MUTANT YEAST STRAINS WITH ENHANCED PRODUCTION OF ERYTHRITOL OR ERYTHRULOSE

Abstract

The invention relates to a method for enhancing the erythritol and/or erythrulose productivity and/or yield of an erythritol and/or erythrulose-producing yeast strain, such as Yarrowia lipolytica, comprising inhibiting in said yeast strain the expression or the activity of an endogenous L-erythrulose kinase and/or erythritol dehydrogenase. The invention also relates to a mutant yeast strain obtained by said method.

Claims

1-18. (canceled)

19. A method for increasing erythritol and/or erythrulose productivity and/or yield of an erythritol and/or erythrulose-producing yeast strain, comprising inhibiting in said yeast strain the expression or the activity of an endogenous L-erythrulose kinase (EC 2.7.1.27) having at least 50% identity with the polypeptide of sequence SEQ ID NO: 1 (YALI_EYK1).

20. The method of claim 19, further comprising overexpressing in said strain at least one enzyme selected from the group consisting of a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21), and an invertase (EC 3.2.1.26).

21. The method of claim 19, further comprising overexpressing in said strain an erythritol dehydrogenase (EC 1.1.1.9) and optionally at least one enzyme selected from the group consisting of a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21) and an invertase (EC 3.2.1.26).

22. The method of claim 19, wherein erythrulose is not produced, and wherein said method further comprises inhibiting in said strain the expression or the activity of an endogenous erythritol dehydrogenase (EC 1.1.1.9) and optionally overexpressing in said strain at least one enzyme selected from the group consisting of a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21) and an invertase (EC 3.2.1.26).

23. The method according to claim 19, wherein the L-erythrulose kinase comprises the consensus amino acid sequence SEQ ID NO: 2.

24. The method according to claim 19, wherein the L-erythrulose kinase has a polypeptide sequence selected from the group consisting of SEQ ID NOS: 1, 3, 4, 5 and 6.

25. The method according to claim 19, wherein the yeast strain belongs to a genus selected from the group consisting of Aurobasidium, Candida, Moniliella, Pseudozyma, Torula, Trichosporon, Trigonopsis and Yarrowia.

26. The method according to claim 25, wherein the yeast strain is selected from the group consisting of Y. lipolytica, Y. galli, Y. yakushimensis, Y. alimentaria and Y. phangnensis.

27. The method according to claim 19, wherein said inhibition is obtained by mutagenesis of an endogenous gene encoding said L-erythrulose kinase.

28. The method according to claim 27, wherein said inhibition is obtained by genetically transforming the yeast strain with a disruption cassette of said endogenous gene.

29. The method according to claim 20, wherein said at least one enzyme is endogenous or from a prokaryotic or eukaryotic organism.

30. The method according to claim 20, wherein the glycerol kinase comprises the amino acid sequence of SEQ ID NO: 8, the glycerol-3P dehydrogenase comprises the amino acid sequence of SEQ ID NO: 9, the triose isomerase comprises the amino acid sequence of SEQ ID NO: 10, the transketolase comprises the amino acid sequence of SEQ ID NO: 11, and the erythrose reductase comprises the amino acid sequence of SEQ ID NO: 12.

31. A method for increasing erythritol productivity and/or yield of an erythritol-producing yeast strain without production of erythrulose, comprising inhibiting in said yeast strain the expression or the activity of an endogenous erythritol dehydrogenase (EC 1.1.1.9) having at least 50% identity with the polypeptide of sequence SEQ ID NO: 7 (YALI_EYD1) and optionally overexpressing in said strain at least one enzyme selected from the group consisting of a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21) and an invertase (EC 3.2.1.26).

32. A mutant erythritol and/or erythrulose-producing yeast strain wherein the expression or the activity of an endogenous L-erythrulose kinase is inhibited in the strain, and optionally wherein at least one enzyme selected from the group consisting of an erythritol dehydrogenase (EC 1.1.1.9), a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21), and an invertase (EC 3.2.1.26) is overexpressed in the strain.

33. A mutant erythritol-producing yeast strain that does not produce erythrulose wherein the expression or the activity of an endogenous L-erythrulose kinase and of an endogenous erythritol dehydrogenase is inhibited in the strain, and optionally wherein at least one enzyme selected from the group consisting of a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21), and an invertase (EC 3.2.1.26) is overexpressed in the strain.

34. A mutant erythritol-producing yeast strain that does not produce erythrulose, wherein the expression or the activity of an endogenous erythritol dehydrogenase is inhibited in the strain, and optionally at least one enzyme selected from the group consisting of a glycerol kinase (EC 2.7.1.30), a glycerol-3P dehydrogenase (EC 1.1.5.3), a triose isomerase (EC 5.3.1.1), a transketolase (EC 2.2.1.1), an erythrose 4 phosphate phosphatase (EC 3.1.3.23), an erythrose reductase (EC 1.1.1.21), and an invertase (EC 3.2.1.26) is overexpressed in the strain.

35. A method for producing erythritol and/or erythrulose, comprising growing the mutant erythritol and/or erythrulose-producing yeast strain of claim 32 under conditions suitable for production of erythritol and/or erythrulose.

36. A method for producing erythritol, comprising growing the mutant erythritol-producing yeast strain of claim 33 under conditions suitable for production of erythritol.

37. A method for producing erythritol, comprising growing the mutant erythritol-producing yeast strain of claim 34 under conditions suitable for production of erythritol.

Description

[0130] The present invention will be understood more clearly from the further description which follows, which refers to non-limitative examples illustrating the inhibition of the expression of the YALI0F01606g gene encoding EYK1 of SEQ ID NO: 1 in Y. lipolytica, as well as to the appended.

[0131] FIG. 1. Panel A shows the growth curve of Y. lipolytica strain W29 (; empty square) JMY4949 (.circle-solid.; filled circle) and FCY001 (.box-tangle-solidup.; filled triangle) during shake-flask culture in minimal YNBG and YNBE medium. Panel B shows the growth curve of Y. lipolytica strain W29 on medium YNBG (; empty circle), RIY208 on medium YNBG (; open triangle) and RIY208 on medium YNBE (.box-tangle-solidup.; filled triangle). Cultures were performed in shake flask.

