Methods of inducing an immune response against HIV by administering immunogenic peptides obtained from protease cleavage sites
10285942 ยท 2019-05-14
Assignee
Inventors
Cpc classification
C07K14/163
CHEMISTRY; METALLURGY
C12N2740/16022
CHEMISTRY; METALLURGY
C12N2740/16034
CHEMISTRY; METALLURGY
A61K39/21
HUMAN NECESSITIES
C12N2740/16334
CHEMISTRY; METALLURGY
C12N2740/16322
CHEMISTRY; METALLURGY
A61K2039/55555
HUMAN NECESSITIES
C12N2740/16234
CHEMISTRY; METALLURGY
C12N2760/18043
CHEMISTRY; METALLURGY
C07K14/161
CHEMISTRY; METALLURGY
C12N2740/16222
CHEMISTRY; METALLURGY
C12N2740/15034
CHEMISTRY; METALLURGY
A61K2039/57
HUMAN NECESSITIES
A61K9/14
HUMAN NECESSITIES
International classification
A61K39/21
HUMAN NECESSITIES
A61K9/14
HUMAN NECESSITIES
Abstract
Instead of generating immune responses to several HIV proteins and risk over activating more CD4+ T cells (easy targets for HIV-1 infection) as current candidate vaccines try to do, a lower magnitude, narrowly focused, well maintained virus specific CD8+ T cell response to multiple subtypes should destroy and eliminate a few founder viruses without inducing inflammatory responses that may activate more CD4+ T cells and provide more targets for HIV-1 virus infection. Specifically, described herein is a method that focuses the immune response to the 12 protease cleavage sites.
Claims
1. A method of eliciting an immune reaction in an individual comprising administering to an individual in need of such treatment an effective amount of a peptide consisting of the amino acid sequence as set forth in any one of SEQ ID NO: 1-12.
2. The method according to claim 1 consisting of the amino acid sequence as set forth in SEQ ID NO: 1.
3. The method according to claim 1 wherein the peptide is administered as a medicament.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DESCRIPTION OF THE PREFERRED EMBODIMENTS
(15) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference.
(16) Because of its essential role in the production of infectious virions, HIV protease has been the major therapeutic target against AIDS. Protease inhibitors have been successfully used to treat HIV-1 infection and are an essential component of successful HAART therapies (Anderson et al., 2009, Handb Exp Pharmacol 85-110). Most of the protease inhibitors were designed to compete with the protease's natural substrates based on the structure of the active binding site (Debouck 1992, AIDS Res Hum Retroviruses 8: 153-164; Laco et al., 1997, Biochemistry 36: 10696-10708; McDonald et al., 1997, Arch Intern Med 157: 951-959; Wlodawer et al., 2000, Biochim Biophys Acta 1477: 16-34; Wlodawer et al., 1998, Ann Rev Biophys Biomol Struct 27: 249-284). Recently, drugs that target Gag by preventing protease mediated processing at specific Gag cleavage sites have been developed (Adamson et al., 2009, Mol Intery 9: 70-74; Adamson et al., 2010, Antiviral Res 85: 119-141; Adamson et al., 2008, Drug Discov Today 13: 424-432; Adamson et al., 2009, Expert Opin Ther Targets 13: 895-908; Keller et al., 2010, J Virol 85: 1420-1428). Studies have shown that the process of protease cleavage requires a tightly controlled, ordered sequence of proteolytic processing events mediated by different rates of cleavage at the different processing sites (Muller et al., 2009, J Biol Chem 284: 29692-29703; Pettit et al., 2005, J Virol 79: 10601-10607; Pettit et al., 2004, J Virol 78: 8477-8485; Pettit et al., 2002, J Virol 76: 10226-10233; Pettit et al., 2005, Retrovirology 2: 66; Pettit et al., 1994, J Virol 68: 8017-8027; Wiegers et al., 1998, J Virol 72: 2846-2854). Even subtle disturbances may be sufficient to interrupt this delicately balanced process and drive it toward a non-productive end (Kaplan et al., 1993, J Virol 67: 4050-4055; Muller et al., 2009, J Biol Chem 284: 29692-29703; Pettit et al., 2005, J Virol 79: 10601-10607; Pettit et al., 2005, Retrovirology 2: 66).
(17) Since the protease cleavage sites are highly conserved among major subtypes of HIV-1, direct immune responses against these cleavage sites would yield several advantages. First, the host immune response may destroy the virus before it can establish itself permanently in the host. Second, the vaccine could force the virus to accumulate mutations, eliminating the normal function of the HIV protease and thus eliminating viable virions. Third, limiting immune responses to these sites avoids immune responses that often generate unwanted inflammatory responses and excessive immune activation which lead to more targets for HIV-1 infection, establishment and spread.
