APTAMER-BASED ANALYTE ASSAYS
20190136241 ยท 2019-05-09
Assignee
Inventors
- Milan Stojanovic (Fort Lee, NJ, US)
- Kyungae YANG (New York, NY, US)
- Steven Taylor (Jersey City, NJ, US)
- Nenad Milosavic (Hackensack, NJ, US)
Cpc classification
A61K45/06
HUMAN NECESSITIES
C12N2310/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61P7/02
HUMAN NECESSITIES
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
A61P7/02
HUMAN NECESSITIES
G01N33/52
PHYSICS
Abstract
The present invention relates to aptamer-based assays to capture and/or detect analytes comprising primary and secondary aptamers, as well as compositions comprising such primary and secondary aptamers, wherein analytes comprise small molecules that offer limited mutually non-competitive epitopes to antibodies, that is, with limited ability to measure in non-competitive sandwich assays using primary and secondary antibodies or primary and secondary aptamers.
Claims
1. An assay for testing a sample for the presence and/or amount of an analyte of interest comprising contacting at least a portion of the sample with effective amounts of (1) a primary aptamer comprising a core sequence that binds to the analyte and (2) an anti-aptamer which is complementary to at least a portion of the primary aptamer, wherein the primary aptamer and/or anti-aptamer comprise a detectable moiety(ies) which detect whether the primary aptamer and anti-aptamer are bound to each other or unbound; and wherein a primary aptamer bound to the analyte does not bind to its anti-aptamer.
2. The assay of claim 1 wherein the primary aptamer comprises a fluorescent label.
3. The assay of claim 1, where the anti-aptamer comprises a quencher moiety.
4. The assay of claim 1, where the anti-aptamer is complementary to at least 85 percent of the primary aptamer
5. The assay of claim 4, where the anti-aptamer is complementary to at least 95 percent of the primary aptamer.
6. The assay of claim 1, where the analyte is selected from the group consisting of glucose, hydrocortisone, phenylalanine, dehydroisoandrosterone, deoxycortisone, testosterone, aldosterone, dopamine, sphingosine-1-phosphate, serotonin, melatonin, tyrosine, tobramycin, amikacin, methylene blue, ammonium, boronic acid, and epinephrine.
7. A method of detecting or measuring the presence or amount of an analyte of interest in a sample, comprising (i) contacting at least a portion of a sample with effective amounts of a primary aptamer and an anti-aptamer that is complementary to at least a portion of the primary aptamer, said primary aptamer and/or anti-aptamer comprising a moiety which allows the amount of primary aptamer bound to analyte to be detected and/or measured, under conditions that would permit duplex formation between the primary aptamer and anti-aptamer if target analyte were not present; and (ii) detecting the amount of primary aptamer that is not bound to anti-aptamer.
8. The method of claim 7 wherein the primary aptamer comprises a fluorescent label.
9. The method of claim 7, where the anti-aptamer comprises a quencher moiety.
10. The method of claim 7, where the anti-aptamer is complementary to at least 85 percent of the primary aptamer
11. The method of claim 10, where the anti-aptamer is complementary to at least 95 percent of the primary aptamer.
12. The method of claim 7, where the analyte is selected from the group consisting of glucose, hydrocortisone, phenylalanine, dehydroisoandrosterone, deoxycortisone, testosterone, aldosterone, dopamine, sphingosine-1-phosphate, serotonin, melatonin, tyrosine, tobramycin, amikacin, methylene blue, ammonium, boronic acid, epinephrine, creatinine, and vasopressin.
13. A method of detecting or measuring the presence or amount of an analyte of interest in a sample, comprising (i) contacting at least a portion of the sample with effective amounts of (a) a primary aptamer comprising a fluorescent label and (b) an anti-aptamer, comprising a moiety that quenches fluorescence of said fluorescent label if primary aptamer and anti-aptamer are bound together in a duplex, under conditions that would permit duplex formation between primary aptamer and anti-aptamer to occur if analyte were not present; and (ii) detecting the amount of fluorescence.
14. The method of claim 13 wherein the primary aptamer comprises a fluorescent label.
15. The method of claim 13, where the anti-aptamer comprises a quencher moiety.
16. The method of claim 13, where the anti-aptamer is complementary to at least 85 percent of the primary aptamer
17. The method of claim 16, where the anti-aptamer is complementary to at least 95 percent of the primary aptamer.
18. The method of claim 13, where the analyte is selected from the group consisting of glucose, hydrocortisone, phenylalanine, dehydroisoandrosterone, deoxycortisone, testosterone, aldosterone, dopamine, sphingosine-1-phosphate, serotonin, melatonin, tyrosine, tobramycin, amikacin, methylene blue, ammonium, boronic acid, epinephrine, creatinine and vasopressin.
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. The method of claim 7, wherein the primary aptamer comprises a core sequence that binds to the analyte and a portion complementary to a sensor oligonucleotide, and the method further comprises contacting at least a portion of the sample with an effective amounts of a sensor oligonucleotide one or more of which is bound to a detectable moiety(ies) which can detect whether the primary aptamer and sensor oligonucleotide are bound to each other or whether primary aptamer is bound to analyte.
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. The method of claim 7, wherein the primary aptamer comprises a core sequence that binds to the analyte and a portion that, when primary aptamer is bound to analyte, binds to a secondary sandwich aptamer, and the method further comprises contacting at least a portion of the sample with an effective amounts of a secondary sandwich aptamer; one or more of which is bound to a detectable moiety(ies) which can detect whether the primary aptamer and secondary sandwich aptamer are bound to each other or unbound.
35. (canceled)
36. (canceled)
37. (canceled)
38. (canceled)
39. (canceled)
40. (canceled)
41. (canceled)
Description
4. BRIEF DESCRIPTION OF THE FIGURES
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
5. DETAILED DESCRIPTION OF THE INVENTION
[0123] The present invention relates to aptamer-based assays to capture and detect analytes. In addition to the primary aptamers, associated oligonucleotides and assay methods described herein, the methodology may be applied to design other aptamers, associated oligonucleotides, and analogous assays with aptamers or aptamer pairs, with adjustments related to the types of molecules, available reagents, and quantitative goals, for example established by the concentration in actual clinical samples and/or affinities of isolated reagents. Further, the assays, which utilize various mixtures of nucleic acids, can be combined with other nucleic acid elements such as those that form strand-displacement cascades.
[0124] For clarity of disclosure and not by way of limitation, this detailed description of the invention is divided into the following sections:
[0125] 5.1. Primary aptamers;
[0126] 5.2. Anti-Aptamer Assays
[0127] 5.3. Pseudosandwich Assays; and
[0128] 5.4. Sandwich Assays.
[0129] Where a sequence provided herein refers to nucleotide N, that position in the sequence may be filled by any natural or unnatural nucleotide, unless specified to the contrary.
[0130] The term epitope is used herein as referring to the binding site for the primary aptamer on the target analyte or, in the case of a sandwich assay, can be a binding site on the target analyte and a second aptamer.
[0131] In certain embodiments, where the invention provides for a sequence having a terminal CTCTC (SEQ ID NO:237) 5 sequence, the invention also provides for an alternative version of that sequence lacking the initial CTCTC (SEQ ID NO:237) sequence.
[0132] In certain embodiments, where the invention provides for a sequence having a CTCTC GGG (SEQ ID NO:238) 5 terminal sequence, the invention also provides for an alternative version of that sequence lacking the initial CTCTCGGG (SEQ ID NO:238) sequence. In certain embodiments, where the invention provides for a sequence having a TCCC (SEQ ID NO:246) 3 terminal sequence, the invention also provides for an alternative version of that sequence lacking the final TCCC (SEQ ID NO:246) sequence. In certain embodiments, where the invention provides for a sequence having a CTCTC GGG (SEQ ID NO:238) 5 terminal sequence and a TCCC (SEQ ID NO:246) 3 terminal sequence, the invention also provides for an alternative version lacking both these sequences.
In the assays described herein, detectable labels are used. In certain embodiments, a fluorescent moiety is comprised in one partner of a binding pair, and a quencher moiety is comprised in the other member of the binding pair. Assays may be designed so that the detectable moietye.g. the fluorescent moietyis on either member of the pair. Fluorescent/quencher compounds are known in the art, and see Mary Katherine Johansson, Methods in Molecular Biol. 335:Fluorescent Energy Transfer Nucleic Acid Probes: Designs and Protocols, 2006, Didenko, ed., Humana Press, Totowa, N.J., and Marras et al., 2002, Nucl. Acids Res. 30, e122 (both incorporated by reference herein). Further, moieties that result in an increase in detectable signal when in proximity of each other may be used as alternative labels in the assays described herein, for example, as a result of fluorescence resonance energy transfer (FRET); suitable pairs include but are not limited to fluoroscein and tetramethylrhodamine; rhodamine 6G and malachite green, and FITC and thiosemicarbazole, to name a few.
[0133] 5.1. Primary Aptamers
[0134] A primary aptamer (A.sup.P) binds an target analyte (ligand, L). A primary aptamer may be isolated (identified as binding to its target analyte) by solution-phase or solid-phase selection.
[0135] Primary aptamers (A.sup.p) and associated oligonucleotides (e.g., anti-aptamers, sensor oligonucleotides, comp oligonucleotides, and sandwich oligonucleotides (also referred to as secondary aptamers or A.sup.s)), can have any size consistent with their intended function. In certain non-limiting embodiments, a primary aptamer or associated oligonucleotide is between about 20-250 nucleotides in length. For example, but not by way of limitation, the length can be between about 20-200 nucleotides, or between about 20-150 nucleotides, or between about 30 and 200 nucleotides, or between about 40-200 nucleotides, or between about 50-200 nucleotides, or between about 60-200 nucleotides, or between about 70-200 nucleotides, or between about 80-200 nucleotides, or between about 100-200 nucleotides, or between about 150-200 nucleotides, or between about 30-150 nucleotides, or between about 30-100 nucleotides, or between about 30-80 nucleotides, or between about 30-50 nucleotides, or between about 40-100 nucleotides; or at least about 20 nucleotides, or at least about 30 nucleotides, or up to about 100 nucleotides, or up to about 200 nucleotides (where about means plus or minus 20 percent), or between 20-250 nucleotides, or between 25 and 100 nucleotides. In certain non-limiting embodiments, primary aptamers and/or associated oligonucleotides can be spiegelmers or contain unnatural enantiomers of nucleic acids..sup.22-25
[0136] In particular embodiments, a primary aptamer is provided comprising a core sequence that acts as a binding pocket for the target analyte. In certain embodiments, a primary aptamer comprising a particular core sequence, or a consensus core sequence, is provided. A primary aptamer may further comprise an operative sequence which plays a functional role in a particular assay, as will be described below. A primary aptamer may also optionally comprise additional sequence, other than core sequence or operative sequence, which does not substantially impact its functionality. A primary aptamer comprising a core sequence that binds to a target analyte of interest may be utilized in diverse assays, including but not limited to those exemplified herein.
[0137] 5.1.1. Methods for Isolating Primary Aptamers
[0138] Primary aptamers can be identified that selectively bind to diverse target analytes, including, but not limited to amino acids, mono- and oligo-saccharides, steroids, catecholamines, serotonin, melatonin, lipids, hormones, and/or peptides. In certain non-limiting embodiments, the method can be used to produce primary aptamers that bind to spiegelmers for vasopressin, aminoglycosides and other antibiotics, immunosupressants, anti-tumor agents, pesticides, hormones, etc.
[0139] For example, and not by way of limitation, the isolation of primary aptamers can be performed using the SELEX process. In certain non-limiting embodiments, the primary aptamers are isolated by either solid- (traditional) or newer solution-phase selections.sup.16-21. Further, in certain non-limiting embodiments, the solution-phase selection has inherent advantages for small molecules, such as higher affinity and ease of screening of aptamers.
[0140] In certain non-limiting embodiments, the method comprises attaching a biotinylated strand complementary (C.sub.B) to one of the PCR primers to agarose-streptavidin (
[0141] In the solution-phase selection, molecules are used without any attachment to a matrix, thus, no functional groups are wasted. This maximizes interactions with aptamers, leading to high affinities. Concentrations of compounds that can be used go up to the limit of solubility, allowing isolation of weak-affinity aptamers (e.g., against metabolites and glucose).
[0142] In certain non-limiting embodiments, fluorescent sensors can be directly obtained from this selection, by substituting biotin with dabcyl and attaching fluorescein to the aptamer (
[0143] In certain non-limiting embodiments, the method comprises:
[0144] (1) Isolating primary aptamers (A.sup.ps) by solution-phase (
[0145] (2) Testing of the primary aptamer in its structure-switching form and modifying its structure switching form, which is then turned into pseudo-sandwich assay format (
[0146] (3) Isolating secondary sandwich aptamers (A.sup.ss) by either solution-phase or solid phase selections (
[0147] (4) Implementing sandwich assays for targets (
[0148] (5) Preparing a shortened form of the primary aptamer originally isolated;
[0149] (6) Modifying the optionally shortened primary aptamer by introducing an operative sequence; and/or
[0150] (7) Modifying the optionally shortened primary aptamer by substituting one or more nucleotides in its binding pocket to improve binding properties in the intended assay.
[0151] 5.1.2 Glucose-Binding Primary Aptamers
[0152] In certain non-limiting embodiments, a primary aptamer binds to glucose in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.1 M (affinity 10) and binds selectively with glucose versus galactose.
[0153] In certain non-limiting embodiments, a glucose-binding primary aptamer comprises the sequences CCGTGTGT (SEQ ID NO:157) and either AGTGTCCATTG (SEQ ID NO:158) or AGTGTCCTTTG (SEQ ID NO:159) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to glucose in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.1 M (affinity 10), and binds selectivity to glucose versus galactose or fructose (see, for example,
[0154] In certain non-limiting embodiments, a glucose-binding primary aptamer has a predicted secondary structure that comprises two stems connected by sequences that bind to glucose (e.g., binding selectively to glucose versus galactose) and/or one or more of the following: a 4-OR-glucose epitope, where R is hydrogen, an alkyl group, another carbohydrate or a protein; cellobiose; and/or maltose. See, for example,
[0155] For example, but not by way of limitation, a glucose-binding primary aptamer may comprise a sequence selected from the group consisting of:
TABLE-US-00001 >S-Glu01: (SEQIDNO:160) CTCTCGGGACGACCGTGTGTGTTGCTCTGTAAC--------- AGTGTCCATTGTCGTCCC; >S-Glu02: (SEQIDNO:161) CTCTCGGGACGACCGTGTGTGGTAGAGTCGTCGGGCTCTAACAGTGTCCT TTGTCGTCCC; >S-Glu03: (SEQIDNO:162) CTCTCGGGACGACCGTGTGTGACGTGCGCCGTGGGGAACGTCAGTGTTCT TTGTCGTCCC; >S-Glu04: (SEQIDNO:163) CTCTCGGGACGACCGTGTGTCGACTTAGAGTCG--------- AGTGTCCTTTGTCGTCCC; and >S-Glu05: (SEQIDNO:164) CTCTCGGGACGACCGTGTGTTGCAATTCTTGCA--------- AGTGTTCTTTGTCGTCCC.
[0156] In certain non-limiting embodiments, a glucose-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:83 (
[0157] In certain non-limiting embodiments, isolated glucose-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:68, or SEQ ID NO:149 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated glucose-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:1. SEQ ID NO:68, or SEQ ID NO:149. Said aptamers can bind to glucose and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0158] 5.1.3 Phenylalanine-Binding Primary Aptamers
[0159] In certain non-limiting embodiments, a primary aptamer binds to phenylalanine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with phenylalanine versus tyrosine (or hydroxyl-phenylalanine) or tryptophan.
[0160] In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GCGT (SEQ ID NO: 165) and AGC and GGTT (SEQ ID NO: 166) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to phenylalanine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively to phenylalanine versus tyrosine (or hydroxyl-phenylalanine) or tryptophan (see, for example,
[0161] For example, but not by way of limitation, a phenylalanine-binding primary aptamer may comprise the sequence: CTC TCG GGA CGA CCG CGT TTC CCA AGA AAG CAA GTA TTG GTT GGT CGT CCC (SEQ ID NO:2)
or a portion thereof comprising the core, SEQ ID NO:85) set forth in
[0162] In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:85 (
[0163] In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GG and GGGGG (SEQ ID NO:168) and GGGG (SEQ ID NO:169) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to phenylalanine (see
TABLE-US-00002 (SEQIDNO:3) CTCTCGGGACGACCGGTGGGGGTTCTTTTTCAGGGG AGGTACGGTCGTCCC.
