Protein A mutants having high alkali resistance and methods of use thereof
10287327 ยท 2019-05-14
Assignee
Inventors
Cpc classification
C07K1/22
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
International classification
C12N9/96
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C07K1/22
CHEMISTRY; METALLURGY
Abstract
A series of protein A mutants having high alkali resistance, and methods of using the protein A mutants are provided. The protein A mutants have a high binding affinity for regions of immunoglobulin proteins other than the complementarity determining regions. The protein A mutants can be coupled to a solid support for immunoglobulin isolation, or conjugated to a label for immunoglobulin detection. This series of protein A mutants has high chemical stability under alkaline conditions of pH 13-14, and can also be used as chromatography ligands for purification procedures that use alkaline solutions under harsh conditions, such as Clean-In-Place (CIP). Also provided are methods of immunoglobulin separation and purification, and alkali regeneration of affinity chromatography medium that uses protein A as a ligand.
Claims
1. A recombinantly expressed mutant protein A molecule for isolating, purifying, or detecting an immunoglobulin, wherein the mutant protein A molecule comprises the amino acid sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 2, the amino acid sequence of residues 7 to 54 of SEQ ID NO: 1, or the amino acid sequence of residues 7 to 54 of SEQ ID NO: 2.
2. The recombinantly expressed mutant protein A molecule of claim 1, wherein the mutant protein A molecule is stable under alkaline conditions of pH 13-14.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
(1) The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown.
(2) In the drawings:
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION OF THE INVENTION
Example 1: Construction of Vector Containing a Gene which is Encoding Protein a Fused with 6 Histidine Residues at its N-Terminus
(10) According to the codon preference of E. coli E. coli and to avoid secondary structure formation of mRNA, gene sequences of protein A fused with 6 histidine residues at its N-terminus were designed and optimized, which are shown here as SEQ ID NO:4 and SEQ ID NO:6 respectively; the corresponding amino acid sequences are shown as SEQ ID NO:3 and SEQ ID NO:5 respectively, of which the former is called protein A1 and the latter is called protein A2 in the following description. Using gene design software, multiple small gene fragments with certain length of overlapping sequences and similar annealing temperature were designed. All the small genes pieced together would cover the whole length of protein A1/A2 genes. The primer pairs were designed and synthesized according to those small gene sequences, of which the sequences were shown as here: Primers 4-1 to 4-8 (SEQ ID NOs: 16-23, respectively) are for the Protein A1 and Primers 6-1 to 6-8 (SEQ ID NOs: 24-31, respectively) are for the Protein A2. Two rounds of PCR reactions were done to synthesize the genes. For the 1st round PCR, all the primers 4-1 to 4-8 or primers 6-1 to 6-8 were mixed together as primers and templates, PBO polymerase (Genscript Corporation) was used for PCR reaction. All PCR reactions were done with 2720 thermal cycler (Applied Biosysytems) using the following method: the reaction cycles were 95 C. for 20 s, 55 C. for 20 s, 72 C. for 20 s, after a total of 25 cycles, one extension step was taken at 72 C. for 3 minutes, the PCR solutions were cooled down to 4 C. and stored as the 1st PCR products. These 1st PCR products were used as templates for the 2nd round. Respectively, forwarding primers (primer 4-1/primer 6-1) and reversing primers (primer 4-8/primer 6-8) were used in the 2nd PCR reaction to amplify whole genes of Protein A1/A2 with the same PCR method as described above. The PCR products from the 2nd round PCR reactions were loading to an agarose gel containing 1% ethidium bromide and purified by electrophoresis. The DNA bands were visualized under UV light and cut out from the gel. The amplified DNA fragments were purified using Quick Gel Extraction Kit (Genscript Corporation) and the protocol provided by the manufacturer. The purified DNA fragments were sequenced using ABI PRISM BIGDYE Terminator Cycle Sequencing Ready Reaction Kit and 3730196-capillary DNA analyzer from Applied Biosystems Inc.
