agrostis, Allium, Antirrhinum, Apium, Arachis, Asparagus, Atropa, Avena, Bambusa, Brassica, Bromus, Browaalia, Camellia, Cannabis, Capsicum, Cicer, Chenopodium, Chichorium, Citrus, Coffea, Coix, Cucumis, Curcubita, Cynodon, Dactylis, Datura, Daucus, Digitalis, Dioscorea, Elaeis, Eleusine, Festuca, Fragaria, Geranium, Glycine, Helianthus, Heterocallis, Hevea, Hordeum, Hyoscyamus, Ipomoea, Lactuca, Lens, Lilium, Linum, Lolium, Lotus, Lycopersicon, Majorana, Malus, Mangifera, Manihot, Medicago, Nemesia, Nicotiana, Onobrychis, Oryza, Panicum, Pelargonium, Pennisetum, Petunia, Pisum, Phaseolus, Phleum, Poa, Prunus, Ranunculus, Raphanus, Ribes, Ricinus, Rubus, Saccharum, Salpiglossis, Secale, Senecio, Setaria, Sinapis, Solanum, Sorghum, Stenotaphrum, Theobroma, Trifolium, Trigonella, Triticum, Vicia, Vigna, Vitis, Zea, and the Olyreae, the Pharoideae and many others.

(59) Most preferred plants for this invention are plants that do not enter the animal or human food chain like Nicotiana species, e.g. Nicotiana benthamiana and Nicotiana tabacum.

(60) Proteins of interest, their fragments (functional or non-functional) and their artificial derivatives that can be expressed in plants or plants cells using the present invention include, but are not limited to: starch modifying enzymes (starch synthase, starch phosphorylation enzyme, debranching enzyme, starch branching enzyme, starch branching enzyme II, granule bound starch synthase), sucrose phosphate synthase, sucrose phosphorylase, polygalacturonase, polyfructan sucrase, ADP glucose pyrophosphorylase, cyclodextrin glycosyltransferase, fructosyl transferase, glycogen synthase, pectin esterase, aprotinin, avidin, bacterial levansucrase, E. coli glgA protein, MAPK4 and orthologues, nitrogen assimilation/methabolism enzyme, glutamine synthase, plant osmotin, 2S albumin, thaumatin, site-specific recombinase/integrase (FLP, Cre, R recombinase, Int, SSVI Integrase R, Integrase phiC31, or an active fragment or variant thereof), oil modifying enzymes (like fatty acids desaturases, elongases etc), isopentenyl transferase, Sca M5 (soybean calmodulin), coleopteran type toxin or an insecticidally active fragment, ubiquitin conjugating enzyme (E2) fusion proteins, enzymes that metabolise lipids, amino acids, sugars, nucleic acids and polysaccharides, superoxide dismutase, inactive proenzyme form of a protease, plant protein toxins, traits altering fiber in fiber producing plants, Coleopteran active toxin from Bacillus thuringiensis (Bt2 toxin, insecticidal crystal protein (ICP), CryIC toxin, delta endotoxin, polyopeptide toxin, protoxin etc.), insect specific toxin AaIT, cellulose degrading enzymes, E1 cellulase from Acidothermus celluloticus, lignin modifying enzymes, cinnamoyl alcohol dehydrogenase, trehalose-6-phosphate synthase, enzymes of cytokinin metabolic pathway, HMG-CoA reductase, E. coli inorganic pyrophosphatase, seed storage protein, Erwinia herbicola lycopen synthase, ACC oxidase, pTOM36 encoded protein, phytase, ketohydrolase, acetoacetyl CoA reductase, PHB (polyhydroxybutanoate) synthase, enzymes involved in the synthesis of polyhydroxylalkanoates (PHA), acyl carrier protein, napin, EA9, non-higher plant phytoene synthase, pTOM5 encoded protein, ETR (ethylene receptor), plastidic pyruvate phosphate dikinase, nematode-inducible transmembrane pore protein, trait enhancing photosynthetic or plastid function of the plant cell, stilbene synthase, an enzyme capable of hydroxylating phenols, catechol dioxygenase, catechol 2,3-dioxygenase, chloromuconate cycloisomerase, anthranilate synthase, Brassica AGL15 protein, fructose 1,6-biphosphatase (FBPase), AMV RNA3, PVY replicase, PLRV replicase, potyvirus coat protein, CMV coat protein, TMV coat protein, luteovirus replicase, MDMV messenger RNA, mutant geminiviral replicase, Umbellularia californica C12:0 preferring acyl-ACP thioesterase, plant C10 or C12:0 preferring acyl-ACP thioesterase, C14:0 preferring acyl-ACP thioesterase (luxD), plant synthase factor A, plant synthase factor B, D6-desaturase, proteins having an enzymatic activity in fatty acids biosynthesis and modifications, e.g. the peroxysomal -oxidation of fatty acids in plant cells, acyl-CoA oxidase, 3-ketoacyl-CoA thiolase, lipase, maize acetyl-CoA-carboxylase, etc.; 5-enolpyruvylshikimate-3-phosphate synthase (EPSP), phosphinothricin acetyl transferase (BAR, PAT), CP4 protein, ACC deaminase, protein having posttranslational cleavage site, DHPS gene conferring sulfonamide resistance, bacterial nitrilase, 2,4-D monooxygenase, acetolactate synthase or acetohydroxyacid synthase (ALS, AHAS), polygalacturonase, Taq polymerase, bacterial nitrilase, many other enzymes of bacterial or phage origin including restriction endonucleases, methylases, DNA and RNA ligases, DNA and RNA polymerases, reverse transcriptases, nucleases (DNases and RNases), phosphatases, transferases etc.

(61) The present invention can be used for the purpose of molecular farming and purification of commercially valuable and pharmaceutically important proteins including industrial enzymes (cellulases, lipases, proteases, phytases etc.) and fibrous proteins (collagen, spider silk protein, etc.). Human or animal health protein may be expressed and purified using described in our invention approach. Examples of such proteins of interest include inter alia immune response proteins (monoclonal antibodies, single chain antibodies, T cell receptors etc.), antigens including those derived from pathogenic microorganisms, colony stimulating factors, relaxins, polypeptide hormones including somatotropin (HGH) and proinsulin, cytokines and their receptors, interferons, growth factors and coagulation factors, enzymatically active lysosomal enzyme, fibrinolytic polypeptides, blood clotting factors, trypsin, trypsinogen, al-antitrypsin (AAT), human serum albumin, glucocerebrosidases, native cholera toxin B, thrombin, human gastric lipase, granulocyte-macrophage colony stimulating factor (GM-CMF), serpin, lactoferrin, lisozyme, oleosin, prothrombin, alpha-galactosidase, as well as function-conservative proteins like fusions, mutant versions and synthetic derivatives of the above proteins.