[0164] In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO: 87 (
[0165] In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GAGG (SEQ ID NO:170) and CATT (SEQ ID NO:171) or CCGG (SEQ ID NO:172) and TGTT (SEQ ID NO:173) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to phenylalanine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to phenylalanine selectively versus tyrosine (or hydroxyl-phenylalanine) or tryptophan. In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GAGG (SEQ ID NO:170) and CATT (SEQ ID NO:171) or CCGG (SEQ ID NO:172) and TGTT (SEQ ID NO:173) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GAGG (SEQ ID NO:170) and CATT (SEQ ID NO:171) or CCGG (SEQ ID NO:172) and TGTT (SEQ ID NO:173), or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GAGG (SEQ ID NO:170) and CATT (SEQ ID NO:171) or CCGG (SEQ ID NO:172) and TGTT (SEQ ID NO:173), or a variant thereof, and at least one operative sequence on either side (flanking) these four sequences. In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises the sequences GAGG (SEQ ID NO:170) and CATT (SEQ ID NO:171) or CCGG (SEQ ID NO:172) and TGTT (SEQ ID NO:173), or a variant thereof, and at least one operative sequence on either side (flanking) these four sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex. For example, but not by way of limitation, a phenylalanine-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CGA GGC TGG ATG CAT TCG CCG GAT GTT CGA TGT CGT CCC (SEQ ID NO:4) or related sequence (SEQ ID NO:174,
[0166] In certain non-limiting embodiments, a phenylalanine-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:89 (
[0167] In certain non-limiting embodiments, isolated phenylalanine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 67, SEQ ID NO: 167, SEQ ID NO:174 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated phenylalanine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 67, SEQ ID NO: 167, or SEQ ID NO:174. Said aptamers can bind to phenylalanine and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0168] 5.1.4 Hydrocortisone-Binding Primary Aptamers
[0169] In certain non-limiting embodiments, a primary aptamer binds to hydrocortisone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 104 M and binds selectively with corticosterone, 11-deoxycorticosterone and/or (17,21-dihydroxyprogesterone, and/or that selectively binds to steroids with a C.17 carbon connected to one oxygen versus steroids that do not have an oxygen at C.17 position.
[0170] In certain non-limiting embodiments, a hydrocortisone-binding primary aptamer comprises the sequences CGCC (SEQ ID NO:175) and ATGTTC (SEQ ID NO:176) and GGATAGT (SEQ ID NO:177) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to hydrocortisone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 104 M and binds to hydrocortisone selectively versus steroids that do not have an oxygen at C.17 position (see
In certain non-limiting embodiments, a hydrocortisone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:91 (
[0171] In certain non-limiting embodiments, a hydrocortisone-binding primary aptamer comprises the sequences CGCC (SEQ ID NO:175) and TACGA (SEQ ID NO:179) and GGATA (SEQ ID NO:180) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to hydrocortisone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 104 M and binds to hydrocortisone selectively versus steroids that do not have an oxygen at C.17 position (see
[0172] In certain non-limiting embodiments, a hydrocortisone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:93 (
[0173] For example, but not by way of limitation, a hydrocortisone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CGC CAG AAG TTT ACG AGG ATA TGG TAA CAT AGT CGT CCC (SEQ ID NO:7,
[0174] In certain non-limiting embodiments, a hydrocortisone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:95 (
[0175] In certain non-limiting embodiments, isolated hydrocortisone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:64 (
[0176] 5.1.5. Dehydroisoandrosterone-Binding Primary Aptamers
[0177] In certain non-limiting embodiments, a primary aptamer binds to dehydroisoandrosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with dehydroisoandrosterone versus deoxycorticosterone.
[0178] In certain non-limiting embodiments, a dehydroisoandrosterone-binding primary aptamer comprises the sequences GGG, GGGG (SEQ ID NO:169) and GG or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to dehydroisoandrosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to dehydroisoandrosterone selectively versus deoxycorticosterone and/or other steroids (see
[0179] For example, but not by way of limitation, a dehydroisoandrosterone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CGG GGG TGG CAT AGG GTA GGC TAG GGT CAC TGT CGT CCC (SEQ ID NO:9) or related sequence (SEQ ID NO:183,
[0180] For example, but not by way of limitation, a dehydroisoandrosterone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CGT GGC TAG GTA GGT TGC ATG CGG CAT AGG GGT CGT CCC (SEQ ID NO:10) or related sequence (SEQ ID NO:184,
[0181] For example, but not by way of limitation, a dehydroisoandrosterone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CGT GAC GGT GTG TAG TTG GGT TGT GGC AGG AGT CGT CCC (SEQ ID NO:11) or related sequence (SEQ ID NO:185,
[0182] In certain non-limiting embodiments, isolated dehydroisoandrosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO:185 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated dehydroisoandrosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO: 183, SEQ ID NO: 184, or SEQ ID NO:185. Said aptamers can bind to dehydroisoandrosterone and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0183] 5.1.6 Deoxycorticosterone-Binding Primary Aptamers
[0184] In certain non-limiting embodiments, a primary aptamer binds to deoxycorticosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with deoxycorticosterone versus dehydroisoandrosterone.
[0185] In certain non-limiting embodiments, a deoxycorticosterone-binding primary aptamer comprises the sequences AGCT (SEQ ID NO:186) and GCGG (SEQ ID NO:187) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to deoxycorticosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to deoxycorticosterone selectively versus dehydroisoandrosterone and/or other steroids (see
[0186] For example, but not by way of limitation, a deoxycorticosterone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CCC GGA TTT TCC GAG TGG AAC TAG CTG TGG CGG TCG TCC C (SEQ ID NO:12) or related sequence (e.g., SEQ ID NO:188,
[0187] For example, but not by way of limitation, a deoxycorticosterone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CGG GGA TTT TCC AGT GCA ACT AGC TGA AAG CGG TCG TCC C (SEQ ID NO: 262).
For example, but not by way of limitation, a deoxycorticosterone-bidning aptamer may comprise the sequence: CTC TCG GGA CGA CCA GGA TTT TCC AGT GTA ACT AGC TAC AGC GGG TCG TCC C (SEQ ID NO: 263).
[0188] In certain non-limiting embodiments, isolated deoxycorticosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:12, SEQ ID NO:62, SEQ ID NO:188, SEQ ID NO: 189, SEQ ID NO: 190, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated deoxycorticosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:12, SEQ ID NO:62, SEQ ID NO:188, SEQ ID NO: 189, or SEQ ID NO: 190. Said aptamers can bind to deoxycorticosterone and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0189] 5.1.7 Testosterone-Binding Primary Aptamers
[0190] In certain non-limiting embodiments, a primary aptamer binds to testosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with testosterone versus 11-deoxycorticosterone.
[0191] In certain non-limiting embodiments, a testosterone-binding primary aptamer comprises the sequences GGG and GGGG (SEQ ID NO:169) and GG, or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, including addition or deletion of a G residue, where said primary aptamer binds to testosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to testosterone (see
[0192] For example, but not by way of limitation, a testosterone-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GAT GTC CGG GGT ACG GTG GTT GCA GTT CGT CGT CCC (SEQ ID NO:13) or a related sequence (e.g., SEQ ID NO:65,
[0193] For example, but not by way of limitation, a testosterone-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GTG GTC ATT GAG TGG TCT TAG GCA GGT AGT CGT CCC (SEQ ID NO:17) or related sequence (SEQ ID NO:192,
[0194] In certain non-limiting embodiments, a testosterone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:109 (
[0195] In certain non-limiting embodiments, a testosterone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:109 (
[0196] In certain non-limiting embodiments, a testosterone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:111 (
[0197] In certain non-limiting embodiments, a testosterone-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:113 (
[0198] In certain non-limiting embodiments, isolated testosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:65, SEQ ID NO:191, or SEQ ID NO:192, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated testosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:65, SEQ ID NO:191, or SEQ ID NO:192. Said aptamers can bind to testosterone and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0199] 5.1.8 Sphingosine-1-Phosphate-Binding Primary Aptamers
[0200] In certain non-limiting embodiments, a primary aptamer binds to sphingosine-1-phosphate in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M (see
[0201] In certain non-limiting embodiments, a sphingosine-1-phosphate-binding primary aptamer comprises the sequences GG and GGGG (SEQ ID NO:169) and GGGGG (SEQ ID NO:168) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to sphingosine-1-phosphate in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively to sphingosine-1-phosphate. In certain non-limiting embodiments, a sphingosine-1-phosphate-binding primary aptamer comprises the sequences GG and GGGG (SEQ ID NO:169) and GGGGG (SEQ ID NO:168) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a sphingosine-1-phosphate-binding primary aptamer comprises the sequences GG and GGGG (SEQ ID NO:169) and GGGGG (SEQ ID NO:168), or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a sphingosine-1-phosphate-binding primary aptamer comprises the sequences GG and GGGG (SEQ ID NO:169) and GGGGG (SEQ ID NO:168), or a variant thereof, and at least one operative sequence on either side (flanking) these three sequences. In certain non-limiting embodiments, a sphingosine-1-phosphate-binding primary aptamer comprises the sequences GG and GGGG (SEQ ID NO:169) and GGGGG (SEQ ID NO:168) or a variant thereof, and at least one operative sequence on either side (flanking) these three sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex.
[0202] For example, but not by way of limitation, a sphingosine-1-phosphate-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGT GGT GTG GGA GAA AGA ATT TTC ATT GGG GTA GGG GGT CGT CCC (SEQ ID NO:18) or related sequence (SEQ ID NO:193,
[0203] In certain non-limiting embodiments, a sphingosine-1-phosphate-binding primary aptamer comprises a core sequence as set forth in SEQ ID NO:117 (
[0204] In certain non-limiting embodiments, isolated sphingosine-1-phosphate-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:18, SEQ ID NO:193, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated sphingosine-1-phosphate-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:18 or SEQ ID NO:193. Said aptamers can bind to sphingosine-1-phosphate and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0205] 5.1.9 Dopamine-Binding Primary Aptamers
[0206] In certain non-limiting embodiments, a primary aptamer binds to dopamine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with dopamine.
[0207] In certain non-limiting embodiments, a dopamine-binding primary aptamer comprises the sequences CCGAT (SEQ ID NO:194) and GGTGT (SEQ ID NO:195) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to dopamine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to dopamine selectively versus serotonin or norepinephrine (
[0208] In certain non-limiting embodiments, a dopamine-binding primary aptamer comprises the sequences GGG and GGGG (SEQ ID NO:169) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to dopamine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to dopamine selectively versus serotonin or tyrosine (
[0209] In certain non-limiting embodiments, a dopamine-binding primary aptamer comprises the sequences CACAG (SEQ ID NO:198) and CACAA (SEQ ID NO:199) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to dopamine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to dopamine selectively versus serotonin, melatonin or tyrosine (
[0210] In certain non-limiting embodiments, a dopamine-binding primary aptamer comprises the sequences GGGG (SEQ ID NO:169) and GG or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to dopamine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to dopamine selectively versus serotonin, melatonin or tyrosine (
[0211] In certain non-limiting embodiments, a dopamine-binding primary aptamer comprises the sequences GGGG (SEQ ID NO:169) and GG or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to dopamine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to dopamine selectively versus serotonin, melatonin or tyrosine (
[0212] In certain non-limiting embodiments, isolated dopamine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:21, SEQ ID NO:196, SEQ ID NO:22, SEQ ID NO: 197, SEQ ID NO:23, SEQ ID NO:200, SEQ ID NO:20, SEQ ID NO:201, SEQ ID NO:19, SEQ ID NO:202 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated dopamine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:21, SEQ ID NO:196, SEQ ID NO:22, SEQ ID NO: 197, SEQ ID NO:23, SEQ ID NO:200, SEQ ID NO:20, SEQ ID NO:201, SEQ ID NO:19, or SEQ ID NO:202. Said aptamers can bind to dopamine and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0213] 5.1.10 Serotonin-Binding Primary Aptamers
[0214] In certain non-limiting embodiments, a primary aptamer binds to serotonin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with serotonin versus dopamine, melatonin, and 5-hydroxytryptophan.
[0215] In certain non-limiting embodiments, a serotonin-binding primary aptamer comprises the sequences GG and GGGG (SEQ ID NO:169) and GGG or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to serotonin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to serotonin selectively versus dopamine, melatonin, or 5-hydroxytryptophan (
[0216] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CTG GTA GGC AGA TAG GGG AAG CTG ATT CGA TGC GTG GGT CGT CCC (SEQ ID NO:25;
[0217] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CTG GTA GGC AAC AGG GGA AGG GAG TTC TGC GTA CGT GGG TCG TCC C (SEQ ID NO:28;
[0218] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CAG GGG CAT ATA TAG TCT AGG GTT TGG TGT GGG TAG TGT CGT CCC (SEQ ID NO:24;
[0219] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CTG GTA GGC AGC AGG GGA AGT AGG CGT GTC CTC GTG GGT CGT CCC (SEQ ID NO:26;
[0220] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCA GTA GGG GAT CCA CAG TGA GGG GTT TGT ATG GGT GGT CGT CCC (SEQ ID NO:27;
[0221] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG AGG TGG TGT CTT GGA CAG TGG TAT TCG CAG TTG CGT CGT CCC (SEQ ID NO:29;
[0222] For example, but not by way of limitation, a serotonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CAG AGA CGG GGT GCT TAC TTG GTT CAG GGG AGT CGA CGT CGT CCC (SEQ ID NO:30;
[0223] In certain non-limiting embodiments, isolated serotonin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:25, SEQ ID NO:203, SEQ ID NO:28, SEQ ID NO:204, SEQ ID NO:24, SEQ ID NO:205, SEQ ID NO:26, SEQ ID NO:206, SEQ ID NO:27, SEQ ID NO:207, SEQ ID NO:29, SEQ ID NO: 208, SEQ ID NO:30, SEQ ID NO:209, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated serotonin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:25, SEQ ID NO:203, SEQ ID NO:28, SEQ ID NO:204, SEQ ID NO:24, SEQ ID NO:205, SEQ ID NO:26, SEQ ID NO:206, SEQ ID NO:27, SEQ ID NO:207, SEQ ID NO:29, SEQ ID NO: 208, SEQ ID NO:30, or SEQ ID NO:209. Said aptamers can bind to serotonin and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0224] 5.1.11 Melatonin-Binding Primary Aptamers
[0225] In certain non-limiting embodiments, a primary aptamer binds to melatonin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with melatonin versus serotonin or tryptophan (see
[0226] For example, but not by way of limitation, a melatonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGT CTT GGG GGT GGT GGG TTT GGC TGG TAC TTA GGG CGT CGT CCC (SEQ ID NO:32;
[0227] For example, but not by way of limitation, a melatonin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CAG CCA AGG TCG TAA GGT ACG GTC AGT GTA CTC GGT TGT CGT CCC (SEQ ID NO:31;
[0228] In certain non-limiting embodiments, isolated melatonin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:31, SEQ ID NO:211, SEQ ID NO:32, SEQ ID NO:210, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated melatonin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:31, SEQ ID NO:211, SEQ ID NO:32, or SEQ ID NO:210. Said aptamers can bind to melatonin and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0229] 5.1.12 Tyrosine-Binding Primary Aptamers
[0230] In certain non-limiting embodiments, a tyrosine-binding primary aptamer comprising a core sequence as set forth in SEQ ID NO: 147 (
[0231] In certain non-limiting embodiments, isolated tyrosine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:33, SEQ ID NO:147, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated tyrosine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:33 or SEQ ID NO:147. Said aptamers can bind to tyrosine and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0232] 5.1.13 Aldosterone-Binding Primary Aptamers
[0233] In certain non-limiting embodiments, a primary aptamer binds to aldosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with aldosterone (see
[0234] In certain non-limiting embodiments, an aldosterone-binding primary aptamer comprises the sequences GATAGT (SEQ ID NO:212) and ATGTTC (SEQ ID NO:213) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to aldosterone in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to aldosterone selectively versus cortisone, cortisol or deoxycortisone. In certain non-limiting embodiments, an aldosterone-binding primary aptamer comprises the sequences GATAGT (SEQ ID NO:212) and ATGTTC (SEQ ID NO:213) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a aldosterone-binding primary aptamer comprises the sequences GATAGT (SEQ ID NO:212) and ATGTTC (SEQ ID NO:213) or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a aldosterone-binding primary aptamer comprises the sequences GATAGT (SEQ ID NO:212) and ATGTTC (SEQ ID NO:213), or a variant thereof, and at least one operative sequence on either side (flanking) these two sequences. In certain non-limiting embodiments, a aldosterone-binding primary aptamer comprises the sequences GATAGT (SEQ ID NO:212) and ATGTTC (SEQ ID NO:213), or a variant thereof, and at least one operative sequence on either side (flanking) these two sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex.