(18) Based on the correlates of protection from HIV in highly exposed but uninfected sex workers in the Pumwani cohort, it is hypothesized that to prevent HIV-1 acquisition, a vaccine should achieve all of the following: 1) focus on the key sites of HIV-1 instead of whole Gag and/or Env protein; 2) recognize multiple HIV subtypes; 3) avoid excess immune activation. A vaccine targeting the 12 protease cleavage sites will achieve this by restricting the immune response to the key sites of HIV-1, force the virus to mutate to its disadvantage and avoid excess immune activation. As discussed herein, the classical vaccine approach, which is aimed at generating strong immune response to full Gag and Env of HIV-1, does not take into account the potential adverse impact of generating wide spread immune responses to HIV antigens on creating enhanced susceptibility to HIV-1 virus, especially activated CD4+ T cells. In addition, since not all CD8+ T cell responses are equally effective, the effective T cell responses could be distracted by ineffective T cell responses and be neutralized by the side effects of excess immune activation, which will attract more target cells for HIV-1 as a result of the induced inflammatory responses.
(19) As discussed herein, one novel vaccine strategy is to target the function of HIV-1 protease, Protease cleavage sites (PCS) of HIV-1 are highly conserved amongst the major subtypes and proper cleavage of all 12 protease recognition sites is needed to generate a viable virion. Directing immune responses against these cleavage sites could destroy the virus before it can establish itself in the host. Alternatively, it would force the virus to accumulate mutations at the PCSs, thus eliminating the ability of the protease to generate infectious virions. As discussed herein, we generated immune responses to peptides corresponding to 12 PCSs of SIVmac239 using a vesicular stomatitis viral (VSV) vector to test the feasibility of this vaccine approach.
(20) Understanding that infection of CD4+ T cells, a key component of the immune system, is the key difference between HIV-1 and other infectious pathogens and activated CD4+ T cells are easier targets for HIV-1 infection is the key to designing vaccines eliciting a narrow spectrum of epitope presentation. Theoretically, recognizing more epitopes will activate more CD8+ T cells to destroy the virus infected cells. However, this could also activate more CD4+ T cells through secretion of cytokines. Because increased CD4+ T cell activation and recruitment to mucosal sites has the potential to enhance HIV transmission, this could explain why B*07:02, an allele that can recognize a broad spectrum of Gag epitopes, is associated with rapid seroconversion.
(21) Instead of generating immune responses to several HIV proteins and risk over activating more CD4+ T cells (easy targets for HIV-1 infection) as current candidate vaccines try to do, a lower magnitude, narrowly focused, well maintained virus specific CD8+ T cell response to multiple subtypes should destroy and eliminate a few founder viruses without inducing inflammatory responses that may activate more CD4+ T cells and provide more targets for HIV-1 virus infection. Specifically, described herein is a method that focuses the immune response to the 12 protease cleavage sites. Unlike antiprotease drug approaches, this method generates host immune responses that target the 12 protease cleavage sites (p17/24, p24/p2, p2/p7, p7/p1, p1/p6, p7/TFP, TFP/p6, P6/PR, PR/RTp51, RT/RTp66, RTp66/INT, NEF). This method aims at eliminating HIV by destroying infected cells and preventing proper viral processing. As discussed herein, anti-protease drugs force mutations in the active site of the protease; cleavage site mutations to evade the antibody and T cell responses should still result in mutations which prevent efficient viral protein processing.
(22) To test the feasibility of this vaccine approach, we used 12 VSV-peptide viruses (IM immunization) and nanopackaged peptides (intranasal boost) as immunogens and 18 Cynomolgus macaques/SIVmac239. As discussed herein, this showed that VSV-peptides immunization and nano-packaged peptide boost generated both antibody and T cell responses to the 12 peptides overlapping the 12 protease cleavage sites and immune responses to the specific peptides depends on the MHC of the monkeys. We used a cumulative, accelerated high dose SIVmac239 intrarectal challenge (1000, 2000, and 3 4000 TCID.sub.50) to examine whether immune response to the 12 protease cleavage sites can protect macaques from SIV infection. Results showed that after a cumulative 7000 TCID.sub.50 challenge, monkeys with immune responses to one or more of the 12 peptides are better protected from SIVmac239 infection when compared to the controls which received no immunization and the monkeys without immune responses to the peptides (Odds ratio: 13.3, 95% Cl: 1.05-169.6, p=0.047, Fisher's exact). Preliminary analysis of plasma antibodies to the peptides of the 12 protease cleavage sites showed that macaques with antibody responses to more peptides are better protected from the higher dose of SIVmac239 challenge (p=0.012). Thus, generating immune responses specifically targeting the 12 protease cleavage sites can protect the macaques from high dose SIVmac239 mucosal challenge.
