Microorganisms with enhanced carbon monoxide availability and use thereof

Abstract

The present invention relates to a protein variant, a microorganism with enhanced carbon monoxide (CO) availability comprising the variant, and a use thereof.

Claims

1. A protein variant having carbon monoxide dehydrogenase activity, wherein the 97.sup.th residue from the N-terminus of SEQ ID NO: 1, alanine (A), is substituted with a different amino acid, and wherein the different amino acid is selected from the group consisting of aspartic acid (D), glutamic acid (E), lysine (K), arginine (R), histidine (H), tyrosine (Y), asparagine (N), glutamine (Q), tryptophan (W), phenylalanine (P), methionine (M), and proline (P).

2. The protein variant of claim 1, wherein the different amino acid is glutamic acid (E).

3. The protein variant of claim 1, wherein the protein variant is encoded by a nucleotide sequence having a substitution at position 290 of SEQ ID NO: 2.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIGS. 1A-1D show graphs confirming the cell densities (OD.sub.600) and the growth rate of E. limosum according to CO concentrations during culture (FIGS. 1A and 1B), growth inhibition by CO treatment (FIG. 1C), and a production level of a metabolite (acetate) of E. limosum according to CO concentrations during culture (FIG. 1D), respectively (in which “na” denotes “not available”).

(2) FIG. 2A shows a graph confirming a cell density and an acetate production level under culture conditions for determining the transfer point of ALE.

(3) FIG. 2B shows a graph illustrating the measurement results of a cell growth rate according to evolution of generations during the process of ALE application.

(4) FIG. 2C shows a graph confirming a profile with respect to the growth of an ECO strain and a parent strain thereof and CO consumption under syngas conditions.

(5) FIG. 2D shows a graph confirming the growth rates of an ECO strain and a parent strain thereof according to CO concentrations.

(6) FIG. 2E shows a graph illustrating the measurement results of the cell densities (OD.sub.600) of an ECO strain and a parent strain thereof according to CO concentrations.

(7) FIG. 2F shows a graph confirming the acetate production level of an ECO strain and a parent strain thereof according to CO concentrations.

(8) FIGS. 3A-3D shows images confirming that a mutation, among the five kinds of key mutations, is included only in the acsA gene within the ECO_acsA, compared to the reference.

(9) FIG. 4 shows the Wood-Ljungdahl pathway of E. limosum and a schematic diagram illustrating a gene cluster involved in the Wood-Ljungdahl pathway, in which the region where a mutation has occurred is indicated with a star.

(10) FIG. 5A shows a graph illustrating the measurement results of the cell growth rates and cell densities of the ECO_acsA strain and a parent strain thereof under syngas conditions comprising 44% of CO.

(11) FIG. 5B shows a graph illustrating the measurement results of the cell growth rates of the ECO_acsA strain and a parent strain thereof under the conditions of CO concentrations of 0%, 20%, 40%, 60%, 80%, and 100%, respectively.

(12) FIG. 5C shows a graph illustrating the measurement results of the cell densities (OD.sub.600) of the ECO_acsA strain and a parent strain thereof under the conditions of CO concentrations of 0%, 20%, 40%, 60%, 80%, and 100%, respectively.

(13) FIGS. 6A-6B shows pathways illustrating the synthesis of acetoin from CO in the ECO_acsA strain (ECO_acsA_ACT), into which a plasmid encoding alsS and alsD genes are introduced, and from CO in a parent strain thereof (WT_ACT), into which the plasmid is introduced (FIG. 6A), and the amounts of acetoin produced from each strain above (FIG. 6B).

DETAILED DESCRIPTION OF THE INVENTION

(14) Hereinafter, the present invention will be described in more detail with reference to the following Examples. However, these Examples and Experimental Examples are for illustrative purposes only and the scope of the invention is not limited by these Examples and Experimental Examples.

