Generation of hepatocytes from pluripotent stem cells
10287552 ยท 2019-05-14
Assignee
Inventors
Cpc classification
C12N2501/999
CHEMISTRY; METALLURGY
C12N5/0672
CHEMISTRY; METALLURGY
International classification
C12N5/00
CHEMISTRY; METALLURGY
A01N65/00
HUMAN NECESSITIES
A01N63/00
HUMAN NECESSITIES
Abstract
Methods are provided for producing differentiated cells from stem cells, including producing hepatocytes. Compositions thereof are also provided, as are methods of treating a liver disorder.
Claims
1. A composition comprising: L-cysteinglutathione disulfide, -Glu-Cys, DL-kynurenine, D-penicillamine disulfide, phenacetin, phytosphingosine HCl, pyridoxal HCl, optionally, an additional antibiotic.
2. The composition of claim 1, wherein the additional antibiotic is tetracaine HCl.
3. The composition of claim 1, which does not contain the additional antibiotic.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION OF THE INVENTION
(11) A method of producing a differentiated cell from a pluripotent stem cell is provided, the method comprising maintaining the pluripotent stem cell in a medium comprising isolated conditioned medium from hepatoblasts, for a time sufficient to produce the differentiated cell.
(12) A method of producing a differentiated cell from a pluripotent stem cell is provided, the method comprising maintaining the pluripotent stem cell in a medium comprising isolated conditioned medium from fetal hepatoblasts, for a time sufficient to produce the differentiated cell.
(13) Also provided is a method of producing a differentiated cell from a pluripotent stem cell, the method comprising maintaining the pluripotent stem cell in a medium comprising conditioned medium from hepatoblasts, or a medium comprising two or more of phenacetin, phytosphingosine HCl, and pyridoxal HCl, for a time sufficient to produce the differentiated cell. In a preferred embodiment, the method comprises maintaining the pluripotent stem cell in a medium comprising two or more of phenacetin, phytosphingosine HCl, and pyridoxal HCl.
(14) In an embodiment of the methods, the differentiated cell is a hepatocyte. In an embodiment, the differentiated cell exhibits a meso-endodermal phenotype of a fetal human hepatocyte. In an embodiment, the differentiated cell exhibits ureagenesis and/or albumin synthesis and/or vimentin expression. In an embodiment, the pluripotent stem cell is an inducible pluripotent stem cell or is an embryonic stem cell.
(15) In an embodiment of the methods, the hepatoblasts are immortalized. In an embodiment, the hepatoblasts have been immortalized by contact with a telomerase. In an embodiment, the hepatoblasts have been immortalized by expression of telomerase, or maintenance of telomerase expression. In an embodiment, hepatoblasts are human. In an embodiment, hepatoblasts are fetal. In an embodiment, hepatoblasts are immortalized human fetal hepatoblasts. In an embodiment, hepatoblasts are isolated. In an embodiment, the medium does not comprise serum. In an embodiment, the conditioned medium from immortalized human fetal hepatoblasts comprises medium obtained from a culture of immortalized human fetal hepatoblasts cultured in a medium comprising a basal medium. In an embodiment, the immortalized fetal hepatoblasts are human immortalized fetal hepatoblasts. In an embodiment, the hepatoblasts are mammalian, but are not human. In an embodiment, the hepatoblasts are human, but are not fetal. In an embodiment, the medium comprising a basal medium further comprises L-glutamine, one or more non-essential amino acids, and an antibiotic. In an embodiment, the basal medium is a Dulbecco's Modified Eagle's Medium (DMEM). In an embodiment, the antibiotic is penicillin-streptomycin. In an embodiment, the non-essential amino acids are glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L-proline and L-serine. In an embodiment, the medium comprising a basal medium further comprises an artificial serum replacement.
(16) A conditioned medium, with regard a culture, is a medium in which the cell culture has been maintained. In an embodiment, the conditioned medium has been exposed to the cells being cultured for 1 or more hours, 2 or more hours, 6 or more hours, 12 or more hours, 24 or more hours, one week or more or two weeks or more.
(17) In an embodiment of the methods, the medium further comprises one or more of L-cysteinglutathione disulfide, -Glu-Cys, DL-kynurenine, D-penicillamine disulfide, and tetracaine HCl. In an embodiment, the medium does not comprise tetracaine HCl. In an embodiment, the medium comprises L-cysteinglutathione disulfide, -Glu-Cys, DL-kynurenine, D-penicillamine disulfide, phenacetin, phytosphingosine HCl, and pyridoxal HCl.
(18) In an embodiment of the methods, the medium comprises retinoic acid and/or dexamethasone. In an embodiment, the medium comprises L-glutamine. In an embodiment, the medium comprises a selenium compound. In an embodiment, the medium comprises sodium selenite. In an embodiment, the medium comprising a selenium compound also comprises one or more of an albumin, transferrin, insulin, progesterone, putrescine, biotin, 1-carnitine, corticosterone, ethanolamine, d(+)-galactose, glutathione (reduced), linolenic acid, linoleic acid, retinyl acetate, selenium, T3 (triodo-1-thyronine), dl--tocopherol, dl--tocopherol acetate, catalase, and superoxide dismutase. In an embodiment, proteins and enzymes of the medium are isolated from human or are recombinant with a human sequence.
(19) A composition is provided for differentiating stem cells into a differentiated cell of interest, the composition comprising isolated conditioned medium obtained from a culture of hepatoblasts cultured in a medium comprising a basal medium. Basal media are widely-known in the art, and as used herein are understood to encompass cell-growth media (for example, un-supplemented) used for culturing mammalian cells.
(20) A composition is provided comprising isolated conditioned medium obtained from a culture of hepatoblasts cultured in a medium comprising a basal medium, or a basal medium further comprising two or more of phenacetin, phytosphingosine HCl, and pyridoxal HCl.
(21) A composition is provided for differentiating stem cells into a differentiated cell of interest, the composition comprising conditioned medium obtained from a culture of hepatoblasts cultured in a medium comprising a basal medium, or a basal medium further comprising two or more of phenacetin, phytosphingosine HCl, and pyridoxal HCl. In an embodiment, (i) the medium comprising a basal medium from which the conditioned medium is obtained, or (ii) the basal medium further comprising two or more of phenacetin, phytosphingosine HCl, and pyridoxal HCl, also further comprises L-glutamine, non essential amino acids, and an antibiotic.
(22) In an embodiment of the compositions, the medium comprising a basal medium further comprises L-glutamine, non essential amino acids, and an antibiotic. In an embodiment, the basal medium is a DMEM. In an embodiment, the antibiotic is penicillin-streptomycin. In an embodiment, the non-essential amino acids are glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L-proline and L-serine. In an embodiment, the medium comprising a basal medium further comprises an artificial serum replacement.
(23) In an embodiment of the compositions, the medium further comprises one or more of L-cysteinglutathione disulfide, -Glu-Cys, DL-kynurenine, D-penicillamine disulfide, and tetracaine HCl. In an embodiment, the medium does not comprise tetracaine HCl. In an embodiment, the medium comprises L-cysteinglutathione disulfide, -Glu-Cys, DL-kynurenine, D-penicillamine disulfide, phenacetin, phytosphingosine HCl, and pyridoxal HCl. In an embodiment, the aforelisted components are, independently, present at a concentration of 10 M or less, of 7.5 M or less, 5 M or less, of 2.5 M or less, or 1 M or less. In an embodiment, the aforelisted components are, independently, present at a concentration of greater than 0.01 M.
(24) In an embodiment of the compositions, the medium comprises retinoic acid and/or dexamethasone. In an embodiment, the medium comprises L-glutamine. In an embodiment, the medium comprises a selenium compound. In an embodiment, the medium comprises sodium selenite. In an embodiment, the medium comprising a selenium compound also comprises one or more of an albumin, transferrin, insulin, progesterone, putrescine, biotin, 1-carnitine, corticosterone, ethanolamine, d(+)-galactose, glutathione (reduced), linolenic acid, linoleic acid, retinyl acetate, selenium, T3 (triodo-1-thyronine), dl--tocopherol, dl--tocopherol acetate, catalase, and superoxide dismutase. In an embodiment, proteins and enzymes of the medium are isolated from human or are recombinant with a human sequence.