(23) Non-human primates (NHPs) are important and arguably the best animal models to evaluate the safety and efficacy of candidate vaccines against human pathogens and study the pathogenesis of infectious and immune-mediated diseases, because they are immunologically similar to humans and are susceptible to many of the same pathogens (Bontrop, R. E., Non-human primates: essential partners in biomedical research. Immunol Rev, 2001. 183: p. 5-9.). Among the nonhuman primates Cynomolgus macaques (Macaca fascicularis) are a common model for pathogenesis studies and are more readily available than Rhesus macaques. They are widely used in many infectious disease studies, including TB, Ebola, Dengue, SIV and HIV (Walsh, G. P., et al., Nat Med, 1996. 2(4): p. 430-6; Larsen, M. H., et al., Vaccine, 2009. 27(34): p. 4709-17; Okada, M., et al., Vaccine, 2009. 27(25-26): p. 3267-70; Pawar, S. N., et al., AIDS Res Hum Retroviruses, 2008. 24(4): p. 643-54; Kita, Y., et al., Vaccine, 2005. 23(17-18): p. 2132-5; Qiu, X., et al., PLoS One, 2009. 4(5): p. e5547; Geisbert, T. W., et al., J Virol, 2009. 83(14): p. 7296-304; Geisbert, T. W., et al., Vaccine, 2008. 26(52): p. 6894-900; Warfield, K. L., et al., J Infect Dis, 2007. 196 Suppl 2: p. S430-7; Swenson, D. L., et al., Olin Vaccine Immunol, 2008. 15(3): p. 460-7; Sullivan, N. J., et al., PLoS Med, 2006. 3(6): p. e177; Feldmann, H., et al., Nat Rev Immunol, 2003. 3(8): p. 677-85; Clarke, T. and J. Knight, Nature, 2003. 424(6949): p. 602; Ikegami, T., Exp Anim, 2002. 51(5): p. 447-55; Garbutt, M., et al., J Virol, 2004. 78(10): p. 5458-65; Angsubhakorn, S., et al., Trans R Soc Trop Med Hyg, 1988. 82(5): p. 746-9; Bernardo, L., et al., Clin Vaccine Immunol, 2008. 15(3): p. 439-46; Guy, B., et al., Am J Trop Med Hyg, 2009. 80(2): p. 302-11; Bernardo, L., et al., Antiviral Res, 2008. 80(2): p. 194-9; Koraka, P., et al., Vaccine, 2007. 25(29): p. 5409-16; Koraka, P., et al., Microbes Infect, 2007. 9(8): p. 940-6; Butrapet, S., et al., Southeast Asian J Trop Med Public Health, 2002. 33(3): p. 589-99; Nakayama, E. E. and T. Shioda, Rev Med Virol. 20(2): p. 77-92; Jiang, Y., et al., J Med Primatol, 2009. 38 Suppl 1: p. 39-46; Turbant, S., et al., Vaccine, 2009. 27(39): p. 5349-56; Bourry, O., et al., Aids, 2009. 23(4): p. 447-54; Kamada, K., et al., Microbes Infect, 2009. 11(2): p. 164-71; Morner, A., et al., J Virol, 2009. 83(2): p. 540-51; Malleret, B., et al., Blood, 2008. 112(12): p. 4598-608; Dahl, M. E., et al., J Pharmacol Exp Ther, 2008. 327(3): p. 926-33; Brennan, G., Y. Kozyrev, and S. L. Hu, Proc Nati Acad Sci USA, 2008. 105(9): p. 3569-74; Vieillard, V., et al., Proc Natl Acad Sci USA, 2008. 105(6): p. 2100-4; Vieillard, V., et al., Aids, 2008. 22(2): p. 185-92; Prost, S., et al., J Clin Invest, 2008. 118(5): p. 1765-75; Karlsson, I., et al., J Virol, 2007. 81(24): p. 13456-68.)