[0132] FIG. 2 shows the schematic representation of the insertion locus of the mutagenesis cassette (MTC, grey) in the YALI0F01606 gene (black) in the JMY4949 genome. Primers are indicated by the small arrow.

[0133] FIG. 3 shows the glycerol and erythritol concentration in the culture medium (A) and cell growth (B) during shake-flask culture of erythritol production from W29 and FCY001. Panel A: (empty circle): glycerol (W29); (empty triangle): glycerol (FCY001); .circle-solid. (filled circle): erythritol (W29); (filled triangle): erythritol (FCY001). Panel B: (empty circle): glycerol (W29); (empty triangle): glycerol (FCY001); .circle-solid. (filled circle): biomass W29; .box-tangle-solidup. (filled triangle): biomass FCY001.

[0134] FIG. 4 shows the CLUSTAL multiple sequence alignment of EYK1 genes in the Yarrowia Glade performed by MUSCLE (3.8). Sequences are from strains YALI: Yarrowia lipolytica CLIB122 (100%); YAGA: Yarrowia galli CBS 9722 (96.77%); YAYA: Yarrowia yakushimensis CBS 10253 (91.62%); YAAL: Yarrowia alimentaria CBS 10151 (87.22%) and YAPH: Yarrowia phangnensis CBS 10407 (85.01%). Maximal identities with Yarrowia lipolytica EYK1 are indicated in brackets.

[0135] FIG. 5 shows the HPLC analysis of culture supernatant of strains FCY001 and JMY2900 grown in YNBcasa containing 10 g/l of erythritol (ERY) or glucose (GLU). Chromatograms correspond to the U.V. signal recorded at 210 nm between 9 and 10 min of analysis. Samples were analysed in the presence (+) or in absence () of polyol standards at a final concentration of 2 g/L.

[0136] FIG. 6 shows NMR spectra of culture supernatants of strain W29 and FCY001. A: Erythrulose solution at 2 g/L in D.sub.2O. B: Culture supernatants of the Y. lipolytica wild-type strain W29. C: Culture supernatants of strain FCY001.

[0137] FIG. 7 shows erythritol production (plain line) and glycerol consumption (doted line) for FCY218 (GUT1-TKL1-eyk, triangle) and JMY2900 (WT, circle) during culture in bioreactor in EPB medium.

[0138] FIG. 8 shows relative expression of the genes GUT1 and TKL1 in strain FCY205, FCY208 and FCY214. The expression levels were standardized relative to the expression of the actin gene (C.sub.T); then the fold difference was calculated (2.sup.CT) based on baseline expression in the wild type strain W29.

EXAMPLES

[0139] 1) Material and Methods

[0140] 1.1) Strains and Media

[0141] Wild-type Y. lipolytica strains used in this study are: [0142] W29 (MATa; Ery+) (Barth and Gaillardin, 1996) [0143] Po1d (MATa ura3-302, leu2-270 xpr2-322; Ura, Leu, Ery+) (Barth, Gaillardin, 1996) [0144] JMY2900, prototrophe derivative of Po1d used as WT control, (MATa ura3-302, leu2-270 xpr2-322; Ura+, Leu+, Ery+; Po1d, Ura+, Leu+) (Ledesma-Amaro et al., 2015) [0145] JMY2101 (Leu+ derivative of Po1d, MATa ura3-302, xpr2-322; Ura, Leu+, Ery+) (Leplat et al., 2015) [0146] JMY4174 (MATa ura3-302 leu2-270 xpr2-322 dga1, lro1, pox1-6, LEU2; Ura Leu+, Ery+)

[0147] Standard YPD and YNB media used for growth and transformation of Y. lipolytica were as described elsewhere (Fickers et al., 2003). YNBG and YNBE used for mutant screening consisted of YNB medium with glucose replaced respectively by 1% (w/v) glycerol or 1% (w/v) erythritol. For erythritol production, media used were based on Tomaszewska et al. (2012). Growth medium (EG) consisted of (per liter): glycerol 50 g; peptone 5 g; yeast extract 5 g. Production medium used for shake-flasks cultures (EPF) was (per liter): glycerol 100 g; yeast extract 1 g; NH.sub.4Cl 4.5g; CuSO.sub.4 0.710.sup.3 g; MnSO.sub.4. H.sub.2O 3210.sup.3 g; 0.72 M phosphate buffer at pH 4.3. Production medium for bioreactor production (EPB) was (per liter): glycerol 150 g; NH.sub.4Cl 2 g; KH.sub.2PO.sub.4 0.2 g; MgSO47 H.sub.2O 1 g; yeast extract 1 g; NaCl 25 g.

[0148] Other Y. lipolytica strains used herein are the following: [0149] JMY4949 (JMY4174 derivative, YALI0F01606::MTC-URA3); MATa ura3-302 leu2-270 xpr2-322 dga1, fro1, pox1-6, LEU2 YALI0F01606::MTC-URA3; Ura+ Leu+, Ery); [0150] FCY001 (JMY2101 derivative, YALI0F01606::MTC-URA3), MATa ura3-302, xpr2-322 YALI0F01606::MTC-URA3; Ura+, Leu+, Ery; [0151] RIY208 (JMY2101 derivative, eyk1::URA3), MATa ura3-302, xpr2-322 eyk1::URA3; Ura+, Leu+, Ery; [0152] RIY203 (Po1d, eyk), MATa ura3-302 leu2-270 xpr2-322 eyk1; Ura, Leu, Ery; [0153] FCY205 (Po1d, LEU2ex-pTEF-GUT1, URA3ex), MATa ura3-302 leu2-270 xpr2-322 LEU2ex-pTEF-GUT1, URA3ex, Ura+, Leu+, Ery+; [0154] FCY208 (Po1d, URA3ex-pTEF-TKL1, LEU2), MATa ura3-302 leu2-270 xpr2-322 URA3ex-pTEF-TKL1, LEU2, Ura+, Leu+, Ery+ [0155] FCY214 (Po1d, LEU2ex-pTEF-GUT1, URA3ex-pTEF-TKL1), MATa ura3-302 leu2-270 xpr2-322 LEU2ex-pTEF-GUT1 URA3ex-pTEF-TKL1, URA3ex, Ura+, Leu+, Ery+ [0156] FCY218 (Po1d, eyk, LEU2ex-pTEF-GUT1, URA3ex-pTEF-TKL1), MATa ura3-302 leu2-270 xpr2-322 LEU2ex-pTEF-GUT1 URA3ex-pTEF-TKL1, Ura+, Leu+, Ery [0157] RIY146 MATa ura3-302 leu2-270 xpr2-322 eyk1::LEU2 [0158] RIY210 (RIY145, LEU2), MATa ura3-302 leu2-270 xpr2-322 eyk1::LEU2 URA3ex-pTEF-EYK1; Ura+, Leu+, Ery;