(62) The content of International patent application PCT/EP03/12530 and European patent application 04016012.9 are incorporated herein by reference in their entireties.

EXAMPLES

(63) The following examples are presented to illustrate the present invention. Modifications and variations may be made without departing from the spirit and scope of the invention.

Example 1

(64) Construction of a TMV-Based RNA Vector

(65) Cloned cDNAs of the crucifer-infecting tobamovirus (cr-TMV; Dorokhov et al., 1994, FEBS Lett. 350, 5-8) and of the turnip vein-clearing virus (TVCV; Lartey et al., 1994, Arch. Virol. 138, 287-298) were obtained from Prof. Atabekov from Moscow University, Russia. A viral vector containing a green fluorescence protein (GFP) gene was made in several cloning steps. The resulting construct, pICH8543 (FIG. 6A), contains in sequential order: a 787 bp fragment from the Arabidopsis actin 2 promoter (ACT2, ref An et al, 1996, GenBank accession AB026654, by 57962 to 58748), the 5 end of TVCV (GenBank accession BRU03387, bp 1 to 5455), a fragment of cr-TMV (GenBank accession Z29370, by 5457 to 5677, with thymine 5606 changed to cytosine to remove the start codon of the coat protein, CP), sequences taa tcg ata act cga g, a synthetic GFP (sGFP) gene, cr-TMV 3 nontranslated region (3 NTR; GenBank accession Z29370, bp 6078 to 6312), and finally the nopaline synthase (Nos) terminator. The entire fragment was cloned between the T-DNA left (LB) and right (RB) borders of pICBV10, a Carb.sup.R pBIN19-derived binary vector. pICH8543 was transformed into Agrobacterium strain GV3101 and infiltrated into a Nicotiana benthamiana leaf. Foci of GFP fluorescence that appeared at 3 dpi grew and became confluent. Surprisingly, even though most cells in the infiltrated area finally expressed GFP due to viral replication and movement, only a fraction of the cells initiated viral replication, as detected by a number of independent GFP expressing foci. It became clear that the limiting factor is not DNA delivery to plant cells, since infiltration of Nicotiana benthamiana leaves with a GFP gene under control of the 35S promoter leads to GFP expression in almost every cell in the infiltrated area (not shown).

(66) To confirm this observation, we made a viral vector construct containing a mutation in the MP. This construct, called pICH14833, is similar to pICH8543 but differs by a deletion of 389 bp in the MP gene, upstream of the EcoRI site present in the MP. The sequence of the NcoI to EcoRI fragment that includes this deletion is given in the annex as SEQ ID No. 1. The entire viral construct (from the ACT2 promoter to the Nos terminator) was cloned between the T-DNA left and right borders of pICBV49, a pBIN19-derived Kan.sup.R binary vector. Due to the deletion in the MP, replicons produced from this construct cannot move from cell to cell but are able to replicate autonomously within a cell. Cell to cell movement can be restored when MP is provided in trans, e.g. from a constitutive promoter such as the cauliflower mosaic virus 35S promoter.

(67) To make an MP expression construct, the TVCV MP gene was amplified by PCR from cloned TVCV cDNA (GenBank accession Z29370, by 4802 to 5628) and subcloned in a binary vector under control of the 35S promoter. The resulting construct, called pICH10745 (not shown), and pICH14833 were transformed into Agrobacterium strain GV3101 and various dilutions of an overnight culture were infiltrated in Nicotiana benthamiana leaves as described by English and colleagues (1997, Plant J., 12, 597-603), except that the infiltration media lacked acetosyringone. Infiltration of pICH14833 alone led to the appearance of a few GFP expressing cells within the infiltrated area. By counting protoplasts prepared from the infiltrated area, we found that only one to three protoplasts expressed GFP from a total of 500 protoplasts (0.2 to 0.6%). Coinfiltration of pICH14833 and pICH10745 led to the formation of GFP-expressing foci that grew from each initial GFP-expressing cell. Ultimately, due to cell-to-cell movement, a large proportion of cells in the infiltrated area expressed GFP (FIG. 7A).

(68) RNA viruses such as tobamoviruses replicate in the cytoplasm and never enter the nucleus. Therefore, they have evolved in an environment where they are not exposed to the nuclear pre-mRNA processing machinery. As a result, it is not surprising that RNA replicon transcripts generated in the nucleus from artificial viral constructs may not be recognized and processed properly by the RNA processing machinery. Moreover, RNA replicons from viral vectors are very large: approximately 7,000 nt in the case of the replicon based on TMV. Very few plant genes have such a large size and the majority of such genes contains introns that facilitate processing of the pre-mRNAs, export from the nucleus, and that improve the stability of the processed transcripts. We therefore hypothesized that modifications of the pre-mRNAs that would increase the efficiency of accurate processing and of export of correctly processed transcripts from the nucleus to the cytosol would lead to an increase of the number of cells that would initiate viral replication. It turned out that there are two approaches can be used to make RNA virus-based vectors that can more efficiently initiate viral replication after DNA delivery to the nucleus: (1) one approach is the removal of sequence features that might induce unwanted processing events (such as alternative splicing events using cryptic splice sites, or premature termination events); (2) a second approach is the addition of introns to increase the amount of properly processed transcripts, to improve export of the RNA from the nucleus to the cytoplasm, and/or to improve stability of the transcripts.