(24) As discussed herein, peptides that correspond to the cleavage site of the HIV-1 protease and may be used in a vaccine preparation include:
(25) TABLE-US-00001 p17(MA)/p24(CA): (SEQIDNO:1) GNSSKVSQNYPIVQNLQGQM; p24(CA)/P2: (SEQIDNO:2) GGPSHKARVLAEAMSQVTNT; p2/p7(NC): (SEQIDNO:3) MSQVQHTNIMMQRGNFKGQKI; p7(NC)/p1: (SEQIDNO:4) MKDCTERQANFLGKIWPSNK; p1/p6gag: (SEQIDNO:5) PSHKGRPGNFLQSRPEPTAP; p7(NC)/TFP: (SEQIDNO:6) MKDCTERQANFLRENLAFQQ; TFP/p6pol: (SEQIDNO:7) ANFLRENLAFQQGEAREFSS; P6pol/PR (SEQIDNO:8) ERQGTVSFSFPQITLWQRPL; PR/RTp51 (SEQIDNO:9) LTQIGCTLNFPISPIETVPV; RT/RTp66 (SEQIDNO:10) KEPIA(I)GAETFYVDGAANRET; RTp66/INT (SEQIDNO:11) LVSNGERKVLFLDGIDKAQE; and Nef (SEQIDNO:12) TAQTNPDCAWLEAQEEEEVG.
(26) According to an aspect of the invention, there is provided a purified or isolated peptide consisting of an amino acid sequence as set forth in any one of SEQ ID NO: 1-12. In a preferred embodiment, the purified or isolated peptide consists of the amino acid sequence as set forth in SEQ ID NO: 1.
(27) According to another aspect of the invention, there is provided a nanoparticle comprising a peptide consisting of the amino acid sequence as set forth in any one of SEQ ID NO: 1-12. In a preferred embodiment, the nanoparticle comprises 12 distinct peptides, a respective one having an amino acid sequence as set forth in a respective one of SEQ ID NO: 1-12.
(28) As used herein, purified does not necessarily mean absolute purity but rather means that the peptide has been purified or enriched by 2, 4, 10, 20, 100 fold or more.
(29) As used herein, isolated means that the peptide has been removed from its natural environment.
(30) For synthetic peptides, purified or isolated may mean for example that the components associated with peptide synthesis have been substantially removed.
(31) According to another aspect of the invention, there is provided the use of a peptide consisting of the amino acid sequence as set forth in any one of SEQ ID NO: 1-12 for eliciting an immune response in an individual in need of such treatment.
(32) As used herein, an individual in need of such treatment refers to an individual who desires protective immunity against HIV-1 infection. Such an individual may be for example an individual who has been infected with HIV-1, an individual who has recently been infected with HIV-1, an individual who is suspected of having been infected with HIV-1, a person who is at risk of infection with HIV-1 and/or an individual who desires protective immunity against HIV-1. Preferably, the individual is a human.
(33) According to another aspect of the invention, there is provided a method of eliciting an immune reaction in an individual comprising administering to an individual in need of such treatment an effective amount of a peptide consisting of the amino acid sequence as set forth in any one of SEQ ID NO: 1-12.
(34) According to another aspect of the invention, there is provided a method of preparing a medicament comprising admixing an isolated peptide consisting of the amino acid sequence as set forth in any one of SEQ ID NO: 1-12 and a suitable excipient for eliciting an immune response against HIV-1.
(35) According to another aspect of the invention, there is provided a medicament for eliciting an immune response against HIV-1 in an individual comprising a peptide consisting of the amino acid sequence as set forth in any one of SEQ ID NO: 1-12 and a suitable excipient.
(36) According to another aspect of the invention, there is provided a medicament for eliciting an immune response against HIV-1 in an individual comprising an effective amount of each of 12 peptides, each representative peptide consisting of the amino acid sequence as set forth in a respective one of SEQ ID NO: 1-12; and a suitable excipient.
(37) In another embodiment of the invention, nucleic acid sequences encoding the above-described peptides are prepared.
(38) As will be appreciated by one of skill in the art, because of the degeneracy of the genetic code, a number of different nucleic acid molecules can be generated which all encode a single peptide. Consequently a number of different nucleic acid molecules encoding the amino acid sequences as set forth in any one of SEQ ID NO: 1-12 can be constructed.
(39) According to an aspect of the invention, there is provided a purified or isolated nucleic acid molecule encoding the amino acid sequence as set forth in any one of SEQ ID NO: 1-12.
(40) As will be appreciated by one of skill in the art, in these embodiments, the nucleic acid molecule may be inserted into a vector, for example, an expression system. It is of note that many suitable expression vectors and systems will be readily apparent to one of skill in the art.
(41) According to another aspect of the invention, there is provided the use of a purified or isolated nucleic acid molecule encoding the amino acid sequence as set forth in any one of SEQ ID NO: 1-12 for eliciting an immune response in an individual in need of such treatment.
