COMPOSITIONS CONTAINING COMBINATIONS OF BIOACTIVE MOLECULES DERIVED FROM MICROBIOTA FOR TREATMENT OF DISEASE
20190134179 ยท 2019-05-09
Assignee
Inventors
- Kenya Honda (Yokohama, JP)
- Bernat Olle (Cambridge, MA)
- Koji Atarashi (Tokyo, JP)
- Takeshi Tanoue (Yokohama, JP)
- Hiroshi Ohno (Yokohama, JP)
- Shinji Fukuda (Yokohama, JP)
- Koji Hase (Yokohama, JP)
Cpc classification
A61P31/00
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K38/16
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
Abstract
Compositions consisting of bioactive molecules derived from the microbiota of a mammal are provided herein. When administered orally with a colonic delivery system, the compositions are useful for the prophylaxis and treatment of diseases, in particular inflammatory, autoimmune and infectious diseases. The compositions comprise combinations of small molecules and bacterial antigens formulated in colonic delivery systems. Use of the compositions results in any or all of: induction of immune tolerance; strengthening of the gut mucosal barrier integrity; reduction of inflammation; and amelioration of a disease state caused by inflammation, an autoimmune reaction or an infectious agent.
Claims
1. A composition having an effect of inducing tolerance, strengthening gut barrier integrity, and reducing inflammation, the composition comprising: (a) one or more short-chain fatty acid or short-chain fatty acid derivative; (b) at least one GPR109 ligand; (c) at least one GPR43 ligand; (d) at least one histone-deacetylase (HDAC) inhibitor; (e) one or more antigen derived from bacteria belonging to Clostridium Cluster IV, Clostridium Cluster XIVa, or Clostridium Cluster XVIII; (f) a flagellin polypeptide; or (g) a combination of at least one of (a)-(d) and one of (e)-(f).
2. The composition of claim 1, wherein (a) is selected from the group consisting of butyrate, isobutyrate, proprionate, acetate, tributyrin, pivaloyloxymethyl butyrate, and monoacetone glucose 3-butyrate.
3. The composition of claim 1, wherein (a) is butyrate.
4. The composition of claim 1, wherein (a) is a mixture of salts of butyrate, isobutyrate, propionate, and acetate.
5. The composition of claim 1, wherein (f) is selected from the group consisting of flagellin, a flagellin-like sequence, a flagellin component, CBirl, Fla-X, FliC, FliD, FlgK, FlgC and FlgE.
6. The composition of claim 1, wherein (f) is flagellin.
7. The composition of claim 1, wherein the bacteria of (e) comprise a combination of bacteria from Clostridium Cluster IV and bacteria from Clostridium Cluster XIVa, or bacteria from Clostridium Cluster IV and bacteria from Clostridium Cluster XVIII, or bacteria from Clostridium Cluster XIVa and bacteria from Clostridium Cluster XVIII, or bacteria from Clostridium Cluster IV, bacteria from Clostridium Cluster XIVa, and bacteria from Clostridium Cluster XVIII.
8. A composition having an effect of inducing tolerance, strengthening gut barrier integrity, and reducing inflammation, the composition comprising butyrate and flagellin.
9. A composition having an effect of inducing tolerance, strengthening gut barrier integrity, and reducing inflammation, the composition comprising a mixture of salts of butyrate, isobutyrate, propionate, and acetate, and flagellin.
10. The composition of claim 1, further comprising a delivery system that directs the composition preferentially to the colonic mucosa.
11. A pharmaceutical composition comprising the composition according to claim 1 and a pharmaceutically acceptable component.
12. A method of inducing tolerance, strengthening gut barrier integrity, and reducing inflammation in an individual in need thereof, comprising administering, to the individual, the pharmaceutical composition of claim 11.
13. A method of treating, aiding in treating, reducing the severity of, or preventing at least one disease selected from an autoimmune disease, an inflammatory disease, an allergic disease, and an infectious disease in an individual in need thereof, the method comprising administering the pharmaceutical composition of claim 11 to the individual.
14. The method of claim 13, wherein the administration is with a colonic delivery system.
15. (canceled)
16. A method of determining activation of a T-cell specific to an antigen expressed by bacteria belonging to Clostridium Cluster IV, Clostridium Cluster XIVa, or Clostridium Cluster XVIII, said method comprising the steps of (a) providing a sample from a subject suspected of comprising cells that recognize said antigen; (b) contacting the sample with complexes of MHC Class II tetramers containing an epitope of said antigen; and (c) determining if binding occurs between the cells of the sample and the MHC Class II tetramers containing the epitope.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
DETAILED DESCRIPTION
I. Definitions
[0021] The term microbiota refers, collectively, to the entirety of microbes found in association with a higher organism, such as a human.
[0022] The term commensal refers to organisms that are normally harmless to a host, and can also establish mutualistic relations with said host.
[0023] The term human microbiome refers to the totality of microbes, their genetic elements (genomes), and environmental interactions in the human body
[0024] The terms tolerance and immune tolerance refer to the process by which the immune system does not attack an antigen.
[0025] The terms tolerance induction or inducing tolerance refer to a process by which tolerance to external antigens can be created by manipulating the immune system.
[0026] The term regulatory T cells or Tregs refers to T cells that suppress an abnormal or excessive immune response and play a role in immune tolerance. The regulatory T cells are typically transcription factor Foxp3-positive CD4-positive T cells. The regulatory T cells of the present invention also include transcription factor Foxp3-negative regulatory T cells that are IL-10-producing CD4-positive T cells.
[0027] The term induces proliferation or accumulation of regulatory T cells refers to an effect of inducing the differentiation of immature T cells into regulatory T cells, which differentiation leads to the proliferation and/or the accumulation of regulatory T cells. Further, the meaning of induces proliferation or accumulation of regulatory T cells includes in-vivo effects, in vitro effects, and ex vivo effects.
[0028] The term strengthening gut barrier integrity refers to a process of improving the ability of the epithelial barrier of the gastrointestinal tract to act as a barrier between the outside lumen and host tissues by reducing its permeability or leakiness. Several defects related to intestinal barrier function have been found in patients with autoimmune and inflammatory diseases. For example, a leaky gut is a primary defect in inflammatory bowel disease (IBD) pathogenesis; substances that damage the barrier, such as NSAIDs, may cause flares in IBD patients, and defects in the gut barrier are sufficient to trigger chronic gut inflammation.
II. Compositions Having Effect of Inducing Tolerance, Strengthening Gut Barrier Integrity, and Reducing Inflammation
[0029] The authors have discovered that bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII, previously shown to have the ability of inducing colonic regulatory T cells and preventing the development of IBD in animals (Atarashi et al., Science, 331(6015):337-41, 2011), produce two types of secretions that, together, synergize to induce tolerance, strengthen barrier function, and reduce inflammation. The two types of secretions are short-chain fatty acids, particularly butyrate, and protein antigens, particularly flagellin polypeptides.
[0030] Described herein are compositions that induce tolerance (e.g., induce proliferation and/or accumulation of regulatory T cells (Tregs), strengthen gut barrier integrity, and reduce inflammation. In some embodiments, the compositions comprise, as active ingredient(s), (a) one or more short-chain fatty acid or short-chain fatty acid derivative; (b) a (at least one or more) GPR109 ligand; (c) a (at least one or more) GPR43 ligand; (d) a (at least one or more) histone-deacetylase (HDAC) inhibitor; (e) one or more antigen derived from bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII; (f) a flagellin polypeptide; or (g) a combination of at least one of (a)-(d) and one of (e)-(f).