Example 2

(69) Removal of Intron-Like Sequences Increases the Frequency of Viral RNA Replicon Formation in the Cytoplasm

(70) We analyzed the sequence of the RNA replicon from pICH4351 using the Netgenell server program (http://www.cbs.dtu.dk/services/NetGene2/) and noticed several intron-like sequence features that might induce alternative splicing events. One such feature is a 0.6 kb uridine-rich region (corresponding to nt 827 to 1462 in GenBank accession BRU03387) at the beginning of the RdRP (FIG. 2A). This region was replaced in pICH14833 bp a PCR-mutagenized sequence that differs from the original sequence by a 54 nucleotide substitution (sequence given in the annex as SEQ ID No. 2; cf. FIG. 3). The 52 nucleotide substitutions were made to replace T-rich sequences by more GC-rich sequences. All nucleotide substitutions were made silent so as not to change the RdRP protein sequence. This mutagenized fragment also contains two nucleotide substitutions (at position 829 and 1459; coordinates relative to GenBank accession BRU03387) that were introduced to remove putative cryptic splice donor and acceptor sites, respectively. To test the effect of these mutations, the resulting clone pICH15466 (FIG. 6A) was agroinfiltrated in N. benthamiana leaves with or without pICH10745 (movement protein in trans). Eight days after infiltration, a 10-fold increase in the number of GFP expressing cells was observed in the area infiltrated with pICH15466 (compared to pICH14833, FIG. 7). This suggests that removal of intron-like sequences from the viral amplicon prevents unwanted alternative splicing events and results in more efficient initiation of viral replication. Coinfiltration of pICH15466 and pICH10745 leads to cell-to-cell movement of the modified replicon at a similar speed as a non-modified replicon. This shows that the modification of the RNA sequence did not affect cell to cell movement of the viral vector.

Example 3

(71) Removal of Intron-Like Sequences in the MP Subgenomic Promoter

(72) A second potentially problematic region corresponds to the MP subgenomic promoter (FIG. 2B). This region is very T-rich and resembles intron sequences very closely. As a consequence, many cryptic splice donor and acceptor sites are predicted in nearby sequences by intron prediction programs. Unfortunately, modifications cannot be made easily to this region without affecting subgenomic promoter function. We decided to completely mutagenize the entire region without regard for the subgenomic promoter, and to provide MP in trans to compensate for the expected loss of MP expression. As MP will not be expressed from this construct, we also deleted most of MP sequence except for the 3 sequences that contain the CP subgenomic promoter which is required to drive expression of the gene of interest. We therefore replaced a 383 bp fragment in pICH14833 (bp 4584 to 5455 in GenBank accession BRU03387) by a 297 bp mutagenized fragment (SEQ ID No. 3). The resulting construct pICH15900 (FIG. 6A) was agroinfiltrated in Nicotiana benthamiana leaves with or without pICH10745. Interestingly, a huge increase in the number of cells initiating replication was detected in comparison to leaf areas infiltrated by pICH14833. By counting GFP-expressing protoplasts prepared from infiltrated leaf areas, we estimate that this modification results in a 80 to 100-fold increase in the number of cells initiating viral replication compared to the unmodified pICH14833. pICH15900 was coinfiltrated with pICH10745 (p35S-MP expression cassette) and an increase in GFP fluorescence was detected due to cell to cell movement. This increase was however very limited because so many cells already expressed GFP even in the absence of cell-to-cell movement. A 1000-fold dilution (corresponding approximately to a calculated OD of 0.004 at 600 nm) of the agrobacterium suspension containing pICH15900 coinfiltrated with a 5-fold diluted suspension of agrobacteria containing pICH10745 (corresponding approximately to a calculated OD of 0.8 at 600 nm) gave rise to separate GFP expression foci. Fluorescent foci were as bright and of the same size as control foci obtained with pICH14833. This tells us that the modification in pICH15900 and the delivery of MP in trans do not compromise functionality of the replicon regarding the level of replication, expression of the gene of interest and cell-to-ell movement. The same constructs (pICH14933 and pICH15900, with or without pICH10745) were coinfiltrated to Nicotiana tabacum leaves. The modifications in pICH15900 lead to a similar increase in the number of cells initiating replication (in comparison to pICH14833) as they did in N. benthamiana.

Example 4

(73) Addition of Introns Improves the Frequency of Formation of Functional RNA Rep/Icons in the Cytoplasm

(74) We tested whether the addition of introns into viral pro-replicon sequences would increase the frequency of initiation of replication. Two constructs were made, pICH15025 and pICH15034 (FIG. 6A), each containing three different Arabidopsis thaliana introns in two different regions of the RdRP. pICH15025 was designed to contain introns in the middle of the RdRP, while pICH15034 contains introns in the 3 end of the RdRP, upstream of the MP subgenomic promoter. The introns were amplified by PCR from Arabidopsis genomic DNA and incorporated into viral sequences using PCR with primers overlapping the planned intron/exon junctions. The fragments containing the introns were subcloned into pICH14833 as an Aval HindIII fragment (SEQ ID No. 4 in the annex) to make pICH15025 or as a Pst1 NcoI fragment (SEQ ID No. 5 in the annexe) to make pICH15034.

(75) Both constructs were separately agroinfiltrated into N. benthamiana leaves and compared to pICH14833. Both constructs significantly increased the number of cells initiating viral replication (FIG. 7A). This increase was estimated to be on the order of a 50-fold improvement relative to pICH14833. Both constructs were also coinfiltrated with an MP expressing clone, and cell-to-cell movement was found to be identical to clones without introns. Both constructs were also tested in N. tabacum, and a similar improvement was observed as in N. benthamiana (FIG. 7B).

(76) A third clone was made, pICH15499, which contained all 6 introns (FIG. 5, 6B, 7A, 7B). This construct was tested in N. benthamiana and N. tabacum. This construct was more efficient than each individual construct with 3 introns, but the improvement was however less than additive.

Example 5

(77) Addition of Introns and Removal of Intron-Like Sequences Increases the Frequency of the Formation of Functional RNA Replicons in the Cytoplasm

(78) Removing intron-like features and adding additional introns in one construct showed that both types of modifications can contribute to improve initiation of viral replication. We subcloned the 6 introns of pICH15499 into pICH15900, which contains the mutagenized MP subgenomic promoter region. The resulting clone pICH15860 (FIG. 6B) was infiltrated into N. benthamiana leaves and found to work significantly better than either parental clones within the range of approximately 50% to 90% of all protoplasts expressing GFP (FIG. 7). The best performing construct contains introns within the RdRP region and modified MP subgenomic promoter region (pICH16191, FIG. 7C). In comparison to a clone without any modification, this represents an 80- to 300-fold improvement. This construct was also coinfiltrated with a MP-expressing construct (pICH10745) and it was found that the modifications did not compromize cell-to-cell movement or replication.