(11) TABLE-US-00001 TABLE1 PCRPrimersforsynthesizingProteinA1andProteinA2genes. PCRPrimersforsynthesizingProteinA1gene (SEQIDNOs:16-23) Primer4-1 CCATGGGCTCACATCATCATCATCATCACGGCTCGGGTGCGGACGGTAA Primer4-2 ACGCATTCTGCTGTTCTTTTTCAAATTTACCGTCCGCACCC Primer4-3 AGAACAGCAGAATGCGTTCTACGAAATTCTGCATCTGCCGA Primer4-4 CATTACGCTGTTCTTCGGTCAGGTTCGGCAGATGCAGAATT Primer4-5 CCGAAGAACAGCGTAATGCATTTATCCAGTCTCTGAAAGATGATCCGAGC Primer4-6 ACCCAGCACGTTCGTAGACTGGCTCGGATCATCTTTCAGA Primer4-7 TACGAACGTGCTGGGTGAAGCGAAAAAACTGAACGATGCG Primer4-8 CATATGTCATTTCGGGGCCTGCGCATCGTTCAGTTTTTTC PCRPrimersforsynthesizingProteinA2gene (SEQIDNO:24-31) Primer6-1 CCATGGGCTCGCACCACCACCACCACCACGGCTCGGGCGCAGATGGCAAG Primer6-2 ATGCGTTCTGTTGTTCTTTTTCAAACTTGCCATCTGCGCC Primer6-3 AAAGAACAACAGAACGCATTCTACGAAATCCTGCATCTGCCGA Primer6-4 TGCGTTACGCTGTTCTTCGGTCAGGTTCGGCAGATGCAGGA Primer6-5 AGAACAGCGTAACGCATTCATCAAGTCTATCCGCGATGATCCG Primer6-6 CCCAGCACGTTCGTAGACTGGCTCGGATCATCGCGGATAG Primer6-7 CTACGAACGTGCTGGGCGAAGCGAAAAAACTGAATGATGC Primer6-8 CATATGTCATTTCGGGGCCTGCGCATCATTCAGTTTTTTCGC
(12) DNA fragments which the sequences had been verified were used as templates for protein A1/A2 subcloning. Primer 7 (SEQ ID NO:7) with primer 8 (SEQ ID NO:8) or primers 7 (SEQ ID NO:7) with primer 9 (SEQ ID NO:9) were used amplify cDNA fragments of the protein A1 or A2 respectively. The PCR products were purified by agarose gel electrophoresis. Using CLONEEZ cloning kit (Genscript Corporation) and following the kit instruction, gene fragments encoding protein A1/A2 were subcloned into pET15b vectors. Vectors containing protein A1/A2 genes were verified by DNA sequencing and named by the following abbreviation: vector containing gene encoding protein A1 with the amino acid sequence shown as SEQ ID NO:3 was named PET15b-ProteinA1; vector containing gene encoding protein A2 with the amino acid sequence shown as SEQ ID NO:5 was named PET15b-ProteinA2.