(25) In an embodiment of the compositions, the hepatoblasts are immortalized. In an embodiment, the hepatoblasts are human hepatoblasts. In an embodiment, the hepatoblasts are fetal hepatoblasts. In an embodiment, the hepatoblasts are immortalized human fetal hepatoblasts. In an embodiment, the hepatoblasts are mammalian, but are not human. In an embodiment, the hepatoblasts are human, but are not fetal.
(26) In the various media described herein and in the various compositions comprising media, the specified components are present in amounts consistent with the health and/or growth of the cells in the medium.
(27) A hepatocyte is an epithelial parenchymatous cell of the liver. In an embodiment, the hepatocyte is capable of secreting bile. In an embodiment, the hepatocyte is polygonal. Induced pluripotent stem cells are adult cells, typically somatic cells, that have been genetically reprogrammed to an embryonic stem cell-like state by being caused to express genes and factors important for maintaining the defining properties of embryonic stem cells. In an embodiment, the induced pluripotent stem cells are mammalian. In an embodiment, the adult cell from which the induced pluripotent stem cell is induced is a human adult cell. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of the blastocyst. In an embodiment, the embryonic stem cells are mammalian. In a further embodiment, the embryonic stem cells are non-human. In an embodiment, the embryonic stem cells are human. Basal media are serum-free media widely available in the art.
(28) A method is provided for treating a liver disorder in a subject comprising administering to the subject an amount of the described compositions, or an amount of the described differentiated cells obtained by any of the methods described hereinabove, in an amount effective to treat a liver disorder.
(29) A liver disorder is a disorder or pathology of the mammalian liver which impairs the proper functioning of the liver as compared to a healthy liver. Such disorders are widely known in the art.
(30) And/or as used herein, for example, with option A and/or option B, encompasses the separate embodiments of (i) option A, (ii) option B, and (iii) option A plus option B.
(31) All combinations of the various elements described herein are within the scope of the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
(32) This invention will be better understood from the Experimental Details, which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims that follow thereafter.
(33) Here, the principle is established that soluble signals from fetal liver cells undergoing hepatic development and with stem or progenitor cell properties can drive differentiation in pluripotent stem cells to generate hepatocytes in the meso-endodermal stage of fetal liver development. These pluripotent stem cell-derived hepatocytes expressed repertoires of hepatobiliary and mesenchymal genes, distinct microRNA profiles, as well as synthetic and metabolic hepatic functions, e.g., albumin secretion, urea production, and xenobiotic disposal, which recapitulated properties of fetal hepatocytes. Therefore, these hESC-derived cells were designated embryonic/fetal hepatocyte-like cells (eFHLC). It was found that hepatic functions were expressed at sufficient levels in eFHLC to sustain mice with fatal drug-induced acute liver failure (ALF) (11). In this setting, transplanted eFHLC provided liver support to prolong life. Moreover, eFHLC released paracrine factors that were capable of protecting hepatocytes in vitro and this mechanism promoted liver regeneration in vivo to complete rescue of mice with drug-induced ALF. Therefore, this method to manipulate pluripotent stem cells to generate hepatocytes in defined developmental stage and with appropriate hepatic potency offers opportunities for a variety of cell type-specific basic, clinical and other applications.
Experimental Results
Example 1
(34) Differentiation of pluripotent hESC generated hepatocytes: First, it was determined in what ways would soluble signals from immature fetal hepatocytes (FH) direct differentiation of hESC. To avoid donor-to-donor variability, FH immortalized by telomerase were used, with stem/progenitor cell properties, as well as meso-endodermal phenotype of primary FH (12-13). Conditioned medium (CM) was harvested from FH over 24 h and excluded serum. Feeder cells or animal additives were not included. A multi-step protocol was developed that included culture of hESC in FH-CM alone for first 3d followed over the next 3d by culture of hESC with FH-CM plus three known soluble factors and then further culture of hESC for a total of 14d with FH-CM plus another known soluble factor. None of the soluble factors added to FH-CM was essential for initiating hepatic differentiation in hESC. However, in the presence of these known soluble factors, hESC adhered better in plastic culture dishes.
(35) During differentiation, hESC in primary culture (P0) gained epithelial morphology within 3d (
(36) eFHLC were characterized by morphology, gene expression and functional assays. eFHLC acquired more cytoplasm, larger nuclei, even binucleated cells, similar to hepatocytes (
(37) TABLE-US-00001 TABLE 2 qRT-PCR analysis of gene expression - Gene expression was normalized with -actin and represents fold-change versus undifferentiated hESC on d 0 of differentiation protocol: Undiffer- entiated eFHLC Gene analyzed H1-hESC d 0 3 d 14 d Pluripotency markers OCT4 1.0 0.1 0 NANOG 1.0 0.1 0 SOX2 1.0 0.1 0 Endodermal markers BRACHYURY 1.0 10 0.6 SOX17 1.0 56 1.0 FOXA2 1.0 27 0.2 Epithelial marker CDH1 1.0 1.5 2.6 Mesenchymal marker VIM 1.0 1 11 Hepatic transcriptional factors GATA4 1.0 155 488 HNF4A 1.0 165 653 HNF1A 1.0 58 136 Hepatic markers AFP 1.0 2 0.4 ALB 1.0 7 21 AAT 1.0 18 82 TAT 1.0 20 25 TTR 1.0 37 273 TDO2 1.0 20 29 ASGPR1 1.0 1 1.6 APOF 1.0 7 9 CYP3A4 1.0 67 66 CYP7A1 1.0 12 14 G6P 1.0 40 68 Biliary marker CK19 1.0 8 17
(38) Protein studies verified mRNA findings in eFHLC as stem cell markers declined (OCT4, NANOG, TRA-1-80) and hepatic (FOXA2, ALB, G6P and glycogen) and biliary (GGT) properties increased. In d14 eFHLC, OCT4 was lost with gain of ECAD, VIM, FOXA2, and ALB expression. eFHLC contained hepatobiliary markers, glycogen, G6P and GGT. Similarly, epithelial (ECAD) and mesenchymal (VIM) markers were coexpressed. High level expression of asialoglycoprotein receptor (ASGPR1), which is specific to adult hepatocytes, indicated many eFHLC were maturing along the hepatic lineage. Flow cytometry showed 27% eFHLC expressed ASGPR1, marking mature hepatocytes.