[0031] In one embodiment, the short-chain fatty acid is a substance selected from the group consisting of: butyrate, isobutyrate, propionate, and acetate. Such molecules are naturally produced in large amounts by bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster IVa, or Clostridium Cluster VIII in the human colon. In a preferred embodiment, the short-chain fatty acid substance is butyrate. Synthetic derivatives of butyrate with similar properties as their natural counterpart such as tributyrin, pivaloyloxymethyl butyrate, and monoacetone glucose 3-butyrate can also be used to that effect.
[0032] A composition containing a mixture of sodium acetate, sodium propionate, sodium butyrate, and sodium isobutyrate, can optimally promote the production of active-form TGF- in culture supernatants of epithelial cell lines. In turn, an environment rich in active-form TGF- helps expansion and differentiation of Tregs, reduces inflammation, and strengthens the gut barrier integrity.
[0033] In one embodiment, substances that bind to GPR109A can be used as a component of the compositions described herein. GPR109A is a G-protein-coupled receptor expressed in the lumen-facing apical membrane of colonic and intestinal epithelial cells that recognizes butyrate with low affinity, as previously shown in the art. Typical concentrations of butyrate in colonic lumen (millimolar) are sufficient to activate the receptor maximally. GPR109A-binding substances used as components of the compositions described herein can be selected from the group consisting of: pyridine-3-carboxylic acid (also known as niacin or Vitamin B3), a niacin derivative, 4,5-Dihydro-5-methyl-4-oxo-5-phenyl-2-furancarboxylic acid, 5-carboxy-2-methyl-1-oxidopyrazin-1-ium, GSK-256073, GSK256073, ARI-3037MO, INCB019602, INCB19602, MK-0354, MK-0354, a barbituric acid derivative, an anthranilic acid derivative, a pyrazole derivative, an isoxazole derivative, a xanthine derivative, a cycloalkane derivative, a pyrazolopyrimidine, and a thyophene.
[0034] In one embodiment, substances that bind to GPR43 can be used as a component of the compositions described herein. GPR43 is a G-protein-coupled receptor that recognizes acetate and propionate. GPR43-binding substances used as components of the compositions described herein can be selected from the group consisting of: acetate, formate, phenylacetamide 1 [(S)-2-(4-chlorophenyl)-3-methyl-N-(thiazol-2-yl) butanamide], phenylacetamide 2 [(S)-2-(4-chlorophenyl)-N-(5-fluorothiazol-2-yl)-3-methylbutanamide], propionate, and valerate.
[0035] In one embodiment, substances that inhibit a histone deacetylase (HDAC) can be used as a component of the compositions described herein. Treatment of nave T cells with butyrate enhances histone H3 acetylation in the Foxp3 gene locus and butyrate thus regulates differentiation of Treg cells by mediating epigenetic modifications. HDAC inhibiting substances used as components of the compositions described herein can be selected from the group consisting of: trichostatin A, (N-(2-aminophenyl)-N-phenyl-octanediamide), 2-(4-butoxyphenyl)-N-hydroxyacetamide, MS-275, suberoylanilide hydroxamic acid, and RG 2833.
[0036] Production of short-chain fatty acids alone does not fully account for the ability of bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster IVa, or Clostridium Cluster VIII to induce tolerance, strengthen barrier function, and reduce inflammation. Antigens expressed by bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster IVa, or or Clostridium Cluster VIII also contribute to induce tolerance, strengthen barrier function, and reduce inflammation. In some embodiments, the compositions described herein contain one or more bacterial antigen selected from the group consisting of: one or more heat treated inactivated bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII or any combination of bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII; a purified membrane fraction from one or more bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII or any combination of bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII, flagellin, a flagellin-like sequence, a flagellin component protein, CBirl, Fla-X, FliC, FliD, FlgK, FlgC, and FlgE. Purified membrane fractions refer to bacterial membranes that have been at least partially purified from other components of a bacterial cell. Purified membrane fractions from bacteria belonging Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII can be obtained by using methods known in the art such as mechanical grinding of bacterial cells followed by ultracentrifugation and followed by extraction with trifluoroethanol and chloroform. In a preferred embodiment, a purified membrane fraction is obtained from one or more bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII any combination of bacteria belonging to Clostridium Cluster IV, or Clostridium Cluster XIVa, or Clostridium Cluster XVIII, selected from Clostridium saccharogumia, Clostridium ramosum JCM1298, Clostridium ramosum, Flavonifractor plautii, Pseudoflavonifractor capillosus ATCC 29799, Clostridium hathewayi, Clostridium saccharolyticum WM1, Bacteroides sp. MANG, Clostridium saccharolyticum, Clostridium scindens, Lachnospiraceae bacterium 5_1_57FAA, Lachnospiraceae bacterium 6_1_63FAA, Clostridium sp. 14616, Clostridium bolteae ATCC BAA-613, cf. Clostridium sp. MLG055, Erysipelotrichaceae bacterium 2_2_44A, Clostridium indolis, Anaerostipes caccae, Clostridium bolteae, Lachnospiraceae bacterium DJF_VP30, Lachnospiraceae bacterium 3_1_57FAA_CT1, Anaerotruncus colihominis, Anaerotruncus colihominis DSM 17241, Ruminococcus sp. IDB, Lachnospiraceae bacterium 2_1_46FAA, Clostridium lavalense, Clostridium asparagiforme DSM 15981, Clostridium symbiosum, Clostridium symbiosum WAL-14163, Eubacterium contortum, Clostridium sp. D5, Oscillospiraceae bacterium NML 061048, Oscillibacter valericigenes, Lachnospiraceae bacterium A4, Clostridium sp. 316002/08, and Clostridiales bacterium 1_7_47FAA, Blautia cocoides, and Anaerostipes caccae DSM 14662. Flagellin proteins are abundantly produced by bacteria belonging to Clostridium Clusters IV, XIVa, and XVIII. Flagellin, flagellin-like sequences, flagellin component proteins, and flagellin polypeptides can be manufactured using methods known in the art including, for example, production in bacterial recombinant hosts or liquid-phase or solid-phase peptide synthesis.
[0037] The composition may be administered in the form of a pharmaceutical composition, a dietary supplement, or a food or beverage (which may also be an animal feed), or may be used as a reagent for an animal model experiment. The composition can be used suitably as a composition having an immunosuppressive effect. The immunosuppressive effect can be evaluated, for example, as follows. Regulatory T cells isolated from an experimental animal, such as a mouse, to which the composition of the present invention is orally administered are caused to act on effector T-cells (CD4+ CD25 cells) isolated from the spleen, and the proliferation ability thereof is measured by using the intake amount of [3H]-thymidine as an index.