EXAMPLE 1

Materials and Methods

(15) 1.1 Strains and Culturing Conditions

(16) Eubacterium limosum ATCC 8486 was distributed by the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) and used. The strain was cultured under anaerobic conditions at 37° C. As the culture medium, DSMZ 135 was used after modification and the specific composition is as follows: 1 g/L ammonium chloride, 2 g/L yeast extract, 10 g/L sodium bicarbonate, 0.1 g/L magnesium sulfate heptahydrate, 0.3 g/L cysteine-HC1, 10 mL vitamin solution (4 mg/L biotin, 4 mg/L folic acid, 20 mg/L pyridoxine-HCl, 10 mg/L thiamine-HCl, 10 mg/L riboflavin, 10 mg/L nicotinic acid, 10 mg/L pantothenate, 0.2 mg/L vitamin B12, 10 mg/L p-aminobenzoic acid and 10 mg/L lipoic acid), 4.64 mM KH.sub.2PO.sub.4, 5.36 mM K.sub.2HPO.sub.4, 4 μM resazurin, and 20 mL trace element solution (1.0 g/L nitrilotriacetic acid, 3.0 g/L MgSO.sub.4.7 H.sub.2O, 0.5 g/L MnSO.sub.4.H.sub.2O, 1.0 g/L NaCl, 0.1 g/L FeSO.sub.4.7 H.sub.2O, 180 mg/L CoSO.sub.4.7 H.sub.2O, 0.1 g/L CaCl.sub.2.2 H.sub.2O, 180 mg/L ZnSO.sub.4.7 H.sub.2O, 10 mg/L CuSO.sub.4.5 H.sub.2O, 20 mg/L KAI(SO.sub.4).sub.2.12 H.sub.2O, 10 mg/L H.sub.3BO.sub.3, 10 mg/L Na.sub.2MO.sub.4.2 H.sub.2O, 30 mg/L NiCl.sub.2.6 H.sub.2O, 0.3 mg/L Na.sub.2SeO.sub.3.5 H.sub.2O, 0.4 mg/L Na.sub.2WO.sub.4.2 H.sub.2O). The strain was cultured under the conditions of 50 mL headspace 200 kPa filled with 0%, 20%, 40%, 60%, 80%, and 100% CO using 100%, 80%, 60%, 40%, 20%, and 0% N.sub.2, respectively.

(17) In order to increase the autotrophic growth rate during the process of adaptive evolution, 40 mM NaCl conjugated with sodium dependent ATP synthase was supplemented to the medium.

(18) 1.2 Adaptive Laboratory Evolution (ALE)

(19) The ALE experiment was performed under the syngas conditions (44% CO, 22% CO.sub.2, 2% H.sub.2, and 32% N.sub.2) described in Example 1.1 above. Before performing the ALE, a pre-adaptation step was performed by allowing the syngas to pass therethrough three times in the mid-exponential phase. The ALE was performed with respect to four independent populations, and the medium in the mid-exponential phase was transferred to a fresh medium while performing the ALE.

(20) 1.3 Whole Genome Sequencing Library

(21) In order to construct a DNA library for entire genome re-sequencing, genomic DNA samples were extracted from an evolved population. Cell stock was cultured in a glucose (5 g/L) culture medium at 37° C. for 12 hours. The cells were collected and resuspended in 500 μL of a lysis buffer containing Tris-Cl (pH 7.5), 5 M NaCl, 1 M MgCl.sub.2, and 20% Triton X-100. Then, cells were frozen using liquid nitrogen and crushed using a mortar. The crushed powders were resuspended in 600 μL of a nuclei lysis solution (Promega, Madison, Wis.), incubated at 80° C., and cooled to 4° C. RNA was removed from the cell lysate using an RNase A solution. The proteins in the lysate were precipitated using a protein precipitation buffer (Promega). After precipitation, the sample was cooled at 4° C. for 10 minutes and centrifuged at 16,000×g for 10 minutes. The supernatant was transferred to a new tube and 1× volume of isopropanol was added thereto. The mixture was centrifuged at 16,000×g for 5 minutes to obtain a DNA pellet, which was washed twice with 80% ethanol. The quality of the DNA obtained was determined by the A260/A280 ratio (>1.9) and tested by gel electrophoresis, and the concentration was quantified using a Qubit® 2.0 Fluorometer (Invitrogen, Carlsbad, Calif.) with a Qubit™ dsDNA HS Assay kit (Invitrogen). The sequencing library was constructed using a TruSeq Nano DNA library prep kit (Illumina, La Jolla, Calif.). The constructed library of the evolved population was sequenced using an Illumina Hiseq2500 (a rapid-run mode as a 50 cycle-ended reaction), and the constructed library of the isolated clone was sequenced with an Illumina MiSeq (a 150-cycle ended reaction).

(22) 1.4 Screening of Mutations

(23) Sequencing readings were performed with the CLC genomics Workbench v6.5.1 (CLC bio, Aarhus, Denmark). Adapter sequences were removed with a trimming tool having default values (quality limit and ambiguous nucleotides residues 2).

(24) The resulting readings were mapped into E. limosum ATCC 8486 reference genome (NCBI Accession No. NZ_CP019962.1) using mapping parameters (mismatch cost: 2, indel cost: 3, deletion cost: 3, length fraction: 0.9, similarity fraction: 0.9). Variation detection from the mapped reading values was performed using a quality-based variation detection tool with the following parameters: neighborhood radius: 5, maximum gap and mismatch count: 5, minimum neighborhood quality: 30, minimum central quality: 30, minimum coverage: 10, minimum variant frequency: 10%, maximum expected alleles: 4, non-specific matches: ignore and genetic code: bacterial and plant plastid.