(39) eFHLC expressed hepatic synthetic, metabolic and xenobiotic disposal functions in vitro: After 14d of differentiation, eFHLC secreted albumin, synthesized urea and converted a xenobiotic, ethoxyresorufin, to resorufin (
(40) eFHLC rescued mice with drug-induced ALF: Identification of hepatic functions and potential for paracrine signaling suggested eFHLC could support recovery of the damaged liver. This was facilitated by a NOD/SCID mouse model of ALF (11), where rifampicin (Rif), phenytoin (Phen) and monocrotaline (MCT) caused dysregulation of Atm signaling, leading to severe oxidative stress, DNA damage, hepatic necrosis, liver test abnormalities, coagulopathy, encephalopathy, and 90-100% mortality. Intraperitoneal transplantation of mature hepatocytes with microcarrier scaffolds rescued mice with ALF. Of note, transplanted hepatocytes remained in peritoneal cavity without migrating to the liver. Moreover, reseeding of the liver with cells was unnecessary. ALF was induced with Rif-Phen-MCT in mice (n=20), followed by 4-610.sup.6 eFHLC (n=10) or vehicle (n=10) i.p. In the FHLC group, 5 mice survived (50%) versus only 1 mouse in the vehicle group (10%), p<0.001. In eFHLC-treated mice, encephalopathy was absent or less severe, whereas sham-treated mice developed severe encephalopathy (grade 3-4), p<0.05. Liver tests improved in the eFHLC group versus the vehicle group. After 7d, serum alanine aminotransferase (ALT) was 7782 versus 4800500 u/l and total bilirubin 0.50.2 versus 2.50.5 mg/dl, p<0.05. Normal blood glucose and serum creatinine levels in all mice excluded hypoglycemia or renal failure as coincidental causes of death. Human cells were identified in cell-microcarrier conglomerates recovered from peritoneal cavity. Histological sections of microcarrier (mc) and cell-conglomerates recovered from mice 7d after eFHLC transplantation showed vascular reorganization (H&E staining), glycogen in transplanted cells, and confirmation of human transplanted cells by in situ hybridization for primate-specific centromere sequences. Transplanted eFHLC were absent from the native liver, as was expected. Livers of vehicle-treated mice were edematous, hemorrhagic and necrotic with extensive expression of phosphorylated histone H2AX, confirming oxidative DNA damage, and only interspersed Ki-67+ cells, indicating limited liver regeneration. In eFHLC-treated mice, liver necrosis and H2AX expression decreased, while the prevalence of Ki-67+ cells increased. Histological grading showed 5.4-fold less liver injury in eFHLC-treated mice after 7d, 0.70.3 versus 3.80.4, p<0.05. The prevalence of Ki-67+ cells at that time was 2.3-fold greater in eFHLC-treated mice, 915 versus 394 cells/HPF, p<0.05. Analysis of hepatic gene expression indicated extensive perturbations in animals with ALF (Table 3). In eFHLC-treated mice, expression of genes in oxidative/metabolic stress, inflammatory cytokines, chemokines or other mediators, and of Atm and cell cycle regulators, i.e., Ccnc, Ccnd1 or Egr1, improved.
(41) After i.p. or subcutaneous transplantation, eFHLC did not proliferate, and no tumors were observed in NOD/SCID mice over 3 months. Undifferentiated hESC generated teratomas as expected (not shown) (5-7).
(42) TABLE-US-00002 TABLE 3 Liver mRNA expression by qRT-PCR (fold NOD/SCID mice versus mice in ALF with sham-treatment or of eFHLC transplantation - Data were first normalized against housekeeping -actin gene in individual samples. Each condition was analyzed with samples in triplicate Gene Sham- Sham- eFHLC- eFHLC- Gene description Symbol 3 d 7 d 3 d 7 d Oxidative or Metabolic Stress Crystallite, alpha B Cryab 1.2 1.6 1.1 1.1 Cytochrome P450, family 1, subfamily a, polypeptide 1 Cyp1a1 3.7 4.9 5.8 4.7 Cytochrome P450, family 1, subfamily b, polypeptide 1 Cyp1b1 3.4 1.5 2.6 1.3 Cytochrome P450, family 2, subfamily a, polypeptide 5 Cyp2a5 6.7 5.1 1.1 1.9 Cytochrome P450, family 2, subfamily b, polypeptide 10 Cyp2b10 1.2 1.1 1.7 1.8 Cytochrome P450, family 2, subfamily b, polypeptide 9 Cyp2b9 7.3 7.2 7.3 2.1 Cytochrome P450, family 2, subfamily c, polypeptide 29 Cyp2c29 46.3 106.9 1.4 1.4 Cytochrome P450, family 3, subfamily a, polypeptide 11 Cyp3a11 13.8 27.7 9.1 4.8 Cytochrome P450, family 4, subfamily a, polypeptide 10 Cyp4a10 1.6 5.9 13.9 11.0 Cytochrome P450, family 4, subfamily a, polypeptide 14 Cyp4a14 7.8 2.0 7.8 18.8 Cytochrome P450, family 7, subfamily a, polypeptide 1 Cyp7a1 32.9 100.2 64.1 11.7 Epoxide hydrolase 2, cytoplasmic Ephx2 4.1 10.4 2.6 2.0 Flavin containing monooxygenase 1 Fmo1 15.6 2.3 1.9 1.3 Flavin containing monooxygenase 4 Fmo4 1.2 2.0 2.1 2.2 Flavin containing monooxygenase 5 Fmo5 1.7 1.3 1.0 1.6 Glutathione peroxidase 1 Gpx1 3.2 3.1 3.0 2.1 Glutathione peroxidase 2 Gpx2 1.6 1.1 1.7 1.0 Glutathione reductase Gsr 1.4 1.4 2.1 2.0 Glutathione S-transferase, mu 1 Gstm1 3.8 10.6 5.8 2.5 Glutathione S-transferase, mu 3 Gstm3 3.9 5.8 1.1 1.8 Heme oxygenase (decycling) 1 Hmox1 1.1 3.5 2.2 1.1 Heme oxygenase (decycling) 2 Hmox2 1.2 1.6 2.4 3.0 Metallothionein 2 Mt2 5.7 7.8 17.8 2.1 Polymerase (RNA) II (DNA directed) polypeptide K Polr2k 1.5 1.2 2.7 2.3 P450 (cytochrome) oxidoreductase Por 1.7 5.9 2.5 4.4 Superoxide dismutase 1, soluble Sod1 2.7 3.6 7.5 6.0 Superoxide dismutase 2, mitochondrial Sod2 4.4 5.4 1.3 1.1 Heat Shock DnaJ (Hsp40) homolog, subfamily A, member 1 Dnaja1 1.9 2.8 3.9 3.4 Heat shock factor 1 Hsf1 1.4 1.7 1.8 1.7 Heat shock protein 1B Hspa1b 1.9 1.1 1.5 2.0 Heat shock protein 1-like Hspa1l 2.8 4.0 7.4 3.7 Heat shock protein 4 Hspa4 1.5 3.3 1.7 1.0 Heat shock protein 5 Hspa5 1.9 1.5 1.1 1.4 Heat shock protein 8 Hspa8 1.0 1.2 1.4 1.4 Heat shock protein 1 Hspb1 1.2 1.8 1.7 2.0 Heat shock protein 1 (chaperonin) Hspd1 1.6 2.4 1.7 1.7 Heat shock protein 1 (chaperonin 10) Hspe1 1.7 1.7 2.4 2.3 Proliferation and Carcinogenesis Colony stimulating factor 2 (granulocyte-macrophage) Csf2 1.2 2.6 1.4 1.1 Cyclin C Ccnc 1.7 1.7 3.6 4.2 Cyclin D1 Ccnd1 1.1 1.8 6.7 12.9 Cyclin G1 Ccng1 1.4 2.4 1.2 1.9 E2F transcription factor 1 E2f1 1.0 2.2 1.4 2.2 Early growth response 1 Egr1 4.2 15.3 30.6 9.7 Proliferating cell nuclear antigen Pcna 1.3 1.4 1.0 1.0 Growth Arrest and Senescence Cyclin-dependent kinase inhibitor 1A (P21) Cdkn1a 