Example 6

(79) Not all Intron Additions Increase the Frequency of Appearance of Functional RNA Replicons in the Cytoplasm

(80) We inserted two different Arabidopsis introns at the beginning of the RdRP, resulting in clone pICH15477 (the sequence of this region is shown as SEQ ID No. 6 in the annex). The sequence in this region already looks very exon-like (e.g. GC-rich without cryptic splice sites) before the addition of introns. No improvement on replication of viral initiation was seen with this construct. Therefore, not any addition of an intron will result in an improvement of the viral vector. It appears that the position chosen for intron insertion or mutagenesis is an important parameter. For example, all intron insertions or nucleotide substitutions that were made in regions near problematic structures such as the MP subgenomic promoter resulted in large improvements, while insertions of introns into sequences that are already exon-like did not.

Example 7

(81) Insertion of Introns in MP Sequences Increase the Frequency of Viral Replicon Formation

(82) We first made a frameshift in the MP by digestion with the restriction enzyme AvrII, filling and religation. We then inserted two introns in the MP. The resulting clone pICH16422 (FIG. 6B) was infiltrated in Nicotiana benthamiana leaves. An about 100-fold increase in the number of cells containing the functional viral replicon was detected.

Example 8

(83) Insertion of Introns into a MP Containing Vector Improves the Frequency of Initiation of Viral Replication of Autonomous Functional Clones

(84) A Kpn1 EcoRI fragment was subcloned from pICH15499 into pICH8543. The resulting clone, 16700 (FIG. 6B) contained a complete viral vector with 6 introns in the RdRP. This clone was infiltrated in N. benthamiana leaf and efficiently initiated replication. This clone was also able to move from cell to cell without the need to provide additional MP in trans.

Example 9

(85) Activation of an Inactive Replicon Stably Integrated on a Chromosome

(86) It is also possible to stably transform intron-containing viral vector constructs in transgenic plants. To avoid deleterious viral replication that would inhibit plant growth, an inactive clone (pro-replicon) can be made by having a part of the vector present in antisense orientation (FIG. 8). Incorporation of recombination sites and of intron sequences at the extremities of the inverted fragment allow this fragment to be flipped in the correct orientation by using an appropriate recombinase. Recombination sites will be completely eliminated from the replicon by splicing. Introns in the pro-replicon allow efficient initiation of replication after recombination and transcription. In one specific example, the recombination sites are located within the gene of interest and downstream of the pro-replicon. Such a configuration prevents any gene expression before recombination. Other configurations can be considered where the recombination sites are located in other areas of the pro-replicon such as in the RdRP and upstream of the promoter. Intron sequences at the recombination site have the advantage of allowing to completely remove the recombination site from the replicon, but also increases the efficiency of viral replication, as described before.

(87) The flipped part can be located at the 3 end of the vector (as shown in FIG. 8), in the middle or at the 5 end, as shown in FIG. 12. Two constructs were made, pICH12691 (containing only one intron at the recombination site) and pICH16888 containing 6 additional introns in the RdRP. The sequence of the entire T-DNA region of pICH12691 is given in SEQ ID No. 7. pICH16888 is similar to pICH12691, but, in addition, contains the three introns described above in pICH15025 (SEQ ID No. 4) and the three introns described in pICH15034 (SEQ ID No. 5) inserted in the same position as in these constructs, respectively. Both pICH12691 and pICH16888 were stably transformed in Nicotiana benthamiana using Kanamycin selection as follows. The constructs pICH12691 and pICH16888 were separately immobilized into A. tumefaciens (GV3101) and were separately used for Agrobacterium-mediated leaf discs transformation of Nicotiana plants as described by Horsh and colleagues (1985, Science, 227, 1229-1231) with minor modifications. Leaf discs were co-cultivated for 30 min in an agrobacterial suspension in Murashige and Skoog (MS) basal medium supplemented with 1 mg/L of alpha-naphthaleneacetic acid (NAA), 0.5 mg/L 6-benzaminopurine (BAP), 200 microM acetosirengone (AS), pH5.5-5.6. Then leaf discs were placed on sterile Whatman filter paper for removal of excessive liquid and transferred onto solid co-cultivation medium (0.8% agar prepared on MS supplemented as described above) for 48 hours cultivation in darkness at 22-23 C. After co-cultivation, leaf discs were placed on selective regeneration medium (0.8% agar prepared on MS supplemented with 1 mg/L BAP, 0.1 mg/L NAA, 1 mg/L MES (pH pH 5.7-5.8), 300 mg/L cefataxim, 50 mg/L kanamycin). After 3-6 weeks of cultivation on regeneration medium, the shoots regenerated from kanamycin-resistant plant cells were transferred onto rooting selective medium (0.8% agar prepared on MS supplemented with 300 mg/L cefotaxim, 200 mg/L timentin to facilitate the elimination of agrobacterium, 50 mg/L kanamycin, pH 5.7-5.8). Regenerated transformants were transferred to a glasshouse and tested by infiltration with a syringe without needle with an agrobacterium suspension containing an integrase expression construct (pICH10881: actin2 promoterPhiC31 integrase; or pICH14313: Zea maize transposable element Spm promoter-PhiC31 integrase). More pICH16888 transformants exhibited viral replication foci after infiltration with the integrase construct than transformants of pICH12691 (FIG. 13). In addition, transformants of pICH16888 displayed more viral initiation foci per infiltration.

Example 10

(88) Plant Viral RNA Sequences Contain Potentially Unstable Regions

(89) The analysis of RNA profile of selected plant RNA viruses as well as one well characterised plant gene (AtDMC1) was performed by using the Netgenell server program (http://www.cbs.dtu.dk/services/NetGene2/). The RNA profile shown in FIG. 9 for AtDMC1 clearly reflects the presence of 14 introns (circled), previously identified by comparing the cDNA and genomic DNA sequences. It is evident that RNA profiles of two plant viruses have regions (see the FIGS. 10, 11) which might cause problems for the stability of said RNA, if they are placed in plant nuclear environment. We have analysed the RNA profiles of several other representatives of plant RNA viruses (not shown), such as Brome Mosaic Virus, different strains of TMV, and many others. All of them have potential problematic regions that might compromise the efficiency of plant RNA virus-based replicon formation if delivered into the plant cell as DNA precursors.