(25) 1.5 Isolation of Single Clones from Evolved Population

(26) The evolved population was streaked on an RCM agar medium to isolate single clones. In order to confirm the sequence of each mutation site, PCR was performed using the primer pairs shown in Table 4, and thereby, the genomic region was amplified and the sequences were analyzed by Sanger sequencing.

(27) TABLE-US-00004 TABLE 4 Sequence Primer (5′ .fwdarw. 3′) Note c1031_mut_confirm_F CAAAAGCCCTTAAA For amplification of ELIM_c1031 region TAGGCG containing mutation site (577 bp) and sequencing (SEQ ID NO: 5) of the mutation site using only forward primer c1031_mut_confirm_R AATGTCAAGCTGTA TTTGCG (SEQ ID NO: 6) c1073_mut_confirm_F GTGTCTGGCAAATG For amplification of ELIM_c1031 region GTATTG containing mutation site (968 bp) and sequencing (SEQ ID NO: 7) of the mutation site using only forward primer c1073_mut_confirm_R TTTAATCACGGTAT CACCCC (SEQ ID NO: 8) c1038_mut_confirm_F GTGTGAACATTGCA For amplification of ELIM_c1031 region CAGTC containing mutation site (945 bp) and sequencing (SEQ ID NO: 9) of the mutation site using only forward primer c1038_mut_confirm_R CAATCTCTGGAAAA AGCTGC (SEQ ID NO: 10) Final_confirm_foracsA_HA_F ACTGGCACTTGACA For amplification of ELIM_c1031 region CCGC containing mutation site (3,976 bp) (SEQ ID NO: 11) Final_confirm_forcooC2_HA_R ATAACAGCAACACC TGGG (SEQ ID NO: 12) acsA_mut_confirm_F ATGCAGACTCCGTT For sequencing of mutation site in acsA CTGG (SEQ ID NO: 13) cooc2_mut_confirm_F GTTAAAGAATGGAC For sequencing of mutation site in cooC2 TGGC (SEQ ID NO: 14)

(28) The selected single clones containing a mutation was cultured in a DSMZ 135 medium, to which CO was added to the headspace, and so as to measure the growth rate and the amounts of metabolites produced were measured.

(29) 1.6 Construction of Plasmid for Biosynthesis of Acetoin

(30) The primers used are shown in Table 5 below.

(31) TABLE-US-00005 TABLE 5 Primer Sequence (5′ .fwdarw. 3′) Note alsS_F CCATACGCGTGGATCCCTCGAGATGTTGACAA For amplification AAGCAACAAAAGAACAAAAATC of alsS and cloning (SEQ ID NO: 15) pJIR750_alsD_alsS alsS_R ATGATTACGAATTCGAGCTCCTAGAGAGCTTT CGTTTTCATGAGTTCC (SEQ ID NO: 16) alsD_F CGGTACCCGGGGATCCACGCGTATGGAAACT For amplification AATAGCTCGTGCGATTG (SEQ ID NO: 17) of alsD and cloning alsD_R ATGCCTGCAGGTCGACCTAACCCTCAGCCGCA pJIR750_alsD CGGATAG (SEQ ID NO: 18) alsD_P1121_U1121_F ACATCTCGAGGGATCCCATTTACCGGGCCAAG For cloning C (SEQ ID NO: 19) pJIR750_alsD_Ul121_P1121_alsS alsD_P_U1121_univ TAGTTTCCATACGCGTTTCCTCCTTGAAACAA GACGTTCTGAG (SEQ ID NO: 20) alsS_P2885_U1121_F3 CCGGTAAATGGGATCCTTTAAGCGTGAAGTG For cloning AAAAGAATGG (SEQ ID NO: 21) pJIR750_alsD_U1_1121- alsS_P_U1121_univ TTGTCAACATCTCGAGTTCCTCCTTGAAACAA P1121_P2885_U1121_alsS GACGTTCTGAG (SEQ ID NO: 22) PU_confirm_F CAGTTAAACGGCCGACTGCTTG For confirmation of (SEQ ID NO: 23) transformant by PU_confirm_R GTCCAGCCGGTTAAACGTGC (SEQ ID NO: 24) PCR (902 bp)