[0159] 1.2) Culture Conditions

[0160] All shake-flask cultures were performed at 28 C. in 250 mL flasks containing 50 mL of appropriate medium. Shake-flasks mutant screening cultures were carried in YNBE or YNBG for 11 h at 190 RPM after a 24 h YPD growth. Erythritol productions were carried in EPF medium for 10 days at 250 RPM after a 72 h EG growth. All cultures were performed in triplicates.

[0161] Bioreactors cultures were performed in 2-1 bioreactors (Biostat B-Twin, Sartorius) containing 1 L EPB medium at 28 C. for 96 h, after a 72 h EG growth. Stirrer speed was set at 800 RPM and aeration rate was kept at 1 vvmin.sup.1. pH was set at 3.0 and automatically adjusted by the addition of 20% (w/v) NaOH or 40% (w/v) H.sub.3PO.sub.4. Bioreactor cultures were performed in duplicates.

[0162] 1.3) Analytical Methods

[0163] Cell growth was monitored by optical density at 600 nm (OD600) and dry cell weight (DCW) was calculated either from OD600 according to gDCW=OD600 nm/4.7 or based on the biomass according to gDCW=OD600 nm*0.29. Glycerol, erythritol and erythrulose concentrations in the media were determined by isocratic UV-RID-HPLC (Agilent 1100 series, Agilent Technologies) using an Aminex HPX-87H ion-exclusion column (3007.8 mm Bio-Rad, Hercules, USA) with 15 mM Trifluoroacetic acid as mobile phase at a flow rate of 0.6 ml.Math.min.sup.1 at 65 C. Samples were analyzed using refractive index and absorbance at a wavelength of 205 nm. Compounds were identified on the basis of the retention time using commercially available standards. Glycerol concentration was calculated from HPLC chromatogram based on the following calibration equations: glycerol concentration=[(pic area1888)/66307] or glycerol concentration=[(pic area1879)/76916].

[0164] 1.4) General Molecular Biology Techniques

[0165] Standard molecular biology techniques were used (Green et al., 2012). Transformation and genetic manipulations of Y. lipolytica were done according to Barth and Gaillardin (1996). Genomic DNA from Y. lipolytica was prepared according to Querol et al., (1992). PCR reactions were performed on a MJ Mini Gradient Thermal Cycler (Bio-Rad) using DreamTaq DNA polymerase (Thermo Scientific), except for genome walking PCR (see below). 25 cycles were carried for each PCR reaction, and were as follows: denaturation at 95 C. for 30 s, annealing at 56 C. for 30 s, extension at 72 C. for 1 min/kb. A final 10 min extension was added as the last step. PCR fragments were purified from agarose gels using GeneJet Gel Extraction Kit (Thermo Scientific).

[0166] 1.5) Mutant Library Screening

[0167] A library of randomly generated Y. lipolytica mutants was constructed by inserting a mutagenesis cassette (MTC) in the genome of the Y. lipolytica wild-type strain JMY4174 (Ura). The MTC sequence consisted of two zeta regions from Ylt1 retrotransposon, allowing random genome insertion (Barth and Gaillardin 1996), flanking the URA3 gene for selection. 11,000 mutants were obtained and screened at the PICT-Genotoul Platform (INSA-Toulouse). After two growth phases on liquid YNB with 2% and 0.2% glucose concentrations respectively, the mutants were screened on two different solid media, YNBG and YNBE.

[0168] Colonies exhibiting normal growth on glycerol but slow growth on erythritol were selected for a second screening. After further growth on YNB, two replicates of each selected mutant were transferred on new plates containing YNBG or YNBE. The clones still showing a slow growth on erythritol for both replicates were selected for shake-flask screening, as described above.

[0169] 1.6) Genome Walking

[0170] The insertion site of the MTC in JMY4949 strain was identified by genome walking using Universal GenomeWalker 2.0 (ClonTech Laboratories inc.). After extraction, genomic DNA was digested with four different restriction enzymes (DraI, EcoRV, PvuII, StuI) and the resulting fragments were ligated with the GenomeWalker adaptors. PCR reactions were performed on the ligated fragments using primers matching the adaptor (AP1, see Table 1) and either the 5 side (GSP1-L) or the 3 side (GSP1-R) of the MTC. This allowed to amplify only the genomic fragments containing the MTC and its surroundings.

[0171] A second PCR reaction with different primers (AP2 and either GSP1-L or GSP1-R) was then performed to ensure specificity. The PCR steps were performed using Advantage 2 Polymerase (ClonTech Laboratories inc.) and cycles were designed as recommended by the user manual. The resulting amplified fragments were separated by gel electrophoresis, purified, and sequenced with Sanger sequencing (GATC Biotech). A BLAST analysis of the sequences was then performed at the GREC site (http://gryc.inra.fr/) on the Y. lipolytica genome to identify the insertion site of the MTC.

[0172] 1.7) Disruption of YALI0F1606g in a Wild-Type Strain

[0173] Construction of the FCY001 strain was achieved by disrupting the YALI0F01606g gene within JMY2101 strain. A 3700 base pairs (bp) region consisting of the MTC insertion site and its surroundings (1000 bp on each side of the MTC insertion site) was amplified from JMY4949 strain, using primers DISR1 and DISR2. The amplified fragment was analyzed by gel electrophoresis and purified. This fragment contained all the elements for a disruption cassette of YALI0F01606g; specific sequences for homologous recombination and site-directed insertion, and a selection marker (URA3 gene within the MTC). This purified disruption cassette was used to transform JMY2101 strain. Transformed strains were selected on YNB plates, and the success of the gene disruption was verified by PCR, using ZETA1 and CHK1 primers.