[0038] Specific examples of target diseases for which the composition is useful for treatment (reducing adverse effects or prevention) include autoimmune diseases, allergic diseases, infectious diseases, and rejection in organ transplantations, such as inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, sprue, autoimmune arthritis, rheumatoid arthritis, Type I diabetes, multiple sclerosis, graft vs. host disease following bone marrow transplantation, osteoarthritis, juvenile chronic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondy loarthropathy, systemic lupus erythematosus, insulin dependent diabetes mellitus, thyroiditis, asthma, psoriasis, dermatitis scleroderma, atopic dermatitis, graft versus host disease, acute or chronic immune disease associated with organ transplantation, sarcoidosis, atherosclerosis, disseminated intravascular coagulation, Kawasaki's disease, Grave's disease, nephrotic syndrome, chronic fatigue syndrome, Wegener's granulomatosis, Henoch-Schoenlejn purpurea, microscopic vasculitis of the kidneys, chronic active hepatitis, uveitis, septic shock, toxic shock syndrome, sepsis syndrome, cachexia, acquired immunodeficiency syndrome, acute transverse myelitis, Huntington's chorea, Parkinson's disease, Alzheimer's disease, stroke, primary biliary cirrhosis, hemolytic anemia, polyglandular deficiency type I syndrome and polyglandular deficiency type II syndrome, Schmidt's syndrome, adult (acute) respiratory distress syndrome, alopecia, alopecia areata, seronegative arthopathy, arthropathy, Reiter's disease, psoriatic arthropathy, chlamydia, yersinia and salmonella associated arthropathy, spondyloarhopathy, atheromatous disease/arteriosclerosis, allergic colitis, atopic allergy, food allergies such as peanut allergy, tree nut allergy, egg allergy, milk allergy, soy allergy, wheat allergy, seafood allergy, shellfish allergy, or sesame seed allergy, autoimmune bullous disease, pemphigus vulgaris, pemphigus foliaceus, pemphigoid, linear IgA disease, autoimmune haemolytic anaemia, Coombs positive haemolytic anaemia, acquired pernicious anaemia, juvenile pernicious anaemia, myalgic encephalitis/Royal Free Disease, chronic mucocutaneous candidiasis, giant cell arteritis, primary sclerosing hepatitis, cryptogenic autoimmune hepatitis, Acquired Immunodeficiency Disease Syndrome, Acquired Immunodeficiency Related Diseases, Hepatitis C, common varied immunodeficiency (common variable hypogammaglobulinaemia), dilated cardiomyopathy, fibrotic lung disease, cryptogenic fibrosing alveolitis, postinflammatory interstitial lung disease, interstitial pneumonitis, connective tissue disease associated interstitial lung disease, mixed connective tissue disease associated lung disease, systemic sclerosis associated interstitial lung disease, rheumatoid arthritis associated interstitial lung disease, systemic lupus erythematosus associated lung disease, dermatomyositis/polymyositis associated lung disease, Sjogren's disease associated lung disease, ankylosing spondy litis associated lung disease, vasculitic diffuse lung disease, haemosiderosis associated lung disease, drug-induced interstitial lung disease, radiation fibrosis, bronchiolitis obliterans, chronic eosinophilic pneumonia, lymphocytic infiltrative lung disease, postinfectious interstitial lung disease, gouty arthritis, autoimmune hepatitis, type-1 autoimmune hepatitis (classical autoimmune or lupoid hepatitis), type-2 autoimmune hepatitis (anti-LKM antibody hepatitis), autoimmune mediated hypoglycemia, type B insulin resistance with acanthosis nigricans, hypoparathyroidism, acute immune disease associated with organ transplantation, chronic immune disease associated with organ transplantation, osteoarthrosis, primary sclerosing cholangitis, idiopathic leucopenia, autoimmune neutropenia, renal disease NOS, glomerulonephritides, microscopic vasulitis of the kidneys, discoid lupus, erythematosus, male infertility idiopathic or NOS, sperm autoimmunity, multiple sclerosis (all subtypes), insulindependent diabetes mellitus, sympathetic ophthalmia, pulmonary hypertension secondary to connective tissue disease, Goodpasture's syndrome, pulmonary manifestation of polyarteritis nodosa, acute rheumatio fever, rheumatoid spondylitis, Still's disease, systemic sclerosis, Takayasu's disease/arteritis, autoimmune thrombocytopenia, idiopathic thrombocytopenia, autoimmune thyroid disease, hyperthyroidism, goitrous autoimmune hypothyroidism (Hashimoto's disease), atrophic autoimmune hypothyroidism, primary myxoedema, phacogenic uveitis, primary vasculitis, vitiligo, allergic rhinitis (pollen allergies), anaphylaxis, pet allergies, latex allergies, drug allergies, allergic rhinoconjuctivitis, eosinophilic esophagitis, hypereosinophilic syndrome, eosinophilic gastroenteritis cutaneous lupus erythematosus, eosinophilic esophagitis, hypereosinophilic syndrome, and eosinophilic gastroenteritis, and diarrhea.
[0039] Additional examples of target diseases for which the composition is useful for treatment include colon cancer, cystic fibrosis, celiac disease, Type 2 diabetes, and autism-related immunopathologies. These diseases are characterized by a reduction of bacteria belonging to Clostridium Clusters IV and XIV, or a reduction of bacteria belonging to Clostridium Cluster IV or Clostridium Cluster XIV, in the gastrointestinal microbiota.
[0040] Compositions described herein can also be used as a pharmaceutical composition for preventing or treating infectious diseases in an individual whose resistance to the infectious diseases is impaired, for example because of damage due to excessive inflammation caused by the immunity or due to an alteration of the patient's microbiome. Examples of infectious pathogens that impair maintenance or recovery of homeostasis of a host, and which eventually bring about such immunopathological tissue damage include Salmonella, Shigella, Clostridium difficile, Mycobacterium (which cause the disease tuberculosis), protozoa (which cause malaria), filarial nematodes (which cause the disease filariasis), Schistosoma (which cause schistosomiasis), Toxoplasma (which cause the disease toxoplasmosis), Leishmania (which cause the disease leishmaniasis), HCV and HBV (which cause the disease hepatitis C and hepatitis B), and herpes simplex viruses (which cause the disease herpes).
[0041] The amount of the composition to be administered or ingested can be determined empirically, taking into consideration such factors as the age, body weight, gender, symptoms, health conditions, of an individual who will receive it, as well as the kind of composition (a pharmaceutical product, a food or beverage) to be administered or ingested. For example, the amount per administration or ingestion is generally 0.01 mg/kg body weight to 100 mg/kg body weight, and, in specific embodiments, 1 mg/kg body weight to 10 mg/kg body weight. The composition may be administered to an individual once, or it may be administered more than once. If the composition is administered more than once, it can be administered on a regular basis (for example, once a day, once every two days, once a week, once every two weeks, once a month, once every 6 months, or once a year) or on an as needed or irregular basis. The appropriate frequency of administration (which may depend on host genetics, age, gender, and health or disease status of the subject, among other factors) may be determined empirically.