(32) The pJIR750ai plasmid was used as a shuttle vector, and the plasmid was cloned into E. coli DH5a (Enzynomics, Inc., Korea). The alsS gene (acetolactate synthase) was obtained from Bacillus subtilis and the alsD gene (acetolactate decarboxylase) was obtained from Aeromonas hydrophila by gene synthesis. The synthesized alsS and alsD genes were amplified using the alsS_F-alsS_R and alsD_F-alsD_R primers. Pvul-treated pJIR750ai (named pJIR750_PvuI_cut) was digested with BamHI and SalI, and the amplified alsD was assembled using an In-Fusion HD cloning Kit (TaKaRa, Japan). The assembled plasmid (pJIR_alsD) was linearized using SacI and BamHI, and then the pJIR750_alsS_alsD plasmid was prepared by assembling the alsS gene using the in-Fusion cloning. In order to control gene expression, the promoters of ELIM_c2885 (pyruvate:ferredoxin oxidaoreductase) and ELIM_c1121 ([Fe] hydrogenase), which are genes constitutively expressed at high levels in E. limosum, were selected and used. The wild-type promoter was amplified using genomic DNA of E. limosum and inserted into the pJIR750_alsS_alsD plasmid to construct the pJIR750_alsS_U_1121_P1121_P2885_U1121_alsD plasmid.

(33) 1.7 Transformation

(34) A protocol for preparing electrocompetent cells was performed. The cells were cultured in 100 mL of a DSM 135 medium to which glucose (5 g/L) was added. In the early-exponential phase (OD.sub.600: 0.3 to 0.5), the cells were recovered by centrifugation at 10,000 rpm at 4° C. for 10 minutes. The recovered cells were washed with 50 mL of a 270 mM sucrose buffer (pH 6) and resuspended to a final concentration of 10.sup.11 cells/mL.

(35) The pJIR750_alsS_U_1121_P1121_P2885_U1121_alsD plasmid (1.5°μg to 2°μg) was added to the electrocompetent cells, and the resulting solution was transferred to a°0.1-cm-gap Gene Pulser cuvette (Bio-Rad, Hercules, Calif.). Then, a 2.0°kV pulse was applied to the cells and the cells were immediately resuspended in 0.9° mL of a reinforced clostridial medium (RCM). The cells were recovered on ice for 5° minutes and incubated at 37° C. for 16° hours. The recovered cells were plated on an RCM plate (1.5% agar) containing thiamphenicol (15°μg/mL). Single colonies were selected and cultured in a DSM 135 medium to which glucose (5 g/L) was added.

(36) 1.8 Measurement of Metabolites

(37) The primary metabolite was measured by HPLC (Waters, Milford, Mass.). A refractive index detector and a MetaCarb 87 H 300° mm°×°7.8° mm column (Agilent, Santa Clara, Calif.) were used. As the mobile phase, a 0.007 N sulfuric acid solution was used at a flow rate of 0.6° mL/min. The oven temperature was 37° C. for acetate and butyrate and 50° C. for acetoin.

(38) 1.9 Measurement of Gas

(39) The CO concentration was measured by gas chromatography (Shimadzu, Japan). A thermal conductivity detector and a ShinCarbon ST Micropaked column (1 mm×2 m, 1/16″, 100/120 mesh) (Restek, Bellefonte, Pa.) were used. Helium was used as a carrier gas at a flow rate of 30 mL/min. The initial oven temperature was set at 30° C. for 1 minute, and the increase rate was 5° C./min until the temperature reached 100° C. The temperatures of the injector and the detector were both set at 100° C.

EXAMPLE 2

Results of Experiments

(40) 2.1 Growth of E. limosum ATCC 8486 in Carbon Monoxide (CO) Culture Conditions

(41) In order to confirm the CO tolerance of E. limosum ATCC 8486, cell growth was confirmed by culturing the strain in 100 mL of the modified DSMZ 135 medium of Example 1.1 at CO concentrations of 0%, 20%, 40%, 60%, 80%, and 100%, respectively. As a control group, the strain was incubated under 100% N.sub.2 gas without CO. The results are shown in FIGS. 1A and 1B.

(42) The control group showed a growth rate of 0.031±0.00211.sup.−1 and a maximum cell density of 0.049±0.005 (FIG. 1A). This low cell growth rate was assumed to be due to the presence of sodium bicarbonate and a yeast extract in the medium. At the CO concentration of 20%, it was confirmed that the cell growth rate was 0.066±0.00211.sup.−1 and the maximum cell density was 0.193±00.010. However, at the CO concentration of 40% to 100%, the cell growth rate was in the range of 0.058±0.000 h.sup.−1 to 0.040±0.000 h.sup.−1 and the maximum cell density was in the range of 0.438±0.038 to 0.063±0.003.

(43) Compared to the control group, the cell growth rate was increased by 2.15-fold at the CO concentration of 20% (FIG. 1B). However, as the CO concentration increased, the cell growth rate gradually decreased to 1.29-fold (in a 100% CO condition). Cells grown at the highest CO concentration had a maximum cell density of less than 0.063, which is slightly higher compared to the maximum cell density in the control group. These results indicate that cell proliferation was inhibited by the increase of the CO concentration in the growth medium.