[0235] For example, but not by way of limitation, a aldosterone-binding aptamer may comprise the sequence: CTC TCG GGA CGA CAG ATA GTT GTT CTT AGC GAT GTT CAG CGT TGT CGT CCC (SEQ ID NO: 264) or related sequence (SEQ ID NO:63,
[0236] For example, but not by way of limitation, a aldosterone-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG TAG GTA GGC CAA CTG GGT ATT TAC TGG TGT CGT CCC (SEQ ID NO: 265).
[0237] In certain non-limiting embodiments, isolated aldosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:63, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated aldosterone-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:214, SEQ ID NO:215, or SEQ ID NO:63. Said aptamers can bind to aldosterone and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0238] 5.1.14 Tobramycin-Binding Primary Aptamers
[0239] In certain non-limiting embodiments, a primary aptamer binds to tobramycin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.3 M and binds selectively with tobramycin (see
[0240] In certain non-limiting embodiments, an tobramycin-binding primary aptamer comprises the sequence(s) TGAAA (SEQ ID NO:216) and/or AAGTG (SEQ ID NO:217) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to tobramycin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.3 M and binds to tobramycin selectively versusamikacin or kanamycin. In certain non-limiting embodiments, an tobramycin-binding primary aptamer comprises the sequence(s) TGAAA (SEQ ID NO:216) and/or AAGTG (SEQ ID NO:217) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a tobramycin-binding primary aptamer comprises the sequence(s) TGAAA (SEQ ID NO:216) and/or AAGTG (SEQ ID NO:217) or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a tobramycin-binding primary aptamer comprises the sequence(s) TGAAA (SEQ ID NO:216) and/or AAGTG (SEQ ID NO:217), or a variant thereof, and at least one operative sequence on either side (flanking) this sequence or sequences. In certain non-limiting embodiments, a tobramycin-binding primary aptamer comprises the sequence(s) TGAAA (SEQ ID NO:216) and/or AAGTG (SEQ ID NO:217), or a variant thereof, and at least one operative sequence on either side (flanking) this sequence or sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex.
[0241] For example, but not by way of limitation, a tobramycin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG CCC CGC AAG GGG TGA AAT GAC AGA GTC AAA GTG CGT CGT CCC (SEQ ID NO: 266).
[0242] In certain non-limiting embodiments, an tobramycin-binding primary aptamer comprises the sequence(s) GTAGTC (SEQ ID NO:219) and/or TCGGTAG (SEQ ID NO:220) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to tobramycin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to tobramycin selectively versusamikacin or kanamycin. In certain non-limiting embodiments, an tobramycin-binding primary aptamer comprises the sequence(s) GTAGTC (SEQ ID NO:219) and/or TCGGTAG (SEQ ID NO:220) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a tobramycin-binding primary aptamer comprises the sequence(s) GTAGTC (SEQ ID NO:219) and/or TCGGTAG (SEQ ID NO:220) or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a tobramycin-binding primary aptamer comprises the sequence(s) GTAGTC (SEQ ID NO:219) and/or TCGGTAG (SEQ ID NO:220), or a variant thereof, and at least one operative sequence on either side (flanking) this sequence or sequences. In certain non-limiting embodiments, a tobramycin-binding primary aptamer comprises the sequence(s) GTAGTC (SEQ ID NO:219) and/or TCGGTAG (SEQ ID NO:220), or a variant thereof, and at least one operative sequence on either side (flanking) this sequence or sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex.
For example, but not by way of limitation, a tobramycin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGT AGT CGG AAA CGG TGT CTC AGT TCC TCG GTA GAG TCG TCC C (SEQ ID NO: 267).
[0243] In certain non-limiting embodiments, isolated tobramycin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:218, SEQ ID NO:221, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated tobramycin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:218 or SEQ ID NO:221. Said aptamers can bind to tobramycin and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0244] 5.1.15 Amikacin-Binding Primary Aptamers
[0245] In certain non-limiting embodiments, a primary aptamer binds to amikacin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.3 M and binds selectively with amikacin versus tobramycin or kanamycin (see
[0246] In certain non-limiting embodiments, an amikacin-binding primary aptamer comprises the sequences GC and GCCC(SEQ ID NO:222) and GTTTAGA (SEQ ID NO:223) and AGTCTT (SEQ ID NO:224) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to amikacin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.3 M and binds to amikacin selectively versustobramycin and kanamycin. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GC and GCCC(SEQ ID NO:222) and GTTTAGA (SEQ ID NO:223) and AGTCTT (SEQ ID NO:224) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GC and GCCC(SEQ ID NO:222) and GTTTAGA (SEQ ID NO:223) and AGTCTT (SEQ ID NO:224), or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GC and GCCC(SEQ ID NO:222) and GTTTAGA (SEQ ID NO:223) and AGTCTT (SEQ ID NO:224), or a variant thereof, and at least one operative sequence on either side (flanking) these four sequences. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GC and GCCC(SEQ ID NO:222) and GTTTAGA (SEQ ID NO:223) and AGTCTT (SEQ ID NO:224), or a variant thereof, and at least one operative sequence on either side (flanking) these four sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex. For example, but not by way of limitation, a amikacin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCG CTT GCC CCC TGG CAT GTT TAG AGC AGA GTC TTT GGT CGT CCC (SEQ ID NO: 268).
[0247] In certain non-limiting embodiments, an amikacin-binding primary aptamer comprises the sequences GGTTCAT (SEQ ID NO:226) and ATGTGGG (SEQ ID NO:227) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to amikacin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to amikacin selectively versustobramycin and kanamycin. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GGTTCAT (SEQ ID NO:226) and ATGTGGG (SEQ ID NO:227) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GGTTCAT (SEQ ID NO:226) and ATGTGGG (SEQ ID NO:227), or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GGTTCAT (SEQ ID NO:226) and ATGTGGG (SEQ ID NO:227), or a variant thereof, and at least one operative sequence on either side (flanking) these two sequences. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences GGTTCAT (SEQ ID NO:226) and ATGTGGG (SEQ ID NO:227), or a variant thereof, and at least one operative sequence on either side (flanking) these two sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex. For example, but not by way of limitation, a amikacin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGT CCG GTT CAT GAC TTC AGT AGT CTA GTG GGG GTC TGT CGT CCC (SEQ ID NO: 269).
[0248] In certain non-limiting embodiments, an amikacin-binding primary aptamer comprises the sequences CAA and CGTCTACGGCTTAGC (SEQ ID NO:229) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to amikacin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds to amikacin selectively versustobramycin and kanamycin. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences CAA and CGTCTACGGCTTAGC (SEQ ID NO:229) or a variant thereof and further comprises at least one operative sequence. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences CAA and CGTCTACGGCTTAGC (SEQ ID NO:229), or a variant thereof, and further comprises at least one operative sequence, said operative sequence complementary to a sequence comprised in a sensor oligonucleotide. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences CAA and CGTCTACGGCTTAGC (SEQ ID NO:229), or a variant thereof, and at least one operative sequence on either side (flanking) these two sequences. In certain non-limiting embodiments, a amikacin-binding primary aptamer comprises the sequences CAA and CGTCTACGGCTTAGC (SEQ ID NO:229), or a variant thereof, and at least one operative sequence on either side (flanking) these two sequences, where two of said operative sequences contain mutually complementary portions and can form a duplex. For example, but not by way of limitation, a amikacin-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGC AAC CAT TCC AGT GGC GTC TAC GGC TTA GCT TTT CGT CGT CCC (SEQ ID NO: 270).
[0249] In certain non-limiting embodiments, isolated amikacin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:225, SEQ ID NO:228, SEQ ID NO:230, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated amikacin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:225, SEQ ID NO:228, or SEQ ID NO:230. Said aptamers can bind to amikacin and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0250] 5.1.16 Methylene Blue-Binding Primary Aptamers
[0251] In certain non-limiting embodiments, a primary aptamer binds to methylene blue in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.6 M and binds selectively with methylene blue (see
[0252] For example, but not by way of limitation, a methylene blue-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCA GGA TGC TGT TCC ACC GGG GTA CAG GTA GGT CGC TGT CGT CCC (SEQ ID NO: 271).
[0253] For example, but not by way of limitation, a methylene blue-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GCG TAG CGA TAG AAG AGA GCA GGG GGA GAG ACC TGT CGT CCC (SEQ ID NO: 272).
[0254] For example, but not by way of limitation, a methylene blue-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GAA GGA GTT CCG GGG TAC GCG GGT AAG GGA AGG AGT CGT CCC (SEQ ID NO: 273).
[0255] For example, but not by way of limitation, a methylene blue-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCA ACG AGT ATA CGC TTA CGT CAC GTT GAT GCT GTG GGT CGT CCC (SEQ ID NO: 274).
[0256] For example, but not by way of limitation, a methylene blue-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGC ATT GAT GTA CAA GCT CGA TTC GTA TCC CTT GAT CGT CGT CCC (SEQ ID NO: 275).
[0257] For example, but not by way of limitation, a methylene blue-binding aptamer may comprise the sequence: CTC TCG GGA CGA CTG GGC TCG TGT TCT ATG GAC AAG GGG GAG TGA CCT GGT CGT CCC (SEQ ID NO: 276).
[0258] In certain non-limiting embodiments, isolated methylene blue-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated methylene blue-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, or SEQ ID NO:236. Said aptamers can bind to methylene blue and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0259] 5.1.17 Ammonium-Binding Primary Aptamers
[0260] In certain non-limiting embodiments, a primary aptamer binds to ammonium ion in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.2 M and binds selectively with ammonium versus glycine or ethanolamine or potassium ion (see
[0261] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG AAG AGG CTC AGT GCT ATC TTA TCT GAG AGG GTT TGT CGT CCC (SEQ ID NO: 277).
[0262] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GAG TGT CTC CTA AGG CCT TAG TAA GAA GGG TCC TGT CGT CCC (SEQ ID NO: 278).
[0263] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GAA GAG GCT CGT GAG TTG ATG GGG AGA GGG TCC GGT CGT CCC (SEQ ID NO: 279).
[0264] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG AAG GGT CCC GTT GAG TTT GCA ATG GTG AGG GTT TGT CGT CCC (SEQ ID NO: 280).
[0265] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGC CGA TGG AAG GGG CCC TGG TGG GAG GGT CAA AGG GGT CGT CCC (SEQ ID NO: 281).
[0266] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GCA GGT AGA TCT ACA TGA ATA TGA AGG AAT GAT CGT CGT CCC (SEQ ID NO: 282).
[0267] For example, but not by way of limitation, an ammonium-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG GGA GTA GCC GGG TGG TTA GTG TCT CGC GAG GAA GTC GTC CC (SEQ ID NO: 283).
[0268] In certain non-limiting embodiments, isolated ammonium-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated ammonium-binding primary aptamers comprise the nucleotide sequence of, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245. Said aptamers can bind to ammonium and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0269] 5.1.18 Boronic Acid-Binding Primary Aptamers
[0270] In certain non-limiting embodiments, a primary aptamer binds to boronic acid in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.2 M and binds selectively with boronic acid versus bisboronic acid, e.g., complexed with glucose (
[0271] For example, but not by way of limitation, a boronic acid-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCA GGT GGG GCT GCT CAA GTG GAG GTT CCT CGT CGT CCC (SEQ ID NO: 284).
[0272] For example, but not by way of limitation, a boronic acid-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCA GAG GGG CCT CAA ATG TGG GGT GTT GCT CGT CGT CCC (SEQ ID NO: 285).
[0273] In certain non-limiting embodiments, isolated boronic acid-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:247, SEQ ID NO:248, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated boronic acid-binding primary aptamers comprise the nucleotide sequence of, SEQ ID NO:247 or SEQ ID NO:248. Said aptamers can bind to boronic acid and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0274] 5.1.19 Epinephrine-Binding Primary Aptamers
[0275] In certain non-limiting embodiments, a primary aptamer binds to epinephrine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.3 M and binds selectively with epinephrine versus serotonin, norepinephrine or dpoamine (
[0276] For example, but not by way of limitation, an epinephrine-binding aptamer may comprise the sequence: CTC TCG GGA CGA CCG GGG TAG GGG TTA GGT GGG AAT GGA GCT GGA CCG TGT CGT CCC (SEQ ID NO: 286).
[0277] For example, but not by way of limitation, an epinephrine-binding aptamer may comprise the sequence: CTC TCG GGA CGA CGG ACC GTT GCC CTG GGG TAG TGC GCG CTT CGT TTA CGT CGT CCC (SEQ ID NO: 287).
[0278] In certain non-limiting embodiments, isolated epinephrine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:249, SEQ ID NO:250, or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated epinephrine-binding primary aptamers comprise the nucleotide sequence of, SEQ ID NO:249 or SEQ ID NO:250. Said aptamers can bind to epinephrine and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0279] 5.1.20 Creatinine-Binding Primary Aptamers
[0280] In certain non-limiting embodiments, a primary aptamer binds to creatinine in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.2 M and binds selectively with creatinine versus creatine or urea.
[0281] In certain non-limiting embodiments, a creatinine-binding primary aptamer comprises the sequences GGTGGCCT (SEQ ID NO:254) and AGGGGTG (SEQ ID NO:255) or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to creatinine (see
[0282] For example, but not by way of limitation, a creatinine-binding aptamer may comprise the sequence: GA CGA CGGTGGCCTTAATAGATAGATGATATTCTTAT ATGTG TGAGGGGTG GT CGT C (SEQ ID NO:256;
[0283] For example, but not by way of limitation, a creatinine-binding aptamer may comprise the sequence: GA CGA C GGTGGCCTATATTGGTATGTATGAA GAATAGAACTATTAGGGGGT GT C (SEQ ID NO: 288).
[0284] For example, but not by way of limitation, a creatinine-binding aptamer may comprise the sequence: CGA C GGTGGCCTATTAAATAGCTTTAGTT TAAGAAAAGTAATAGGGGGT GT CG (SEQ ID NO:258;
[0285] For example, but not by way of limitation, a creatinine-binding aptamer may comprise the sequence: CTC TCG GGA CGA C GGTGGCCTATTAAGTAGCTTTA GTTCAAGAAAAGTAATAGGGGGT GT CGT CCC (SEQ ID NO: 289).
[0286] In certain non-limiting embodiments, isolated creatinine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated creatinine-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, or SEQ ID NO:259. Said aptamers can bind to creatinine and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0287] 5.1.21. Vasopressin-Binding Primary Aptamers
[0288] In certain non-limiting embodiments, a primary aptamer binds to vasopressin in an aqueous solution at room temperature or 25 C. with a dissociation constant of less than 10.sup.4 M and binds selectively with vasopressin versus oxytocin or pressinoic acid.