III. Delivery Systems
[0042] The combined effects of Clostridium-derived short-chain fatty acids and Clostridium-derived antigens on induction of tolerance, gut barrier integrity, and reduction of inflammation are strongly dependent on physical proximity of these substances to the gut barrier. In a physiological context, these substances are typically secreted by bacteria that live in close proximity to the colonic intestinal wall. If the Clostridium-derived short-chain fatty acids and Clostridium-derived antigens are administered orally to a subject without being formulated in a colonic delivery system, they have limited or inadequate efficacy because the Clostridium-derived antigens are degraded by proteases during passage in the gastrointestinal tract and the short-chain fatty acids are rapidly absorbed in the small intestine before reaching the colon. Formulating the compositions described herein in delivery systems that preferentially target their release to colonic tissue greatly enhances the ability of the compositions to induce tolerance, increase gut barrier integrity, and reduce of inflammation.
[0043] General Strategies to Enable Delivery to the Colon
[0044] Numerous methods have been described in the art to enable general delivery of drugs to the colon, and any of them can be combined with the novel features of this invention to improve delivery to a niche in the colon. Such methods include pH-sensitive formulations (e.g., formulations coated with enteric polymers that release drug when the pH move towards a more alkaline range, after passage through the stomach); formulations that delay the release of the drug for a lag time of 3-5 hours, roughly equivalent to small intestinal transit time, thereby securing delivery to the colon; drugs coated with bioadhesive polymers that selectively provide adhesion to the colonic mucosa (e.g., see U.S. Pat. No. 6,368,586); delivery systems that incorporate protease inhibitors to prevent proteolytic activity in the gastrointestinal tract from degrading biologic drug agents; and formulations containing molecules that target receptors preferentially expressed in dendritic cells, such as CD205 Dendritic-Cell Specific Intercellular Adhesion Molecule 3-Grabbing Nonintegrin (DC-SIGN) and Langerin, receptors preferentially expressed in intestinal epithelial cells, and receptors preferentially expressed in macrophages such as anionic lipids, muramyl tripeptide (MTP), Arg-Gly-Asp (RGD), anti-VCAM-1, Anti-CC52, Anti-CC531, Ancti-CD11c/DEC-205, lectins (such as Mann-C4-Chol, Man2DOG, aminophenyl-alfa-D-mannopyranoside, Man3-DPPE), bovine serum albumin derivatives, O-steroly amylopectin, fibronectin, and galactosyl.
[0045] Formulations are prepared using a pharmaceutically acceptable carrier composed of materials that are considered safe and effective and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. The carrier is all components present in the pharmaceutical formulation other than the active ingredient or ingredients. The term carrier includes but is not limited to diluents, binders, lubricants, desintegrators, fillers, and coating compositions. Carrier also includes all components of the coating composition which may include plasticizers, pigments, colorants, stabilizing agents, and glidants. The delayed release dosage formulations may be prepared as described in references such as Pharmaceutical dosage form tablets, eds. Liberman et. al. (New York, Marcel Dekker, Inc., 1989), RemingtonThe science and practice of pharmacy, 20th ed., Lippincott Williams & Wilkins, Baltimore, Md., 2000, and Pharmaceutical dosage forms and drug delivery systems, 6th Edition, Ansel et.al., (Media, Pa.: Williams and Wilkins, 1995) which provides information on carriers, materials, equipment and process for preparing tablets and capsules and delayed release dosage forms of tablets, capsules, and granules.
[0046] Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins that are commercially available under the trade name Eudragit (Roth Pharma, Westerstadt, Germany), Zein, shellac, and polysaccharides.
[0047] Additionally, the coating material may contain conventional carriers such as plasticizers, pigments, colorants, glidants, stabilization agents, pore formers and surfactants.
[0048] Optional pharmaceutically acceptable excipients present in the drug-containing tablets, beads, granules or particles include, but are not limited to, diluents, binders, lubricants, disintegrants, colorants, stabilizers, and surfactants. Diluents, also termed fillers, are typically necessary to increase the bulk of a solid dosage form so that a practical size is provided for compression of tablets or formation of beads and granules. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starches, pregelatinized starch, silicone dioxide, titanium oxide, magnesium aluminum silicate and powder sugar.
[0049] Binders are used to impart cohesive qualities to a solid dosage formulation, and thus ensure that a tablet or bead or granule remains intact after the formation of the dosage forms. Suitable binder materials include, but are not limited to, starch, pregelatinized starch, gelatin, sugars (including sucrose, glucose, dextrose, lactose and sorbitol), polyethylene glycol, waxes, natural and synthetic gums such as acacia, tragacanth, sodium alginate, cellulose, including hydorxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, and veegum, and synthetic polymers such as acrylic acid and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid/polymethacrylic acid and polyvinylpyrrolidone.
[0050] Lubricants are used to facilitate tablet manufacture. Examples of suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glycerol behenate, polyethylene glycol, talc, and mineral oil.
[0051] Disintegrants are used to facilitate dosage form disintegration or breakup after administration, and generally include, but are not limited to, starch, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethylcellulose, hydroxypropyl cellulose, pregelatinized starch, clays, cellulose, alginine, gums or cross linked polymers, such as cross-linked PVP (Polyplasdone XL from GAF Chemical Corp).
[0052] Stabilizers are used to inhibit or retard drug decomposition reactions which include, by way of example, oxidative reactions.
[0053] Surfactants may be anionic, cationic, amphoteric or nonionic surface active agents. Suitable anionic surfactants include, but are not limited to, those containing carboxylate, sulfonate and sulfate ions. Examples of anionic surfactants include sodium, potassium, ammonium of long chain alkyl sulfonates and alkyl aryl sulfonates such as sodium dodecylbenzene sulfonate; dialkyl sodium sulfosuccinates, such as sodium dodecylbenzene sulfonate; dialkyl sodium sulfosuccinates, such as sodium bis-(2-ethylthioxyl)-sulfosuccinate; and alkyl sulfates such as sodium lauryl sulfate. Cationic surfactants include, but are not limited to, quaternary ammonium compounds such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyl dimethylbenzyl ammonium chloride, polyoxyethylene and coconut amine. Examples of nonionic surfactants include ethylene glycol monostearate, propylene glycol myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4-oleate, sorbitan acylate, sucrose acylate, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbates, polyoxyethylene octylphenylether, PEG-1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, Poloxamer 401, stearoyl monoisopropanolamide, and polyoxyethylene hydrogenated tallow amide. Examples of amphoteric surfactants include sodium N-dodecyl-.beta.-alanine, sodium N-lauryl-.beta.-iminodipropionate, myristoamphoacetate, lauryl betaine and lauryl sulfobetaine.
[0054] If desired, the tablets, beads granules or particles may also contain minor amount of nontoxic auxiliary substances such as wetting or emulsifying agents, dyes, pH buffering agents, and preservatives.
[0055] As will be appreciated by those skilled in the art and as described in the pertinent texts and literature, a number of methods are available for preparing drug-containing tablets, beads, granules or particles that provide a variety of drug release profiles. Such methods include, but are not limited to, the following: coating a drug or drug-containing composition with an appropriate coating material, typically although not necessarily incorporating a polymeric material, increasing drug particle size, placing the drug within a matrix, and forming complexes of the drug with a suitable complexing agent.
[0056] The delayed release dosage units may be coated with the delayed release polymer coating using conventional techniques, e.g., using a conventional coating pan, an airless spray technique, fluidized bed coating equipment (with or without a Wurster insert), or the like. For detailed information concerning materials, equipment and processes for preparing tablets and delayed release dosage forms, see Pharmaceutical Dosage Forms: Tablets, eds. Lieberman et al. (New York: Marcel Dekker, Inc., 1989), and Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 6.sup.th Ed. (Media, Pa.: Williams & Wilkins, 1995).