Example 11

(90) Optimized Vectors Work in Other Species

(91) A fully optimized construct containing the mutagenized region (described in pICH15466) and 16 introns (including the six introns of pICH15860, the two introns of pICH16422 and eight additional introns) was made. In summary this construct contains introns inserted at the following positions (given relative to TVCV sequence, GenBank accession BRU03387): nt 209, nt 828, nt 1169, nt 1378, nt 1622, nt 1844, nt 2228, nt 2589, nt 2944, nt 3143, nt 3381, nt 3672, nt 3850, nt 4299, nt 5287, nt 5444.

(92) This construct was tested for expression in Beta vulgaris. Infiltration of the entire plant was performed as described next. Agrobacteria carrying pICH18711 were inoculated to 300 ml of LB containing 50 g/ml Rifampicin and 50 g/ml Kanamycin (selection for the binary vector) and grown until saturation. The bacteria were pelleted at 4800 g for 10 min and resuspended in 3 l of infiltration buffer (10 mM MES pH 5.5, 10 mM MgSO.sub.4) in order get a 10-fold dilution relative to the saturated Agrobacterium culture. A beaker containing the infiltration solution was placed in an exsiccator (30 mm diameter), with the aerial parts of a plant dipped in the solution. A vacuum was applied for two minutes using a Type PM 16763-860.3 pump from KNF Neuberger (Freiburg, Germany), reaching from 0.5 to 0.9 bar. The plants were returned to the greenhouse under standard conditions.

(93) GFP expression was high in leaves of the plants infiltrated with pICH18711 (FIG. 14). In contrast, only a few small spots could be seen in control plants infiltrated with pICH16700 containing no intron (not shown).