[0174] Strain RIY208 was constructed by disrupting the EYK1 gene in strain JMY2101 as described hereinafter. The EYK1 P and T fragments were amplified from strain W29 genomic DNA using primer pairs EYK1-PF/EYK1-PR and EYK1-TF/EYK1-TR, respectively. The URA3 marker was amplified from the JMP113 plasmid (Fickers et al. 2013) using the primer pair LPR-F/LPR-R. Primer EYK1-PR, EYK1-TR, LPR-F and LPR-R were designed to introduce an SfiI restriction site in amplified fragment. Amplicons were digested with SfiI before being purified and ligated, using T4 DNA ligase, at a molar ratio of 1:1. The ligation products were amplified via PCR using the primer pair EYK1-PF/EYK1-TR. They were then purified and used to transform strain JMY2101, this process yielded strain RIY208 (A eyk1::URA3). The prototroph derivative of strain RIY208, namely RIY203 was obtained according to Fickers et al. 2003.

[0175] Strain RIY203 was constructed using the same disruption cassette except that the transformed strain was Po1d. This process yielded strain RIY203.

[0176] 1.8) Strain Construction for Overexpression of Glycerol Kinase and Transketolase

[0177] The different genes that were over-expressed are YALI0F00484g (GUT1, Glycerol kinase, Y. lipolytica; BamHI site removal) and YALI0E06479g (TKL1, Transketolase Y. lipolytica; Intron removal, ClaI site removal). Yeast genes were amplified from genomic DNA of strain Y. lipolytica W29.

[0178] Primers for gene amplification were designed to introduce an AvrII site at the 3 end and a BamHI restriction sites at the 5 end of genes YALI0F00484g and YALI0E06479g (Table 1). Introns and undesirable restriction sites were removed by overlap extension PCR and site-directed mutagenesis (Higuchi et al., 1988): BamHI site removal in YALI0F00484g (GUT1, Glycerol kinase, Y. lipolytica) was performed with primer GUT1F1/GUT1R1 (PCR1) and GUT1F2/GUT1F1 (PCR2) and finally with GUT1F1/GUT1F1 using amplicons from PCR1 and PCR2 as templates. Intron removal, ClaI site removal for YALI0E06479g (TKL1, Transketolase Y. lipolytica.) was performed using primer pairs TKLIF1/TKL1R1 (PCR1), TKL1F2/TKL1R2 (PCR2) and TKL1F3/TKL1R3, (PCR3). Finally, the modified TKL1 was amplified with primers TKLF1/TKL1R3 and amplicons from PCR1, PCR2 and PCR3 as template.

[0179] Amplicons were purified from agarose gel, before being digested using BamHI/AvrII restriction enzymes. The corresponding fragments were finally cloned into BamHI/AvrII digested JMP1047 (Lazar et al 2013) or JMP2563 (Dulermo et al 2017) vectors in order to obtain URA3 or LEU2 counterpart, respectively. The correctness of the resulting construct was verified by DNA sequencing.

[0180] Expression cassettes for genes GUT1 and TKLI were rescued from corresponding vectors by NotI digestion and purified from agarose gel before being used to transform Y. lipolytica strains Po1d or RIY203. Transformants were selected on YNB medium supplemented with uracil or leucine depending on their auxotrophy. Correctness of the constructed strain was verified by analytical PCR on genomic DNA using primer pairs URA3F/61stop or LEU2F/61stop, depending on the auxotrophic marker used for transformation. Prototrophic stains were obtained according to Fickers et al. 2003.

TABLE-US-00001 TABLE1 Primersusedforgenomewalkingandstrainconstructions(Restrictionsitesare underlined,mismatchedbasesforsite-directedmutagenesisareinbold, overhangsforoverlapextensionPCRareinitalics)arethefollowing: SEQID Primer Sequence(5-3) No. GSP1-L TCTCGGTGGTCAATGCGTCAGAAGATATC 13 GSP2-L AGCCGAGTGAATGTTGCCTGCCGTTAGT 14 GSP1-R AGCGTTCGCCAATTGCTGCGCCATCGT 15 GSP2-R ACACTACCGAGGTTACTAGAGTTGGGAAA 16 AP1 GTAATACGACTCACTATAGGGC 17 AP2 ACTATAGGGCACGCGTGGT 18 DISR1 TGTAGCACCTGGGTCAACATTT 19 DISR2 TCCGATGACCTGACTAGTGCG 20 CHK1 GATTGCTCCGTTTGTAAGTACA 21 ZETA1 TGGTCCTGTTCCACCTGAAC 22 GUT1F1 GACGGATCCATGTCTTCCTACGTAGGAGCTCTC(restrictionsite 23 BamHI) GUT1R1 GTTATCCAGAATCCATCGGAC 24 GUT1F2 GGTCCGATGGATTCTGGATA 25 GUT1R2 GACCCTAGGTTACTCAAGCCAGCCAACAG(restrictionsiteAvrII) 26 TKL1F1 CGAGGATCCATGGCTCCCCAATTTTCAAAG(restrictionsite 27 BamHI) TKL1R1 GCCACAGCATCAATGCCAAGGTTCGGATGGTGTT 28 TKL1F2 ATCAACACCATCCGAACCTTGGCTATTGATGCTGTGGCCAAGGC 29 TKL1R2 GTTCTTGAGATCATCAATAGTGATGTCGTAGC 30 TKL1F3 GCTACGACATCACTATTGATGATCTCAAGAAC 31 TKL1R3 GACCCTAGGTTAGACACCGTGGCCGGGTC(restrictionsiteAvrII) 32 URA3F AGGAAGAAACCGTGCTTAAGAG 33 LEU2F TAAGTCGTTTCTACGACGCATT 34 61Stop GTAGATAGTTGAGGTAGAAGTTG 35 EYK-PF GTTGTGTGATGAGACCTTGGTGC 36 EYK-PR AAAGGCCATTTAGGCCGCAGCTCCTCCGACAATCTTG(restriction 37 siteSfiI) EYK-TF TAAGGCCTTGATGGCCACAAGTAGAGGGAGGAGAAGC 38 (restrictionsiteSfiI) EYK-TR GTTTAGGTGCCTGAAGACGGTG 39 LPR-F ATAGGCCTAAATGGCCTGCATCGATCTAGGGATAACAGG 40 (restrictionsiteSfiI) LPR-R ATAGGCCATCAAGGCCGCTAGATAGAGTCGAGAATTACCCTG 41 (restrictionsiteSfiI) GUT1-L-q CCCTGTCCACCTACTTTGCC(targetgeneGUT1) 42 GUT1-R-q TTGGAGGTGTCGGTGATGTG(targetgeneGUT1) 43 TKL1-P-L-q CAGCAACACAGATGGCAACC(targetgeneGUT1TKL1) 44 TKL1-T-R-q CGAGACCTCCGCTGCTTACTAC(targetgeneGUT1TKL1) 45 ACT-F GGCCAGCCATATCGAGTCGCA(targetgeneACT) 46 ACT-R TCCAGGCCGTCCTCTCCC(targetgeneACT) 47