[0057] A preferred method for preparing extended release tablets is by compressing a drug-containing blend, e.g., blend of granules, prepared using a direct blend, wet-granulation, or dry-granulation process. Extended release tablets may also be molded rather than compressed, starting with a moist material containing a suitable water-soluble lubricant. However, tablets are preferably manufactured using compression rather than molding. A preferred method for forming extended release drug-containing blend is to mix drug particles directly with one or more excipients such as diluents (or fillers), binders, disintegrants, lubricants, glidants, and colorants. As an alternative to direct blending, a drug-containing blend may be prepared by using wet-granulation or dry-granulation processes. Beads containing the active agent may also be prepared by any one of a number of conventional techniques, typically starting from a fluid dispersion. For example, a typical method for preparing drug-containing beads involves dispersing or dissolving the active agent in a coating suspension or solution containing pharmaceutical excipients such as polyvinylpyrrolidone, methylcellulose, talc, metallic stearates, silicone dioxide, plasticizers or the like. The admixture is used to coat a bead core such as a sugar sphere (or so-called non-pareil) having a size of approximately 60 to 20 mesh.
[0058] An alternative procedure for preparing drug beads is by blending drug with one or more pharmaceutically acceptable excipients, such as microcrystalline cellulose, lactose, cellulose, polyvinyl pyrrolidone, talc, magnesium stearate, a disintegrant, etc., extruding the blend, spheronizing the extrudate, drying and optionally coating to form the immediate release beads.
[0059] Delayed release formulations are created by coating a solid dosage form with a film of a polymer which is insoluble in the acid environment of the stomach, and soluble in the neutral environment of small intestines. The delayed release dosage units can be prepared, for example, by coating a drug or a drug-containing composition with a selected coating material. The drug-containing composition may be, e.g., a tablet for incorporation into a capsule, a tablet for use as an inner core in a coated core dosage form, or a plurality of drug-containing beads, particles or granules, for incorporation into either a tablet or capsule. Preferred coating materials include bioerodible, gradually hydrolyzable, gradually water-soluble, and/or enzymatically degradable polymers, and may be conventional enteric polymers. Enteric polymers, as will be appreciated by those skilled in the art, become soluble in the higher pH environment of the lower gastrointestinal tract or slowly erode as the dosage form passes through the gastrointestinal tract, while enzymatically degradable polymers are degraded by bacterial enzymes present in the lower gastrointestinal tract, particularly in the colon. Suitable coating materials for effecting delayed release include, but are not limited to, cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxymethyl cellulose, hydroxypropyl methyl cellulose, hydroxypropyl methyl cellulose acetate succinate, hydroxypropylmethyl cellulose phthalate, methylcellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate and carboxymethylcellulose sodium; acrylic acid polymers and copolymers, preferably formed from acrylic acid, methacrylic acid, methyl acrylate, ethyl acrylate, methyl methacrylate and/or ethyl methacrylate, and other methacrylic resins that are commercially available under the tradename Eudragit. (Rohm Pharma; Westerstadt, Germany), including Eudragit. L30D-55 and L100-55 (soluble at pH 5.5 and above), Eudragit. L-100 (soluble at pH 6.0 and above), Eudragit. S (soluble at pH 7.0 and above, as a result of a higher degree of esterification), and Eudragits. NE, RL and RS (water-insoluble polymers having different degrees of permeability and expandability); vinyl polymers and copolymers such as polyvinyl pyrrolidone, vinyl acetate, vinylacetate phthalate, vinylacetate crotonic acid copolymer, and ethylene-vinyl acetate copolymer; enzymatically degradable polymers such as azo polymers, pectin, chitosan, amylose and guar gum; zein and shellac. Combinations of different coating materials may also be used. Multi-layer coatings using different polymers may also be applied.
[0060] The coating composition may include conventional additives, such as plasticizers, pigments, colorants, stabilizing agents, glidants, etc. A plasticizer is normally present to reduce the fragility of the coating, and will generally represent about 10 wt. % to 50 wt. % relative to the dry weight of the polymer. Examples of typical plasticizers include polyethylene glycol, propylene glycol, triacetin, dimethyl phthalate, diethyl phthalate, dibutyl phthalate, dibutyl sebacate, triethyl citrate, tributyl citrate, triethyl acetyl citrate, castor oil and acetylated monoglycerides. A stabilizing agent is preferably used to stabilize particles in the dispersion. Typical stabilizing agents are nonionic emulsifiers such as sorbitan esters, polysorbates and polyvinylpyrrolidone. Glidants are recommended to reduce sticking effects during film formation and drying, and will generally represent approximately 25 wt. % to 100 wt. % of the polymer weight in the coating solution. One effective glidant is talc. Other glidants such as magnesium stearate and glycerol monostearates may also be used. Pigments such as titanium dioxide may also be used. Small quantities of an anti-foaming agent, such as a silicone (e.g., simethicone), may also be added to the coating composition.
[0061] The particles can be prepared entirely from a therapeutic agent, or from a combination of the agent and a surfactant. The particles can be made of a variety of materials. Both inorganic and organic materials can be used. For example, ceramics may be used. Polymeric and non-polymeric materials, such as fatty acids, may be used to form aerodynamically light particles. Other suitable materials include, but are not limited to, gelatin, polyethylene glycol, trehalose, and dextran. Particles with degradation and release times ranging from seconds to months can be designed and fabricated, based on factors such as the particle material.
[0062] In addition to a therapeutic or diagnostic agent (or possibly other desired molecules for delivery), the particles can include excipients such as a sugar, such as lactose, a protein, such as albumin, and/or a surfactant.
[0063] Enteric Coated Capsules: Gastric resistant natural polymer, as used herein, refers to natural polymers or mixtures of natural polymers which are insoluble in the acidic pH of the stomach. Film-forming natural polymer, as used herein, refers to polymers useful for surface coatings that are applied by spraying, brushing, or various industrial processes, which undergo film formation. In most film-formation processes, a liquid coating of relatively low viscosity is applied to a solid substrate and is cured to a solid, high-molecular-weight, polymer-based adherent film possessing the properties desired by the user. For most common applications, this film has a thickness ranging from 0.5 to 500 micrometers (0.0005 to 0.5 millimeters, or 0.00002 to 0.02 inches).
[0064] Gelling agent, as used herein, refers to substances that undergo a high degree of cross-linking or association when hydrated and dispersed in the dispersing medium, or when dissolved in the dispersing medium. This cross-linking or association of the dispersed phase alters the viscosity of the dispersing medium. The movement of the dispersing medium is restricted by the dispersed phase, and the viscosity is increased.