(42) In embodiments such as these, in which a nucleic acid molecule is used, for example, to elicit an immune response or treat an individual, it is to be understood that the nucleic acid molecule encoding the peptide is arranged for expression within the host cell. In some embodiments, the nucleic acid molecule may be naked DNA or the nucleic acid molecule may be inserted into a suitable vector system as discussed above and may be operably linked to a suitable promoter such that the encoded peptide is expressed in the desired cells. As discussed above and herein, such expression systems are well known in the art.
(43) According to another aspect of the invention, there is provided a method of eliciting an immune reaction in an individual comprising administering to an individual in need of such treatment an effective amount of a nucleic acid molecule encoding the amino acid sequence as set forth in any one of SEQ ID NO: 1-12.
(44) According to another aspect of the invention, there is provided a method of preparing a medicament comprising admixing a nucleic acid molecule encoding the amino acid sequence as set forth in any one of SEQ ID NO: 1-12 and a suitable excipient for eliciting an immune response against HIV-1.
(45) According to another aspect of the invention, there is provided is provided a medicament for eliciting an immune response against HIV-1 in an individual comprising a nucleic acid molecule encoding the amino acid sequence as set forth in any one of SEQ ID NO: 1-12 and a suitable excipient.
(46) According to another aspect of the invention, there is provided is provided a medicament for eliciting an immune response against HIV-1 in an individual comprising 12 nucleic acid molecules, each representative one of said nucleic acid molecules encoding the amino acid sequence as set forth in a respective one of SEQ ID NO: 1-12; and a suitable excipient.
(47) As will be apparent to one of skill in the art, the frequency of usage of specific codons is known in many organisms. Accordingly, it is possible to develop or engineer or construct a nucleic acid molecule encoding a specific peptide using the most frequently used codons so that maximum expression of the peptide encoded by the nucleic acid molecule is achieved.
(48) Accordingly, SEQ ID NOS: 13-24 represent codon-optimized sequences for expression in mammalian cells of the peptides encoded by the amino acid sequences set forth in SEQ ID NO: 1-12.
(49) TABLE-US-00002 p17(MA)/p24(CA): (SEQIDNO:13) GGCAACAGCAGCAAGGTGAGCCAGAACTACCCCATCGTGCAGAACCTGCA GGGCCAGATG; p24(CA)/P2: (SEQIDNO:14) GGCGGCCCCAGCCACAAGGCCAGGGTGCTGGCCGAGGCCATGAGCCAGGT GACCAACACC; p2/p7(NC): (SEQIDNO:15) ATGAGCCAGGTGCAGCACACCAACATCATGATGCAGAGGGGCAACTTCAA GGGCCAGAAG; p7(NC)/p1: (SEQIDNO:16) ATGAAGGACTGCACCGAGAGGCAGGCCAACTTCCTGGGCAAGATCTGGCC CAGCAACAAG; p1/p6gag: (SEQIDNO:17) CCCAGCCACAAGGGCAGGCCCGGCAACTTCCTGCAGAGCAGGCCCGAGCC CACCGCCCCC; p7(NC)/TFP: (SEQIDNO:18) ATGAAGGACTGCACCGAGAGGCAGGCCAACTTCCTGAGGGAGAACCTGGC CTTCCAGCAG; TFP/p6pol: (SEQIDNO:19) GCCAACTTCCTGAGGGAGAACCTGGCCTTCCAGCAGGGCGAGGCCAGGGA GTTCAGCAGC; P6pol/PR: (SEQIDNO:20) GAGAGGCAGGGCACCGTGAGCTTCAGCTTCCCCCAGATCACCCTGTGGCA GAGGCCCCTG; PR/RTp51: (SEQIDNO:21) CTGACCCAGATCGGCTGCACCCTGAACTTCCCCATCAGCCCCATCGAGAC CGTGCCCGTG; RT/RTp66: (SEQIDNO:22) AAGGAGCCCATCRYCGGCGCCGAGACCTTCTACGTGGACGGCGCCGCCAA CAGGGAGACC; RTp66/INT: (SEQIDNO:23) CTGGTGAGCAACGGCATCAGGAAGGTGCTGTTCCTGGACGGCATCGACAA GGCCCAGGAG; and Nef: (SEQIDNO:24) ACCGCCCAGACCAACCCCGACTGCGCCTGGCTGGAGGCCCAGGAGGAGGA GGAGGTGGGC.
(50) According to an aspect of the invention, there is provided a purified or isolated nucleic acid molecule consisting of the nucleotide sequence as set forth in any one of SEQ ID NO: 13-24.