105.0 92.0 141.4 116.5 DNA-damage inducible transcript 3 Ddit3 1.2 3.9 2.1 1.1 Growth arrest and DNA-damage-inducible 45 alpha Gadd45a 3.1 1.6 2.1 5.7 Insulin-like growth factor binding protein 6 Igfbg6 10.2 3.5 101.8 110.4 Transformed mouse 3T3 cell double minute 2 Mdm2 1.0 1.8 5.4 4.7 Transformation related protein 53 Trp53 1.3 1.3 1.1 1.1 Inflammation Chemokine (C-C motif) ligand 21b Ccl21b 5.0 16.6 16.1 16.6 Chemokine (C-C motif) ligand 3 Ccl3 5.4 30.7 6.3 4.4 Chemokine (C-C motif) ligand 4 Ccl4 3.4 21.5 8.1 3.7 Chemokine (C-X-C motif) ligand 10 Cxcl10 2.4 10.8 4.5 1.1 Interleukin 18 Il18 3.0 2.1 3.6 2.9 Interleukin 1 alpha Il1a 2.9 1.0 1.3 1.2 Interleukin 1 beta Il1b 1.2 3.5 1.6 1.4 Interleukin 6 Il6 1.9 7.3 6.0 1.8 Lymphotoxin A Lta 1.2 1.1 1.8 Macrophage migration inhibitory factor Mif 1.5 1.3 1.9 1.3 Nuclear factor of kappa light polypeptide gene enhancer Nfkb1 1.3 1.5 1.3 1.5 in B-cells 1, p105 Nitric oxide synthase 2, inducible Nos2 6.5 24.4 26.5 1.8 Serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 50.8 57.3 286.0 7.4 DNA Damage and Repair Ataxia telangiectasia mutated homolog (human) Atm 1.7 2.4 1.3 1.1 CHK2 checkpoint homolog (S. pombe) Chek2 1.1 1.6 1.2 1.1 Excision repair cross-complementing rodent repair deficiency, Ercc1 1.1 2.1 1.2 1.1 complementation group 1 Excision repair cross-complementing rodent repair deficiency, Ercc4 1.5 2.0 2.4 2.1 complementation group 4 RAD23a homolog (S. cerevisiae) Rad23a 2.0 2.7 3.0 2.8 RAD50 homolog (S. cerevisiae) Rad50 1.8 1.5 1.3 1.3 UDP glucuronosyltransferase 1 family, polypeptide A2 Ugt1a2 2.8 3.1 3.2 2.5 Uracil DNA glycosylase Ung 1.7 1.4 1.9 1.4 X-ray repair complementing defective repair in Chinese Xrcc1 1.3 1.4 2.8 2.4 hamster cells 1 X-ray repair complementing defective repair in Chinese Xrcc2 1.4 1.1 1.7 1.4 hamster cells 2 X-ray repair complementing defective repair in Chinese Xrcc4 1.1 1.0 1.4 1.6 hamster cells 4 Apoptosis Signaling Annexin A5 Anxa5 2.9 5.0 4.4 2.4 Bcl2-associated X protein Bax 1.5 2.3 1.2 1.2 Bcl2-like 1 Bcl2l1 1.7 2.6 3.9 1.9 Caspase 1 Casp1 2.4 1.7 1.5 1.2 Caspase 8 Casp8 4.3 1.1 1.1 1.1 Fas ligand (TNF superfamily, member 6) Fasl 1.2 1.2 1.7 1.8 Nuclear factor of kappa light polypeptide gene enhancer Nfkbia 1.3 1.7 1.1 1.4 in B-cells inhibitor, alpha Tumor necrosis factor receptor superfamily, member 1a Tnfrsf1a 1.1 1.5 1.7 1.1 Tumor necrosis factor (ligand) superfamily, member 10 Tnfsf10 4.3 3.4 6.3 4.9 TNFRSF1A-associated via death domain Tradd 1.6 1.3 2.3 1.9
(43) Mechanisms in hepatic differentiation of hESC: To understand how FH-CM caused hepatic differentiation in hESC, cytokines and growth factors were examined, and 62 of 507 such proteins were found to be present in FH-CM (
(44) Genes expressed under differentiation conditions were analyzed by qRT-PCR with customized array from SA Biosciences. Expression of individual genes was normalized against housekeeping gene, -actin. The data indicated culture of hESC with protein-depleted FH-CM was effective in initiating differentiation along meso-endodermal hepatic stage. Most notable were decreases in expression of Nanog and Sox2 and increases in expression of AFP and VIM.
(45) TABLE-US-00003 TABLE 1 Changes in gene expression. (C) Genes expressed under differentiation conditions. Gene expression was analyzed by qRT-PCR with customized array from SA Biosciences. Undiffer- FH-CM-treated eFHLC x 3 d entiated Heat- 3 kd Amicon Gene analyzed H1-hESC denatured cut-off Pluripotency genes OCT4 1.0 1.3 1.3 NANOG 1.0 0.3 0.1 SOX2 1.0 0.7 0.3 Endoderm markers BRACHYURY 1.0 0.5 1.9 SOX17 1.0 0.7 1.0 FOXA2 1.0 0.3 1.2 Epithelial marker CDH1 1.0 0.7 0.9 Mesenchymal marker VIM 1.0 6.2 4.6 Hepatic transcription factors GATA4 1.0 0.5 1.5 HNF4A 1.0 1.0 2.0 HNF1A 1.0 0.4 1.4 Hepatic markers AFP 1.0 1.3 2.5 ALB 1.0 0.7 2.0 AAT 1.0 0.5 1.8 TAT 1.0 0.6 1.9 TTR 1.0 0.5 1.7 TDO2 1.0 0.6 1.7 ASGPR1 1.0 0.9 1.5 APOF 1.0 0.5 1.9 CYP3A4 1.0 0.6 1.4 CYP7A1 1.0 0.7 3.3 G6P 1.0 0.5 2.0 Biliary marker CK19 1.0 0.7 0.6
(46) TABLE-US-00004 TABLE 4 Listing of compounds identified by LC-MS metabolomics analysis in FH-CM Compound, Retention Corrected Compound Exact Mass Time (min) p-value Identification 281.1072 1.93 1.37E09 281.1072 448.0098 2.00 1.22E09 448.0098 426.0855 2.02 2.94E10 Cysteineglutathione disulfide 197.0828 2.15 3.49E12 N-benzylideneaniline n-oxide 374.1351 2.17 6.77E13 374.1351 380.1687 2.25 5.35E09 Asn Thr Phe 211.0454 2.25 1.13E09 211.0454 156.0031 2.50 2.26E11 C6 H7 N P S 128.0112 2.51 1.08E13 128.0112 268.0192 2.53 3.57E13 268.0192 161.0683 2.54 1.55E05 2-Aminoadipic acid 226.9919 2.64 1.92E10 226.9919 1092.4396 2.65 1.06E10 1092.4396 339.0923 2.66 1.17E12 Cys Ser Met 380.1361 2.67 7.25E04 C15 H29 N2 O3 P S2 408.1783 2.67 2.01E05 Tryptophan 373.1532 2.71 2.22E12 C15 H20 N9 O P 135.0547 2.71 1.44E14 Adenine 301.1136 2.84 7.53E10 C9 H15 N7 O5 210.9971 2.85 3.14E09 210.9971 380.1367 2.90 1.01E10 C15 H29 N2 O3 P S2 + 2.9005 90.0319 2.96 2.24E16 Lactic acid 323.0060 3.00 4.68E13 C24 H4 P 167.0584 3.08 7.45E14 Pyridoxal (Vitamin B6) 250.0623 3.47 3.36E11 gamma-L-Glutamyl-L- cysteine 122.0487 3.90 1.71E09 Niacinamide 201.1666 4.04 2.92E12 C12 H25 S 149.0510 4.05 3.76E10 Methionine 268.0713 4.72 9.69E05 Homolanthionine 444.1428 4.75 1.39E08 444.1428 396.0489 5.00 4.58E12 C21 H8 N4 O5 329.9910 5.07 3.49E12 C19 H9 P3 214.0085 5.09 4.95E12 2,3-Dioxogulonic acid 296.0869 5.35 9.46E15 Penicillamine disulfide 233.1224 6.30 3.27E09 C11 H23 O P2 401.1190 9.24 1.77E07 C17 H25 N2 O5 S2 612.1535 11.45 4.66E10 Glutathione, oxidized 208.0851 12.83 8.30E13 Kynurenine 159.0685 15.31 2.39E15 Indoleacetaldehyde 266.0351 32.20 1.27E08 C13 H15 P S2 482.1143 34.69 6.19E13 C16 H26 N4 O9 S2 383.1070 35.60 2.47E15 Succinoadenosine 135.0558 35.62 1.08E13 C7 H7 N2 O 297.0898 35.63 4.09E15 5-Methylthioadenosine 313.0839 35.63 2.22E13 C13 H12 N7 O P 369.4807 36.70 2.74E10 369.4807 315.2040 36.76 4.82E12 C15 H23 N8 499.1462 37.07 9.72E11 C23 H28 N5 O2 P3 249.5732 37.30 7.64E10 249.5732 595.1771 37.42 2.15E11 8-Hydroxy-perphenazine glucuronide 1482.8310 37.65 1.69E09 1482.831 556.1732 37.71 3.76E12 C23 H28 N9 O4 P2 639.1682 38.11 3.28E13 639.1682 179.0950 38.20 2.24E16 Phenacetine 264.1823 38.21 3.28E12 Tetracaine 312.1465 38.38 