[0065] Gastric resistant film-forming compositions containing (1) a gastric resistant natural polymer; (2) a film-forming natural polymer; and optionally (3) a gelling agent, are described herein. Exemplary gastric resistant natural polymers include, but are not limited to, pectin and pectin-like polymers which typically consist mainly of galacturonic acid and galacturonic acid methyl ester units forming linear polysaccharide chains. Typically these polysaccharides are rich in galacturonic acid, rhamnose, arabinose and galactose, for example the polygalacturonans, rhamnogalacturonans and some arabinans, galactans and arabinogalactans. These are normally classified according to the degree of esterification. In high (methyl) ester (HM) pectin, a relatively high portion of the carboxyl groups occur as methyl esters, and the remaining carboxylic acid groups are in the form of the free acid or as its ammonium, potassium, calcium or sodium salt. Useful properties may vary with the degree of esterification and with the degree of polymerization. Pectin, in which less than 50% of the carboxyl acid units occur as the methyl ester, is normally referred to as low (methyl) ester or LM-pectin. In general, low ester pectin is obtained from high ester pectin by treatment at mild acidic or alkaline conditions. Amidated pectin is obtained from high ester pectin when ammonia is used in the alkaline deesterification process. In this type of pectin some of the remaining carboxylic acid groups have been transformed into the acid amide. The useful properties of amidated pectin may vary with the proportion of ester and amide units and with the degree of polymerization. In one embodiment, the gastric resistant natural polymer is pectin. The gastric resistant natural polymer is present in an amount less than about 5% by weight of the composition, preferably from about 2 to about 4% by weight of the composition.
[0066] Exemplary film-forming natural polymers include, but are not limited to, gelatin and gelatin-like polymers. In a preferred embodiment, the film-forming natural polymer is gelatin. A number of other gelatin-like polymers are available commercially. The film-forming natural polymer is present in an amount from about 20 to about 40% by weight of the composition, preferably from about 25 to about 40% by weight of the composition. The compositions can optionally contain a gelling agent. Exemplary gelling agents include divalent cations such as Ca.sup.2+ and Mg.sup.2+. Sources of these ions include inorganic calcium and magnesium salts and calcium gelatin. The gelling agent is present in an amount less than about 2% by weight of the composition, preferably less than about 1% by weight of the composition.
[0067] One or more plasticizers can be added to the composition to facilitate the film-forming process. Suitable plasticizers include glycerin, sorbitol, sorbitans, maltitol, glycerol, polyethylene glycol, polyalcohols with 3 to 6 carbon atoms, citric acid, citric acid esters, triethyl citrate and combinations thereof. The concentration of the one or more plasticizers is from about 8% to about 30% by weight of the composition. In one embodiment, the plasticizer is glycerin and/or sorbitol.
[0068] The film-forming composition can be used to prepare soft or hard shell gelatin capsules which can encapsulate a liquid or semi-solid fill material or a solid tablet (Softlet) containing an active agent and one or more pharmaceutically acceptable excipients. Alternatively, the composition can be administered as a liquid with an active agent dissolved or dispersed in the composition.
[0069] The film-forming composition can be used to prepare soft or hard capsules using techniques well known in the art. For example, soft capsules are typically produced using a rotary die encapsulation process. Fill formulations are fed into the encapsulation machine by gravity.
[0070] The capsule shell can contain one or more plasticizers selected from the group consisting of glycerin, sorbitol, sorbitans, maltitol, glycerol, polyethylene glycol, polyalcohols with 3 to 6 carbon atoms, citric acid, citric acid esters, triethyl citrate and combinations thereof.
[0071] In addition to the plasticizer(s), the capsule shell can include other suitable shell additives such as opacifiers, colorants, humectants, preservatives, flavorings, and buffering salts and acids.
[0072] Opacifiers are used to opacify the capsule shell when the encapsulated active agents are light sensitive. Suitable opacifiers include titanium dioxide, zinc oxide, calcium carbonate and combinations thereof.
[0073] Colorants can be used to for marketing and product identification/differentiation purposes. Suitable colorants include synthetic and natural dyes and combinations thereof.
[0074] Humectants can be used to suppress the water activity of the softgel. Suitable humectants include glycerin and sorbitol, which are often components of the plasticizer composition. Due to the low water activity of dried, properly stored softgels, the greatest risk from microorganisms comes from molds and yeasts. For this reason, preservatives can be incorporated into the capsule shell. Suitable preservatives include alkyl esters of p-hydroxy benzoic acid such as methyl, ethyl, propyl, butyl and heptyl (collectively known as parabens) or combinations thereof.
[0075] Flavorings can be used to mask unpleasant odors and tastes of fill formulations. Suitable flavorings include synthetic and natural flavorings. The use of flavorings can be problematic due to the presence of aldehydes which can cross-link gelatin. As a result, buffering salts and acids can be used in conjunction with flavorings that contain aldehydes in order to inhibit cross-linking of the gelatin.
[0076] Soft or hard capsules can be used to deliver a wide variety of pharmaceutically active agents. Suitable agents include small molecules, proteins, nucleic acid, carbohydrates, lipids, and full organisms.
[0077] Fill formulations may be prepared using a pharmaceutically acceptable carrier composed of materials that are considered safe and effective and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. The carrier is all components present in the pharmaceutical formulation other than the active ingredient or ingredients. As generally used herein carrier includes, but is not limited to surfactants, humectants, plasticizers, crystallization inhibitors, wetting agents, bulk filling agents, solubilizers, bioavailability enhancers, pH adjusting agents, and combinations thereof.
[0078] Alternatively, the composition can be administered as a liquid with an active agent dissolved (e.g. solution) or dispersed (e.g., suspension) in the composition. Suitable active agents are described above. The solution or suspension may be prepared using one or more pharmaceutically acceptable excipients. Suitable excipients include, but are not limited to, surfactants, humectants, plasticizers, crystallization inhibitors, wetting agents, bulk filling agents, solubilizers, bioavailability enhancers, pH adjusting agents, flavorants and combinations thereof
[0079] Mucoadhesive Particles and methods of manufacturing: In general terms, adhesion of polymers to tissues may be achieved by (i) physical or mechanical bonds, (ii) primary or covalent chemical bonds, and/or (iii) secondary chemical bonds (e.g., ionic). Physical or mechanical bonds can result from deposition and inclusion of the adhesive material in the crevices of the mucus or the folds of the mucosa. Secondary chemical bonds, contributing to bioadhesive properties, consist of dispersive interactions (e.g., Van der Waals interactions) and stronger specific interactions, which include hydrogen bonds. The hydrophilic functional groups responsible for forming hydrogen bonds are the hydroxyl (OH) and the carboxylic groups (COOH).
[0080] Adhesive polymeric microspheres have been selected on the basis of the physical and chemical bonds formed as a function of chemical composition and physical characteristics, such as surface area, as described in detail below. These microspheres are characterized by adhesive forces to mucosa of greater than 11 mN/cm.sup.2. The size of these microspheres range from between a nanoparticle to a millimeter in diameter. The adhesive force is a function of polymer composition, biological substrate, particle morphology, particle geometry (e.g., diameter) and surface modification.
[0081] Classes of Polymers Useful in Forming Bioadhesive Microspheres: Suitable polymers that can be used to form bioadhesive microspheres include soluble and insoluble, biodegradable and nonbiodegradable polymers. These can be hydrogels or thermoplastics, homopolymers, copolymers or blends, natural or synthetic. A key feature, however, is that the polymer must produce a bioadhesive interaction between 110 N/m2 (11 mN/cm2) and 100,000 N/m2 when applied to the mucosal surface of rat intestine.