(51) According to another aspect of the invention, there is provided the use of a nucleic acid molecule consisting of the nucleotide sequence as set forth in any one of SEQ ID NO: 13-24 for eliciting an immune response in an individual in need of such treatment.
(52) According to another aspect of the invention, there is provided a method of eliciting an immune reaction in an individual comprising administering to an individual in need of such treatment a nucleic acid molecule consisting of the nucleotide sequence as set forth in any one of SEQ ID NO: 13-24.
(53) An effective amount of the nucleic acid molecule may be an amount sufficient to generate a sufficient amount of the encoded peptide to elicit an immune response or immune reaction, for example, to elicit protective immunity.
(54) According to another aspect of the invention, there is provided a method of preparing a medicament comprising admixing an effective amount of a nucleic acid molecule encoding the nucleotide sequence as set forth in any one of SEQ ID NO: 13-24 and a suitable excipient for eliciting an immune response against HIV-1.
(55) According to another aspect of the invention, there is provided a medicament for eliciting an immune response against HIV-1 in an individual comprising a nucleic acid molecule consisting of the nucleotide sequence as set forth in any one of SEQ ID NO: 13-24 and a suitable excipient.
(56) According to another aspect of the invention, there is provided is provided a medicament for eliciting an immune response against HIV-1 in an individual comprising an effective amount of 12 nucleic acid molecules, each respective one of said 12 nucleic acid molecules consisting of the nucleotide sequence as set forth in a respective one of SEQ ID NO: 13-24; and a suitable excipient.
(57) Generating immune responses to any antigen, for example, a peptide having an amino acid sequence as set forth in any one of SEQ ID NO: 1-12 requires an efficient antigen delivery system. One advantage of using viral vectors as vaccines is that they are believed to act as their own adjuvant by stimulating the innate immune response through the binding of viral components to pathogen recognition receptors of the host cells (Clarke et al., 2006, Springer Semin Immunopathol 28: 239-253). Delivery of antigens in nanoparticles can protect antigens against degradation by enzymes, facilitate uptake by APCs, prolong presentation of antigens, induce cell-mediated immune responses, elicit more effective immune responses than soluble antigens (Csaba et al., Adv Drug Deliv Rev 61: 140-157; De Temmerman et al., 2011, Drug Discov Today 16: 569-582; Koping-Hoggard et al., 2005, Expert Rev Vaccines 4: 185-196). To test the hypotheses that an effective preventative HIV vaccine selectively targets the key sites of HIV-1 and a vaccine targeting the 12 protease cleavage sites of HIV-1 can prevent HIV-1 acquisition, we selected two antigen delivery methods: recombinant vesicular stomatitis virus and nanoparticle antigen delivery system, discussed herein.
(58) The pATX VSVG4 plasmid encodes the full-length VSV virus with the exception of the native glycoprotein (GP). This virus vector was modified to tolerate the addition of four foreign genes due to the presence of four unique multiple cloning sites (MCS#1 to 4). The nucleotide sequences (SEQ ID NO: 37-48) encoding the peptide overlapping the 12 protease cleavage sites (SEQ ID NO: 25-36) were codon-optimized for expression in mammalian cells as discussed above and synthesized by PCR from complementary 40-mer oligonucleotide primers along with flanking Mlul/Blnl restriction sites required for cloning into the desired location of pATX VSVG4. The nucleotide sequence of each peptide was cloned into PCR 2.1-TOPO TA vector and then inserted into MCS#3 of pATX VSVG4 in order to facilitate stronger immune responses.
(59) As discussed below, experiments in mice demonstrated that the peptides overlapping the 12 protease cleavage sites were successfully expressed in the recombinant viruses and that they are immunogenic. It is important to note that in these experiments, recombinant VSV particles expressing the respective peptides were used, demonstrating that expression vectors can be used for immunization.
(60) In a study using Cynomolgus macaques from Philippines, described below, the results showed that recombinant VSV expressing peptides overlapping the protease cleavage sites can generate antibody and T cell responses in macaques, and nanopackaged peptides can boost plasma antibody and T cell response to the peptides overlapping the protease cleavage sites. The macaques with antibody and T cell response to the peptides overlapping the protease cleavage sites are better protected from higher dosage of intrarectal SIVmac239 challenges. As discussed below, macaques with antibody responses against any of the 12 peptides are better protected against higher dose intrarectal SIVmac239 challenge. A Macaque with antibody responses to 8 peptides has not been infected after a cumulative of 15000 TCID.sub.50 SIVmac239 intrarectal challenge (1000, 2000, 4000, 4000 and 4000 TCID.sub.50).
(61) Furthermore, as discussed below, there is a positive correlation between antibody responses (to the number of peptides) and the infection dosage of SIVmac239 intrarectal challenge.