(44) These results show a trend similar to the results that growth is completely inhibited when CO is present at a concentration of 25% or higher in the culture headspace in an experiment using an acetogen, Acetobacterium woodii (which is a strain close to the existing E. limosum); or to the results that growth is inhibited at CO concentrations of 50% or higher in an experiment culturing Thermoanaerobacter kivui. These results indicate that although an acetogenic microorganism can utilize CO to some extent, its growth is significantly affected by CO concentration.

(45) In addition, experiments to confirm the effect of CO on cell growth were performed. First, in a DSMZ 135 medium containing glucose (5 g/L), the microorganism was cultured until it reached the mid-exponential phase. In the mid-exponential phase (an OD.sub.600 value of 1.320), CO gas at concentrations of 0% (=100% N.sub.2, control group), 20%, 40%, 60%, 80%, or 100% was injected at the same pressure. After 2 hours, the OD.sub.600 value was measured. As a result, it was confirmed that the OD.sub.600 value was decreased at all CO concentrations (FIG. 1C).

(46) Then, in order to confirm the effect of CO on the phenotype, metabolites produced by E. limosum were analyzed and the results are shown in FIG. 1D. Among the identified metabolites, acetate was the most important metabolite, and acetate is known as a major metabolic final product of an acetogen under autotrophic culture conditions. Acetate biosynthesis produces ATP, which is required for cellular functions of an acetogen, and thus, acetate production is closely related to cell growth.

(47) The amount of acetate produced by the cells cultured in the absence of CO was at the level of 0.384±0.017 mM. However, under the conditions of CO at concentrations of 20%, 40%, 60%, 80%, and 100%, the acetate production level was 3.457±0.226 mM, 5.363±0.283 mM, 0.618±0.107 mM, 0.519±0.030 mM, and 0.279±0.006 mM, respectively. It was confirmed that the amount of acetate produced was increased under the conditions of CO at concentrations of 20% and 40% compared to other conditions. In addition, it was confirmed that the acetate production pattern was dependent on cell growth. In conditions of high CO concentrations, the amount of acetate produced decreased as the CO concentration increased, but it was not a significant change compared to the control group (P-value>0.05).

(48) These results suggest that acetate production correlates with a growth pattern that is affected by the amount of CO concentration in a culture medium, which suggests that the increase of CO tolerance potentially enhances acetate production in E. limosum.

(49) 2.2 ALE of E. limosum ATCC 8486 in CO Culture Conditions

(50) In order to improve the CO tolerance of E. limosum, adaptive laboratory evolution (ALE) was applied.

(51) First, the conditions to express desired phenotypes were set.

(52) Specifically, in order to determine CO tolerance, E. limosum was cultured under the conditions described in Example 1.1 to Example 1.2, and the transfer point of ALE was determined (FIG. 2A). Under this condition, the cell growth rate was 0.070±0.002 h.sup.−1 and the maximum cell density (OD.sub.600) was 0.486±0.021. This is different from that the cell growth rate, which was 0.058±0.000 h.sup.−1 under 40% CO condition, which is because the autotrophic growth of acetogens is enhanced in an environment where H.sub.2 is co-present with CO.

(53) According to the growth profile, the mid-exponential phase was 42 to 54 hours after the first inoculation. Therefore, 48 hours was determined as the transfer point of ALE.

(54) In order to perform ALE, four independent E. limosum groups (named as ALE1, ALE2, ALE3, and ALE4, respectively) were adapted and their reproducibility was confirmed. First, in the 40.sup.th generation, the growth rate of all of the groups was increased to 0.085 h.sup.−1, and this was maintained until the 120.sup.th generation (FIG. 2B). After adaptation, the growth rate began to show a slight difference at 0.086 h.sup.−1 in the 120.sup.th generation, but there was no change after the 150.sup.th generation (FIG. 2B). Accordingly, ALE was stopped in the 150.sup.th generation.

(55) To further examine changes in cell growth at the clonal level, the evolved strain ALE4 (hereinafter, ECO), which showed the highest growth rate of 0.089 h.sup.−1 in the 150.sup.th generation, was selected. Meanwhile, the other three groups (i.e., ALE1, ALE2, and ALE3) also showed similar growth rates of 0.086 h.sup.−1, 0.087 h.sup.−1, and 0.088 h.sup.−1, respectively.

(56) The growth and CO consumption profiles of ECO and its parent strain were compared under the conditions of syngas (FIG. 2C). The two strains completely consumed the CO present in the head space at 84 and 64 hours, respectively. The CO consumption rates were 0.043±0.019 mmol h.sup.−1 and 0.058±0.003 mmol h.sup.−1, respectively. These results indicate that the carbon consumption rate of the adapted strain was increased by 1.35-fold (FIG. 2C).