[0082] In order for bioadhesive particles to embed themselves or become engulfed in the mucus lining the GI tract, the radius of the individual particles should be as thick as the thickness of the natural mucous layer. It has been shown that the gastric mucous layer thickness typically varies from 5 to 200 in the rat and 10 to 400 in man. Occasionally, however, it can reach thicknesses as great as 1000 in man, as described by Spiro, R. G., Glycoproteins, Annual Review of Biochemistry, 39, 599-638, 1970; Labat-Robert, J. & Decaeus, C., Glycoproteins du Mucus Gastrique: Structure, Fonction, et Pathologie, Pathologie et Biologie (Paris), 24, 241, 1979; Allen, A., Hutton, D. A., Pearson, J. P., & Sellers, L. A., Mucus Glycoprotein Structure, Gel Formation and Gastrointestinal Mucus Function in Mucus and Mucosa, Ciba Foundation Symposium 109 (eds. J. Nugent & M. O'Connor), pp. 137 (London: Pitman, 1984). In the past, two classes of polymers have appeared to show useful bioadhesive properties: hydrophilic polymers and hydrogels. In the large class of hydrophilic polymers, those containing carboxylic groups (e.g., poly[acrylic acid]) exhibit the best bioadhesive properties. One could infer that polymers with the highest concentrations of carboxylic groups should be the materials of choice for bioadhesion on soft tissues. In other studies, the most promising polymers were: sodium alginate, carboxymethylcellulose, hydroxymethylcellulose and methylcellulose. Some of these materials are water-soluble, while others are hydrogels.
[0083] Rapidly bioerodible polymers such as poly[lactide-co-glycolide], polyanhydrides, and polyorthoesters, whose carboxylic groups are exposed on the external surface as their smooth surface erodes, are excellent candidates for bioadhesive drug delivery systems. In addition, polymers containing labile bonds, such as polyanhydrides and polyesters, are well known for their hydrolytic reactivity. Their hydrolytic degradation rates can generally be altered by simple changes in the polymer backbone.
[0084] Representative natural polymers include proteins, such as zein, modified zein, casein, gelatin, gluten, serum albumin, or collagen, and polysaccharides, such as cellulose, dextrans, polyhyaluronic acid, polymers of acrylic and methacrylic esters and alginic acid. Representative synthetic polymers include polyphosphazines, poly(vinyl alcohols), polyamides, polycarbonates, polyalkylenes, polyacrylamides, polyalkylene glycols, polyalkylene oxides, polyalkylene terephthalates, polyvinyl ethers, polyvinyl esters, polyvinyl halides, polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof. Synthetically modified natural polymers include alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, and nitrocelluloses. Other polymers of interest include, but are not limited to, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxymethyl cellulose, cellulose triacetate, cellulose sulfate sodium salt, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butyl methacrylate), poly(isobutyl methacrylate), poly(hexyl methacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) polyethylene, polypropylene, poly(ethylene glycol), poly(ethylene oxide), poly (ethylene terephthalate), poly(vinyl acetate), polyvinyl chloride, polystyrene, polyvinyl pyrrolidone, and polyvinylphenol. Representative bioerodible polymers include polylactides, polyglycolides and copolymers thereof, poly(ethylene terephthalate), poly(butic acid), poly(valeric acid), poly(lactide-co-caprolactone), poly[lactide-co-glycolide], polyanhydrides, polyorthoesters, blends and copolymers thereof.
IV. Engineered Bacteria Expressing a Clostridium Antigen and Short-Chain Fatty Acids
[0085] Described herein are engineered organisms that express at least one Clostridium-derived antigen and at least one short-chain fatty acid. In a preferred embodiment, the Clostridium-derived antigen is flagellin and the short-chain fatty acid is butyrate. The organism may be a genetically engineered bacteria or a genetically engineered yeast. Preferably, the organism is a genetically engineered bacteria, such as a bacteria belonging to the genus Clostridium, a lactic acid bacteria, or E. coli. In a preferred embodiment, said organism is a Gram positive organism belonging to Clostridium Clusters IV or XIVa. Said organism is able to express at least on antigen and at least one short-chain fatty acid in vivo in the colonic mucosa of an animal. For example, PCR fragments containing the coding regions of flagellin (e.g., GenBank accession numbers AY551005 aor AY551006) and of enzymes involved in the synthesis of butyrate such as Acetyl-CoA C-acetyltransferase, 3-hydroxybutyryl CoA dehydrogenase, enoyl-CoA hydratase, butyryl-CoA dehydrogenase, phosphate butyryltransferase, and butyrate kinase can be cloned into an organism, and recombinant vectors comprising these PCR clones can be constructed. The recombinant antigens and short-chain fatty acids produced by these engineered bacteria can induce tolerance, increase gut barrier integrity, and reduce inflammation in a subject in need thereof. The present specification also relates to pharmaceutical compositions comprising engineered organisms expressing at least one Clostridium-derived antigen and one short-chain fatty acid as described above.
V. Methods of Treatment
[0086] As described above, and as shown in Examples, administration of the compositions to an individual makes it possible to induce tolerance, strengthen gut barrier integrity, and reduce inflammation in the individual. This provides a method of inducing tolerance, strengthening the gut barrier, and reducing inflammation in an individual in need thereof. The method comprises administering to an individual a composition described herein. In some embodiments, the composition comprises (a) one or more short-chain fatty acid or short-chain fatty acid derivative; (b) a (at least one or more) GPR109 ligand; (c) a (at least one or more) GPR43 ligand; (d) a (at least one or more) histone-deacetylase inhibitor; (e) one or more antigen derived from bacteria belonging to Clostridium Clusters IV, XIVa, or XVIII; (f) a flagellin polypeptide; or (g) a combination of at least one of (a)-(d) and one of (e)-(f) is administered to an individual in need of prevention, reduction or treatment of a condition or disease. The composition is administered (provided) to the individual in sufficient quantity to produce the desired effect of inducing tolerance, strengthening the gut barrier, and reducing inflammation. It may be administered to an individual in need of treatment, reduction in the severity of or prevention of at least one disease selected from an autoimmune disease, an inflammatory disease, an allergic disease, or an infectious disease.
[0087] Whether administration of the composition induces tolerance can be determined by using, as an index, increase or reinforcement of at least one of the following: the number of regulatory T cells, the ratio of regulatory T cells in the T cell group of the colon, a function of regulatory T cells, or expression of a marker of regulatory T cells. A specific approach is measurement counts or percentage of Foxp3-expressing Tregs in a patient sample, such as a biopsy or a blood sample, promotion (enhancement) of IL-10 expression, promotion (enhancement) of CTLA4 expression, promotion (enhancement) of IDO expression, or suppression of IL-4 expression as the index of the induction of proliferation or accumulation of regulatory T cells. Whether administration of the composition strengthens barrier function can be determined by using, as an index, increase in production of active form TGF- and/or tight junction-related proteins by intestinal epithelial cells. Whether administration of the composition reduces inflammation can be determined by using, as an index, increase in production of anti-inflammatory cytokines such as IL-10 and/or TGF-, or decrease in production of pro-inflammatory cytokines such as IL-4.