3.54E13 Phe Phe 514.1626 38.43 2.11E10 C21 H26 N9 O3 P2 252.0902 38.49 5.52E11 Carbamazepine 10,11- epoxide 485.0762 38.74 5.00E06 C27 H19 N O4 S2 1471.5754 38.79 3.76E10 1471.5754 450.8249 38.79 6.24E11 450.8249 1024.2646 38.80 5.22E10 1024.2646 374.1240 38.81 1.14E11 C27 H19 P 771.3008 38.83 7.29E12 771.3008 916.2433 38.89 2.75E09 FMNH 346.0992 38.95 7.64E10 C25 H14 O2 582.1468 38.99 3.49E12 C27 H25 N10 P3 590.1166 38.99 6.94E12 5-Aminoimidazole ribonucleotide 574.1458 39.10 1.39E08 C28 H26 N6 O4 S2 450.8238 39.32 1.38E10 450.8238 578.2068 39.32 3.49E12 C36 H37 O P3 265.0948 39.45 6.24E11 265.0948 262.0776 39.54 1.57E06 C8 H16 N5 O S2 574.1232 39.67 4.57E13 C24 H34 N O7 P2 S2 558.1804 39.74 6.47E07 C35 H30 N2 O S2 276.0570 39.83 3.89E13 C15 H9 N4 P 421.1670 39.83 1.87E06 C13 H27 N9 O3 S2 208.5870 39.92 4.39E09 208.587 574.1265 40.06 3.42E11 C28 H31 O7 P S2 558.1820 40.24 1.31E06 C23 H34 N4 O8 S2 447.1469 40.38 1.58E10 C23 H30 N O2 P S2 622.1914 40.39 2.50E10 622.1914 314.1083 40.70 3.28E13 C21 H17 N P 558.1816 40.84 1.35E07 C23 H34 N4 O8 S2 + 40.837997 290.1090 40.97 3.66E11 C15 H18 N2 O2 S 350.0953 41.14 6.53E10 N-acetylaspartate 330.1974 41.31 9.31E 14 C16 H30 N2 O3 S 507.1460 41.32 2.60E11 C32 H29 P2 S 290.1086 41.42 2.29E11 C15 H18 N2 O2 S + 41.415 706.1547 41.52 6.64E11 706.1547 324.1161 41.76 2.29E10 acetohexamide 1170.3890 41.81 4.73E12 1170.389 507.1476 42.27 2.81E10 C30 H24 N2 O4 P 324.1154 42.45 4.93E12 C19 H19 N O2 P 317.2929 42.65 9.15E12 Phytosphingosine 507.1482 43.29 2.20E12 1-deoxy-1-[methyl[3-phenyl- 3-[4-(trifluoro- methyl)phenoxy]pro- pyl]amino]-b-D- Glucopyranuronic acid 382.1235 43.56 4.58E12 C20 H22 N3 O P2 366.1256 43.63 6.18E05 C17 H22 N2 O5 S 906.3010 44.60 3.26E10 906.301 583.0971 45.71 4.27E09 583.0971 354.2546 46.00 3.63E12 5beta-Chola-3,8(14),11-trien- 24-oic Acid 541.1893 46.15 6.05E08 C29 H33 O8 S 234.1606 46.18 2.09E10 3-n-decyl acrylic acid 517.3172 47.16 4.12E11 Linolenoyl lysolecithin 541.3209 47.22 4.31E10 541.3209
Discussion
(47) Direct differentiation of hESC with FH-CM rapidly and efficiently generated hepatocytes, leading to uniformity of hepatic development, including expression of hepatic transcription factors, coordinately-regulated hepatobiliary genes, epithelial markers, as well as mesenchymal markers. This recapitulated the meso-endodermal stage of natural fetal hepatocytes (4-7). The extent of synthetic, metabolic and xenobiotic disposal functions further confirmed this developmental stage in eFHLC. Despite this immaturity, transplanted eFHLC rescued mice in ALF by providing critical life-support and paracrine signals to aid liver repair/regeneration, which was similar to the capability in this setting of mature hepatocytes (7, 11).
(48) Previously, lack of knowledge or uncertainties in the hepatic lineage stage achieved made it difficult to interpret the efficacy of stem cell differentiation protocols (1-3, 18-21). Use of FH-CM without animal-derived materials, feeder cells or genetic manipulation to express multiple transcription factors avoided previous major restrictions (22). These attributes should be especially helpful for developing further insights into liver cell differentiation mechanisms in stem cells, as well as various applications of stem cell-derived liver cells.
(49) FH-CM induced hepatic differentiation in hESC by the steps of endoderm specification followed by maturation to fetal stage. This reproduced paracrine effects of proteins during differentiation of mouse stem cells in vitro (17). However, hepatic differentiation induced by FH-CM lacking proteins was singularly different from cell differentiation induced by cytokine/chemokine/growth factor-based protocols. Despite the presence in FH-CM of proteins affecting cell attachment and perhaps proliferation, e.g., activinA, FGFs, GCSF, interleukin-6, TNF, VEGF, etc., (14,18,23,24), deficiency of RTK activation in hESC substantiated that these proteins did not play seminal roles in stem cell differentiation with FH-CM. The findings indicated active role in stem cell differentiation of natural small compounds in FH-CM. Whether these compounds could additionally have emanated from eFHLC themselves during cell differentiation was unknown. Previously, screening of chemical libraries identified synthetic candidate compounds advancing islet cell differentiation (25). These results are different from the present findings because small molecules in FH-CM originated naturally from cells. Among the list of these small compounds, putative differentiation-inducing molecules included those affecting differentiation in stem/progenitor cells, e.g., 2-aminoadipic acid (26). Use of specific matrices and synthetic surfaces could help in further expanding eFHLC or other stem cell-derived cell types.
(50) Protein secretion, urea synthesis and xenobiotic metabolism in eFHLC indicated suitable hepatic properties. Cells engrafted and functioned in xenotolerant mice, which was similar to mature human hepatocytes (27). After transplantation, stem cell-derived hepatocytes may engraft and express liver functions in animals, although often largely at mRNA level (5-7, 22, 28) On the other hand, for cell therapy requiring organ repopulation with healthy cells, proliferation of transplanted cells is critical (22, 28). In treating genetic conditions permanently, extensively modified cells, e.g., those reprogrammed with multiple transcription factors, will be less desirable than cells differentiated simply by extracellular soluble signals. It should be noteworthy that in settings, such as ALF, where short-term liver support by extrahepatic reservoirs of cells rescued animals without need for reseeding of the liver with cells, other considerations are applicable (7, 11). For instance, eFHLC showed capacity for glucose homeostasis, protein synthesis and ammonia detoxification, besides releasing hepatoprotective substances, e.g., FGFs, GCSF, IGFs, VEGF, etc. Previously, only GCSF was known to regulate ATM promoter activity (29). It was found that FGFs and IGF also regulated hepatic ATM signaling. As molecular perturbations, including ATM signaling, improved after eFHLC transplantation, this added specificity to the effects of cell therapy in ALF.