[0289] In certain non-limiting embodiments, a vasopressin-binding primary aptamer comprises the sequences GTAGTACGTT (SEQ ID NO:260) and CAT or a variant of any of these sequences that differs in one or two bases by substitution, deletion, insertion or extension, where said primary aptamer binds to vasopressin (see
[0290] For example, but not by way of limitation, a vasopressin-binding aptamer may comprise the sequence: GA C GTCCAAGTAGTACGTTTAATTAGG ATTTCCGAATTATTGGCATGC GT C (SEQ ID NO:261;
[0291] In certain non-limiting embodiments, isolated vasopressin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:261 or variants of these sequences having at least about 80 percent, or at least about 85 percent, or at least about 90 percent, or at least about 95 percent, or at least about 98 percent homology to the original sequence, for example obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions. Percent homology can be determined using standard software such as BLAST or FASTA. In certain non-limiting embodiments, isolated vasopressin-binding primary aptamers comprise the nucleotide sequence of SEQ ID NO:261. Said aptamers can bind to vasopressin and in their structure-switching formats (for example, in an anti-aptamer assay, a pseudosandwich assay, or a sandwich assay) they can respond by an increase in fluorescence.
[0292] 5.2 Anti-Aptamer Assays
[0293] In certain embodiments, an anti-aptamer assay is provided, in which a sample to be tested for the presence and/or amount of an analyte of interest is contacted with effective amounts of (1) a primary aptamer comprising a core sequence that binds to the analyte and (2) an anti-aptamer which is complementary to at least a portion of the primary aptamer, wherein the primary aptamer and/or anti-aptamer comprise a detectable moiety(ies) which detect whether the primary aptamer and anti-aptamer are bound to each other or unbound; and wherein a primary aptamer bound to the analyte does not bind to its anti-aptamer.
[0294] Certain embodiments provide for a method of detecting or measuring the presence or amount of analyte of interest in a sample, comprising (i) contacting at least a portion of a sample with effective amounts of a primary aptamer and an anti-aptamer that is complementary to at least a portion of the primary aptamer, said primary aptamer and/or anti-aptamer comprising a moiety which allows the amount of primary aptamer bound to analyte to be detected and/or measured, under conditions that would permit duplex formation between the primary aptamer and anti-aptamer if target analyte were not present; and (ii) detecting and optionally quantifying the amount of primary aptamer that is not bound to anti-aptamer.
[0295] A sample may be, for example and not limitation, a blood sample, a plasma sample, a serum sample, a urine sample, a tissue sample, a cerebrospinal fluid sample, a sputum sample, a fecal sample, a water sample, an industrial sample, etc.
[0296] As an illustrative example and not by way of limitation, the presence or amount of analyte of interest in a sample may be determined by (i) contacting at least a portion of the sample with effective amounts of (a) a primary aptamer comprising a fluorescent label and (b) an anti-aptamer, complementary to at least 80 percent or at least 90 percent or at least 95 percent or at least 98 percent of the primary aptamer, comprising a moiety that quenches fluorescence of said fluorescent label if primary aptamer and anti-aptamer are bound together in a duplex (for example, as a double-stranded molecule), under conditions that would permit duplex formation between primary aptamer and anti-aptamer to occur if analyte were not present; and (ii) detecting and optionally quantifying the amount of fluorescence. The amount of fluorescence may further be compared to the amount of fluorescence that results from a control mixture of primary aptamer and anti-aptamer in the absence of sample or in the presence of a known amount of analyte (e.g., a standard curve). This example may be modified as would be known to one skilled in the art. For example, different moieties may be used to detect duplex formation, such as a colorimetric label, an enzymatic label, a radiolabel, etc., and the detectable label may be carried on the anti-aptamer, depending on assay design.
[0297] In certain embodiments, a primary aptamer comprises one or more operative sequence which is complementary to anti-aptamer and facilitates duplex formation. For example, an operative sequence with a nucleotide composition which favors duplex formation may be used (a.k.a. a toe hold sequence).
[0298] The anti-aptamer assay and method of using it may utilize any primary aptamer that binds an analyte of interest, including but not limited to those set forth herein.
[0299] An anti-aptamer has a sequence which is complementary to at least 80 percent or at least 90 percent or at least 95 percent or at least 98 percent of its corresponding primary aptamer.
[0300] A primary aptamer or anti-aptamer for use in the anti-aptamer assay may be between about 30 and about 200 nucleotides, or between about 30 and 100, or between about 30 and 80, nucleotides in length.
[0301] In certain non-limiting embodiments, the primary aptamer and anti-aptamer may be present, in the assay, in a ratio of about 1:1. Depending on the strength of binding between analyte and primary aptamer and/or between primary aptamer and anti-aptamer, it may be desirable to alter this ratio to produce a dose-response curve having the desired features (for example, being able to measure/detect analyte at a particular concentration). As an illustrative example, and not by way of limitation, if binding between primary aptamer and analyte is very strong relative to the affinity between primary aptamer and anti-aptamer, it may be desirable to increase the relative amount of anti-aptamer, so that the ratio is 1:greater than 1. Non-limiting examples are about 1:1;
[0302] In certain non-limiting embodiments, an anti-aptamer assay may be performed in solution. Non-limiting examples of the use of anti-aptamer assay, in solution, for detecting various analytes are shown in
[0303] In certain non-limiting embodiments, an anti-aptamer assay may be performed in as a solid phase assay, with primary aptamer or anti-aptamer bound a solid phase (e.g., an ELISA-like format). Non-limiting examples of the use of anti-aptamer assay as a solid-phase assay, for detecting various analytes are shown in
[0304] In certain non-limiting embodiments, a kit is provided for practicing an anti-aptamer assay as described herein. For example, said kit comprises a primary aptamer directed toward an analyte of interest and a corresponding anti-aptamer. Non-limiting examples of primary aptamers that may be comprised in such a kit include the primary aptamers set forth herein, for example as described in Section 5.1 and
[0305] 5.3 Pseudosandwich Assay
[0306] The present application discloses pseudosandwich assays in solution (
[0307] Certain embodiments provide for a pseudosandwich assay, or method of detecting or measuring the presence or amount of an analyte of interest in a sample, comprising (i) contacting at least a portion of a sample with effective amounts of (a) a primary aptamer comprising a core sequence that binds to the analyte and a portion complementary to a sensor oligonucleotide; (b) a sensor oligonucleotide; and optionally (c) a comp oligonucleotide; one or more of which is bound to a detectable moiety(ies) which can detect whether the primary aptamer and sensor oligonucleotide are bound to each other or whether primary aptamer is bound to analyte.
[0308] In certain non-limiting embodiments, the method comprises:
[0309] (1) Isolating primary aptamers (APs) by solution-phase (
[0310] (2) Testing of the primary aptamer in its structure-switching form and modifying its structure switching form, which is then turned into pseudo-sandwich assay format (
[0311] (3) Isolating secondary aptamers (A.sup.ss) by either solution-phase or solid phase selections (
[0312] (4) Implementing sandwich assays for targets (
[0313] An exemplary list of the disclosed primary aptamers are provided in
[0314] A pseudo-sandwich assay transforms reversible interactions of analyte-binding aptamers (primary aptamers or A) into a more stable partially double helical complex, which can be used in solution-phase assays (
[0315] The stable double helical product released once a primary aptamer is bound to its analyte can be also captured to a solid state surface (e.g., plate well or beads or lateral flow pad) and subjected to extensive washing, therefore eliminating many sources of high background in other aptamer-based assays using structure switching principles. The oligonucleotide in complex with capture oligonucleotide can be then used to generate amplified readout indicative of presence and quantity initially bound analyte, like in a typical sandwich ELISA.
[0316] For example, a complementary oligonucleotide (C.sub.D) can be extended (C.sub.Dext) into an aptamer. While C.sub.D on its own is in equilibrium and 3-5 equivalents are used to achieve quenching of aptamers with fluorescein, C.sub.Dext requires only one equivalent and it binds nearly irreversibly to the aptamers. This helps with the half-response point.
[0317] C.sub.Dext can then be further extended by adding a toehold region that allows this kinetically protected stable complex to interact with an oligonucleotide complementary to C.sub.Dext (C.sub.Dext.sup.comp). The presence of an excess of C.sub.Dext.sup.comp) in solution allows small amounts of aptamer to form binding pockets and interact with the L. This triggers establishment of equilibrium leading to a certain amount of double helix formations which is substantially increase with the release of double helix into solution. This process can be monitored by an increase in fluorescence in solution.
[0318] Pseudosandwich Assaysin Solution:
[0319] In certain non-limiting embodiments pseudosandwich assays in solution can be performed, wherein a double helix formation is triggered by deoxycorticosterone. In certain non-limiting embodiments, primary aptamers comprising the nucleotide sequence of SEQ ID NO: 12 or analogs can form a complex with C.sub.Dext and in the presence of C.sub.Dext.sup.comp can produce an increase in fluorescence in the presence of deoxycorticosterone and analogs.
[0320] In certain non-limiting embodiments pseudosandwich assays in solution can be performed, wherein a double helix formation is triggered by tyrosine. In certain non-limiting embodiments, primary aptamers comprising the nucleotide sequence of SEQ ID NO: 33 or analogs can form a complex with C.sub.Dext and in the presence of C.sub.Dext.sup.comp can produce an increase in fluorescence in the presence of tyrosine and analogs.
[0321] In certain non-limiting embodiments pseudosandwich assays in solution can be performed, wherein a double helix formation is triggered by glucose. In certain non-limiting embodiments, primary aptamers comprising the nucleotide sequence of SEQ ID NO: 1 or analogs can form a complex with C.sub.Dext and in the presence of C.sub.Dext.sup.comp can produce an increase in fluorescence in the presence of glucose and analogs.
[0322] In certain non-limiting embodiments pseudosandwich assays in solution can be performed, wherein a double helix formation is triggered by Phenylalanine. In certain non-limiting embodiments, primary aptamers comprising the nucleotide sequence of SEQ ID NO: 2 or analogs can form a complex with C.sub.Dext and in the presence of C.sub.Dext.sup.comp can produce an increase in fluorescence in the presence of Phenylalanine and analogs.
[0323] In certain non-limiting embodiments, if the C.sub.Dext is deposited on plates, the double helix remains attached to the plate when the rest of solution is removed and it can now be extensively washed. This double helix can be used in numerous ways for the signal development.
[0324] Pseudosandwich Assays on Plate:
[0325] In certain non-limiting embodiments solution-evolved aptameric sensors are adapted for use in a solid surface-format application, for example, ELISA-type assays. Specifically, the solution sensorcomposed of an analyte and a specific aptamer comprising the nucleotide sequence of SEQ ID NO: 12, which is partially hybridized to C.sub.Dextis modified with attachment chemistry to enable its anchoring to a solid surface.
[0326] In certain non-limiting embodiments the attachment chemistry comprises use of biotin or covalent bonding between maleimide and sulfhydryl functional groups. In addition, the complementary strand to the competitor oligonucleotide C.sub.Dext (C.sub.Dext.sup.comp) (optimized to bind to the C.sub.Dext in the presence of analyte) is modified with a biotin-tag, which is used to capture a read-out producing molecule e.g. HRP conjugate. In certain non-limiting embodiments, the read-out is performed using 3,3,5,5-Tetramethylbenzidine (TMB), the substrate for HRP, for visualization.
[0327] In certain non-limiting embodiments, optimization of response of the surface-bound sensor, relative to +/analyte, can be carried out by adjustment of several parameters: Amount of sensor on surface; attachment chemistry, concentration of complementary competitor oligonucleotide; buffer in each step; washing steps; HRP concentration; HRP substrate.
[0328] In certain embodiments, a primary aptamer comprises at least one operative sequence which is complementary to at least a portion of a sensor oligonucleotide.
[0329] Non-limiting illustrative examples showing pairs of primary aptamer and sensor oligonucleotide are shown in
[0330] A sample may be, for example and not limitation, a blood sample, a plasma sample, a serum sample, a urine sample, a tissue sample, a cerebrospinal fluid sample, a sputum sample, a fecal sample, a water sample, an industrial sample, etc.
[0331] In certain non-limiting embodiments, the foregoing assays can be used to detect and/or quantitate any analyte of interest, and can be particularly advantageous over existing methods in detecting and/or quantitating analytes that have a molecular weight less than about 1000 Daltons, or less than about 500 Daltons, or less than about 200 Daltons, including but not limited to steroid compounds, such as but not limited to cortisol, aldosterone, dehydroisoandrosterone, progesterone, testosterone; glucose; amino acids such as but not limited to phenylalanine, leucine, isoleucine, valine, citrulline, tyrosine, alanine; pharmaceutical compounds, vitamins, toxins, neurotransmitters (e.g., catecholamines, serotonin), peptides (vasopressin, oxytocin, angiotensin, natriuretic peptides, glucagon, insulin and others), antibiotics and antifungal compounds (e.g., aminoglucosides), macrocyclic immunosuppresants, or lipids or lipid complexes.
[0332] In certain non-limiting embodiments, the assays can also be applied to large molecules, for example, above 1000 D.
[0333] In certain non-limiting embodiments, a kit is provided for practicing a pseudo-sandwich assay as described herein. In certain embodiments, said kit comprises a primary aptamer directed toward an analyte of interest and a corresponding sensor oligonucleotide. Non-limiting examples of primary aptamers that may be comprised in such a kit include the primary aptamers set forth herein, for example as described in Section 6.1 and
[0334] 5.4 Sandwich Assay
[0335] A secondary aptamer (A.sup.S) binds a complex (A.sup.P*L) of a primary aptamer (A.sup.P) to its target analyte (ligand, L) selectively over free primary aptamers, forming a ternary complex (A.sup.p*L*A.sup.S). The secondary aptamers are isolated by solution-phase or solid-phase selections. An exemplary non-limiting list of the disclosed secondary aptamers is provided in
[0336] In certain embodiments, a sandwich assay is provided, which comprises a method of detecting or measuring the presence or amount of an analyte of interest in a sample, comprising (i) contacting at least a portion of a sample with effective amounts of (a) a primary aptamer comprising a core sequence that binds to the analyte and a portion that, when primary aptamer is bound to analyte, binds to a secondary sandwich aptamer; (b) a secondary sandwich aptamer; one or more of which is bound to a detectable moiety(ies) which can detect whether the primary aptamer and secondary sandwich aptamer are bound to each other or unbound.
[0337] In certain embodiments, a primary aptamer comprises at least one operative sequence which binds to a sandwich aptamer (a.k.a. secondary aptamer).
[0338] In certain, non-limiting embodiments, a secondary aptamer comprises an aptamer (secondary) that binds to an aptamer (primary) with former binding to the latter preferentially when the latter is bound to its ligand (an analyte of interest).
[0339] In certain, non-limiting embodiments, a secondary aptamer comprises a sequence (secondary) that binds to another sequence (primary) with former binding to the latter preferentially when the latter bound to a molecule.
[0340] In certain, non-limiting embodiments, the present invention discloses an assay for a molecule (fluorescence assay and ELISA-like) that uses two oligonucleotides with one oligonucleotide that preferentially binds to the other, when the latter is bound to that molecule.
[0341] In certain, non-limiting embodiments, one aptamer (primary) is sufficient to form a receptor.
[0342] A sandwich assay, without availability of the second binding site (epitope) in a molecule, is enabled by a secondary aptamer (A.sup.S; a.k.a. sandwich aptamer or secondary sandwich aptamer) forming a ternary complex (A.sup.P*L*A.sup.S) (
[0343] In certain non-limiting embodiments, a kit is provided for practicing a sandwich assay as described herein. For example, said kit comprises a primary aptamer directed toward an analyte of interest and a corresponding sandwich aptamer (a.k.a., secondary aptamer. Non-limiting examples of primary aptamers that may be comprised in such a kit include the primary aptamers set forth herein, for example as described in Section 6.1 and
[0344] A sample may be, for example and not limitation, a blood sample, a plasma sample, a serum sample, a urine sample, a tissue sample, a cerebrospinal fluid sample, a sputum sample, a fecal sample, a water sample, an industrial sample, etc.
[0345] 5.4.1. Isolation of Secondary Aptamers
[0346] The present application discloses the isolation of secondary aptamers using the SELEX process.