(94) TABLE-US-00001 ANNEX SEQIDNo.1(NcoI-EcoRIfragmentofpICH14833): ccatggacaaagtgataaaggcagctttttgtggagacgatagcctgatttacattcctaaaggtttagacttgcctgatattcaggcggg cgcgaacctcatgtggaacttcgaggccaaactcttcaggaagaagtatggttacttctgtggtcgttatgttattcaccatgatagagga gccattgtgtattacgatccgcttaaactaatatctaagttaggttgtaaacatattagagatgttgttcacttagaagagttacgcgagtctt tgtgtgatgtagctagtaacttaaataattgtgcgtatttttcacagttagatgaggccgttgccgaggttcataagaccgcggtaggcggt tcgtttgctttttgtagtataattaagtatttgtcagataagagattgtttagagatttgttctttgtttgataatgtcgatagtctcgtacgaaccta aggtgagtgatttcctcaatctttcgaagaaggaagagatcttgccgaaggctctaacgaggttagaattc SEQIDNo.2(partofpICH15466): ggagataacctgagcttcttcttccataatgagagcactctcaattacacccacagcttcagcaacatcatcaagtacgtgtgcaagac gttcttccctgctagtcaacgcttcgtgtaccacaaggagttcctggtcactagagtcaacacttggtactgcaagttcacgagagtggat acgttcactctgttccgtggtgtgtaccacaacaatgtggattgcgaagagttttacaaggctatggacgatgcgtggcactacaaaaa gacgttagcaatgcttaatgccgagaggaccatcttcaaggataacgctgcgttaaacttttggttcccgaaagtgagagacatggttat cgtccctctctttgacgcttctatcacaactggtaggatgtctaggagagaggttatggtgaacaaggacttcgtctacacggtcctaaat cacatcaagacctatcaagctaaggcactgacgtacgcaaacgtgctgagcttcgtggagtctattaggtctagagtcataattaacgg tgtcactgccaggtctgaatgggacacagacaaggcaattctaggtccattagcaatgacattcttcctgatcacgaagctgggtcatgt gcaagat SEQIDNo.3(partofpICH15900): gcggacgatacgtgatccaccatgatagaggagccattgtgtattacgatccgcttaaactaatatctaagctcggctgcaagcacatc agagacgtcgtgcacttagaagagttacgcgagtctttgtgcgacgtagctagtaacttgaacaactgcgcctacttctcacagttagat gaggccgttgctgaggtccacaagactgcggtcggaggctccttcgcgttctgtagcatcatcaaatacttgtcagacaagaggctgtt cagggacctgttcttcgtctgagttgacg SEQIDNo.4(partofpICH15025):(contains3Intronsshownunderlinedinitalics) Cccgagctatactgtaccttcgccgaccgattggtactacagtacaagaaggcggaggagttccaatcgtgtgatctttccaaacctct agaagagtcagagaagtactacaacgcattatccgagctatcagtgcttgagaatctcgactcttttgacttagaggcgtttaagacttta tgtcagcagaagaatgtggacccggatatggcagcaaag gtaaatcctggtccacacttttacgataaaaacacaagattttaaactatgaactgatcaataatcattcctaaaagaccacacttttgtttt gtttctaaagtaatttttactgttataacag gtggtcgtagcaatcatgaagtcagaattgacgttgcctttcaagaaacctacagaagaggaaatctcggagtcgctaaaaccagga gaggggtcgtgtgcagagcataaggaagtgttgagcttacaaaatgatgctccgttcccgtgtgtgaaaaatctagttgaaggttccgt gccggcgtatggaatgtgtcctaagggtggtggtttcgacaaattggatgtggacattgctgatttccatctcaagagtgtagatgcagtt aaaaagggaactatgatgtctgcggtgtacacagggtctatcaaagttcaacaaatgaagaactacatagattacttaagtgcgtcgct ggcagctacagtctcaaacctctgcaag gtaagaggtcaaaaggtttccgcaatgatccctctttttttgtttctctagtttcaagaatttgggtatatgactaacttctgagtgttccttgatg catatttgtgatgagacaaatgtttgttctatgttttag gtgcttagagatgttcacggcgttgacccagagtcacaggagaaatctggagtgtgggatgttaggagaggacgttggttacttaaac ctaatgcgaaaagtcacgcgtggggtgtggcagaagacgccaaccacaagttggttattgtgttactcaactgggatgacggaaagc cggtttgtgatgagacatggttcagggtggcggtgtcaagcgattccttgatatattcggatatgggaaaacttaagacgctcacgtcttg cagtccaaatggtgagccaccggagcctaacgccaaagtaattttggtcgatggtgttcccggttgtggaaaaacgaaggagattatc gaaaag gtaagttctgcatttggttatgctccttgcattttaggtgttcgtcgctcttccatttccatgaatagctaagattttttttctctgcattcattctt cttgcctcagttctaactgtttgtggtatttttgttttaattattgctacaggtaaacttctctgaagacttgattttagtccctgggaaggaagctt SEQIDNo.5(partofpICH15034):(contains3Intronsshownunderlinedinitalics) ctgcag gtaaaatattggatgccagacgatattctttcttttgatttgtaactttttcctgtcaaggtcgataaattttattttttttggtaaaaggtcgataatt tttttttggagccattatgtaattttcctaattaactgaaccaaaattatacaaaccag gtttgctggaaaatttggttgcaatgatcaaaagaaacatgaatgcgccggatttgacagggacaattgacattgaggatactgcatct ctggtggttgaaaagttttgggattcgtatgttgacaaggaatttagtggaacgaacgaaatgaccatgacaagggagagcttctccag gtaaggacttctcatgaatattagtggcagattagtgttgttaaagtctttggttagataatcgatgcctcctaattgtccatgttttactggtttt ctacaattaaag gtggctttcgaaacaagagtcatctacagttggtcagttagcggactttaactttgtggatttgccggcagtagatgagtacaagcatatg atcaagagtcaaccaaagcaaaagttagacttgagtattcaagacgaatatcctgcattgcagacgatagtctaccattcgaaaaag atcaatgcgattttcggtccaatgttttcagaacttacgaggatgttactcgaaaggattgactcttcgaagtttctgttctacaccagaaag acacctgcacaaatagaggacttcttttctgacctagactcaacccaggcgatggaaattctggaactcgacatttcgaagtacgataa gtcacaaaacgagttccattgtgctgtagagtacaagatctgggaaaagttaggaattgatgagtggctagctgaggtctggaaacaa g gtgagttcctaagttccatttttttgtaatccttcaatgttattttaacttttcagatcaacatcaaaattaggttcaattttcatcaaccaaataat atttttcatgtatatatag gtcacagaaaaacgaccttgaaagattatacggccggaatcaaaacatgtctttggtatcaaaggaaaagtggtgatgtgacaacctt tattggtaataccatcatcattgccgcatgtttgagctcaatgatccccatgg SEQIDNo.6(fragmentofpICH15477,containing1Intronshowninunderlineditalics) Gttttagttttattgcaacaacaacaacaaattacaataacaacaaacaaaatacaaacaacaacaacatggcacaatttcaacaa acaattgacatgcaaactctccaagccgctgcgggacgcaacagcttggtgaatgatttggcatctcgtcgcgtttacgataatgcagt cgaggagctgaatgctcgttccagacgtcccaag gtaaaacaacatttcattcacatatatgaatacttttgtcattgagtacgaagaagacacttactacttgttgatgaaagtttccgcctttata cttatctatatcattttcatcatttcaaactagtatgaaattaggtgatgtttatatgatatcatggaacattaatctatagggaaactgttttgag ttagttttgtataatattittccctgtttgatgttag gttcatttctccaaggcagtgtctacggaacagacactgattgcaacaaacgcatatccggagttcgagatttcctttactcatacgcaat ccgctgtgcactccttggccggaggccttcggtcacttgagttggagtatctcatgatgcaagttccgttcggctctctgacctacgacatc ggcggaaacttctccgcgcacctcttcaaaggtaattttctttctctactcaattttctccaagatccaatatttgaagactgatctatagttaa aattaatctctactccattcttgttacctcaggtcgcgattacgttcactgctgcatgc: gttttagttttattgcaacaacaacaacaaattacaataacaacaaacaaaatacaaacaacaacaacatggcacaatttcaacaaa caattgacatgcaaactctccaagccgctgcgggacgcaacagcttggtgaatgatttggcatctcgtcgcgtttacgataatgcagtc