(51) Materials and Methods
(52) Studies were approved according to NIH guidelines, by the Einstein Committee on Clinical Investigations, Embryonic Stem Cell Research Oversight Committee, and Animal Care and Use Committee.
(53) Fetal cells: Fetal livers were from Human Fetal Tissue Repository at Einstein. Ep-CAM+ liver cells were isolated and cultured as previously described (5, 6). hTERT-FH-B cells were cultured in DMEM with 10% FBS (12). To obtain CM, hTERT-FH-B were cultured for 24 h in DMEM/F12 medium with 2% Knock-out Serum Replacer (KSR), 2 mM L-glutamine, 0.1 mM MEM Non Essential Amino Acids (NEAA), 1% penicillin-streptomycin (Invitrogen Corp., Carlsbad, Calif.).
(54) Culture of hESC. WA-01 hESC were passaged weekly on matrigel-coated dishes in DMEM/F12 medium, 1% B27 supplement, 1% N2 supplement, 2 mM L-glutamine, 0.1 mM NEAA, 1% penicillin-streptomycin (Invitrogen Corp.) and 50 ng/ml basic FGF (R&D Systems, Minneapolis, Minn.). For the final hepatic differentiation protocol, hESC were washed with DMEM/F12, and cultured in FH-CM.
(55) Cytotoxicity assays. For effects of CM from hFHLC on TNF--induced cytotoxicity, 1.510.sup.5 primary mouse hepatocytes were isolated by collagenase perfusion (11), and plated in 24-well dishes in RPMI 1640 medium with 10% FBS and antibiotics. After overnight culture, cells were switched to CM plus 10 ng/ml TNF- (Sigma) for 16-18 h, followed by thiazolyl blue viability assays, as described previously (14). For cisP toxicity assays, Huh-7 cells were used after transduction by a lentiviral vector to express human ATM promoter-driven tdTomato gene (15). Huh-7 cells cultured with 15 M cis-P (Sigma) or 2 g/ml G-CSF (Amgen Inc., Thousand Oaks, Calif.) for 16-18 h were incubated for 20 min with 6 g/ml Hoechst33342 (Sigma) for cell viability and TdTomato/ATM promoter expression.
(56) Hepatic functions. For albumin, cell culture medium harvested after 3 h was analyzed by human albumin immunoassay (Bethyl Laboratories, Montgomery, Tex.). For ureagenesis, cells were incubated with 2.5-7.5 mM ammonium chloride for 12 h and urea content was analyzed as previously described (27). For CYP450 activity, cells were induced overnight with phenobarbital, 7-ethoxyresorufin and M dicumarol were added for 12 h at 37 C., and resorufin was measured, as described previously (30).
(57) Human cytokine arrays. Conditioned medium was analyzed by human antibody array I membrane for 507 human proteins and cell lysates were analyzed by Human RTK Phosphorylation Antibody Array 1 (RayBiotech, Norcross, Ga.), according to manufacturer.
(58) NOD/SCID mice with ALF. CB17.NOD/SCID.sup.prkdc mice, 6-7 weeks old, were from Jackson Labs. (Bar Harbor, Me.). Mice were given 3 daily doses of i.p. Rif (75 mg/kg) and Phen (30 mg/kg) followed by one i.p. dose on d4 of MCT (160 mg/kg), as described previously. .sup.11 After 1d, 4-610.sup.6 hESC-derived cells differentiated for 14d were transplanted i.p. with 1 ml Cytodex 3 microcarriers (Amersham Biosciences Corp., Piscataway, N.J.). Sham-treated animals received microcarriers. Encephalopathy was graded from 0 (absent) to 3 (coma). Mice were observed for 2 weeks. In some studies, hESC-derived cells were injected subcutaneously or i.p. for tumor formation over 3 months.
(59) Immunohistochemistry. Cells were fixed in 4% paraformaldehyde in phosphate buffered saline, pH 7.4 (PBS), blocked/permeabilized with 5% goat serum, 0.2% Triton X-100 (Sigma) in PBS for 1 h, and incubated overnight at 4 C. with anti-human antibodies for OCT3/4 (1:200), AFP (1:100), ECAD (1:50) (Santa Cruz Biotechnology Inc., Santa Cruz, Calif.), FOXA2 (1:100) (R&D Systems), ALB (1:200) (Sigma), VIM (1:100) (US Biologicals, Swampscott, Mass.). After washing in PBS, TRITC-conjugated goat anti-mouse IgG (1:50, Sigma) or anti-rabbit IgG (1:100) were added for 1 h with 4-6-diamidino-2-phenylindole (DAPI) (Invitrogen) counterstaining. In negative controls, primary antibodies were omitted. Glycogen, G-6-P, and GGT were stained as described (4-7).
(60) Electron microscopy. Cells were fixed in 2.5% glutaraldehyde in cacodylate butter, postfixed in osmium tetroxide, and stained with 1% uranyl acetate before embedding in plastic. Ultrathin sections were examined under JEOL 1200 electron microscope.
(61) Molecular studies. RNA was extracted by TRIzol reagent (Invitrogen), cleaned by RNeasy (Qiagen Sciences, Germantown, Md.), incubated in DNase I (Invitrogen) and reverse-transcribed by Omniscript RT kit (Qiagen). Platinum PCR SuperMix (Invitrogen) was used for PCR with annealing at 94 C.5 min, and 35 cycles at 94 C.30 s, 55 C.30 s, 72 C.45 s, and 72 C.10 min (primers, Table 4). Mouse Stress and Toxicity RT.sup.2 Profiler PCR Array and RT.sup.2 Real-Time SyBR Green PCR mix and RT.sup.2 First Strand kit were from SABiosciences (Frederick, Md.). cDNA synthesis and PCR was according to the manufacturer. For quantitative (q) RT-PCR analysis of gene expression, customized arrays were obtained for 24 genes, including pluripotency genes, transcription factors and hepatobiliary genes (CAPH-0800A; SA Biosciences). Data were analyzed by 2-Ct method. Fold-changes in gene expression were expressed as log-normalized ratios from sham-treated/normal and cell transplantation/normal livers. Gene expression was analyzed with U133 2.0 Plus oligonucleotide arrays (Affymetrix Corp., Santa Clara, Calif.) as described (10). Changes in mRNA expression were examined for pathway-specificity by IPA tools (Ingenuity Systems Inc., Redwood, Calif.).
(62) TABLE-US-00005 TABLE5 PrimersequencesforRT-PCR(SEQIDNOS.1-24, toptobottom,respectively). Amplicon size Gene Primersequence5-3 expected OCT4 F:GACAACAATGAAAATCTTCAGGAGA 218bp R:TTCTGGCGCCGGTTACAGAACCA ALB F:TGCTTGAATGTGCTGATGACAGGG 161bp R:AAGGCAAGTCAGCAGGCATCTCATC AFP F:TGCAGCCAAAGTGAAGAGGGAAGA 260bp R:CATAGCGAGCAGCCCAAAGAAGAA CK-19 F:ATGGCCGAGCAGAACCGGAA 308bp R:CCATGAGCCGCTGGTACTCC VIM F:CACCTACAGCCTCTACG 170bp R:AGCGGTCATTCAGCTC -SMA F:AGTACCCGATAGAACATGG 153bp R:TTTTCTCCCGGTTGGC CYP1B1 F:CACCAAGGCTGAGACAGTGA 230bp R:GCCAGGTAAACTCCAAGCAC CYP2C9 F:GGACAGAGACGACAAGCACA 200bp R:TGGTGGGGAGAAGGTCAAT CYP3A4 F:TGTGCCTGAGAACACCAGAG 201bp R:GCAGAGGAGCCAAATCTACC CYP2E1 F:CCGCAAGCATTTTGACTACA 202bp R:GCTCCTTCACCCTTTCAGAC CYP1A1 F:AGGCTTTTACATCCCCAAGG 197bp R:GCAATGGTCTCACCGATACA -Actin F:TCACCACCACGGCCGAGCG 350bp R:TCTCCTTCTGCATCCTGTCG Abbreviations: F, Forward; R, Reverse; bp, base pair; ALB, albumin; AFP, -fetoprotein; CK-19, cytokeratin-19; VIM, vimentin; SMA, smooth muscle actin, CYP, cytochrome P450
(63) For microRNAs, total RNA isolated by TRIzol reagent (Invitrogen) was analyzed by LC Sciences (Houston, Tex.) with probe set based on Sanger miRBase, v 9.0. Later, transcripts with <500 arbitrary signals were excluded as these are not identified by qRT-PCR. Data were transformed to log 2 followed by clustering of transcripts (Cluster3, Stanford University) and heatmaps were drawn (JavaTree1.1.6r2).