[0347] In certain non-limiting embodiments, methods for selecting secondary aptamers (A.sup.s) can be performed, which can also be combined in some cases (
[0348] Solid-State Election
[0349] During the solid-state selection a target aptamer (A.sup.p) is attached to a matrix (e.g., beads), incubated with a library (e.g., but not limited to, pre-structured or unstructured N.sub.20-100) in the presence of target analyte L to isolate aptamer candidates with affinity for A.sup.p*L complex (
[0350] Solution-Phase Selection
[0351] The process in solution-phase uses pre-structured library to enable formation of stem between primers attached to matrix via complementary oligonucleotides, and A.sup.s candidates are selected because their loop is closed through binding to A.sup.p and they get released from the solid surface (
[0352] In certain non-limiting embodiments, primary aptamers used in selection can be made from DNA, RNA, modified nucleotides, or spiegelmers. Spiegelmers are particularly suitable to minimize background, increase affinity, and improve properties of secondary aptamers, because these are mirror-image nucleic acids.sup.20-23 with L-deoxyribose or ribose, that do not firm contiguous Watson Crick base pairing with natural DNA. In certain non-limiting embodiments, such spiegelmers can be obtained by inverting aptamers for planar molecules or molecules with planes of symmetry, such as serotonin or dopamine (aptamers depicted in
[0353] 5.4.2. Secondary Aptamers to Glucose-Binding Primary Aptamers
[0354] More specifically, in certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for glucose. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with glucose. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with a mono- or oligo-saccharide. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with glucose, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0355] 5.4.3. Secondary Aptamers to Phenylalanine-Binding Primary Aptamers
[0356] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for phenylalanine. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with Phenylalanine. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with an amino acid or a peptide. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with Phenylalanine, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0357] 5.4.4. Secondary Aptamers to Hydrocortisone-Binding Primary Aptamers
[0358] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for hydrocortisone. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with hydrocortisone. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with hydrocortisone, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0359] 5.4.5. Secondary Aptamers to Dehydroisoandrosterone-Binding Primary Aptamers
[0360] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for dehydroisoandrosterone. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with dehydroisoandrosterone. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with dehydroisoandrosterone, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0361] 5.4.6. Secondary Aptamers to Deoxycorticosterone-Binding Primary Aptamers
[0362] In certain non-limiting embodiments, secondary aptamers can be isolated using the aforementioned method for deoxycorticosterone. In certain non-limiting embodiments, secondary aptamers comprising the nucleotide sequence of any one of SEQ ID NO: 34-35 (
[0363] 5.4.7. Secondary Aptamers to Testosterone-Binding Primary Aptamers
[0364] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for testosterone. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with testosterone. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with testosterone, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0365] 5.4.8. Secondary Aptamers to Sphingosine-1-Phosphate-Binding Primary Aptamers
[0366] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for sphingosine-1-phosphate. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with sphingosine-1-phosphate. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with sphingosine-1-phosphate, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0367] 5.4.9. Secondary Aptamers to Dopamine-Binding Primary Aptamers
[0368] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for dopamine. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with dopamine. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with dopamine, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0369] 5.4.10. Secondary Aptamers to Serotonin-Binding Primary Aptamers
[0370] In certain non-limiting embodiments, secondary aptamers were isolated using the aforementioned method for serotonin. In certain non-limiting embodiments, secondary aptamers comprising any one of the nucleotide sequences of SEQ ID NO: 36, SEQ ID NO: 59, and SEQ ID NO: 60 (
[0371] 5.4.11. Secondary Aptamers to Tyrosine-Binding Primary Aptamers
[0372] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for tyrosine. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with tyrosine. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with tyrosine, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0373] 5.4.12. Secondary Aptamers to L-Tyrosine-Binding Primary Aptamers
[0374] In certain non-limiting embodiments, secondary aptamers can be isolated according to the aforementioned method for L-tyrosine. In certain non-limiting embodiments, secondary aptamers or their analogs obtained by substitutions, deletions, and insertions of Watson-Crick base pairs or by mutations at non-conserved positions, bind to a primary aptamer, when the latter is in the complex with L-tyrosine. In certain non-limiting embodiments, secondary aptamers or their analogs bind to a primary aptamer, when the latter is in the complex with L-tyrosine, wherein the analog comprises a nucleotide sequence at least 80% identical to the nucleotide sequence of the secondary aptamer; a nucleotide sequence at least 95% identical to the nucleotide sequence of the secondary aptamer; and a nucleotide sequence at least 99% identical to the nucleotide sequence of the secondary aptamer.
[0375] In certain non-limiting embodiments, this protocol can be suitably modified and optimized to isolate secondary aptamers to all non-limiting examples of primary aptamers and their analogs (including spiegelmers) as depicted in
[0376] 5.4.13 Additional Sandwich Assay Embodiments
[0377] In certain non-limiting embodiments, the present application provides sandwich assays, with fluorescent detections and ELISA-like formats.
[0378] In the pseudosandwich assay described above, there were no true sandwich interactions (thus, pseudo-sandwich) and ligand*aptamer interactions were translated into a presence of a double helix allowing a format similar to a non-competitive sandwich ELISA. However, in certain embodiments a sandwich assay comprises two aptamers binding to one molecule at the same time without competing with each other.
[0379] In certain non-limiting embodiments of the present application aptamers against aptamer*ligand complexes or secondary aptamer bind primary aptamers when in complexes with ligands have been generated (
[0380] Sandwich Assay in Solution
[0381] In certain non-limiting embodiments, sandwiches are formed in solution for deoxycorticosterone and serotonin and fluorescence read-outs are measured (
[0382] Sandwich Assay on Plate
[0383] In certain non-limiting embodiments, a sandwich assay on plate is performed for serotonin (
[0384] In certain non-limiting embodiments, the foregoing assays can be used to detect and/or quantitate any analyte of interest, and can be particularly advantageous over existing methods in detecting and/or quantitating analytes that have a molecular weight less than about 1000 Daltons or less than about 500 Daltons or less than about 200 Daltons, including but not limited to steroid compounds, such as but not limited to cortisol, aldosterone, dehydroepiandrosterone, progesterone, testosterone; glucose; amino acids such as but not limited to phenylalanine, leucine, isoleucine, valine, citrulline, tyrosine, alanine; pharmaceutical compounds, vitamins, toxins, neurotransmitters (e.g., catecholamines, serotonin), peptides (vasopressin, oxytocin, angiotensin, natriuretic peptides, glucagon, insulin and others), antibiotics and antifungal compounds (e.g., aminoglucosides), macrocyclic immunosuppresants, or lipids or lipid complexes.
[0385] In certain non-limiting embodiments, these assays can also be applied to larger molecules, with molecular weight above 1000 Daltons.
6. EXAMPLE 1ISOLATION OF PRIMARY APTAMERS
[0386] The present example provides methods for isolating primary aptamers (A.sup.P) and examples of their structures.
[0387] The isolation of primary aptamers was performed using the SELEX process. Primary aptamers were isolated by solution-phase selection, as this method has inherent advantages for small molecules, such as higher affinity and ease of screening of aptamers (Table 1). Non-limiting examples are provided in
[0388] The method was based on attaching a biotinylated strand complementary (C.sub.B) to one of the PCR primers to agarose-streptavidin (
[0389] Fluorescent sensors were directly obtained from this selection, by substituting biotin with dabcyl and attaching fluorescein to the aptamer (
[0390] Primary aptamers were isolated according to the aforementioned method for: [0391] 1. D-Glucose (SEQ ID NO:1); [0392] 2. L-Phenylalanine (SEQ ID NOS: 2-4); [0393] 3. Hydrocortisone (SEQ ID NOS: 5-7); [0394] 4. Dehydroisoandrosterone and Deoxycorticosterone 21-glucoside (DOG) (SEQ ID NOS: 8-12); [0395] 5. Testosterone (SEQ ID NOS: 13-17); [0396] 6. Sphingosine-1-phosphate (SEQ ID NO: 18); [0397] 7. Dopamine (SEQ ID NOS: 19-23); [0398] 8. Serotonin (SEQ ID NOS: 24-30); [0399] 9. Melatonine (SEQ ID NOS: 31-32); and [0400] 10. L-Tyrosine (SEQ ID NO: 33).
[0401] The disclosed primary aptamers bound to their target analyte and in their structure-switching formats they responded to its presence by an increase in fluorescence (
TABLE-US-00003 TABLE1 PrimaryAptamerSequences. SEQID Target PrimaryAptamerSequence NO: Glucose CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCG 1 TCCC Phenylalanine CTCTCGGGACGACCGCGTTTCCCAAGAAAGCAAGTATTGGTTGGTCG 2 TCCC CTCTCGGGACGACCGGTGGGGGTTCTTTTTCAGGGGAGGTACGGTCG 3 TCCC CTCTCGGGACGACGAGGCTGGATGCATTCGCCGGATGTTCGATGTCG 4 TCCC Hydrocortisone CTCTCGGGACGACGCCCGCATGTTCCATGGATAGTCTTGACTAGTCG 5 TCCC CTCTCGGGACGACTAGCGTATGCGCCAGAAGTATACGAGGATAGTC 6 GTCCC CTCTCGGGACGACGCCAGAAGTTTACGAGGATATGGTAACATAGTC 7 GTCCC Dehydro- CTCTCGGGACGACGGGGATTTTCCCAATTGGTTCTTTCAATTTAGTCG 8 isoandrosteroneand TCCC Deoxycorticosterone Dehydro- CTCTCGGGACGACGGGGGTGGCATAGGGTAGGCTAGGGTCACTGTC 9 isoandrosterone GTCCC CTCTCGGGACGACGTGGCTAGGTAGGTTGCATGCGGCATAGGGGTC 10 GTCCC CTCTCGGGACGACGTGACGGTGTGTAGTTGGGTTGTGGCAGGAGTCG 11 TCCC Deoxycorticosterone CTCTCGGGACGACCCGGATTTTCCGAGTGGAACTAGCTGTGGCGGTC 12 GTCCC Testosterone CTCTCGGGACGACGGGATGTCCGGGGTACGGTGGTTGCAGTTCGTCG 13 TCCC CTCTCGGGACGACCAGGTGCCATTAGCGTCAGTGTGCTACGATGTCG 14 TCCC CTCTCGGGACGACCCGTTCGATCTAACCCTTGTTAGCCGTGATGTCG 15 TCCC CTCTCGGGACGACCCCTTCGATCTTCAACCAAAGCCGTTGGATGTCG 16 TCCC CTCTCGGGACGACGGGTGGTCATTGAGTGGTCTTAGGCAGGTAGTCG 17 TCCC Sphingosine-1- CTCTCGGGACGACGTGGTGTGGGAGAAAGAATTTTCATTGGGGTAG 18 phosphate GGGGTCGTCCC Dopamine CTCTCGGGACGACCACTTCAGACGCTCAACGTTTGGGGAGGCACGG 19 CAGGTCGTCCC CTCTCGGGACGACGGGGAGGAGTTAGCATGACGGCAACTTTAGTAC 20 TTCGTCGTCCC CTCTCGGGACGACGCCAGTTTGAAGGTTCGTTCGCAGGTGTGGAGTG 21 ACGTCGTCCC CTCTCGGGACGACTGCAGCCTGGGGTTGTGGGGGGTAGGGGAGGTC 22 TGAGTCGTCCC CTCTCGGGACGACCACACAGAGGCACAACTCGCAGGAGCAAAGCGG 23 CAGGTCGTCCC Serotonin CTCTCGGGACGACAGGGGCATATATAGTCTAGGGTTTGGTGTGGGTA 24 GTGTCGTCCC CTCTCGGGACGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCG 25 TGGGTCGTCCC CTCTCGGGACGACTGGTAGGCAGCAGGGGAAGTAGGCGTGTCCTCG 26 TGGGTCGTCCC CTCTCGGGACGACCAGTAGGGGATCCACAGTGAGGGGTTTGTATGG 27 GTGGTCGTCCC CTCTCGGGACGACTGGTAGGCAACAGGGGAAGGGAGTTCTGCGTAC 28 GTGGGTCGTCCC CTCTCGGGACGACGGAGGTGGTGTCTTGGACAGTGGTATTCGCAGTT 29 GCGTCGTCCC CTCTCGGGACGACAGAGACGGGGTGCTTACTTGGTTCAGGGGAGTC 30 GACGTCGTCCC Melatonin CTCTCGGGACGACAGCCAAGGTCGTAAGGTACGGTCAGTGTACTCG 31 GTTGTCGTCCC CTCTCGGGACGACGTCTTGGGGGTGGTGGGTTTGGCTGGTACTTAGG 32 GCGTCGTCCC Tyrosine CTCTCGGGACGACGGCCCGATCTCAGAGTAGTCGTCCC 33
[0402] The sequences of the primary aptamers that were isolated for serotonin in their presumed secondary structure, as shown with the complementary oligonucleotide (C) that was used in selection (C.sub.B) or fluorescence sensing (C.sub.D), and the presumed core pocket (as shown in
TABLE-US-00004 TABLE2 SequencesofPrimaryAptamersforserotoninintheirpresumedsecondarystructure, thecomplementaryoligonucleotidesusedintheirselection,andtheirpresumedcorepockets. ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:24 PrimaryAptamer CTCTCGGGACGACAGGGGCATATATAGTCTAGGGTTTGGTGTGGGTAGTGTCGT CCC(SEQIDNO:37) Complementary TGTCGTCCCGAGAG(SEQIDNO:38) oligonucleotide CorePocket NAGGGGCATATATAGTCTAGGGTTTGGTGTGGGTAGTN,whereNcanbeanyoneof A,T,G,orC(SEQIDNO:39) ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:25 PrimaryAptamer CTCTCGGGACGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTCGT CCC(SEQIDNO:40) Complementary GTCGTCCCGAGAG(SEQIDNO:41) oligonucleotide CorePocket NTGGTAGNNNGATAGGGNNNNGCTGANNNGANNNGTGGN,whereNcanbeany oneofA,T,G,orC(SEQIDNO:42) ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:26 PrimaryAptamer CTCTCGGGACGACTGGTAGGCAGCAGGGGAAGTAGGCGTGTCCTCGTGGGTCGT CCC(SEQIDNO:43) Complementary GTCGTCCCGAGAG(SEQIDNO:44) oligonucleotide CorePocket NTGGTAGGCAGCAGGGGAAGTAGGCGTGTCCTCGTGGN,whereNcanbeanyone ofA,T,G,orC(SEQIDNO:45), ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:27 PrimaryAptamer CTCTCGGGACGACCAGTAGGGGATCCACAGTGAGGGGTTTGTATGGGTGGTCGT CCC(SEQIDNO:46) Complementary GGTCGTCCCGAGAG(SEQIDNO:47) oligonucleotide CorePocket NAGTAGGGGANNNCAGTGAGGGGTTTGTANNNNTN,whereNcanbeanyoneofA, T,G,orC(SEQIDNO:48) ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:28 PrimaryAptamer CTCTCGGGACGACTGGTAGGCAACAGGGGAAGGGAGTTCTGCGTACGTGGGTC GTCCC(SEQIDNO:49) Complementary GTCGTCCCGAGAG(SEQIDNO:50) oligonucleotide CorePocket NTGGNAGGNAACAGGGGNGGGAGNNCTNCGTNCGTGGN,whereNcanbeanyone ofA,T,G,orC(SEQIDNO:51) ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:29 PrimaryAptamer CTCTCGGGACGACGGAGGTGGTGTCTTGGACAGTGGTATTCGCAGTTGCGTCGT CCC(SEQIDNO:52) Complementary CGTCGTCCCGAGAG(SEQIDNO:53) oligonucleotide CorePocket NGGAGGTGGNNNNNNNNNNNGTGGTATTCGCAGTTGCN,whereNcanbeanyone ofA,T,G,orC(SEQIDNO:54) ForPrimaryAptamersisolatedforSerotonincomprisingthenucleotidesequenceofSEQIDNO:30 PrimaryAptamer CTCTCGGGACGACAGAGACGGGGTGCTTACTTGGTTCAGGGGAGTCGACGTCGT CCC(SEQIDNO55) Complementary TGTCGTCCCGAGAG(SEQIDNO:56) oligonucleotide CorePocket NNAGANNNGGGGTGCTTACTTGGTTCAGGGGANNNGACNN,whereNcanbeany oneofA,T,G,orC(SEQIDNO:57)
7. EXAMPLE 2PSEUDOSANDWICH ASSAYS
[0403] In the present example pseudosandwich assays, with fluorescent detection in solution and on plates (ELISA-like format) are provided.