(57) In addition, it was confirmed that ECO and its parent strain reached the stationary phase at 72 and 48 hours, respectively, and the maximum cell densities (OD.sub.600) of the strains were increased by 1.28-fold to 0.498±0.028 and 0.639±0.016, respectively (FIG. 2C).

(58) Then, the CO tolerance of ECO was confirmed while changing the CO concentration from 0% to 100%, and the results are shown in FIG. 2D. The growth rates of the strains under the conditions of CO concentrations of 20% and 40% were 0.076±0.001 h.sup.−1 and 0.089±0.001 h.sup.−1, respectively, which were 1.21- and 1.56-fold higher compared to that of the parent strain under the same conditions, respectively (FIG. 2D). In addition, the growth rates were 0.069±0.001 h.sup.−1, 0.056±0.001 h.sup.−1 and 0.048±0.001 h.sup.−1, respectively, under the conditions of growth inhibition of 60%, 80%, and 100% CO, which were 1.64-, 1.30-, and 1.20-fold higher compared to that of the parent strain, respectively (FIG. 2D). In addition, the maximum OD.sub.600 value was confirmed under the condition of CO concentration of 60%, which was 7.49-fold higher compared to that of the parent strain (FIG. 2E).

(59) The amount of acetate produced by ECO at CO concentrations of 0%, 20%, 40%, 80%, and 100% were 0.274±0.060 mM, 3.835±0.215 mM, 6.819±0.457 mM, 8.311±0.254 mM, 0.866±0.217 mM, and 0.264±0.043 mM, respectively (FIG. 2F).

(60) From the above, it was confirmed that the acetate production was dependent on growth in both ECO and its parent strain, but the amount of acetate produced and the growth level were increased in ECO. These results indicate that the amount of CO consumed, the growth, and the tolerance were increased in the adaptively-evolved E. limosum under autotrophic conditions.

(61) 2.3 Confirmation of Mutations in Adaptive Evolutionary Strains Through Genome Re-Sequencing

(62) The genome was analyzed in order to confirm the genetic variation that causes the phenotypic changes shown in Example 2.1. For this purpose, the whole-genome sequencing of the first, the 50.sup.th, the 100.sup.th, and the 150.sup.th generations was performed, respectively. As a result, it was confirmed that there are a total of 39 mutations in all of the adaptively evolved strains (Table 6).

(63) TABLE-US-00006 TABLE 6 Samples Locus tag Position Type Reference Allele AA change ECO_acs ELIM_c1653 1,832,907 SNV C T Ala.sup.92Val A, 2, 3, 4 1,832,922 SNV C A Ala.sup.97Glu 1, 2, 3, 4 ELIM_c1031 1,126,411 Insertion — T Asn.sup.119LysfsX132 1, 2, 3, 4 Intergenic 1,970,647 SNV G A — 1, 2, 3 ELIM_c1654 1,834,784 Insertion — A Ala.sup.72AlafsX92 1, 2, 3 ELIM_c3581 3,896,831 SNV C A Asp.sup.66Tyr 1, 2, 3 Intergenic 1,972,135 SNV T C — 1, 2, 4 ELIM_c1038 1,130,590 SNV G A Glu.sup.48Lys 1, 2, 4 ELIM_c1073 1,159,055 SNV T G Tyr.sup.136X 1, 4 ELIM_c0527 588,552 Deletion C — Gly.sup.279ValfsX282 1 ELIM_c0236 256,802 SNV G T Ser.sup.348X 1 ELIM_c0337 370,333 SNV C G Glu.sup.315Gln 1 ELIM_c0437 483,053 SNV G A Ala.sup.185Val 1 ELIM_c0530 592,464 SNV G A Ile.sup.774Ile 1 ELIM_c0659 726,708 SNV G C Pro.sup.74Arg 726,714 SNV T C Asp.sup.72Gly 1 ELIM_c0672 739,966 SNV C A Ala.sup.88Ser 1 ELIM_c0750 832,772 SNV G C Ala.sup.326Ala 1 ELIM_c0854 938,560 SNV A G Lys.sup.490Arg 1 ELIM_c0866 952,049 SNV G A Val.sup.789Val 1 ELIM_c1063 1,148,482 SNV G T Gly.sup.741Trp 1 ELIM_c1325 1,436,020 SNV A G Ile.sup.865Thr 1 ELIM_c2814 3,101,419 SNV C A Ala.sup.63Ala 1 ELIM_c2882 3,162,881 SNV G A Gly.sup.38Arg 1 ELIM_c2942 3,240,199 SNV C A Arg.sup.143Arg 1 ELIM_c3150 3,443,977 SNV T C Asp.sup.310Gly 1 ELIM_c3386 3,699,117 SNV T A Leu.sup.144X 1 ELIM_c3427 3,747,388 SNV G T Asp.sup.56Tyr 1 ELIM_c3691 3,999,914 SNV C A Met.sup.194Ile 1 Intergenic 3,309,964 SNV A T — 2 ELIM_c2071 2,255,729 SNV C A Gly.sup.14Val 2 ELIM_c2621 2,852,312 SNV G C Leu.sup.152Leu 2 ELIM_c3002 3,306,141 SNV C T Ser.sup.47Ser 2 Intergenic 3,183,238 SNV G C — 2 Intergenic 3,305,753 SNV G A — 3 ELIM_c0293 322,696 SNV G T Ile.sup.170Ile 4 ELIM_c0006 5,401 SNV G T His.sup.99Asn 4 ELIM_c1330 1,446,536 SNV G A Val.sup.392Val 4 Intergenic 1,946,081 SNV G C —