(64) Tissue studies: Tissue samples were frozen to 80 C. in methylbutane. Cryostat sections were prepared. Tissue morphology was analyzed by H&E stained sections. Tissue injury was graded as previously described (38). For hepatic function in transplanted cells, glycogen and G-6-P were stained (35). For Ki67 and histone H2AX, tissues were fixed in 4% PAF followed by rabbit anti-Ki67 (1:750, Vector Laboratories, Burlingame, Calif.) or rabbit anti-phosphoS139 H2AX (1:300, ab2893; Abcam, Cambridge, Mass.), respectively, and secondary anti-Rabbit Alexa Fluor 546 (1:500, Molecular Probes), followed by counterstaining with DAPI (7, 11). Transplanted cells were identified by in situ hybridization for alphoid satellite sequences in centromeres (27).
(65) Liquid chromatography-mass spectroscopy (LC-MS) metabolomics. For non-targeted metabolite screen by LC-MS, 5 uL media were injected and separated on Agilent 1100 system with Waters Atlantis T3 column (3 m, 1502.1 mm i.d.). Binary mobile phase consisting of solvent systems A (0.1% formic acid in ddH.sub.2O, v/v) and B (0.1% formic acid in acetonitrile, v/v) were used in gradient elution with flow of 0.3 mL/min. Initial conditions were set at 100:0 A:B, 1 min hold was employed followed by linear gradient to 70:30 at 20 min and linear gradient to 10:90 at 45 min. Gradient conditions were reset to 100:0 A:B from 45.1 min to 55 min. After separation, column effluent was introduced by positive mode electrospray ionization into Agilent MSD-TOF mass spectrometer. Mass data from m/z 70-1100 were collected. Biomarkers were identified with Agilent Mass Profiler Professional software, as recommended. These studies were performed by Bruce Cooper at Purdue University Metabolite Profiling Facility.
(66) Serological studies. Sera were stored at 20 C. and analyzed for ALT and bilirubin as previously described. Human albumin was measured by immunoassay (Bethyl Laboratories).
(67) Statistical analysis. Data were analyzed by t-tests, Pearson correlation tests, logrank tests, and ANOVA with Holm-Sidak posthoc test. P values <0.05 were considered significant.
Example 2
(68) Differentiation of human embryonic stem cells (hESC) by synthetic counterparts of substances made naturally in fetal hepatocytes: The list of principal components identified by LC-MS in conditioned medium from fetal hepatocytes (FH-CM), which was provided in Table 4 was further reduced to a set of 8 compounds (CP) (commercially available in chemically synthesized form) (Table 6).
(69) TABLE-US-00006 TABLE 6 CP tested for induction of hepatic differentiation in hESC and iPSC CP Exemplary Catalog designation Chemical identity Manufacturer No. 1 L-Cysteinglutathione Santa Cruz sc- Disulfide 211701 2 -Glu-Cys Sigma G0903 3 DL-Kynurenine Sigma 61250 4 D-Penicillamine disulfide Sigma P1101 5 Phenacetin Sigma 77440 6 Phytosphingosine HCl Sigma P2795 7 Pyridoxal HCl Sigma P6155 8 Tetracaine HCl Sigma T7508
(70) The ability of these CP to substitute for FH-CM in differentiating hESC (WA-01 line) was examined in various combinations of CP (see Table 7) in micromolar concentrations of 1, 5, 10, 15, 20, and 25. Amounts of >10 micromolar of the compounds caused toxicity with cell death and detachment of hESC (WA-01 line) from surfaces of cell culture dishes. When these 8 CP were tested in hESC individually in medium (see methods), none of the CP in 1, 5 or 10 micromolar amounts induced hepatic differentiation, and OCT4 was still expressed, albumin or vimentin was not expressed, and cell morphology was unchanged. These 8 CP were then tested in concentrations of 5 or 10 micromolar each in combinations to substitute for FH-CM in differentiating hESC.
(71) TABLE-US-00007 TABLE 7 Combinations of CP and their effects on induction of hepatic differentiation in hESC and iPSC Combination of compounds in culture Hepatic (+, present; CP CP CP CP CP CP CP CP differentiation , absent) 1 2 3 4 5 6 7 8 induced? 1 + No (only undifferentiated hESC) 2 + + No (only undifferentiated hESC) 3 + + + No (only undifferentiated hESC) 4 + + + + No (only undifferentiated hESC) 5 + + + + + Yes but incomplete (undifferentiated hESC present) 6 + + + + + + Yes but incomplete (undifferentiated hESC present) 7 + + + + + + + Yes (most optimal with no obvious undifferentiated hESC) 8 + + + + + + + + Yes (but less optimal versus 7CP group of row above) Hepatic differentiation was evaluated by characteristic morphology of undifferentiated stem cells and of epithelial cells along with albumin staining.
(72) The culture medium contained additives, including retinoic acid, dexamethasone. Amounts of >10 micromolar of the compounds caused toxicity with cell death and detachment of adherent hESC from surfaces of cell culture dishes. Further analysis indicated culture of hESC with CP individually or in groupings of up to 6 CP at one time in 1, 5 or 10 micromolar amounts, did not alter morphology of cultured hESC and these continued to display characteristic small sizes and cluster formation (not shown). By contrast, culture of hESC with a group of 7 CP in 5 or 10 micromolar concentrations for 2 weeks generated large cells with uniform morphology of epithelial cells (
(73) Further studies were performed of hESC-derived epithelial cells with this set of 7 CP. In response to the most effective combination of 7 CP, morphology of undifferentiated hESC changed and expression of OCT4 was no longer observed in differentiated hESC (
(74) iPSC were utilized that were obtained by reprogramming of normal human fibroblasts with non-integrating Sendai virus vectors from the Pluripotent Stem Cell Core at Albert Einstein College of Medicine. The differentiation protocol with FH-CM and CP was identical to studies with hESC described above. After 2 weeks, iPSC cultured with FH-CM became larger with epithelial morphology, whereas undifferentiated iPSC were smaller and were arranged in clusters (
(75) Materials and Methods
(76) Chemicals and reagents: CP were purchased and stock solutions were prepared in either water or ethanol as recommended by the manufacturers (Sigma Chemical Co.; Santa Cruz Biotechnology).
(77) Cells and cell culture: WA-01 hESC were passaged on matrigel-coated dishes in DMEM/F12 medium, 1% B27 supplement, 1% N.sub.2 supplement, 2 mM L-glutamine, 0.1 mM NEAA (Life Technologies) and 50 ng/ml basic FGF (R&D Systems). The iPSC were generated from normal human fibroblasts with CytoTune-iPS Sendai Reprogramming Kit (Life Technologies, Cat # A1378001). The iPSC were cultured on matrigel-coated dishes in DMEM/F12 medium, 1% B27 supplement, 1% N.sub.2 supplement, 2 mM L-glutamine, 0.1 mM NEAA (Life Technologies) and 50 ng/ml basic FGF (R&D Systems). To obtain FH-CM, hTERT-FH-B cells were cultured for 24 h in DMEM/F12 medium with 2% Knock-out Serum Replacer (KSR), 2 mM L-glutamine, 0.1 mM MEM Non Essential Amino Acids (NEAA), 1% penicillin-streptomycin (Life Technologies).