Example 2: Construction of Vector Containing a Gene which is Encoding Protein a Dimer Fused with 6 Histidine Residues at its N-Terminus
(13) According to the codon preference of E. coli and to avoid secondary structure formation of mRNA, gene sequences of protein A dimer fused with 6 histidine residues at its N-terminus were designed and optimized, which are shown here as SEQ ID NO:11 and SEQ ID NO:13 respectively; the corresponding amino acid sequences are shown as SEQ ID NO:10 and SEQ ID NO:12 respectively, of which the former is called protein AA1 and the latter is called protein AA2 for the following description. Using gene design software, multiple small gene fragments with certain length of overlapping sequences and similar annealing temperature were designed. All the small genes pieced together would cover the whole length of protein AA1/AA2 genes. The primer pairs were designed and synthesized according to those small gene sequences, of which the sequences were shown as here: Primers 11-1 to 11-12 (SEQ ID NOs: 32-43) are for the Protein AA1 and Primers 13-1 to 13-12 (SEQ ID NOs: 44-55) are for the Protein AA2. Two rounds of PCR reactions were done to synthesize the genes. For the 1st round PCR, all the primers of 11-1 to 11-12 or primers 13-1 to 13-12 were mixed together as primers and templates, PBO polymerase (Genscript Corporation) was used for PCR reaction. All PCR reactions were done with 2720 thermal cycler (Applied Biosysytems) using the following method: the reaction cycles were 95 C. for 20 s, 55 C. for 20 s, 72 C. for 20 s, after a total of 25 cycles, one extension step was taken at 72 C. for 3 minutes, the PCR solutions was cooled down to 4 C. and stored as the 1st PCR products. These 1st PCR products were used as templates for the 2nd round. Respectively, forwarding primers (primer 11-1/primer 13-1) and reversing primers (primer 11-12/primer 13-12) were used in the 2nd PCR reaction to amplify whole genes of Protein AA1/AA2 with the same PCR method as described above. The PCR products from the 2nd round PCR reactions were loading to an agarose gel containing 1% ethidium bromide and purified by electrophoresis. The DNA bands were visualized under UV light and cut out from the gel. The amplified DNA fragments were purified using Quick Gel Extraction Kit (Genscript Corporation) and the protocol provided by the manufacture. The purified DNA fragments were sequenced using ABI PRISM BIGDYE Terminator Cycle Sequencing Ready Reaction Kit and 3730196-capillary DNA analyzer from Applied Biosystems Inc.
(14) TABLE-US-00002 TABLE2 PCRPrimersforsynthesizingProteinAA1dimerandProtein AA2dimer PCRPrimersforsynthesizingProteinAA1dimergene (SEQIDNOs:32-43) Primer11-1 CCATGGGCTCACATCATCATCATCATCACGGCTCGGGTGCGGACGGTAA Primer11-2 ACGCATTCTGCTGTTCTTTTTCAAATTTACCGTCCGCACCC Primer11-3 AGAACAGCAGAATGCGTTCTACGAAATTCTGCATCTGCCGAACCTGACC Primer11-4 TCAGAGACTGGATAAATGCATTACGCTGTTCTTCGGTCAGGTTCGGCAG Primer11-5 TGCATTTATCCAGTCTCTGAAAGATGATCCGAGCCAGTCTACGAACGTGC Primer11-6 CCTGCGCATCGTTCAGTTTTTTCGCTTCACCCAGCACGTTCGTAGACTGG Primer11-7 TGAACGATGCGCAGGCCCCGAAAGCGGATGGCAAATTCGAAAAAG Primer11-8 GCAGAATTTCATAGAAGGCGTTCTGCTGTTCTTTTTCGAATTTGCCATCC Primer11-9 CGCCTTCTATGAAATTCTGCACCTGCCGAATCTGACGGAAGAACAGCGCA Primer11-10 GCTCGGATCGTCTTTCAGGCTCTGGATGAACGCATTGCGCTGTTCTTCCG Primer11-11 TGAAAGACGATCCGAGCCAGTCCACGAATGTTCTGGGCGAAGCGAAAAA Primer11-12 CATATGTCATTTCGGTGCTTGTGCGTCATTCAGTTTTTTCGCTTCGCCCA PCRPrimersforsynthesizingProteinAA2dimergene (SEQIDNOs:44-55) Primer13-1 CCATGGGCTCGCACCACCACCACCACCACGGCTCGGGCGCAGATGGCAAG Primer13-2 TCGTAGAATGCGTTCTGTTGTTCTTTTTCAAACTTGCCATCTGCGCC Primer13-3 ACAGAACGCATTCTACGAAATCCTGCATCTGCCGAACCTGACCGA Primer13-4 CGCGGATAGACTTGATGAATGCGTTACGCTGTTCTTCGGTCAGGTTCGGC Primer13-5 TCATCAAGTCTATCCGCGATGATCCGAGCCAGTCTACGAACGTGCTGGG Primer13-6 GGCCTGCGCATCATTCAGTTTTTTCGCTTCGCCCAGCACGTTCGTAG Primer13-7 AATGATGCGCAGGCCCCGAAAGCGGATGGTAAATTTGAAAAAGAACAGCA Primer13-8 AGGTGCAGAATTTCATAGAAGGCGTTCTGCTGTTCTTTTTCAAATTTACC Primer13-9 CTTCTATGAAATTCTGCACCTGCCGAATCTGACGGAAGAACAGCGTAATG Primer13-10 GCTCGGATCGTCACGAATGCTTTTAATGAACGCATTACGCTGTTCTTCCG Primer13-11 CGTGACGATCCGAGCCAGAGCACGAATGTCCTGGGCGAAGCCAAAAA Primer13-12 CATATGTCATTTCGGTGCTTGTGCGTCGTTCAGTTTTTTGGCTTCGCCCA