(62) As discussed herein, better protection from intrarectal challenge is obtained if a low dose, such as 175 or 250 TCID.sub.50 is used. The HIV viral load in one ejaculation in sexual transmissions is estimated at 10.sup.4 to 10.sup.5 copies/ml and is equivalent to 5 to 50 TCID.sub.50.
(63) The immunogenicity of the peptides was also demonstrated by positive results of a peptide screen using iTopia Epitope Discovery System and ELISPOT responses in human PBMCs as discussed below.
(64) In summary, the vaccines targeting the protease cleavage sites showed that the immune responses generated can protect macaques from an accelerated high dosage of intrarectal SIVmac239 challenge when compared with unvaccinated controls and macaques with poor immune response to the PCS-peptides. The results demonstrate that an HIV vaccine targeting the 12 protease cleavage sites (SEQ ID NO: 1-12) will be effective. Furthermore, a nanopackaged peptide cocktail that effectively generates immune responses to the PCS-peptides will reduce the time to bring the vaccine to its application: prevention from HIV-1 acquisition and stop the HIV pandemic that has caused more than 25 million deaths, more than 60 million infections and devastated social communities and the economies of countries in the pandemic region.
(65) As discussed herein, the novel vaccine approach is derived from studying the correlate of protection of a group of highly exposed and persistently seronegative female sex workers enrolled in the Pumwani sex worker cohort. We have tested the feasibility of this approach in a pilot study by immunizing Cynomolgus macaques with 12 recombinant VSV-peptide viruses and boosted the immune responses with nano-package peptides. The monkeys were then intrarectally challenged with cumulative, accelerated high dose SIVmac239. The results showed that monkeys with immune responses to one or more protease cleavage sites are 13 times less likely to be infected by SIVmac239 mucosal challenge than the monkeys that did not receive the immunization and the monkeys that have no good immune responses to any of the protease cleavage sites.
(66) The invention will now be explained and illustrated by way of examples. However, the invention is not necessarily limited by the examples.
(67) The nucleotide sequences (SEQ ID NO: 37-48) encoding the peptides (SEQ ID NO: 25-36) overlapping the 12 protease cleavage sites were cloned into the rVSV vector. This generated 12 recombinant VSV viruses each expressing one of the 12 20-amino acid peptides of SEQ ID NO: 1-12 respectively. RT-PCR demonstrated the expression of RNA encoding the peptides overlapping the protease cleavage sites. An example is shown in
(68) Next, nanoparticles were specifically engineered for the encapsulation of the 12 distinct peptides overlapping the protease cleavage sites (SEQ ID NO: 25-36).
(69) Advances in nanotechnology have led to the development of nanoparticulate carriers composed of biomaterials that are biocompatible and biodegradable and can be used to efficiently deliver proteins and genes (Csaba et al., 2005 in Polymeric Gene Delivery: Principles and Applications (2005: CRC Press); de la Fuente et al., 2008, Nanomed 3: 845-857; de la Fuente et al., 2008, Marcomol Biosci 8: 441-450; Saez-Cirion et al., 2009, J Immunol 182: 7828-7837). These nanoparticles can also accommodate antigenic material and are promising agents as adjuvants for subunit vaccination (Csaba et al., 2009, Adv Drug Deliv Rev 61: 140-157; Koping-Hoggard et al., 2005, Expert Rev Vaccines 4: 185-196). Their ability to protect the antigen from environmental conditions (Petit et al., 1994, J Virol 68: 8017-8027), to pass the mucosal barrier (Petit et al., 199, J Virol 8017-8027; Saez-Cirion et al., 2009, J Immunol 182: 7828-7837; Willer et al., 2010, Nature 446:S8), and to potentiate immune responses have prompted the investigation of nanostructures for single dose and needle-free vaccination.
(70) Nanoparticle-based vaccines have shown to be effective in the induction of immune responses. Typically, the intramuscular or intranasal administration to mice of antigens encapsulated into nanocarriers induced immune responses that significantly exceeded those provoked by the antigens alone. More recently, a pilot study involving non-human primates and SIVmac239 showed the potential of polysaccharidic nanoparticle packaged antigens to prevent HIV-1 acquisition.
(71) Nanoparticles were specifically engineered for the encapsulation of the 12 distinct peptides overlapping the protease cleavage sites (SEQ ID NO: 25-36). The nanopackaged peptides boosted antibody and T cell responses to the peptides overlapping the protease cleavage sites (
(72) The nanostructures are composed of biomaterials such as for example but by no means limited to polysaccharides, polyaminoacids and lipids, of pharmaceutical grade. Other suitable biomaterials and methods of production of nanostructures and nanoparticles will be readily apparent to one of skill in the art.