(78) Hepatic differentiation: For differentiation, hESC/iPSC were washed with DMEM/F12 and cultured for 2 weeks in FH-CM and CP in DMEM/F12 with 2% Knock-out Serum Replacer (KSR), 1% B27 supplement, 2 mM L-glutamine, 0.1 mM MEM Non-Essential Amino Acids (NEAA), 1% penicillin-streptomycin (Life Technologies). For testing effects of CP in differentiation of hESC/iPSC, identical culture medium was used except that one or more CP were added and the step of incubating hTERT-FH-B cells in this medium was omitted. HepG2 cells of human origin were included in some studies and were cultured in usual conditions with serum-containing medium as described in the parent document.
(79) Immunostaining: Cells were fixed in 4% paraformaldehyde in phosphate buffered saline, pH 7.4 (PBS), blocked/permeabilized with 5% goat serum, 0.2% Triton X-100 (Sigma) in PBS for 1 h, and incubated overnight at 4 C. with mouse anti-human albumin antibody (HSA-11 clone, 1:200, Sigma), anti-human OCT3/4 (1:200, Santa Cruz Biotechnology), anti-human vimentin (1:100, US Biologicals). After washes in PBS, TRITC-conjugated goat anti-mouse IgG (1:50, Sigma) cells were counterstained for 1 h with 4-6-diamidino-2-phenylindole (DAPI) (Life Technologies). In negative controls, primary antibody was omitted.
(80) Hepatic functions: For ureagenesis, cells were incubated with 5 mM ammonium chloride for 12 h and analyzed as described (Cho et al., 2004, (31)). For CYP450 activity, cells were analyzed for 7-ethoxyresorufin conversion, as described (Gupta et al., 1999, (32)).
REFERENCES
(81) 1. Chinzei, R., et al. Embryoid-body cells derived from a mouse embryonic stem cell line show differentiation into functional hepatocytes. Hepatology 36, 22-29 (2002). 2. Karp, J. M., et al. Cultivation of human embryonic stem cells without the embryoid body step enhances osteogenesis in vitro. Stem Cells 24, 835-843 (2006). 3. Cai, J., et al. Directed differentiation of human embryonic stem cells into functional hepatic cells. Hepatology 45, 1229-1239 (2007). 4. Inada, M., et al. Stage-specific regulation of adhesion molecule expression segregates epithelial stem/progenitor cells in fetal and adult human livers. Hepatol Int 2, 50-62 (2008). 5. Malhi, H., Irani, A. N., Gagandeep, S. & Gupta, S. Isolation of human progenitor liver epithelial cells with extensive replication capacity and differentiation into mature hepatocytes. J Cell Sci 115, 2679-2688 (2002). 6. Inada, M., et al. Phenotype reversion in fetal human liver epithelial cells identifies the role of an intermediate meso-endodermal stage before hepatic maturation. J Cell Sci 121, 1002-1013 (2008). 7. Bandi, S., Joseph, B., Cheng, K. & Gupta, S. Spontaneous origin from human embryonic stem cells of early developmental stage liver cells displaying conjoint meso-endodermal phenotype with hepatic functions. J Cell Sci 2012; in press. 8. Moore, R. N. & Moghe, P. V. Expedited growth factor-mediated specification of human embryonic stem cells toward the hepatic lineage. Stem Cell Res 3, 51-62 (2009). 9. Johannesson, M., et al. FGF4 and retinoic acid direct differentiation of hESCs into PDX1-expressing foregut endoderm in a time- and concentration-dependent manner. PLoS ONE 4, e4794 (2009). 10. Ding, B. S., et al. Inductive angiocrine signals from sinusoidal endothelium are required for liver regeneration. Nature 468, 310-5 (2010). 11. Bandi, S., et al. Perturbations in Atm signaling pathways following drug-induced acute liver failure and their reversal during rescue of animals by cell therapy. Am J Pathol 178, 161-74 (2011). 12. Wege, H., et al. Telomerase reconstitution immortalizes human fetal hepatocytes without disrupting their differentiation potential. Gastroenterology 124, 432-444 (2003). 13. Zalzman, M. et al. Reversal of hyperglycemia in mice using human expandable insulin-producing cells differentiated from fetal liver progenitor cells. Proc Natl Acad Sci USA 100, 7253-8 (2003). 14. Enami, Y., et al. Hepatic stellate cells promote hepatocyte engraftment in rat liver after prostaglandin-endoperoxide synthase inhibition. Gastroenterology 136, 2356-64 (2009). 15. Shaner, N. C., et al. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22, 1567-72 (2004). 16. D'Amour, K. A., et al. Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat Biotechnol 23, 1534-1541 (2005). 17. Soto-Gutierrez, A., et al. Differentiation of mouse embryonic stem cells to hepatocyte-like cells by co-culture with human liver nonparenchymal cell lines. Nat Protoc 2, 347-356 (2007). 18. Lavon, N., Yanuka, 0. & Benvenisty, N. Differentiation and isolation of hepatic-like cells from human embryonic stem cells. Differentiation 72, 230-238 (2004). 19. Rambhatla, L., Chiu, C. P., Kundu, P., Peng, Y. & Carpenter, M. K. Generation of hepatocyte-like cells from human embryonic stem cells. Cell Transplant 12, 1-11 (2003). 20. Hay, D. C., et al. Highly efficient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling. Proc Natl Acad Sci USA 105, 12301-12306 (2008). 21. Shiraki, N., et al. Differentiation of mouse and human embryonic stem cells into hepatic lineages. Genes Cells 13, 731-746 (2008). 22. Huang, P., et al. Induction of functional hepatocyte-like cells from mouse fibroblasts by defined factors. Nature 475, 386-9 (2011). 23. Jung, J., Zheng, M., Goldfarb, M. & Zaret, K. S. Initiation of mammalian liver development from endoderm by fibroblast growth factors. Science 284, 1998-2003 (1999). 24. Piscaglia, A. C., Shupe, T. D., Oh, S. H., Gasbarrini, A. & Petersen, B. E. Granulocyte-colony stimulating factor promotes liver repair and induces oval cell migration and proliferation in rats. Gastroenterology 133, 619-31 (2007). 25. Chen, S., et al. A small molecule that directs differentiation of human ESCs into the pancreatic lineage. Nat Chem Biol 5, 258-65 (2009). 26. Takeda, M., et al. Alpha-aminoadipate induces progenitor cell properties of Mller glia in adult mice. Invest Ophthalmol Vis Sci 49, 1142-50 (2008). 27. Cho, J. J., et al. Analysis of the functional integrity of cryopreserved human liver cells including xenografting in immunodeficient mice to address suitability for clinical applications. Liver Int 24, 361-370 (2004). 28. Basma, H., et al. Differentiation and transplantation of human embryonic stem cell-derived hepatocytes. Gastroenterology 136, 990-999 (2009). 29. Gueven, N., et al. Site-directed mutagenesis of the ATM promoter: consequences for response to proliferation and ionizing radiation. Genes Chromosomes Cancer 38, 157-167 (2003). 30. Gupta, S., et al. Position-specific gene expression in the liver lobule is directed by the microenvironment and not by the previous cell differentiation state. J Biol Chem 274, 2157-2165 (1999). 31. Cho, J. J., Joseph, B., Sappal, B. S., Giri, R. K., Wang, R., Ludlow, J. W., Furth, M. E., Susick, R., and Gupta, S. (2004). Analysis of the functional integrity of cryopreserved human liver cells including xenografting in immunodeficient mice to address suitability for clinical applications. Liver Int 24, 361-370. 32. Gupta, S., Rajvanshi, P., Sokhi, R. P., Vaidya, S., Irani, A. N., and Gorla, G. R. (1999). Position-specific gene expression in the liver lobule is directed by the microenvironment and not by the previous cell differentiation state. J Biol Chem 274, 2157-2165.