(15) DNA fragments which the sequences had been verified were used as templates for protein AA1/AA2 subcloning. Primer 7 (SEQ ID NO:7) with primer 14 (SEQ ID NO:14) or primers 7 (SEQ ID NO:7) with primer 15 (SEQ ID NO:15) were used amplify cDNA fragments of the protein AA1 or AA2 respectively. The PCR products were purified by agarose gel electrophoresis. Using CLONEEZ cloning kit (Genscript Corporation) and following the kit instruction, gene fragments encoding protein AA1/AA2 were subcloned into pET15b vectors. Vectors containing protein AA1/AA2 genes were verified by DNA sequencing and named by the following abbreviation: vector containing gene encoding protein AA1 with the amino acid sequence shown as SEQ ID NO:10 was named PET15b-ProteinAA1; vector containing gene encoding protein AA2 with the amino acid sequence shown as SEQ ID NO:12 was named PET15b-ProteinA2.
Example 3: Expression of Protein a with N-Terminal Fused Six Histidine Residues
(16) The plasmid PET15b-ProteinA1 was transformed into competent cells of Escherichia coli strain BL21. Escherichia coli BL21 containing the plasmid PET15b-ProteinA1 was inoculated into the culture broth (1 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl, and 100 mg/L Ampicillin) and cultured at 37 C. When cells reached the logarithmic growth curve, 0.5 mM IPTG was added into the broth to induce protein expression for 4 hours, cell pellets were collected by centrifugation. A small amount of the cell was heated at high temperature (95 C.) and the whole cell lysate was loaded onto 420% gradient SDS-PAGE gel for analysis. As shown in
Example 4: Expression of Protein a Dimer with N-Terminal Fused Six Histidine Residues
(17) The plasmid PET15b-ProteinAA1 was transformed into competent cells of Escherichia coli BL21. Escherichia coli BL21 containing the plasmid PET15b-Protein AA1 was inoculated into the culture broth (1 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl, and 100 mg/L Ampicillin) and cultured at 37 C., when cells reached their logarithmic growth curve 0.5 mM IPTG was added to induce protein expression for 4 hours. Cell pellets were collected by centrifugation. A small amount of bacteria was heated at high temperature (95 C.) and the whole cell lysate was loaded onto 420% gradient SDS-PAGE gel for analysis. As shown in
Example 5: Purification of Protein a with the N-Terminal Fused Six Histidine Residues
(18) The constant flow pump was rinsed with distilled water, and then the empty glass chromatographic column. About 200 ml Ni-IDA resin (Genscript Corporate) was packed into the column. Using the constant flow pump, the column was equilibrated with equilibration buffer (20 mM Tris 300 mM NaCl) for about 3 L (20 CV) at the flow rate of 5 ml/min. 10 g cell pellets expressing protein A1 were suspended with 200 ml equilibration buffer (20 mMTris 300 NaCl) and sonicated (Ningbo Xinzhi bio technology limited company JY98 IIIDH). Cell lysate was centrifuged and the supernatant was loaded onto the Ni-IDA column at the flow rate of 2 ml/min. Then the column was excessively washed with equilibration buffer at the flow rate of 5 ml/min to remove unbounded proteins and contaminants until the UV being stable. Then the target protein was eluted with elution buffer (20 mM Tris, 300 mM NaCl, 250 mM Iminazole) at the flow rate of 5 ml/min and collected. The eluted protein was loaded onto 420% gradient SDS-PAGE for analysis. As shown in