[0404] Solution-evolved aptameric sensors were adapted for use in a solid surface-format application, for example, ELISA-type assays. The solution sensorcomposed of an analyte and a primary aptamer partially hybridized to a competitor oligonucleotidewas modified using attachment chemistry to enable its anchoring to a solid surface. The surface attachment chemistry used was biotin-streptavidin interaction. In addition, the complementary strand to the competitor oligonucleotide (optimized to bind to the competitor oligonucleotide in the presence of analyte) was modified with a biotin-tag, which was used to capture a detection molecule e.g. streptavidin-HRP conjugate. The HRP substrate, TMB, was used for visualization.
[0405] Optimization of response of the surface-bound sensor, relative to +/analyte, was carried out by adjusting parameters including: amount of sensor on surface, attachment chemistry, concentration of complementary competitor oligonucleotide, buffer in each step, washing steps, HRP concentration, and HRP substrate.
Experimental Procedure for Pseudosandwich Assayin Solution
[0406] The solution buffer had the composition of the SELEX buffer or any other buffer that the sensor was shown to work in. Each sample well contained a final concentration of 50 nM aptamer-C.sub.Dext duplex (with a stoichiometric amount of C.sub.Dext in relation to aptamer, or in two- or three-fold excess). Selected concentrations of analyte were added, and complement to C.sub.Dext was added to a final concentration of 2 M. Final mixtures were incubated at room temperature for 20 minutes and then the fluorescence signal was measured.
[0407] Pseudosandwich assays in solution, where a double helix formation was triggered by an analyte, were performed for: [0408] 1. Deoxycorticosterone 21-glucoside (DOG); [0409] 2. L-Tyrosine; [0410] 3. D-Glucose; and [0411] 4. L-Phenylalanine
[0412] The primary aptamers formed a complex with C.sub.Dext and in the presence of C.sub.Dext.sup.comp produced an increase in fluorescence in the presence of their target analytes (
[0413] If the C.sub.Dext was deposited on plates, the double helix remained attached to the plate when the rest of solution was removed and it could be extensively washed.
Experimental Procedure for Pseudosandwich Assayin Solid State
[0414] Deoxycorticosterone 21-glucoside (DOG) sensor ELISA on streptavidin-coated plates was performed as following: 151.5 pmoles (6.6 L30 M) of DOG sensor in PBS pH 7.4 buffer solution, was added per well of the streptavidin-coated ELISA plate (Thermo, binding capacity 5 pmoles) containing 100 L of PBS buffer, to give a final sensor concentration of 1.44 M. The mixture was incubated at room temperature for 5 minutes. The solution was then removed from the well and the well washed thoroughly eight times with PBS buffer. Next, 100 L of TRIS pH 7.4 buffer (composed of 20 mM TRIS, 140 mM NaCl, 5 mM KCl, and 2 mM MgCl.sub.2) was added per well, followed by 2 L of 2 mM DOG dissolved in DMSO, to give a final Deoxycorticosterone 21-glucoside (DOG) concentration of 50 M. The single-stranded complement containing the biotin tag was then add (2 L of 100 M stock) to give a final concentration of 1.79 M. The mixture was incubated at room temperature of 20 minutes. The solution was then removed and the wells washed thoroughly 8 with PBS buffer. 100 L of PBS containing 1% BSA and 8000-fold diluted HRP-STV conjugate was then added per well, and incubated for 5 minutes at room temperature. The solution was removed and wells were washed thoroughly 8 with PBS buffer. 100 L of TMB/H.sub.2O.sub.2 substrate was then added to each well and the reaction progression was monitored on a plate reader at 652 nm.
[0415] Results for Deoxycorticosterone 21-glucoside (DOG) concentration dependence on a streptavidin-ELISA 96-well plate are shown in
[0416] Phenylalanine (Phe) sensor ELISA on streptavidin-coated plates was performed as following: The aforementioned procedure was carried out for the Phe sensor, except the 20 minute incubation step was carried out in 20 mM HEPES pH 7.5, 1 M NaCl, 10 mM MgCl.sub.2, 5 mM KCl buffer. Phe concentrations used were 0-200 M from a 2 mM stock solution in water. Results for Phe concentration dependence on a streptavidin-ELISA 96-well plate are shown in
8. EXAMPLE 3ISOLATION OF SECONDARY APTAMERS
[0417] The present example discloses methods for isolating secondary aptamers (A.sup.S) and their structure.
[0418] The isolation of secondary aptamers was performed using the SELEX process. Two methods for selecting secondary aptamers (A.sup.s) were performed, which can also be combined in some cases (
[0419] (1) A Solid-State Selection.
[0420] A target aptamer (A.sup.p) was attached to a matrix (e.g., beads), incubated with a library (e.g., but not limited to, prestructured or unstructured N.sub.20-100) in the presence of target analyte L to isolate aptamer candidates with affinity for A.sup.p*L complex (
[0421] (2) A Solution-Phase Selection.
[0422] The process in solution-phase used pre-structured library to enable formation of stem between primers attached to matrix via complementary oligonucleotides, and A.sup.s candidates were selected because their loop was closed through binding to A.sup.p and they get released from the solid surface (
[0423] Secondary aptamers were isolated using the aforementioned methods for: [0424] 1. Deoxycorticosterone (SEQ ID NOS: 34-35); [0425] 2. Serotonin (SEQ ID NOS: 36, 59, and 60);
[0426] The secondary aptamers bound to the primary aptamers, when the latter is in the complex with their target analytes (
[0427] The nucleotide sequences of the secondary aptamers are shown in Table 3.
TABLE-US-00005 TABLE3 SecondaryAptamerSequences. SEQID Target SecondaryAptamerSequence NO: Deoxy- GTCATGTGGCGCCTCGACCCCAGCCTTGGTAGCTGTTGGCCACACAA 290 corticosterone GAGCACATGAC GTCATGTGACGAGACAAGGAGAACGGAAGGCGACCGGATAAATCG 291 GATATCACATGAC Serotonin GTCATGTGGATTGTGACTTGCCCACAACGATTTTGCCAAACATGCAT 36 AGCCACATGAC CATGTGGATTGTGACTTGCCCACAACGATTTTGCCAAACATGCATAG 60 CCACATG
[0428] Secondary aptamers for serotonin were isolated based on nucleotide sequences of primary aptamer for serotonin comprising: CGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTCG (SEQ ID NO: 58), which was derived from the nucleotide sequence SEQ ID NO: 25 (
[0429] Isolated primary and secondary aptamers were used to perform sandwich assays as described in Example 4. Complementary oligonucleotides comprising the following nucleotide sequence: CACATGACACAGA (SEQ ID NO: 61) were used in fluorescence sensing.
9. EXAMPLE 4SANDWICH ASSAYS
[0430] In the present example, examples of sandwich assays, with fluorescent detections and ELISA-like formats are provided.
[0431] In the pseudosandwich assay described above, there were no true sandwich interactions (thus, pseudo-sandwich) and ligand*aptamer interactions were translated into a presence of a double helix allowing a format similar to non-competitive sandwich ELISAs. However, the true sandwich requires two aptamers (similar to two antibodies) binding to one molecule at the same time without competing with each other. This can be difficult for small molecules, simply because they lack two epitopes.
[0432] An alternate approach is depicted in
Experimental Procedure for Sandwich Assayin Solution
[0433] The solution buffer had the composition of the SELEX buffer or any other buffer that the sensor was shown to work in. The buffer used for the measurement of serotonin was PBS buffer including 2 mM MgCl.sub.2. For the measurement of deoxycorticosterone and testosterone, the buffer consisted of 20 mM HEPES, 1 M NaCl, 10 mM MgCl.sub.2, and 5 mM KCl (pH 7.5).
[0434] Separate solutions were prepared in parallel: (1) Four times concentrated primary aptamer (A.sup.P) was prepared in buffer and incubated for >5 min in a water bath heated to boiling until use for unfolding secondary structure, then mixed with four times concentrated analyte (L) and incubated >30 min. e.g. 20 L of 4 concentrated A.sup.P (e.g. 10 M) and 20 L of 4 concentrated serotonin solution (e.g. 800 M). The final concentration of serotonin was 400 M and of the complex A.sup.P-serotonin was 5 M. This is the 2 concentration of Ap-serotonin complex solution. (2) Two times concentrated secondary aptamer (A.sup.S) solution was prepared. FAM fluorescent conjugated A.sup.S (100 nM) and its dabcyl-quencher strand were mixed, the dabcyl-quencher strand was in three to five-fold excess for the sufficient quenching. This mixture was incubated for >5 min in a water bath heated to boilingused to promote unfolding of secondary structure and hybridization with the quencher strand. 40 L of each of the separately prepared solutions (1) and (2) were mixed and incubated for 40 min. Then 75 L of the mixed solution was taken for measurement. The fluorescent signal was measured. Each sample contained a final concentration of 2.5-5 M of primary aptamer (A.sup.P), 50 nM of secondary aptamer A.sup.S, 150 nM-250 nM of dabcyl quencher strand, and the indicated concentrations of analyte on the plots.
Sandwich Assayin Solid State
[0435] First, ligand (L) and primary aptamer (Ap) solution were prepared. 400 L of 2 concentrated Bio-TEG conjugated primary aptamer (0.6 pmole/L) was prepared in buffer, and incubated in the boiling water for >5 min until use. Two times concentrated serotonin solution (e.g. 400 M in buffer, 50 L) was prepared, then mixed with 50 L ligand and 50 L of A.sup.P solution and incubated >30 min. The final concentration of serotonin was 200 M and of the complex A.sup.P-serotonin was 30 pmole per well. Second, a Bio-TEG modified secondary aptamer solution was prepared in bulk and 100 L were applied (0.5 pmole/l) per well. This solution was incubated for >5 min in a water bath heated to boiling and was allowed to cool until use. After preparing these solutions, the ELISA assay was carried out. The ELISA plate wells were washed with PBS (+2 mM MgCl2) buffer, 2 times, with soaking 5 min between washes. The A.sup.S solution (100 L) was added to the wells, then incubated for 20 min at room temperature to allow biotin binding to the plate. The solution was then removed and the wells were washed thoroughly 8 times with the same buffer. Then, 100 L of [L*A.sup.P] solution was added to the wells and incubated for >30 min at room temperature. The solution was then removed and the wells were washed thoroughly 8 times with the same buffer. 100 L of PBS containing 1% BSA and 10000-fold diluted HRP-STV conjugate was then added per well, and incubated for 5 minutes at room temperature. The solution was removed and wells washed thoroughly 10 times with the same buffer. Directly after this wash, 100 L of TMB/H.sub.2O.sub.2 substrate was then added to each well and the reaction progression monitored on a plate reader at 370 or 652 nm.
[0436] Fluorescence read-outs when sandwiches are formed in solution (
[0439] In this assay, a primary aptamer is in solution and a secondary aptamer, which is also in solution, was turned in structure-switching fluorescent form, and was interacting with the primary aptamer when the primary aptamer was in complex with the targeted steroid through the release of a quencher-labeled competitor oligonucleotide (
[0440] A sandwich assay on plate was performed for the following analyte: [0441] 1. Serotonin. In this assay, a primary aptamer was deposited on plate, while a secondary aptamer bound to the primary aptamer when it was in its complex with serotonin (
10. EXAMPLE 5ANTI-APTAMER ASSAY
[0442] 400 nM FAM-aptamer solution and four-times concentrated Iowa Black-complement strand solution are prepared separately in buffer (20 mM HEPES, 1 M NaCl, 10 mM MgCl2, 5 mM KCl, pH 7.5). These solutions were annealed separately by incubating in boiling water for 5 min, and cooled down at room temperature for 30 min. Meanwhile, a two-times concentrate of each aptamer's target solutions were prepared; the final concentration is indicated in each plot. After the 30 min incubation period of the aptamer and complement strand solutions, 18.75 ul of the aptamer solution is added first to the 384-well plate, then 37.5 ul of the target solution is added, and then immediately added is 18.75 ul of complementary strand solution. Without incubation, the fluorescent measurement was started and read every 5 min at room temperature for >8 hours by using Fluorescence plate reader (Victor II microplate reader, PerkinElmer). The final concentration of aptamer is 100 nM, the concentration of complementary strand is 100 nM for all except CS aptamer (1000 nM) in 75 L reaction volume. The final concentration of target/ligand is indicated in each plot.
[0443] Each aptamer and its complementary strand is listed in below. The results are shown in
(A) DOG Aptamer/Complementary (100 nM: 100 nM)
[0444]
TABLE-US-00006 -DOGS.2_sht/DOGS.2_sht_anti: (SEQIDNO:292) CGACCCGGATTTTCCGAGTGGAACTAGCTGTGGCGG TCG/36-FAM/; (SEQIDNO:293) /5IABkFQ/CGACCGCCACAGCTAGTTCCACTCGGAAAA TCCGGGTCG -DOGS.2_Full/DOGS.2_Full_anti: (SEQIDNO:294) /56-FAM/CTCTCGGGACGACCCGGATTTTCCGAGTGG AACTAGCTGTGGCGGTCGTCCC; (SEQIDNO:295) GGGACGACCGCCACAGCTAGTTCCACTCGGAAAATC CGGGTCGTCCCGAGAG/3IABkFQ/
(B) ALD Aptamer/Complementary: (100 nM: 100 nM)
[0445]
TABLE-US-00007 -ALDS.1_sht/ALDS.1_sht_anti: (SEQIDNO:296) CGACAGATAGTTGTTCTTAGCGATGTTCAGCGTTGT CG/36-FAM/; (SEQIDNO:297) /5IABkFQ/CGACAACGCTGAACATCGCTAAGAACAACT ATCTGTCG -ALDS.1_Full/ALDS.1_Full_anti: (SEQIDNO:298) /56-FAM/CTCTCGGGACGACAGATAGTTGTTCTTAGC GATGTTCAGCGTTGTCGTCCC; (SEQIDNO:299) GGGACGACAACGCTGAACATCGCTAAGAACAACTAT CTGTCGTCCCGAGAG/3IABkFQ/
(C) CS Aptamer/Complementary: (100 nM: 1000 nM)
[0446]
TABLE-US-00008 CSS.1_sht/CSS.1_sht_anti: (SEQIDNO:300) GACGACGCCCGCATGTTCCATGGATAGTCTTGACTA GTCGTC/36-FAM/; (SEQIDNO:301) /5IABkFQ/GACGACTAGTCAAGACTATCCATGGAACAT GCGGGCGTCGTC
(D) TES Aptamer/Complementary:
[0447]
TABLE-US-00009 TES.1_sht/TES.1_sht_anti: (SEQIDNO:302) ACGGGATGTCCGGGGTACGGTGGTTGCAGTTCGT/36- FAM/; (SEQIDNO:303) /5IABkFQ/ACGAACTGCAACCACCGTACCCCGGACATC CCGT
(E) Phe-CpRh Aptamer/Complementary:
[0448]
TABLE-US-00010 Phe-CpRh_sht/Phe-CpRh_sht_anti: (SEQIDNO:304) /56-FAM/CGACACAGCGTGAGCCAACTAATTAGTGCG TATTGTCG; (SEQIDNO:305) CGACAATACGCACTAATTAGTTGGCTCACGCTGTGT CG/3IABkFQ/
(F) Phe Aptamer/Complementary:
[0449]
TABLE-US-00011 Phe_sht/Phe_sht_anti: (SEQIDNO:306) /GACCGGTGGGGGTTCTTTTTCAGGGGAGGTACGGTC/ 36-FAM/; (SEQIDNO:307) /5IABkFQ/GACCGTACCTCCCCTGAAAAAGAACCCCCA CCGGTC
11. EXAMPLE 6SANDWICH ASSAY
[0450]
[0451]
[0452]
[0453]
12. EXAMPLE 7PROTOCOLS FOR SECONDARY APTAMER ELISA (SANDWICH ASSAY)
[0454] Secondary Aptamer on the Plate and Primary Aptamer in Solution Method (
[0455] A biotinylated secondary aptamer is immobilized on a streptavidin-coated plate in appropriate buffer for about 30 minutes at room temperature, and then washed with buffer to remove excess unbound aptamers. A primary aptamer and its target are pre-incubated for 40 min at room temperature and then added to the immobilized secondary aptamer, incubating on the plate for 40 minutes. Streptavidin-HRP, 10000-fold diluted in 100 L of PBS (w. 1% BSA), is added next, and incubated for 20 mins, then washed thoroughly with PBS. TMB substrate mix is then added and change in absorbance at 370 nm recorded for 45 mins.