gaggagctgaatgctcgttccagacgtcccaaggtaaaacaacatttcattcacatatatgaatacttttgtcattgagtacgaagaaga cacttactacttgttgatgaaagtttccgcctttatacttatctatatcattttcatcatttcaaactagtatgaaattaggtgatgtttatatgatat catggaacattaatctatagggaaactgttttgagttagttttgtataatatttttccctgtttgatgttaggttcatttctccaaggcagtgtctac ggaacagacactgattgcaacaaacgcatatccggagttcgagatttcctttactcatacgcaatccgctgtgcactccttggccggag gccttcggtcacttgagttggagtatctcatgatgcaagttccgttcggctctctgacctacgacatcggcggaaacttctccgcgcacct cttcaaaggtaattttctttctctactcaattttctccaagatccaatatttgaagactgatctatagttaaaattaatctctactccattcttgttac ctcaggtcgcgattacgttcactgctgcatgc SEQIDNo.7:T-DNAregionofpICH12691,whereinsequencesegmentshavethefollowing function: Nucleotides1to25:Leftborder(oppositestrand), Nucleotides86to1484:Nospromoter-NPTIIcodingsequence-Nosterminator(ontheopposite strand), Nucleotides1506to1552:AttPrecombinationsite(oppositestrand), Nucleotides1553to1599:intron5 part(oppositestrand), Nucleotides1600to2022:TVCVRdRP5 end(oppositestrand), Nucleotides2023to2809:Arabidopsisactin2promoter(oppositestrand), Nucleotides2836to2903:AttBrecombinationsite, Nucleotides2904to2959:intron3 part, Nucleotides2960to7991:TVCVRdRP3 part-MP5 part, Nucleotides7992to8168:cr-TMVMP3 end. Nucleotides8248to8967:GFPcodingsequence Nucleotides8961to9215:cr-TMV3 untranslatedregion, Nucleotides9234to9497:Nosterminator, Nucleotides9549to9473:T-DNArightborder(oppositestrand): tggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacacattgcggacgtttttaatgtactggggtggatgcagg tcgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgttttctatcgcgtattaaatgtataattgcg ggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaacgtaattcaacagaaattatatg ataatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatctgcttgactctagatccagagtc ccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaa gcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccg gccacagtcgatgaatccagaaaagcggccatttttccaccatgatattcggcaagcaggcatcgccatgagtcacgacgagatcctc gccgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgaca agaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcag ccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaa tagcagccagtcccttcccgcttcagtgacaacgtcgagcacagctgcgcaaggaacgcccgtcgtggccagccacgatagccgc gctgcctcgtcctggagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgcccctgcgctgacagccggaa cacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagcggccggagaacctgcgt gcaatccatcttgttcaatcatgcgaaacgatccagatccggtgcagattatttggattgagagtgaatatgagactctaattggataccg aggggaatttatggaacgtcagtggagcatttttgacaagaaatatttgctagctgatagtgaccttaggcgacttttgaacgcgcaata atggtttctgacgtatgtgcttagctcattaaactccagaaacccgcggctgagtggctccttcaacgttgcggttctgtcagttccaaacg taaaacggcttgtcccgcgtcatcggcgggggtcataacgtgactcccttaattctccgctcatggtaccagcttctcgagcgaccctac gcccccaactgagagaactcaaaggttaccccagttggggcacaacaaaaatcaaatctaaatttgtgtaattatgaaaatgaaactt acctttgaagaggtgcgcggagaagtttccgccgatgtcgtaggtcagagagccgaacggaacttgcatcatgagatactccaactc aagtgaccgaaggcctccggccaaggagtgcacagcggattgcgtatgagtaaaggaaatctcgaactccggatatgcgtttgttgc aatcagtgtctgttccgtagacactgccttggagaaatgaaccttgggacgtctggaacgagcattcagctcctcgactgcattatcgta aacgcgacgagatgccaaatcattcaccaagctgttgcgtcccgcagcggcttggagagtttgcatgtcaattgtttgttgaaattgtgcc atgttgttgttgtttgtattttgtttgttgttattgtaatttgttgttgttgttgcaataaaactaaaacttcaaagcggagaggaaaatatatgaattt atataggcgggtttatctcttacaactttattttcggcctttcaaaaaaataattaaaatcgacagacacgaatcatttcgaccacaggtaa agataacgtgacctggctgtcagacagccttttccctcgtgttaactaatttttaaactaattaatcatctcagcccttggattagttcttttgctt tgatggcttcatgactgtgacctgctcgatccgcgtgttacatgacagctccgtttttttagtggttaacttaaaccgagtcaatccaggcaa cgttagtcgtcgtcgtggttggcttgttcaattagatttcatacaattcaacgtaatttaattcgttttctattagaattgtatcataattattcag accgtgaaagaaagtgtctttcatgatgtgtttatggatatttatacaataagatacaatgtttcatcatattcactattcacgattagtatgta cattaaataatggctactactacatccgaactcgtcaaaacgattctgaatcaattatacatatgctgactcttgcatacataaaaaatag ttgtttaaattttgtctaactaatgtttggtataagtataatgttgagttgagataccaattacatcgagtctagccattttgtcgtgccatattcgt caaaactttcttacataatgataacctagatctagatgagatatgtatcaatgtatttgagatcataattaagttcgttctaaattttgtcgaaa cgcgtggtacgctgcagaattgctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcac ccatcttttattacatgtttgaacttcaacaatttatgactttttgttcttattgttgcaggtcgcgattacgttcactgctgcatgcctaatctggat gtacgtgacattgctcgccatgaaggacacaaggaagctatttacagttatgtgaatcgtttgaaaaggcagcagcgtcctgtgcctga ataccagagggcagctttcaacaactacgctgagaacccgcacttcgtccattgcgacaaacctttccaacagtgtgaattgacgaca gcgtatggcactgacacctacgctgtagctctccatagcatttatgatatccctgttgaggagttcggttctgcgctactcaggaagaatgt gaaaacttgtttcgcggcctttcatttccatgagaatatgcttctagattgtgatacagtcacactcgatgagattggagctacttttcagaa gtccggtgataatttaagttttttctttcataatgagagcactctcaattacacccacagttttagtaatataattaagtatgtgtgtaaaacgtt ctttcctgctagtcaacggtttgtgtatcataaggagtttttagttactagagtcaacacttggtactgtaagtttacgagagtggatacttttac tcttttccgtggtgtgtaccataataatgtggattgcgaagagttttacaaggctatggacgatgcgtggcactacaaaaagacgttagca atgcttaatgccgagaggaccatcttcaaggataacgctgcgttaaacttttggttcccgaaagtgagagacatggttatcgtccctctctt tgacgcttctatcacaactggtaggatgtctaggagagagattatggtgaacaaggatttcgtttatacggtcctaaatcacataaaaac gtatcaagctaaggctttaacttacgcaaatgttctgtcctttgtggagtctattaggtctagagtgataattaacggtgtcactgccaggtct gaatgggacacagacaaggcaattctaggtccattagcaatgacatttttccttataacaaagttgggtcatgtgcaggatgaaataatc ctgaaaaagttccagaagttcgacagaaccaccaatgagctgatttggacaagtctctgcgatgccctgatgggggttattccctcggt