Example 6: Purification of Protein a Dimer with the N-Terminal Fused Six Histidine Residues
(19) The constant flow pump was rinsed with distilled water, and then the empty glass chromatographic column. About 200 ml Ni-IDA resin (Genscript Corporate) was packed into the column. Using the constant flow pump, the column was equilibrated with equilibration buffer (20 mM Tris 300 mM NaCl) for about 3 L (20 CV) at the flow rate of 5 ml/min. 10 g cell pellets expressing protein A1 were suspended with 200 ml equilibration buffer (20 mMTris 300 NaCl) and sonicated (Ningbo Xinzhi bio technology limited company JY98 IIIDH). Cell lysate was centrifuged and the supernatant was loaded onto the Ni-IDA column at the flow rate of 2 ml/min. Then the column was excessively washed with equilibration buffer at the flow rate of 5 ml/min to remove unbounded proteins and contaminants until the UV being stable. Then the target protein was eluted with elution buffer (20 mM Tris, 300 mM NaCl, 250 mM Imidazole) at the flow rate of 5 ml/min and collected. The eluted protein was loaded onto 420% gradient SDS-PAGE for analysis. As shown in
Example 7: Protein a or Protein a Dimer with the N-Terminal Fused Six Histidine Residues Used as an Ligand for Affinity Chromatographic Medium to Purify Immunoglobulin
(20) Using the amino group, protein A or protein A dimer with the N-terminal fused six histidine residues were coupled onto the epoxy-based surface of agarose medium to make affinity chromatographic resin. Here 10 mg dimeric protein A or protein A was coupled to an epoxy-based surface of 1 ml SEPHAROSE 4B (GE Healthcare) agarose beads to make Protein A affinity resin, of which 0.5 ml resin was used for immunoglobulin purification test. Firstly, the constant flow pump was cleaned with 20 ml double distilled water, then the empty chromatographic column was cleaned. 0.5 ml resin was packed into the column. Using constant flow pump the column was equilibrated with 10 ml phosphate buffer (containing 0.15M NaCl, 30 mM Na2HPO4, 10 mM NaH2PO4 pH 7) at the flow rate of 1 ml/min.
(21) 15 ml of human serum at the concentration of 5 mg/ml was used as testing sample and loaded to the packed column at the flow rate of 0.5-1 ml/min to the saturate the binding of immunoglobulin to the protein A ligands, and then washed the column with 20 ml (40 CV) phosphate buffer (containing 0.15M of NaCl, 30 mM Na2HPO4, 10 mMNaH2PO4 pH 7.0) to remove unbound proteins and contaminants. Human immunoglobulin was finally eluted with 0.1M pH 3.0 glycine buffer and collected with UV detection. 20 uL of the eluted fraction was loaded onto 4-20% gradient SDS-PAGE gel for analysis. As shown in
Example 8: Alkali Resistance Tests of Protein a or Protein a Dimer with the N-Terminal Fused Six Histidine Residues as Ligands of Affinity Chromatographic Medium for Purifying Immunoglobulin
(22) 0.5 ml of SEPHAROSE beads conjugated protein A dimer with six N-terminal histidine residues was used for Clean-In-Place (CIP) test using alkaline solutions. First, the procedure of Example 7 was performed, and the total amount of eluted immunoglobulin was calculated as column capacity. After elution, CIP was performed using 15 ml 0.5M NaOH solution at a flow rate of 1 ml/min to clean the resin thoroughly. And then followed with 10 ml of phosphate buffer (containing 0.15M of NaCl, 30 mMNa2HPO4, 10 mM NaH2PO4 adjusted to pH 7.0) at the same flow rate to wash out NaOH and re-equilibrate the column. Another procedure of Example 7 was performed to determine the binding capacity of the column, which could be used as binding ability of protein A ligand to immunoglobulin. As shown in
(23) It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.