(64) As a result of classification of these mutations, it was confirmed that 33 mutations were located in the genic regions and that 6 mutations were located in the intergenic regions.

(65) Among these, five key mutations accounting for the mutation frequency of top 15% were confirmed. These were confirmed as single base mutations (SNV) (i.e., ELIM_c1038, ELIM_c1073, and ELIM_c1653) and insertion mutations (i.e., ELIM_c1031 and ELIM_c1654) (Table 7).

(66) TABLE-US-00007 TABLE 7 Mutation Locus Tag Gene (Type) AA Change Description ELIM_c1031 — —356T (insertion) Asn.sup.119LysfsX133 Integrase family protein ELIM_c1038 — G133A (SNV) Glu48Lys Putative ATPase, transposase-like protein ELIM_c1073 dam T408G (SNV) Tyr.sup.136X N6 adenine-specific DNA methylase D12 class ELIM_c1653 acsA C290A (SNV) Ala97Glu CODH catalytic subunit ELIM_c1654 cooC2 —216A (insertion) Ala.sup.72AlafsX92 CODH nickel insertion accessory protein

(67) It was confirmed that two kinds of the above mutations were located in hypothetical genes, while the other three kinds were located in the genes whose functions are identified. In particular, it was confirmed that the two kinds of mutations are mutations in an active site and in a major region that determines maturity in acsA and cooC2 genes, which are the genes encoding the CODH/ACS complex.

(68) Specifically, it was assumed that although the mutation of acsA is not located in the active site of the enzyme, it may modify the structure of the protein by mutating a small non-polar amino acid into a large polar amino acid thereby affecting the activity of the protein. The other mutation occurred in cooC2 appeared as a synonymous substitution at the mutation site, but it induced a frame shift and thereby introduced an early stop codon 20 amino acids downstream of the mutation site. Considering that an early stop codon usually leads to a loss of gene function, this may be interpreted as having no effect in evolved strains regardless of the importance of cooC in autotrophic conditions.

(69) Based on the foregoing, it was interpreted that the mutation in the acsA gene, among the 5 major mutations, represents the altered phenotype of the strain that is adapted/evolved to autotrophic growth.

(70) 2.4 Effect of acsA Mutation on CO Fixation

(71) In order to verify the details confirmed in Example 2.3, additional experiments were performed.

(72) Among the 5 mutations identified in Example 2.3 above, the mutant strain, which has a mutation only in the acsA gene but has no mutations in the other four kinds of genes, was isolated (FIG. 3) and was named as ECO_acsA. This mutant strain was deposited at the Korean Culture Center of Microorganisms (KCCM) of the Korea Research Institute of Bioscience and Biotechnology (KRIBB) on Jun. 4, 2020, and was assigned Accession No. KCTC 14201BP.

(73) Meanwhile, it was confirmed that the ECO_acsA further includes other mutations in addition to the mutation of the acsA gene, but it was confirmed that the other mutations were mutations that could not have an effect on autotrophic growth conditions. These mutations included in the ECO_acsA are described in Table 8 below.

(74) TABLE-US-00008 TABLE 8 Mutation Locus Tag Gene (Type) AA Change Description ELIM_c0006 — G1265T (SNV) Ala.sup.422Glu Gp11 ELIM_c2214 — —413G Arg.sup.138Arg Hypothetical (insertion) protein ELIM_c2227 — G82T (SNV) Ala.sup.28Ser Terminase ELIM_cl653 acsA C290A (SNV) Ala.sup.97Glu CODH Catalytic subunit Intergenic — C2393145— — — (deletion) — A2393154— — — (deletion)

(75) An experiment to confirm the CO availability of the isolated ECO_acsA strain was performed. First, the growth profile of the isolated ECO_acsA strain was confirmed under the syngas conditions in the presence of 44% CO and then compared to that of the parent strain. In the ECO_acsA strain and its parent strain, the growth rates were 0.095±0.000 h.sup.−1 and 0.050±0.001 h.sup.−1, respectively, and the cell densities were 0.703±0.023 and 0.498±0.028, respectively (FIG. 5A). These results indicate that the ECO_acsA strain grows 1.9-fold faster and thus has a 1.41-fold higher cell density compared to its parent strain.