[0088] Methods for detecting such expression include northern blotting, RT-PCR, and dot blotting for detection of gene expression at the transcription level; ELISA, radioimmunoassays, immunoblotting, immunoprecipitation, and flow cytometry for detection of gene expression at the translation level. Samples that may be used for measuring such an index include tissues and fluids obtained from an individual, such as blood, a biopsy, or a fecal sample.
VI. Methods for Detecting and Quantifying Induction of Tolerance in a Subject
[0089] Described herein are also immunoassays to detect and measure activation of T cells, particularly specific Treg subsets that recognize antigens expressed by bacteria belonging to Clostridium Clusters IV, XIVa, and XVIII. Such immunoassays can be used to determine and quantify whether administration of the composition induces tolerance in a subject. In some embodiments, the immunoassay quantifies the frequency of Tregs that recognize a flagellin epitope in the context of presentation by MHC Class II molecules. Complexes of four MHC Class II tetramers with streptavidin, a molecule having tetrameric binding sites for biotin, to which a fluorochrome is bound, are prepared. The MHC Class II chains are obtained by recombinant expression of polynucleotides encoding a desired epitope, for example a flagellin epitope, in host cells. Populations of Tregs specific for a Clostridium antigen, such as Tregs specific for a flagellin epitope, in samples from a subject, are readily detected even when present in very low numbers by use of this method. For example, a sample obtained from a subject such as a sample of peripheral blood lymphocytes (PBLs) containing a diverse population of T cells, can be contacted with the tetramer reagents described herein. When contacted with the diverse population of T cells in the sample, the tetramers containing epitopes recognized by a T cell in the sample bind to the matched T cell. The contents of the reaction can be analyzed using flow cytometry, to quantify those T cells having an MHC tetramer bound thereto.
EXAMPLES
[0090] Following are examples, which describe specific aspects. They are not intended to be limiting in any way.
Example 1
[0091] First, to gain mechanistic insight into the induction of Tregs by bacteria belonging to Clostridium Clusters IV, XIVa, and XVIII, germ-free mice were colonized with a cocktail of bacteria comprising bacterial strains belonging to Clostridium Cluster IV, bacterial strains belonging to Clostridium Cluster XIVa, and bacterial strains belonging to Clostridium Cluster XVIII (Clostridium-colonized mice). To identify metabolites potentially involved in Treg induction, the hundreds of metabolites present in the luminal composition of Clostridium-colonized, ex-germ free mice were painstakingly investigated with NMR-based metabolome analysis coupled with principal component analysis (PCA). This resulted in identification of short-chain fatty acids including acetate, propionate, isobutyrate, and particularly butyrate, as responsible for Treg induction. The influence of acetate, propionate, and butyrate on Treg induction in vitro was measured as follows: Splenic nave (CD44.sup.loCD62L.sup.hi) CD4+ T cells were stimulated with anti-CD3 and anti-CD28 mAb-coated beads and cultured in the presence of T-cell antigen receptor signaling and TGF- with or without each of these short-chain fatty acids listed above. Supplementation of each short chain fatty acid, but in particular butyrate, enhanced differentiation of Treg cells compared to a no treatment control (
Example 2
[0092] Second, to gain insight into the molecular mechanism of action by which butyrate induces Tregs, assessment was carried out to determine whether butyrate regulates gene expression in T cells. Chromatin immunoprecipitation (ChIP) was performed using MAGnify ChiP system (Invitrogen) according to the manufacturer's protocol. The assay showed that butyrate upregulated histone H3 acetylation in the promoter and conserved non-coding sequence (CNS) 1 in the Foxp3 gene locus (
Example 3
[0093] Third, each short chain fatty acid identified, as well as a mixture of sodium salts of all the short-chain fatty acids identified, were tested for their ability to induce active form TGF-, which is a property representative of the ability of a composition to induce tolerance, increase gut barrier integrity, and reduce inflammation. 0.5 mM solutions of each individual short-chain fatty acid increased expression of active-form TGF- in culture supernatants of epithelial cell line HT29. Surprisingly, a 0.5 mM mixture of sodium salts of acetate, propionate, butyrate, and isobutyrate increased expression of active-form TGF- more than three-fold higher than any of the individual short-chain fatty acid solutions alone (
Example 4
[0094] Fourth, investigation was carried to determine whether bacteria belonging to Clostridium Clusters IV, XIVa, and XVIII provide bacterial antigens to T cells. To do this, assessment was carried out of the antigen specificity of Tregs accumulated in mice colonized by a mixture of 17 strains belonging to Clostridium Clusters, XIVa, and XVIII IV (17-mix) using a cognate antigen-driven suppression assay. CD4+CD25+ Lamina Propria T cells from mice colonized by 17-mix substantially inhibited the OT-I ovalbumin (OVA) peptide-driven proliferation of OT-I CD8 T cells, and this suppression was markedly enhanced in the presence of autoclaved caecal content from +17-mix mice or autoclaved 17 strains cultured in vitro, but not in the presence of OT-II OVA peptide or caecal content from GF mice (
TABLE-US-00001 SEQIDNO:1 atggtagtacagcacaatttacaggcaatg aactctaacagaatgttaggcatcacacag aagacagcatctaagtctacagaaaagtta tcttcaggttacgcaatcaaccgcgcagca gacaacgcagcaggtcttgctatttctgag aagatgagaaagcagatcagaggacttaca caggcttctacaaatgctgaggacggcatc agctctgtacagacagcagaaggcgctttg acagaagtgcatgatatgcttcagagaatg aacgagctggcaattcaggcagcaaacggc acaaactcagaagatgaccgctcatacatt caggacgaaattgaccagctgacacaggaa atcgatcgtgttgctgagacaacaaagttc aatgagacatatctcttgaagggtgacaca aagaacgttgacgctatggactatacatat agctataaggcagttacaacgaatactgta gcaagagcttcggttttagcagcagagaac acagctacaggtatgtcagttagtatttca tttgctgcaaacagcggcaaggttactgca gctgactctaacaaccttgcaaaggctatc agagatcagggcttcacaatcacaacatct acccagaatggtaaggttgtttacggtctt gagctgaacggaagcgatgcaaaggcaaac tatacagtttcaacagtaagtatggaagct ggtacattcaagatcctgaattctaataag caggttgttgcatctgtaacaatatctaca acagctagctttaaaaaggtatctggtatg tcacagatcgttacggcgtactctgtatca gcagcttatgcgacgggtgatgtatactct ctctatgacgcagacggaaatgcaatttca gcaaacaagctggataagtactttacggca ggcggcgctacagaggcaggcggaatagct actacactttcagcaaactctggtgtgcct aaggtttatgacgtactcggaaaagaggtt tctgcagtaagcattgcaagtactttagta acagcagttaaggataagacggctgcattg aagatgaacttccatgtaggtgctgacgga acagataacaacaagattaagatcaacatt gaggctatgacagctaagagtcttggagtt aacggtctgaaggtgagcggttcgagcgga acaaacgctacaaacgctatcgagataatc gctggcgctatcaagaaggtttctacacag agatctgctcttggtgcggttcagaacaga ttagagcacacaatcaacaacttggataac atcgttgagaacacaacagcagctgagtca ggaatccgcgatacagatatggctacagag atggttaagtactctaacgctaatatcctt tcacaggcaggtcagtctatgcttgcacag tctaaccagtctaaccagggtgtacttcag ctcttacagtaa