[0181] 1.9) RNA Isolation and Transcript Quantification.

[0182] Shake-flask cultures were grown in EPF medium for 24 h. Cells were then collected and store at 80 C. RNA extraction and cDNA synthesis were performed as previously described (Sassi et al 2016). Primers for RT-qPCR are listed in Table 1. The results were normalized to actin gene and analyzed to the ddCT method (Sassi et al 2016). Samples were analyzed in duplicates.

[0183] 2) Results

[0184] 2.1) Mutant Screening

[0185] In order to isolate a Y. lipolytica strain unable to grow on erythritol, a library of 11,000 insertion mutants was screened on glycerol and erythritol medium plates. After the first screening, 188 mutants were selected for having a have normal growth on glycerol but a slow growth on erythritol. After a second screening, 10 mutants were still displaying this phenotype consistently and were selected for shake-flask screening. Among these, one mutant was confirmed to be deficient for erythritol consumption (FIG. 1A). No growth on erythritol was observed for this mutant, while it grew as fast as W29 on glycerol. This strain was named JMY4949.

[0186] 2.2) Identification of the Disrupted Gene

[0187] In order to find which gene was disrupted in the JMY4949 strain, a genome walking analysis was performed. Primers designed to match the MTC allowed to amplify the region surrounding its insertion site in the JMY4949 genome. After sequencing this region, BLAST analysis revealed that the MTC insertion site was located within the YALI0F01606g gene, indicating that the disruption of this gene caused the loss of the ability to grow on erythritol (FIG. 2).

[0188] 2.3) Construction of a Y. lipolytica Strain Disrupted in YALI0F1606g Gene

[0189] A disruption cassette of this gene YALI0F01606g was constructed to transform the wild-type strain JMY2101. The strain FCY001 was obtained as a result. This strain has the same genotype as W29 except for the disruption of YALI0F01606g. This strain was evaluated in shake-flasks in YNBG and YNBE medium, and exhibited the same phenotype as JMY4949 strain (FIG. 1A). These results confirmed that the YALI0F01606g gene is essential in the erythritol catabolism pathway, and that the disruption of this gene alone is sufficient to remove the ability of Y. lipolytica to use erythritol as a carbon source. In addition, growth of FCY001 did not show any growth defect on glycerol media (FIG. 1A). As shown in FIG. 1B, strain RIY208 which is also a strain disrupted in YALI0F1606g gene, shows a growth defect on YNBE medium. It showed a similar growth profile as compared to strain W29 on YNBG medium.

[0190] 2.4) Shake-Flask Erythritol Production

[0191] In order to assess the effects of a YALI0F01606g strain on erythritol production, shake-flask production cultures were carried using W29 and FCY001 (FIG. 3). After 7 days of culture and near glycerol exhaustion, FCY001 had produced 35.7 g/l erythritol while W29 had only produced 30.7 g/l, meaning that the disruption of YALIF01606g gene had a positive effect on erythritol production. Results also showed that as soon as glycerol was depleted, W29 strain began to use erythritol for its growth, leading to a quick decrease of erythritol concentration in the medium. On the other hand, only a small decrease in erythritol concentration was observed in the FCY001 culture, after which its concentration remained stable during at least seven days. The small drop in erythritol concentration might be due to a partial conversion of erythritol into L-erythrulose, which couldn't be further converted. This would be consistent with the hypothesis that YALI0F01606g is an EYK.

[0192] 2.5) Bioreactor Erythritol Production

[0193] Batch bioreactor cultures of FCY001 and W29 were performed to further evaluate the benefits of a YALI0F01606g disruption in production conditions. Results are displayed in Table 2.

TABLE-US-00002 TABLE 2 Characteristic parameter of erythritol production during culture in bioreactor of W29 and FCY001 strain Parameters FCY001 W29 Yield (g .Math. g.sup.1)* 0.46 0.15 0.34 0.02 Yield (g .Math. g.sup.1).sup.$ 0.49 0.02 0.39 0.01 Erythritol productivity (g .Math. l.sup.1 .Math. h.sup.1) 0.59 0.03 0.52 0.05 Specific erythritol productivity 0.115 0.005 0.089 0.002 (g .Math. l.sup.1 .Math. h.sup.1 .Math. DCW.sup.1) Specific glycerol uptake rate 0.291 0.013 0.253 0.005 (g .Math. l.sup.1 .Math. h.sup.1 .Math. DCW.sup.1) Specific erythritol productivity 0.052 0.005 0.040 0.002 (g .Math. g.sub.DCW.sup.1 .Math. h.sup.1) * Specific glycerol uptake rate 0.110 0.003 0.101 0.003 (g .Math. g.sub.DCW.sup.1 .Math. h.sup.1) * *glycerol concentration was calculated according to glycerol concentration = [(pic area 1888)/66307]. .sup.$glycerol concentration was calculated according to glycerol concentration = [(pic area 1879)/76916]. specific productivity according to gDCW = OD600 nm/4.7 * specific productivity according to gDCW = OD600 nm*0.29

[0194] Bioreactor experiments confirmed the observations from the shake-flasks observations. Compared to W29, FCY001 had 25 to 35% higher yield depending on the method used for glycerol calculation, 28 to 30% higher specific productivity depending on the calculation method used for the conversion of the measured OD, and a 13% higher productivity. The significantly higher yield compared to the W29 strain might indicate that in a wild-type strain, some of the produced erythritol is consumed even before glycerol depletion. More surprising is the observation that FCY001 glycerol uptake is consistently faster than for W29, although its growth is slightly slower (data not shown), which would indicate that a YALI0F01606g disruption improves glycerol uptake, and that this increased glycerol uptake is mostly directed towards erythritol production rather than biomass production. These results altogether show that a YALI0F01606g disruption allows the improvement erythritol production while helping to keep its concentration stable after glycerol depletion.