(76) Then, the production of metabolites and CO consumption by the ECO_acsA strain were measured under syngas conditions in the presence of 44% CO. As confirmed previously in the Examples, acetate was the main product, and the amount of acetate produced was 6.889 mM. Such an increase in the amount of acetate produced indicates that the C-cluster in the active site of the CODH subunit, which is encoded by the mutated acsA, increases CO utilization. As in the amount of acetate produced, CO consumption rates in the ECO_acsA strain and its parent strain were 0.059±0.002 mmol h.sup.−1 and 0.043±0.019 mmol 11.sup.−1, respectively, thus showing a difference of about 1.37-fold (FIG. 5A).

(77) Then, CO tolerance was measured at different CO concentrations. Under the conditions of CO concentrations of 20%, 40%, 60%, 80%, and 100%, the growth rate of the ECO_acsA strain was 0.070±0.001 h.sup.−1, 0.079±0.001 h.sup.−1, 0.059±0.001 h.sup.−1, 0.043±0.002 h.sup.−1, and 0.040±0.001 h.sup.−1, respectively, indicating that the growth rate gradually decreased at a CO concentration of 40% or higher (FIG. 5B). However, it was confirmed that the decreased growth rate was also an increase compared to that of the parent strain, and the growth rate was increased by 2.25-fold under the conditions of 40% CO. In addition, it was confirmed that in all of the CO conditions, the cell density of the ECO_acsA strain was increased compared to that of its parent strain (FIG. 5C). These results indicate that the CO resistance of the strain was increased significantly.

(78) These results, as predicted in Example 2.3, confirm that the phenotypic changes in E. limosum that appear when the microorganism is cultured under CO conditions are due to the mutation of acsA, and it can be seen that the acsA mutation is a key factor in the strain's utilization of CO.

(79) 2.5 Amount of Acetoin Produced by ECO_acsA Strain

(80) The genes involved in the acetoin biosynthesis pathway are present in E. limosum, but the production of acetoin under CO or glucose, and H.sub.2/CO.sub.2 conditions has not been confirmed. This was thought to be because insignificant transcription and translation are blocked when E. limosum is cultured under heterotrophic or eutrophic conditions. Therefore, whether it is possible to synthesize acetoin from the new biosynthetic pathway, that was confirmed based on the previous Examples, was confirmed.

(81) In order to synthesize acetoin, a plasmid, which includes alsS encoding α-acetolactate synthase (which produces one molecule of acetolactate by condensation of two molecules of pyruvic acid) and alsD encoding acetolactate decarboxylase (which converts acetolactate to acetoin), was constructed (FIG. 6A), and the plasmid was introduced into the parent strain by transformation. The specific method for plasmid construction is described in Example 1.6, and the method for strain preparation is described in Example 1.7.

(82) The prepared strain (WT_ACT) was cultured in syngas conditions in the presence of 44% CO (performed in three repetitions), and it was confirmed that acetoin was produced in an amount of 14.6±0.8 mM/gDW (FIG. 6B).

(83) The same plasmid was introduced into the ECO_acsA strain (ECO_acsA_ACT) and the amount of metabolites produced was measured under the same CO condition. As a result, it was confirmed that the amount of acetoin produced was 19.6±1.3 mM/gDW, which is an increase by 1.34-fold (P-value≤0.015).

(84) In addition, as a result of comparison of the amount of CO consumed, it was confirmed that the WT_ACT consumed CO in the amount of 429.8±131.6 mM/gDW, and the ECO_acsA_ACT consumed CO in the amount of 642.7±317.8 mM/gDW. That is, it can be interpreted that the ECO_acsA strain has increased CO resistance and CO consumption, and thus has an enhanced ability of producing acetoin.

(85) To summarize the above, it was confirmed that the mutations in the CODH/ACS complex can increase CO tolerance, CO consumption, and growth rates of strains in the presence of CO, and can be effectively used in the design of strains. Therefore, it can be seen that these mutations can also be applied to the production of useful products such as acetoin.

(86) From the foregoing, one of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. On the contrary, the present invention is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims [Accession No.]

(87) Depositary: Korea Research Institute of Bioscience and Biotechnology

(88) Accession Number: KCTC14201BP

(89) Deposited Date: Jun. 4, 2020