caaggagacgcttgtgcgcggtggttttgtgaaagtagcagaacaagccttagagataaaggttcccgagctatactgtacctttgccg acagattggtactacagtacaagaaggcggaggagttccaatcgtgtgatctttccaaacctctagaagagtcagagaagtactaca acgcattatccgagctatcagtgcttgagaatctcgactcttttgacttagaggcgtttaagactttatgtcagcagaagaatgtggaccc ggatatggcagcaaaggtggtcgtagcaatcatgaagtcagaattgacgttgcctttcaagaaacctacagaagaggaaatctcgga gtcgctaaaaccaggagaggggtcgtgtgcagagcataaggaagtgttgagcttacaaaatgatgctccgttcccgtgtgtgaaaaat ctagttgaaggttccgtgccggcgtatggaatgtgtcctaagggtggtgtttcgacaaattggatgtggacattgctgatttccatctcaa gagtgtagatgcagttaaaaagggaactatgatgtctgcggtgtacacagggtctatcaaagttcaacaaatgaagaactacatagat tacttaagtgcgtcgctggcagctacagtctcaaacctctgcaaggtgcttagagatgttcacggcgttgacccagagtcacaggaga aatctggagtgtgggatgttaggagaggacgttggttacttaaacctaatgcgaaaagtcacgcgtggggtgtggcagaagacgcca accacaagttggttattgtgttactcaactgggatgacggaaagccggtttgtgatgagacatggttcagggtggcggtgtcaagcgatt ccttgatatattcggatatgggaaaacttaagacgctcacgtcttgcagtccaaatggtgagccaccggagcctaacgccaaagtaatt ttggtcgatggtgttcccggttgtggaaaaacgaaggagattatcgaaaaggtaaacttctctgaagacttgattttagtccctgggaag gaagcttctaagatgatcatccggagggccaaccaagctggtgtgataagagcggataagagcaatgttagaacggtggattccttct tgatgcatccttctagaagggtgtttaagaggttgtttatcgatgaaggactaatgctgcatacaggttgtgtaaatttcctactgctgctatct caatgtgacgtcgcatatgtgtatggggacacaaagcaaattccgttcatttgcagagtcgcgaactttccgtatccagcgcattttgcaa aactcgtcgctgatgagaaggaggttagaagagttacgctcaggtgcccggctgatgttacgtatttccttaacaagaagtatgacggg gcggtgatgtgtaccagcgcggtagagagatccgtgaaggcagaagtggtgagaggaaagggtgcattgaacccaataaccttac cgttggagggtaaaattttgaccttcacacaagctgacaagttcgagttactggagaagggttacaaggatgtgaacactgtgcacga ggtgcaaggggagacgtacgagaagactgctattgtgcgcttgacatcaactccgttagagatcatatcgagtgcgtcacctcatgtttt ggtggcgctgacaagacacacaacgtgttgtaaatattacaccgttgtgttggacccgatggtgaatgtgatttcagaaatggagaagt tgtccaatttccttcttgacatgtatagagttgagcgggggtccaatagcaattacagatcgatgcagtattcagggacagcaacttgttt gttcagacgcccaagtcaggagattggcgagatatgcaattttactatgacgctcttcttcccggaaacagtactattctcaatgaatttga tgctgttacgatgaatttgagggatatttccttaaacgtcaaagattgcagaatcgacttctccaaatccgtgcaacttcctaaagaacaa cctattttcctcaagcctaaaataagaactgcggcagaaatgccgagaactgcaggtttgctggaaaatttggttgcaatgatcaaaag aaacatgaatgcgccggatttgacagggacaattgacattgaggatactgcatctctggtggttgaaaagttttgggattcgtatgttgac aaggaatttagtggaacgaacgaaatgaccatgacaagggaaagtttttctagatggctttcgaaacaagagtcatctacagttggtc agttagcggactttaactttgtggatttgccggcagtagatgagtacaagcatatgatcaagagtcaaccaaagcaaaagttagacttg agtattcaagacgaatatcctgcattgcagacgatagtctaccattcgaaaaagatcaatgcgattttcggtccaatgttttcagaactta cgaggatgttactcgaaaggattgactcttcgaagtttctgttctacaccagaaagacacctgcacaaatagaggacttcttttctgacct agactcaacccaggcgatggaaattctggaactcgacatttcgaagtacgataagtcacaaaacgagttccattgtgctgtagagtac aagatctgggaaaagttaggaattgatgagtggctagctgaggtatggaaacaaggacacagaaaaacgaccttgaaagattatac ggccggagtcaaaacatgtctttggtatcaaaggaaaagtggtgatgtgacaacctttattggtaataccatcatcattgcagcctgtttg agctcaatgatccccatggacaaagtgataaaggcagctttttgtggagacgatagcctgatttacattcctaaaggtttagacttgcctg atattcaggcgggcgcgaacctcatgtggaacttcgaggccaaactcttcaggaagaagtatggttacttctgtggtcgttatgttattca ccatgatagaggagccattgtgtattacgatccgcttaaactaatatctaagttaggttgtaaacatattagagatgttgttcacttagaag agttacgcgagtctttgtgtgatgtagctagtaacttaaataattgtgcgtatttttcacagttagatgaggccgttgccgaggttcataaga ccgcggtaggcggttcgtttgctttttgtagtataattaagtatttgtcagataagagattgtttagagatttgttctttgtttgataatgtcgatag tctcgtacgaacctaaggtgagtgatttcctcaatctttcgaagaaggaagagatcttgccgaaggctctaacgaggttaaaaaccgtg tctattagtactaaagatattatatctgtcaaggagtcggagactttgtgtgatatagatttgttaatcaatgtgccattagataagtatagat atgtgggtatcctaggagcgtgtttttaccggagagtggctagtgccagacttcgttaaaggtggagtgacgataagtgtgatagataagc gtctggtgaactcaaaggagtgcgtgattggtacgtacagagccgcagccaagagtaagaggttccagttcaaattgttccaaatta ctttgtgtccaccgtggacgcaaagaggaagccgtggcaggttcatgttcgtatacaagacttgaagattgaggcgggttggcagccg ttagctctggaagtagtttcagttgctatggtcaccaataacgttgtcatgaagggtttgagggaaaaggtcgtcgcaataaatgatccg gacgtcgaaggtttcgaaggtgtggttgacgaatcgtcgattcggttgcagcatttaaagcggttgacaactttaaaagaaggaaaaa gaaggttgaagaaaagggtgtagtaagtaagtataagtacagaccggagaagtacgccggtcctgattcgtttaatttgaaagaaga aaacgtcttacaacattacaaacccgaataatcgataactcgagtatttttacaacaattaccaacaacaacaaacaacaaacaaca ttacaattacatttacaattatcatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac gtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacca ccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcagctacggcgtgcagtgcttcagccgctaccccgaccacatga agcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaag acccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaa catcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcvatcaaggt gaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacg gccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatgg tcctgctggagttcgtgaccgccgccgggatcactcacggcatggacgagctgtacaagtaaagcggcccctagagcgtggtgcgc acgatagcgcatagtgtttttctctccacttgaatcgaagagatagacttacggtgtaaatccgtaggggtggcgtaaaccaaattacgc aatgttttgggttccatttaaatcgaaaccccttatttcctggatcacctgttaacgcacgtttgacgtgtattacagtgggaataagtaaaa gtgagaggttcgaatcctccctaaccccgggtaggggcccagcggccgctctagctagagtcaagcagatcgttcaaacatttggca ataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgta atgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgca aactaggataaattatcgcgcgcggtgtcatctatgttactagatcgaccagcttagatcagattgtcgtttcccgccttcagtttaaactat cagtgtttgacaggatatattggcgggtaaac