[0195] 2.6) Shake-Flask Erythrulose Production

[0196] In order to further assess the effects of the disruption of YALI0F01606g on Y. lipolytica phenotype, strain FCY001 and JMY2900 were grown in YNBCasa medium supplemented with glucose or erythritol. Cultures were inoculated at a relatively high biomass (i.e., 0.5 g CDW/ml) and medium was supplemented with casamino acid as energy source for strain FCY001 since this latter has been demonstrated to be unable to grow on YNB-erythritol (FIG. 1A). After 48 h of culture at 28 C., biomasses were equal to 1 and 4 g CDW/ml for strain FCY001 and JMY2900, respectively. Culture supernatants were analyzed by HPLC for the presence of erythritol or erythrulose. For strain JMY2900, erythritol was not detected whereas a residual concentration of 2.6 g/L was measured in culture supernatant of strain FCY001 (data not shown). FIG. 5 shows the UV signals recorded for culture supernatant, pure or mixed with erythrulose or erythritol. For strain FCY001 supernatant, two compounds were eluted at retention time 9.186 and 9.658 min. Based on the chromatogram obtained for supernatants of strains FCY001 and JMY2900 grown on erythrulose and glucose based medium, respectively, these two compounds seems to be related to erythritol catabolism and to be specific of FCY001 mutant. Moreover, addition of pure erythritol in the sample did not modify the elution profile demonstrating that these two compounds do not correspond to erythritol. By contrast, addition of pure erythrulose in the sample, led to an increase of the elution peak intensity of one of the two compounds demonstrating, thus, that it corresponds to erythrulose.

[0197] The defect of growth observed for FCY001 in the presence of erythritol together with the detection of erythulose in the culture supernatant of this strain demonstrate clearly that gene YALI0F01606g is involved in erythitol catabolism and that it corresponds to erythritol kinase.

[0198] 2.7) Erythrulose Production Analysis by NMR

[0199] To confirm that the disruption of EYK1 lead to the accumulation of erythrulose, strains FCY001 and wild-type strain W29 were incubated at high cell density in EPF medium for 48 h and, the culture supernatants were analyzed by NMR spectroscopy. For that purpose, EPF medium was inoculated at high cell density (OD 600 nm=2) with Y. lipolytica strains and incubated for 48 h at 250 RPM. Culture supernatants were then used for NMR measurements. Spectra were recorded at 25 C. on a Bruker AVIII HD equipped with a SMART BBFO probe operating at 400 MHz for the .sup.1H. The pulse sequence used for .sup.1H detection with water suppression was Perfect-echo Watergate sequence (Adams et al 2013). Spectra were centered on the water signal at 4.7 ppm. 16 transient were added on 32K point during an acquisition time of 2.56 s. The delay for binomial water suppression was 800 s and the relaxation delay was 1 s. Prior to Fourier transform, data were multiplied with an exponential function to give a broadening of 0.3 Hz. Samples were prepared by mixing 570 l of Y. lipolytica culture supernatant with 30 l of D.sub.2O. Erythrulose (Sigma Aldrich) solution at 2 g/L in D.sub.2O was used as a standard.

[0200] As shown in FIG. 6, the characteristic signals observed for erythrulose standard solution in the range of 4.32 and 4.54 ppm are clearly present for strain FCY001 as compared to strain W29. This clearly demonstrated that the EYK disrupted strain accumulates erythrulose as compared to the non-disrupted strain.

[0201] 2.8) The Pull and Push Strategy to Enhance Erythritol Production

Overexpression of Glycerol Kinase Increase Glycerol Assimilation Rate and Erythritol Productivity

[0202] For strain FCY205 (pTEF-GUT/), the specific glycerol consumption rate (q.sub.GLY) was increased by 20% as compared to the parental strain [i.e. 0.091 and 0.076 g/(gDCW h), respectively] (Table 3). This increase is in the same range as that obtained for Y. lipolytica strain A101 overexpressing GUT1 (Mironczuk et al 2016).

[0203] In strain overexpressing GUT1 (FCY205), erythritol specific productivity (q.sub.ERY) was increased by 45% as compared to the wild-type strain [i.e. 0.051 and 0.035 g/(gDCW h), respectively] while yield was increased by a 21% [i.e. 0.56 and 0.46 g/g, respectively].

Overexpression of Triose Isomerase and Transketolase Leads to an Increase in Erythritol Productivity

[0204] Gene encoding TKL1 involved in erythritol synthesis from DHAP, the end product of glycerol catabolism, identified in Y. lipolytica genome as YALI0E06479g, was used to construct strains FCY208.

[0205] Strain FCY208 (pTEF-TKL1) also showed a higher conversion yield (Y.sub.S/P) as compared to FCY205 (pTEF-GUT1) [i.e. 0.59 and 0.56 g/g, respectively; Table 3]. However, glycerol uptake was found somewhat lower for this mutant (0.068 g.Math.g.sub.DCW.sup.1.Math.h.sup.1) as compared to the wild-type strain (0.076 g.Math.g.sub.DCW.sup.1.Math.h.sup.1).

[0206] Strain FCY205 (pTEE-GUT1) has shown a significant increase in glycerol uptake capacity while strain FCY208 (pTEF-TKL1) was able to convert glycerol into erythritol with the highest yield. To further increase erythritol productivity, these two genes were co-expressed in strain FCY214. In shake flask culture, this strain performed significantly better than JMY2900 in term of erythritol specific productivity (i.e. 65% increase) and cumulates the positive effect observed for strains FCY205 and FCY208, i.e. higher glycerol uptake rate [i.e. 0.095 and 0.091 g/L, respectively] and higher glycerol/erythritol conversion yield [i.e. 0.61 and 0.59 g/L, respectively].