[0456] Primary Aptamer on the Plate and Secondary Aptamer in Solution Method (
[0457] A biotinylated primary aptamer is immobilized on a streptavidin-coated plate in appropriate buffer for about 30 minutes at room temperature, and then washed with buffer to remove excess unbound aptamers. A target solution is then added to the immobilized primary aptamer and incubated for about 40 min. The secondary aptamer is added to the plate on top of the target solution and incubated about 40 min, then washed with buffer to remove the unbound secondary aptamers. Streptavidin-HRP, 10000-fold diluted in 100 L of PBS (w. 1% BSA), is added next, and incubated for 20 mins, then washed thoroughly with PBS. TMB substrate mix is then added and change in absorbance at 370 nm recorded for 45 mins.
13. REFERENCES
[0458] 1. Cox, K. L.; Devanarayan, V.; Kriauciunas, A.; Manetta, J.' Montrose, C.; Sittampalam, S. Immunoassay Methods in Assay Guidance Manual (Internet), NCBI Resources Bookshelf; last updated: Dec. 24, 2014. [0459] 2. Gan, S. D.; Patel, K. R. Enzyme Immunoassay and Enzyme-Linked Immunosorbent Assay J Investig Derm 133, e12 (2013) [0460] 3. Lequin, R. Enzyme Immunoassay (EIA)/Enzyme-Linked Immunosorbent Assay (ELISA) Clinical Chemistry 51(12): 2415-2418 (2005). [0461] 4. Fan, M.; He, J. Recent Progress in Noncompetitive Hapten Immunoassays: A review Chapter 5 in Trends in Immunolabelled and Related Techniques, www.intechopen.com, accessed at: Jun. 1, 2015. [0462] 5. Wilson, R. Sensitivity and Specificity: Twin Goals of Proteomics Assays Expert Rev Proteomics 10(2): 135-149 (2013). [0463] 6. Dong, J.-X.; Xu, C.; Wang, H.' Xiao, Z.-L.; Gee, S. J.; Li, Z.-F.; Wang, F.; Wu, W.-J.; Shen, Y.-D.; Yang, J.-Y.; Sun, Y.-M.; Hammock, B. D. Enhanced Sensitive Immunoassay Noncompetitive Phage AntiImmune Complex Assay for the Determination of Malachite Green and Leucomalachite Green J Agric Food Chem 62(34): 8752-8758 (2014). [0464] 7. Ihara, M.; Suzuki, T.; Kobayashi, N.; Goto, J.; Ueda, H. Open-Sandwich Enzyme Immunoassay for One-Step Noncompetitive Detection of Corticosteroid 11-Deoxycortisol Anal Chem 81(20): 8298-8304 (2009). [0465] 8. Shen, J.; Li, Y.; Gu, H.; Xia, F.; Zuo, X. Recent Development of Sandwich Assay based on Nanobiotechnologies for Proteins, Nucleic Acids, Small Molecules, and Ions Chem Rev 114(15): 7631-7677 (page 7662) (2014). [0466] 9. Ozer, A.; Pagano, J. M.; Lis, J. T. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization Molecular Therapy Nucleic Acids 3: e 183 (2014). [0467] 10. McKeague, M.; Derosa, M. C. Challenges and opportunities for small molecule aptamer development. J Nucleic Acids, Article ID 748913 (2012). [0468] 11. Rohloff, J. C.; Gelinas, A. D.; Jarvis, T. C.; Ochsner, U. A.; Schenider, D. J.; Gold, L.; Janjic, N. Nucleic Acid Ligands with Protein-like Side Chains: Modified Aptamers and Their Use as Diagnostic and Therapeutic Agents Molecular Therapy Nucleic Acids 3: e:201 (2014). [0469] 12. Ellington, A. D. & Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands Nature (London) 346: 818-822 (1990). [0470] 13. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase Science 249(4968):505-510 (1990). [0471] 14. Cho, E. J.; Lee, J.-W.; Ellington, A. D. Applications of Aptamers as Sensors Annu. Rev. Anal Chem 2:241-264 (2009). [0472] 15. Keefe, A. D.; Pai, S.; Ellington, A. Aptamers as therapeutics Nat Rev Drug Discovery, 9:537-550 (2010). [0473] 16. Yang, K.-A.; Pei, R.; Stefanovic, D.; Stojanovic, M. N. Optimizing Cros-reactivity with Evolutionary Search for Sensors J Am Chem Soc 134:1642-1647 (2012). [0474] 17. Stoltenburg, R.; Nikolaus, N.; Strehlitz, B. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics J Anal Meth Chem 15697 (2012). [0475] 18. Rajendran M.; Ellington, A. D. Selection of fluorescent aptamer beacons that light up in the presence of zinc Anal Bioanal Chem 390:1067-75 (2008). [0476] 19. Nutiu, R.; Li, Y. In vitro selection of structure-switching signaling aptamers Angew Chem Int Ed 44: 1061-1065 (2005). [0477] 20. Hu, J.; Easley, C. J.; A simple and rapid approach for measurement of dissociation constants of DNA aptamers against proteins and small molecules via automated microchip electrophoresis Analyst 136:3461-3468 (2011). [0478] 21. Nutiu, R., and Li, Y. Structure-switching signaling aptamers J Am Chem Soc 125:4771-4778 (2003). [0479] 22. Vater, A.; Klussmann, S. Toward third-generation aptamers: Spiegelmers and their therapeutics prospects. Curr Opin Drug Discov Devel 6: 253-261 (2003). [0480] 23. Vater, A.; Klussmann, S. Turning mirror-image oligonucleotides into drugs: the evolution of Spiegelmer therapeutics Drug Discovery Today 20(1): 147-155 (2015). [0481] 24. Williams, K. P.; Liu, X. N.; Schumacher, T. N.; Lin, H. Y.; Ausiello, D. A.; Kim, P. S.; Bartel, D. P. Bioactive and Nuclease-resistant L-DNA Ligand of Vasopressin. Proc Natl Acad Sci. USA, 94(21):11285-11290 (1997). [0482] 25. Purschke, W. G.; Eulberg, D.; Buchner, K.; Vonhoff, S.; Klussmann, S. An L-RNA-based aquaretic agent that inhibits vasopressin in vivo. Proc Natl Acad Sci USA 103:5173-5178 (2003). [0483] 26. Yang, K. A; Barbu, M.; Halim, M.; Pallavi, P.; Kim, B.; Kokpashchikov, D.; Pecic, S.; Taylor, S.; Worgall, T. S.; Stojanovic, M. N. Recognition and Sensing of Low-Epitope Targets via Ternary Complexes with Oligonucleotides and Synthetic Receptors Nat Chem. 6:1003-1008 (2014). [0484] 27. Ozer, A.; Pagano, J. M.; Lis, J. T. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization Molecular Therapy Nucleic Acids 3: e 183 (2014). [0485] 28. McKeague, M.; Derosa, M. C. Challenges and opportunities for small molecule aptamer development. J Nucleic Acids, Article ID 748913 (2012). [0486] 29. Rohloff, J. C.; Gelinas, A. D.; Jarvis, T. C.; Ochsner, U. A.; Schenider, D. J.; Gold, L.; Janjic, N. Nucleic Acid Ligands with Protein-like Side Chains: Modified Aptamers and Their Use as Diagnostic and Therapeutic Agents Molecular Therapy Nucleic Acids 3: e:201 (2014). [0487] 30. Ellington, A. D. & Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands Nature (London) 346: 818-822 (1990). [0488] 31. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase Science 249(4968):505-510 (1990). [0489] 32. Robertson, D. L.; Joyce, G. F. Selection in vitro of an RNA enzyme that specifically cleaves single stranded DNA Nature 344:467-468 (1990). [0490] 33. Cho, E. J.; Lee, J.-W.; Ellington, A. D. Applications of Aptamers as Sensors Annu. Rev. Anal Chem 2:241-264 (2009). [0491] 34. Keefe, A. D.; Pai, S.; Ellington, A. Aptamers as therapeutics Nat Rev Drug Discovery, 9:537-550 (2010). [0492] 35. Anslyn, E. Supramolecular Analytical Chemistry J Org Chem 72(3):687-699 (2007). [0493] 36. Gennady V.; Oshovsky, D.; Reinhoudt, D. V.; Verboom, W. Supramolecular Chemistry in Water Angew. Chem. Int. Ed. 46(14): 2366-2393 (2007). [0494] 37. Jonathan W. Steed (Editor-in-Chief), Philip A. Gale (Editor-in-Chief) Supramolecular Chemistry: From Molecules to Nanomaterials Wiley, 8 Volume Set (2012). [0495] 38. Steed, J. W.; Atwood, J. L.; Supramolecular Chemistry, 2nd Edition, Willey, (2009). [0496] 39. Pedersen, C. J. Cyclic polyethers and their complexes with metal salts J Am Chem Soc 89(26):7017-7036 (1967). [0497] 40. Kyba, E. P.; Siegel, M. G.; Sousa, L. R.; Sogah, G. D. Y.; Cram, D. J. Chiral, hinged, and functionalized multiheteromacrocycles J Am Chem Soc 95:2691-2692 (1973). [0498] 41. Dietrich, B.; Lehn, J.-M.; Sauvage, J.-P. Diaza-polyoxa-macrocycles et macrobicycles Tet Lett 2885-2888 (1969). [0499] 42. Costa J. B.; Andreiev A. I.; Dieckmann T. Thermodynamics and kinetics of adaptive binding in the malachite green RNA aptamer Biochemistry 24; 52(38):6575-83 (2013). [0500] 43. Hermann, T.; Patel, D. J. Adaptive Recognition by Nucleic Acids Science 287:820-825 (2000). [0501] 44. Xia, T.; Yuan, J.; Fang, X.; Conformational dynamics of an ATP-binding DNA aptamer: a single molecule study. J Phys Chem B 117(48): 14994-50003 (2013). [0502] 45. Vater, A.; Klussmann, S. Toward third-generation aptamers: Spiegelmers and their therapeutics prospects. Curr Opin Drug Discov Devel 6: 253-261 (2003). [0503] 46. Vater, A.; Klussmann, S. Turning mirror-image oligonucleotides into drugs: the evolution of Spiegelmer therapeutics Drug Discovery Today 20(1): 147-155 (2015). [0504] 47. Williams, K. P.; Liu, X. N.; Schumacher, T. N.; Lin, H. Y.; Ausiello, D. A.; Kim, P. S.; Bartel, D. P. Bioactive and Nuclease-resistant L-DNA Ligand of Vasopressin. Proc Natl Acad Sci. USA, 94(21):11285-11290 (1997). [0505] 48. Purschke, W. G.; Eulberg, D.; Buchner, K.; Vonhoff, S.; Klussmann, S. An L-RNA-based aquaretic agent that inhibits vasopressin in vivo. Proc Natl Acad Sci USA 103:5173-5178 (2003). [0506] 49. Kato, T.; Yano, K.; Ikebukuro, K.; and Karube, I. Interaction of three-way DNA junctions with steroids Nucleic Acids Res 28:1963-1968 (2000). [0507] 50. Stojanovic, M. N.; Green, E. G.; Semova, S.; Nikic, D. B.; Landry, D. W. Cross-reactive arrays based on three-way junctions J Am Chem Soc 125:6085-6089 (2003). [0508] 51. Yang, K.-A.; Pei, R.; Stefanovic, D.; Stojanovic, M. N. Optimizing Cros-reactivity with Evolutionary Search for Sensors J Am Chem Soc 134:1642-1647 (2012). [0509] 52. Iskander, K. N.; Osuchowski, M. F.; Stearns-Kurosava, D. J.; Stepien, D.; Valentine, C.; Remick, D. G. Sepsis: multiple abnormalities, heterogenous responses, and evolving understanding Phys. Rev. 93(3): 1247-1288 (2013). [0510] 53. Benedict, C. R.; Rose, J. A. Arterial norepinephrine changes in patients with septic shock Circ Shock 38(3): 165-172 (1992). [0511] 54. Wilson, M. F.; Brackett, D. J.; Tompkins, P, Benjamin, B.; Archer, L. T.; Hinshaw, L. B. Elevated plasma vasopressin concentrations during endotoxin and E. coli shock Adv Shock Res 6:15-26 (1981). [0512] 55. Landry D. W., Levin H. R., Gallant E. M., Ashton R. C., Seo S., D'Alessandro D., Oz M. C., Oliver J. A. Vasopressin deficiency contributes to the vasodilation of septic shock Circulation 95: 1122-1125 (1997). [0513] 56. Lin, I. Y.; Ma, H. P.; Lin, A. C.; Chong, C. F.; Lin, C. M.; Wang, T. Low plasma vasopressin/norepinephrine ratio predicts septic shock Am J Emrg Med 23(6): 718-724 (2005). [0514] 57. Sam, S.; Corbridge, T. C.; Mokhlesi, B.; Comellas, A. P.; Molitch, M. E. Cortisol levels and mortality in severe sepsis Clin Endorinol (Oxf) 60(1): 29-35 (2004). [0515] 58. Bendel, S.; Karlsson, S.; Pettila, V.; Loisa, P.; Varpula, M.; Ruokonen, E.; Finnsepsis Study Group Freel cortisol in sepsis and septic shock Anesth Analq 106(6): 1813-1819 (2008). [0516] 59. Annane, D.; Maximi, V.; Ibrahim, F.; Alvarez, J. C.; Abe, E.; Boudou, P. Diagnosis of Adrenal Insufficiency in Severe Sepsis and Septic Shock Am J Respir Crit Care Med 174:1319-1326, 2006. [0517] 60. Moares, R. B.; Freidman, G.; Viana, M. V.; Tonietto, T.; Saltz, H.; Czepielewski, M. A. Aldosterone secretion in patients with septic shock: a prospective study. Arq Bras Endorcinol Metabol 57(8): 636-641 (2013). [0518] 61. Salgado, D. R.; Rocco, J. R.; Silva, E.; Vincent, J. L. Modulation of the renin-angiotensin-aldosterone system in sepsis: a new therapeutic approach? Expert Opin Ther Targets 14(1): 11-20 (2010). [0519] 62. Zhang, W.; Chen, X.; Huang, L.; Lu, N.; Zhou, L.; Wu, G.; Chen, Y. Severe sepsis: Low expression of renin-angiotensin system is associated with poor prognosis Exper Therap Med 7(5): 1342-1348 (2014). [0520] 63. Sato, Y.; Fujiwara, H.; Takatsu, Y. Cardiac troponin and heart failure in the era of high-sensitivity assays J. Cardiology 60(3): 160-167 (2012). [0521] 64. Sherwood, M. W.; Newby, K. High-Sensitivity Troponin Assays: Evidence, Indications, and Reasonable Use J Am Heath Assoc. 3: e000403 (2014). [0522] 65. Cox, K. L.; D evanarayan, V.; Kriauciunas, A.; Manetta, J.' Montrose, C.; Sittampalam, S. Immunoassay Methods in Assay Guidance Manual (Internet), NCBI Resources Bookshelf; last updated: Dec. 24, 2014. [0523] 66. Gan, S. D.; Patel, K. R. Enzyme Immunoassay and Enzyme-Linked Immunosorbent Assay J Investig Derm 133, e12 (2013). [0524] 67. Lequin, R. Enzyme Immunoassay (EIA)/Enzyme-Linked Immunosorbent Assay (ELISA) Clinical Chemistry 51(12): 2415-2418 (2005). [0525] 68. Fan, M.; He, J. Recent Progress in Noncompetitive Hapten Immunoassays: A review Chapter 5 in Trends in Immunolabelled and Related Techniques, www.intechopen.com, accessed at: Jun. 1, 2015. [0526] 69. Wilson, R. Sensitivity and Specificity: Twin Goals of Proteomics Assays Expert Rev Proteomics 10(2): 135-149 (2013). [0527] 70. De Lemos, J. A.; Morrow, D. A.; Brain Natriuretic Peptide Measurement in Acute Coronary Syndromes Circulation 106: 2686-2870 (2002). [0528] 71. Osborne, S. E.; Ellington, E. D. Nucleic acid selection and the challenge of combinatorial chemistry Chemical Reviews 97 (2): 349-370 (1997). [0529] 72. Vant-Hull B., Gold L, Zichi D A. Theoretical principles of in vitro selection using combinatorial nucleic acid libraries Curr Protoc Nucleic Acid Chem. Chapter 9: Unit 9.1 (2000). [0530] 73. Dong, J.