(73) For example, techniques such as ionic gelification, nanoprecipitation and solvent displacement can be used to efficiently entrap the antigens within biodegradable nanocarrier particles. Based on the selected biomaterials, the antigen characteristics and the immunization objectives, nanocarriers can be developed as nanomatrices or nanocapsules containing an oily core. Of course, nanoparticles constructed with different polysaccharides, polyaminoacids and lipids will be of differing size and zeta potential. Furthermore, the loading capacity of the nanoparticles, protection and release of the associated antigens can be determined by HPLC, SDS-PAGE or Western Blot.
(74) The effect of protection from infection was measured in the number of exposures and cumulative dose of SIVmac239 viral challenge. Secondary outcome such as viral load set point and CD4+ T cell decline was also compared. Correlation of systemic and mucosal antibody and T cell response to the antigens with protection from low-dose intrarectal SIVmac239 challenge was conducted by regression analysis. The secondary outcome including peak and set point viral load, acute and chronic CD4+ T cell counts, CD4/CD8 ratios and viral mutations were analyzed.
(75) These results are shown in
(76) Because of the diversity and heterogeneity of MHC class I and II of Cynomolgus macaques, not all macaques can generate antibody or T cell responses to the peptides overlapping the 12 protease cleavage sites and there is considerable variation in antibody and T cell responses to the PCS-peptides among macaques immunized with the rVSV-PCS and boosted with nanopackaged peptides. The vaccine results showed that antibody responses to the peptides overlapping the 12 protease cleavage sites correlate with protection against higher cumulative dosage of SIVmac239 intrarectal challenge (
(77)
(78) We monitored viral load and conducted whole blood CD4.sup.+ and CD8.sup.+ T cell counts after the macaques have been infected. Since the vaccinated macaques have been challenged with higher dosage of SIVmac239, the comparison of the peak viral load is not fair. It appears that despite the higher peak viral load in the vaccinated macaques due to the higher challenge dosage, their viral load declines much faster than the control group (
(79) Furthermore, for this vaccine strategy to work, a given individual must have an HLA class I allele that can recognize one of the epitope/peptide overlapping one of the 12 protease cleavage sites of HIV-1. Every individual has a total of 6 class I alleles from 3 class I genes (HLA-A, HLA-B and HLA-C) and the utility of the vaccine depends on how many individuals in a population have at least one of the HLA class I alleles that can recognize the peptide overlapping one of the 12 protease cleavage sites. For this vaccine strategy to work best, a given individual should also have a HLA class II allele that can recognize one of the epitopes/peptide overlapping one of the 12 protease cleavage sites of HIV-1. Every individual has two DRB1 alleles, two DQA1/DQB1 allele pairs and two DPA1/DPB1 allele pairs. The utility of this vaccine approach also depends on how many individuals in a population who have at least one of these class II allele/allele pairs that can recognize the peptide overlapping one of the 12 protease cleavage sites.
(80) Consequently, we examined the population coverage using several approaches:
(81) a. We analyzed the currently known HLA class I epitopes overlapping the 12 protease cleavage sites. The percentage of the population that would recognize at least one of the sites is 86% for Caucasian in North America and 62-71.8% for individuals in sub-Saharan Africa.
(82) b. We used computational methods based on the epitope binding motifs of HLA class I alleles and population allele frequencies. Epitope prediction using two different computational algorithms showed that the population coverage is very high (
(83) c. We screened epitopes of 8 common HLA class I alleles using iTopia Epitope Discovery System and confirmed the epitopes by IFN-gamma ELISPOT assays using patient PBMCs. Screen using iTopia Figure A. Epitope prediction using NetMHCpan (Nielsen et al.) Epitope Discovery System showed that the percentage of individuals recognizing at least one PCS is very high.
(84) The population coverage was predicted using computational algorithms, the Population Coverage Calculator with the clade A and D peptides overlapping the protease cleavage sites (PCSs). The population coverage was also calculated based on the T cell epitopes that have already been identified at these sites. Furthermore, the peptides overlapping the 12 PCSs were screened with 8 HLA class I alleles using iTopia Epitope Discovery system and confirmed using IFN ELISPOT assays with PBMCs.
(85) Analysis using all three approaches showed that the percentage of populations in the world can recognize peptides overlapping at least one PCS is very high, including more than 90% population in Sub-Saharan Africa. iTopia epitope Discovery System screen showed that the eight common HLA alleles have epitopes in multiple PCSs (4 to 12).