[0207] Results are summarized in Table 3 below.

TABLE-US-00003 TABLE 3 Dynamic parameters calculated from glycerol uptake and erythritol synthesis after 8 days of culture in EPF medium for the different constructed strains Over- expressed Biomass q.sub.ERY (g .Math. q.sub.GLY (g .Math. Y.sub.S/P Strain genes (g.sub.DCW) g.sub.DCW.sup.1 .Math. h.sup.1) g.sub.DCW.sup.1 .Math. h.sup.1) (g .Math. g.sup.1) JMY2900 5.30 0.035 0.076 0.46 (WT) FCY205 GUT1 4.83 0.051 0.091 0.56 FCY208 TKL1 5.36 0.040 0.068 0.59 FCY214 GUT1- 4.81 0.058 0.095 0.61 TKL1 The values provided are the means of three independent replicates; the standard deviations were less than 10% of the mean. q.sub.ERY erythritol specific production rate, q.sub.GLY glycerol specific consumption rate, Y.sub.S/P glycerol/erythritol conversion yield.

[0208] Quantification of the overexpression of gene GUT1 and TKL1 FIG. 8 shows that gene GUT1 and TKL1 are overexpressed in the corresponding strain (ie FCY205, FCY208 and FCY214) between 3 to 16 more than in strain JMY2900.

[0209] 2.9) Overexpression of Triose Isomerase and Transketolase in Strain RIY203 Further Increases Erythritol Productivity

Overexpression of the Genes GUT1 and TKL1 was Carried Out in a Strain Wherein the EYK1 Gene (YALI0F01606g) was Disrupted.

[0210] Behavior of the resulting strain FCY218 and FCY214 were investigated in bioreactor as compared to strain JMY2900. Results are presented in Table 4 and FIG. 7.

TABLE-US-00004 TABLE 4 Results of bioreactor cultures of FCY214 and FCY218. Standard deviation were less than 10% JMY2900 FCY214 FCY218 Erythritol (g .Math. l.sup.1) 55.8 79.4 78.5 Productivity (g .Math. l.sup.1 .Math. h.sup.1) 0.59 0.84 1.05 q.sub.ERY (g .Math. g.sub.DCW.sup.1 .Math. h.sup.1) 0.046 0.057 0.071 q.sub.GLY (g .Math. g.sub.DCW.sup.1 .Math. h.sup.1) 0.105 0.119 0.135 Yield (g .Math. g.sup.1) 0.44 0.48 0.53 Final biomass (g.sub.DCW) 12.8 14.7 14.9

[0211] At the end of the culture of strain FCY214, erythritol concentration in the culture supernatant reached 79.4 g.Math.l.sup.1. That is a significant increase (42%) as compared to the parental strain (55.8 g.Math.l.sup.1). In those conditions, erythritol is produced at a constant rate (0.84 g/L.Math.h) between 24 and 96 h of culture (Table 4).

[0212] As expected, the resulting strain FCY218 is unable to reconsume erythritol, especially after glycerol exhaustion in the bioreactor (FIG. 7). As a consequence, strain FCY218 showed a higher q.sub.GLY as compared to FCY214 [i.e. 0.135 and 0.119 g/(gDCW h), respectively], a higher erythritol productivity [i.e. 1.05 and 0.84 g/L h.sup.1, respectively] and a higher yield [i.e. 0.53 and 0.48 g/g, respectively] (Table 4). Moreover, the maximal erythritol concentration was obtained in a lag of time reduced by 66%, as compared to strain JMY2900, positively affecting the process profitability.

[0213] 2.10) Overexpression of YALI0F01650g in a Eyk Strain Allows the Conversion of Erythritol into Erythrulose at High Yield

[0214] Y. lipolytica gene YALI0F01650g (SEQ ID NO: 7) has 56% identity with gene ODQ69345.1 (SEQ ID NO: 48) and ODQ69163.1 (SEQ ID NO: 49) that encode erythritol dehydrogenase in Lipomyces starkeyi. From this YALI0F01650g was suggested to encode an erythritol dehydrogenase in Y. lipolytica. The disruption of the latter, renamed EYD1, impairs growth on erythritol medium.

[0215] Strain RIY210 was constructed by overexpressing YALI0F01650g under the strong constitutive promoter pTEF in strain RIY203. EYD was amplified from JMY2900 genomic DNA by PCR using primers EYD_Surexp_F (SEQ ID NO: 50=GACGGATCCCACAATGGTTTCTTCAGCCGCTACTT) and EYD_surexp_R (SEQ ID NO: 51=GACCCTAGGTTACCAGACGTGGTGGCCAC); designed to introduce a BamHI and AvrII restriction sites in the PCR fragment. The latter was cloned into BamHI/AvrII digested JMP1047 (Lazar et al 2013) vectors and used to transform strain RIY146. The resulting strain RIY210 was then grown in medium YNB containing a mixture of glycerol and erythritol (50/50). Accumulation of erythulose in culture supernatant was estimated by HPLC after 24 h of growth. Results were compared to that obtained for the wild-type strain. As shown in Table 5, erythrulose accumulate in the culture supernatant of strain RIY210. Conversion of erythritol into erythrulose is closed to 65%.

TABLE-US-00005 TABLE 5 accumulation of erythrulose in strain W29 and RIY210 W29 RIY210 Biomass at t = 0 h (gDCW/L) 0.58 0.58 Biomass at t = 24 h (gDCW/L) 12.85 9.15 Glycerol consumed (g/L) 10 10 Erythritol consumed (g/l) 10.2 7.51 Erythrulose produced (g/L) 0 4.83 Yield (g/g) 0 0.63 Productivity (g/L .Math. h) 0 0.20

CONCLUSIONS

[0216] The present invention provides mutant strains impaired in erythritol catabolism with erythritol productivity increased by 72% and a 65% increase in erythritol specific productivity as compared to a wild-type strain, while process duration was reduced by 66%. It also provides a mutant strain impaired in erythritol catabolism with a conversion of erythritol into erythrulose close to 65%. All these advantages were obtained using an inexpensive medium and in a non-optimized process.