-X.; Xu, C.; Wang, H. Xiao, Z.-L.; Gee, S. J.; Li, Z.-F.; Wang, F.; Wu, W.-J.; Shen, Y.-D.; Yang, J.-Y.; Sun, Y.-M.; Hammock, B. D. Enhanced Sensitive Immunoassay Noncompetitive Phage AntiImmune Complex Assay for the Determination of Malachite Green and Leucomalachite Green J Agric Food Chem 62(34): 8752-8758 (2014). [0531] 74. Ihara, M.; Suzuki, T.; Kobayashi, N.; Goto, J.; Ueda, H. Open-Sandwich Enzyme Immunoassay for One-Step Noncompetitive Detection of Corticosteroid 11-Deoxycortisol Anal Chem 81(20): 8298-8304 (2009). [0532] 75. Shen, J.; Li, Y.; Gu, H.; Xia, F.; Zuo, X. Recent Development of Sandwich Assay based on Nanobiotechnologies for Proteins, Nucleic Acids, Small Molecules, and Ions Chem Rev 114(15): 7631-7677 (page 7662) (2014). [0533] 76. Stojanovic, M. N., de Prada, P., Landry, D. W. Self-assembling aptameric sensors J Am Chem Soc, 122:11547-11548 (2000). [0534] 77. Chandra, M.; Silverman, S. K. DNA and RNA Can Be Equally Efficient Catalysts for Carbon-Carbon Bond Formation, J Am Chem Soc 130:2936-2937 (2008). [0535] 78. Pinheiro, V. B.; Holliger, P. Towards XNA nanotechnology: new materials from synthetic genetic polymers Trends Biotechnology 32(6): 321-328 (2014). [0536] 79. Santoro, S. W.; Joyce, G. F.; Sakthivel, K.; Gramatikova, S.; Barbas, C. F. RNA cleavage by a DNA enzyme with extended chemical functionality J Am Chem Soc 122:2433-2439 (2000). [0537] 80. Perrin D. M.; Garestier, T.; Helene, C. Bridging the gap between proteins and nucleic acids: a metal-independent RNAseA mimic with two protein-like functionalities J Am Chem Soc 123:1556-1563 (2001). [0538] 81. Kimoto, M.; Yamashige, R.; Matsunaga, K-I.; Yokoyama, S.; Hirao, I. Generation of high-affinity DNA aptamers using an expanded genetic alphabet Nature Biotechnol 31, 453-457 (2013). [0539] 82. Imaizumi, Y.; Kasahare, Y.; Fujita, H.; Kitadume, S.; Ozaki, H.; Endoh, T.; Kuwhara, M.; Sugimoto, N. Efficacy of base-modification on target binding of small molecule DNA aptamers J Am Chem Soc 135, 9412-9419 (2013). [0540] 83. Brukner, I.; El-Ramahi, R.; Gorska-Flipot, I.; Krajinovic, M.; Labuda, D. An in vitro selection scheme for oligonucleotide probes to discriminate between closely related DNA sequences. Nucleic Acids Res. 35(9): e66, (2007), and literature cited therein. [0541] 84. Brukner, I.; Krajinovic, M.; Dascal, A.; Labuda, D. A protocol for the in vitro selection of specific oligonucleotide probes for high-resolution DNA typing. Nat Protoc 2(11):2807-14 (2007). [0542] 85. Ayel, E.; Escud, C. In vitro selection of oligonucleotides that bind double-stranded DNA in the presence of triplex-stabilizing agents. Nucleic Acids Res 38(5): e31 (2010), and literature cited therein. [0543] 86. Darfeuille, F.; S. Reigadas; J. Hansen; H. Orum; C. Di Primo; J. Toulme (2006). Aptamers targeted to an RNA hairpin show improved specificity compared to that of complementary oligonucleotides. Biochemistry 45 (39):12076-12082. [0544] 87. Durand, G.; Lisi, S.; Ravelet, C.; Dausse, E.; Peyrin, E.; Toulme, J.-J. Riboswitches Based on Kissing Complexes for the Detection of Small Ligands Angew Chem Int Ed 53(27): 6942-6945 (2014). [0545] 88. Luense, C. E.; Michlewski, G.; Hopp, C. S.; Rentmeister, A.; Caceres, J. F.; Famulok, M.; Mayer, G. An aptamer targeting the apical-loop domain modulates pri-miRNA processing Angew Chem Int Ed 49(27):4674-4677, (2010). [0546] 89. Butcher, S. E.; Pyle, A. M. The Molecular Interactions that Stabilize RNA Tertiary Structure: RNA Motifs, Patterns, and Networks Acc. Chem. Res. 44(12):1302-1311 (2011). [0547] 90. Abraham, M.; Dror, O.; Nussinov, R.; Wolfson, H. J. Analysis and classification of RNA tertiary structures RNA 14(11):2274-2289 (2008). [0548] 91. Butcher, S. E.; Heckman, J. E.; Burke, J. M. Reconstitution of hairpin ribozyme activity following separation of functional domains. Journal Biol Chem 270 (50): 29648-29651 (1995). [0549] 92. Doherty, E A; Doudna J A Ribozyme structures and mechanisms. Annu. Rev. Biophys. Biomol. Struct. 30: 457-475 (2001). [0550] 93. Rinker, S.; Ke, Y.; Liu, Y.; Chhabra, R.; Yan, H. Self-assembled DNA nanostructures for distance dependent multivalent ligand-protein binding Nature Nanotech 3:418-422 (2008). [0551] 94. Corbett, P. T.; Leclaire, J.; Vial, L.; West, K. R.; Wietor, J.-L.; Sanders, J. K. M.; Otto, S. Dynamic combinatorial chemistry. Chem Rev 106 (9):3652-3711 (2006). [0552] 95. Wang Y.; Rando R. R. Specific binding of aminoglycoside antibiotics to RNA Chemistry & Biology 2:281-290 (1995). [0553] 96. Stojanovic, M. N.; de Prada, P.; Landry, D. W. Fluorescent Sensors based on aptamer self-assembly J Am Chem Soc 122: 9678-9679 (2000). [0554] 97. Stojanovic, M. N.; de Prada, P.; Landry, D. W. Aptamer-based folding fluorescent sensor for cocaine, J Am Chem Soc 123: 4928-4929, (2001). [0555] 98. Stojanovic, M. N.; Landry, D. W. Aptamer-based colorimetric sensor for cocaine J Am Chem Soc 124: 9678-9679 (2002). [0556] 99. Stojanovic, M. N. Kolpashchikov, D. M. Modular allosteric sensors J Am Chem Soc 126: 9266-9270, (2004). [0557] 100. Pei, R.; Shen, A; Olah, M.; Stefanovic, D.; Worgall, T.; Stojanovi, M. N. High-resolution crossreactive array for alkaloids Chem Commun. (Camb); (22):3193-5 (2009). [0558] 101. Green, E. G.; Olah, M. J.; Abramova, T.; Williams, L.; Stefanovi, D.; Worgall, T.; Stojanovi, M. N. Rational Approach to Minimal Cross-reactive Arrays J Am Chem Soc 128: 15278-15282 (2006). [0559] 102. Stoltenburg, R.; Nikolaus, N.; Strehlitz, B. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics J Anal Meth Chem 15697 (2012). [0560] 103. Rajendran M.; Ellington, A. D. Selection of fluorescent aptamer beacons that light up in the presence of zinc Anal Bioanal Chem 390:1067-75 (2008). [0561] 104. Nutiu, R.; Li, Y. In vitro selection of structure-switching signaling aptamers [0562] Angew Chem Int Ed 44: 1061-1065 (2005). [0563] 105. Hu, J.; Easley, C. J.; A simple and rapid approach for measurement of dissociation constants of DNA aptamers against proteins and small molecules via automated microchip electrophoresis Analyst 136:3461-3468 (2011). [0564] 106. Nutiu, R., and Li, Y. Structure-switching signaling aptamers J Am Chem Soc 125:4771-4778 (2003). [0565] 107. Nguyen, T. H.; Pei, R.; Landry, D.; Stojanovic, M.; Lin. Q Label-free microfluidic characterization of temperature dependent biomolecular interactions, Biomicrofluid 5:34118-341187 (2011). [0566] 108. Nguyen, T. H.; Pei, R.; Landry, D.; Stojanovic, M.; Lin. Q Microfluidic Aptameric Affinity Sensing of Vasopressin for Clinical Diagnostic and Therapeutic Applications, Sensors and Actuators B: Chemical 154: 59-66 (2011). [0567] 109. Nguyen, T. H.; Pei, R.; Landry, D.; Stojanovic, M.; Lin. Q. An Aptameric Microfluidic System for Specific Purification, Enrichment and Mass Spectrometric Detection of Biomolecules, J of Microelectromechanical Syst 18(6): 1198-1207 (2009). [0568] 110. Hilton, J. P.; Olsen, T.; Kim, J.; Zhu, J.; Nguyen, T. H.; Barbu, M.; Pei, R.; Stojanovic, M.; Lin, Q. Isolation of thermally sensitive protein-binding oligonucleotides on a microchip Microfluidics and Nanofluidics, 19(4):795-804 (2015). [0569] 111. Linnet, K. Necessary sample size for method comparison studies based on regression analysis Clin Chem 45:882-894 (1999). [0570] 112. Magari, R. T. Evaluating Agreement Between Two Analytical Methods in Clinical Chemistry Clin Chem Lab Med 38: 1021-1025 (2000). [0571] 113. Linnet, K. Performance of Deming regression analysis in case of misspecified analytic error ratio in method comparison studies Clin Chem 44:1024-1031 (1998). [0572] 114. Dewitte, K.; Fierens, C.; Stockl, D.; Thienport, L. M. Application of the Bland-Altman plot for interpretation of method-comparison studies: a critical investigation of its practice Clin Chem 48:799-801 (2002). [0573] 115. Yang, L.; Flint Beal, M. Determination of Neurotransmitter Levels in Models of Parkinson's Disease by HPLC-ECD in Giovanni Manfredi and Hibiki Kawamata (eds.), Neurodegeneration: Methods and Protocols, Methods in Molecular Biology., vol. 793: 401-415, 2011. [0574] 116. Kennedy, B.; Ziegler, M. G. A more sensitive and specific radioenzymatic assay for catecholamines Life Sci 47(23):2143-53 (1990). [0575] 117. http://www.abnova.com/products/products detail. asp?catalog id=KA1887 and other vendors, accessed on Mar. 2, 2016. [0576] 118. Clark, J. J.; Sandberg, S. G.; Wanat, M. J.; Gan, J. O.; Home, E. A.; Hart, A. S.; Akers, C. A. et al. Chronic microsensors for longitudinal subsecond dopamine detection in behaving animals Nat. Methods 7(2):126-129 (2010). [0577] 119. Mannironi, C.; Di Nardo, A.; Fruscoloni, P.; Tocchini-Valentini, G. P. In vitro selection of dopamine RNA ligands Biochem 36(32): 9726-9734 (1997). [0578] 120. Simpson, N.; Maffei, A.; Freeby, M.; Burroughs, S.; Freyberg, Z.; Javitch, J.; Leibel, R. L.; Harris, P. E. Dopamine-mediated autocrine inhibitory circuit regulating human insulin secretion in vitro Mol Endocrinol (10):1757-72 (2012). [0579] 121. Hauser, N. C.; Martinez, R.; Jacob, A.; Rupp, S.; Hoheisel, J. D.; Matysiak, S. Utilising the left helical conformation of L-DNA for analyzing different marker types on a single universal microarrays platform Nucleic Acids Res 34(18): 501-5111 (2006). [0580] 122. Hampshire, A. J.; Rusling, D. A.; Broughton-Head, V. J.; Fox, K. R. Footprinting: A method for determining the sequence selectivity, affinity, and kinetics of DNA binding ligands Methods 42(2): 128-140 (2007). [0581] 123. Regulski, E. E.; Breaker, R. R. In-Line Probing Analysis of Riboswitches Methods in Molecular Biology 419: 53-75, Totowa, N.J. (2008). [0582] 124. Franksson, G.; Anggard, E. The Plasma Protein Binding of Amphetamine, Catecholamines and Related Compounds Acta Pharm Tox 28(3):209-214 (2009). [0583] 125. Appendix. Normal Hormone Reference Ranges. Greenspan's Basic & Clinical Endocrinology. Ninth Edition. the McGraw-Hill Companies (2011). [0584] 126. Elias, A. N.; Nosratola, D.; Vaziri, M. D.; Maksy, M. Plasma Norepinephrine, Epinephrine, and Dopamine Levels in End-Stage Renal Disease Arch Intern Med 145:101301015 (1985). [0585] 127. Plunker, J. J.; Reeves, J. D.; Ngo, L.; Bellows, W., Shafer, S. L.; Roache, G.; Howse, J.; Herskowitz, A.; Mangano, D. T. et al Urine and Plasma Catecholamine and Cortisol Concentrations after Myocardial Revascularization Anest 86:785-796 (1997). [0586] 128. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction Nucleic Acids Res 31 (13), 3406-15, (2003). [0587] 129. Zadeh, J. N., Steenberg, C. D.; Bois, J. S.; Wolfe, B. R.; Khan, A. R.; Pierce, M. B.; Dirks, R. M.; Pierce, N. A. NUPACK: analysis and design of nucleic acid systems J Comp Chem 32:170-173 (2011). [0588] 130. (http://www.enzolifesciences.com/ADI-900-017A/arg8-vasopressin-elisa-kit/) and other similar kits, accessed on Mar. 3, 2015. [0589] 131. (https://www.buhlmannlabs.ch/products-solutions/special-products/vasopressin-adh/) and similar kits, accessed on Mar. 3, 2015. [0590] 132. Zhang, D.; Rios, D. R.; Tam, V. H.; Chow, D. S. Development and validation of a highly sensitive LC-MS/MS assay for the quantification of arginine vasopressin in human plasma and urine: Application in preterm neonates and child J Pharm Biomed Anal 96:67-73 (2014). [0591] 133. Bassi, E.; Park, M.; Azavedo, L. C. P. Therapeutic Strategies for High-Dose Vasopressor-Dependent Shock volume 2013: ID 654708, 10 pages (2013). [0592] 134. Raff, H.; Findling, J. W. Aldosterone control in critically ill patients: ACTH, metoclopramide, and atrial natriuretric peptide Crit Care Med 18(9):915-920 (1997). [0593] 135. Dick, M.; Dasta, J. F.; Choban, P. S.; Sinha, R.; Flancbaum, L. Serum Aldosterone Concentrations and Urine Output in Oliguric Intensive Care Unit Patients Receiving Low-Dose Dopamine Ann Pharmacotherapy 28:837-840 (1994). [0594] 136. Lichtarowicz-Krynska, E. J.; Cole, T. J.; Camacho-Hubner, C.; Britto, J.; Levin, M.; Klein, N.; Aynsley-Green, A. Circulating Aldosterone Levels are Unexpectedly Low in Children with Actute Meningococcal Disease J Clin Endocrin Met 89(3):1410-1414 (2004). [0595] 137. Meurant, G. The Adrenal Cortex chapter in Molecular and Cell Endocrinology in Principles of Medical Biology, v. 10A, p. 241 (1997). [0596] 138. Folan, M. M.; Stone, R. A.; Pittenger, A. L.; Pittenger, A. L.; Stofferl, J. A.; Hess, M. M.; Kroboth, P. D. Dehydroepiisoandreosterone, dehydroepiisoandrosterone-sulfate, and cortisol concentrations in intensive care unit patients Crit Care Med 20(5):965-970 (2001). [0597] 139. Vd Berghe, G.; d Zegher, F.; Wouters, P.; Schetz, M.; Verwaest, C.; Ferdinande, P.; Lauwers, P. Dehydroepiandrosterone sulphate in critical illness: effect of dopamine Clin Endocrin 43:457-463 (1995).
[0598] Various references are cited herein, the contents of which are hereby incorporated by reference in their entireties.