REFERENCES

[0217] Altschul, S., et al., 1997. Nucleic Acids Res. 25, 3389-3402. [0218] Barth, G. and Gaillardin, C. 1996. Yarrowia lipolytica. In: Nonconventional Yeasts in Biotechnology. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 313-388. [0219] Barth, G. and Gaillardin, C. 1997. FEMS microbiology reviews, 19, 219-237. [0220] Blazeck, J., 2011. Applied and Environmental Microbiology. 77: 7905-7914. [0221] Blazeck, J., 2013. Applied Microbiology and Biotechnology. 97:3037-3052. [0222] Blazeck J., et al., 2014. Nature Communications. 5: 3131, DOI: 10.1038/ncomms4131. [0223] Baykov, A. A., et al., 1988. Anal. Biochem. 171, 266-270. [0224] Carly F., et al., 2015. Enhancement of erythritol production from Yarrowia lipolytica by metabolic engineering. In: XVI Congreso Nacional de Biotecnologia y Bioingenieria. 21 al 26 de Junio de 2015, Guadalajara, Jalisco, Mxico. [0225] Dulermo R., Brunel F., Dulermo T., Ledesma-Amaro R., Vion J., Trassaert M., Thomas S., Nicaud J-M. and Leplat C. (2017) Using a vector pool containing variable-strength promoters to optimize protein production in Yarrowia lipolytica. Microb Cell Fact (2017) 16:31. DOI 10.1186/s12934-017-0647-3 [0226] Fickers, P., et al., 2003. Journal of Microbiological Methods, 55, 727-737. [0227] Fickers, P., et al., 2005. FEMS Yeast Research, 5, 527-543. [0228] Gaillardin, C., Ribet, A M. 1987. Current Genetics. 11: 369-375. [0229] Ge, C., et al., 2012. Se Pu. 30, 843-846. [0230] Green, M. R., et al., 2012. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 3 pp. [0231] Gysler, C., et al., 1990, Biotechnology Techniques. 4, 285-290. [0232] Hedfalk, K. 2012 Codon Optimisation for Heterologous Gene Expression in Yeast. In Springer Protocols: Methods in Molecular Biology. Recombinant protein production in yeast: methods and protocols. Volume 866 pp. 47-55. Springer Eds. [0233] Hellingwerf, F. J., WO2015-147644A1. [0234] Higuchi, R., Krummel, B., and Saiki, R. K. (1988). A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16, 7351-7367. [0235] Hirata, Y., et al., 1999, Journal of Bioscience and Bioengineering, 87:630-635. [0236] Ishizuka, H., et al., 1989. Journal of Fermentation and Bioengineering, 68, 310-314. [0237] Ishizuka, H., et al., 1992. Bioscience, Biotechnology, and Biochemistry 56, 941-945. [0238] Ito, H., et al., 1983, Journal of Bacteriology. 153, 163-168. [0239] Jeya, M., et al., 2009. Applied microbiology and biotechnology, 83, 225-231. [0240] Kim, S.-Y., et al., 1997. Biotechnology Letters, 19, 727-729. [0241] Klebe, R. J., et al., 1983, Gene. 25:333-341. [0242] Kuznetsova, E., et al., 2006. The Journal of Biological Chemistry, 281, 36149-36161. [0243] Lazar, Z. et al., 2013, J Ind Microbiol Biotechnol., 40, 1273-1283. [0244] Lee, J.-K., et al., 2000. Biotechnology Letters, 23, 497-500. [0245] Lee, D., et al., Microbial Cell Factories, 2010, 9, 43. [0246] Le Dall, M. T., et al., 1994, Current Genetics. 26:38-44. [0247] Leplat, C., et al., 2015, FEMS Yeast Research, doi: 10.1093/femsyr/fov052. [0248] Lindgren, V., et al., 1977, Journal of Bacteriology, 119, 431-442. [0249] Madzak, C., et al., 2000, Journal of Molecular Microbiology and Biotechnology, 2:207-216. [0250] Madzak, C., et al., 2004, Journal of Biotechnology, 109:63-81. [0251] Maftahi, M., et al., Yeast, 1996, 12:859-868. [0252] Matsushika, A., et al., 2012, Enzyme and Microbial Technology, 51, 16-25. [0253] Miller, G. L., 1959, Anal Chem 31, 426-428. [0254] Mironczuk, A. A., et al., 2014, Journal of Industrial Microbiology and Biotechnology, 41:57-64. [0255] Mizanur R. M., et al., 2001, J. Biosc. Bioeng., 92:237-241. [0256] Moon, H.-J., et al., 2010. Applied Microbiology and Biotechnology, 86, 1017-1025. [0257] Moonmangnee, D., et al., 2002, Biosci. Biotechnol. Biochem., 66:307-318. [0258] Morii, K., et al., 1985, Anal Biochem., 151, 188-191 [0259] Mller, S., et al., 1998. Yeast. 14:1267-1283. [0260] Nicaud, J-M, et al., 2002. FEMS Yeast Research 2/3, 371-379. [0261] Nicaud, J.-M., 2012. Yeast, 29, 409-418. [0262] Nishimura, K., et al., 2006. Journal of Bioscience and Bioengineering; 101:303-308. [0263] Orr-Weaver, T. L., et al., 1981, Proceedings of the National Academy of Sciences of the United States of America, 78:6354-6358. [0264] Querol, A., et al., 1992. Applied and Environmental Microbiology, 58, 2948-2953. [0265] Paradowska and Dagmara (2009). Ann. Universatis Marie-Curie Sklodowska Lublin, 13:47-54. [0266] Ratledge, C. (1994). Yeasts, moulds, algae and bacteria as sources of lipids. Technological advances in improved and alternative sources of lipids. B. S. Kamel, Kakuda, Y. London, Blackie academic and professional, 235-291. [0267] Rymowicz, W., et al., 2008. Biotechnology Letters, 31, 377-380. [0268] Ryu, Y.-W., et al., 2000. Journal of Industrial Microbiology and Biotechnology, 25, 100-103. [0269] Rywiska, A., et al., 2013. Biomass and Bioenergy, 48, 148-166. [0270] Sassi, H., et al 2016, Microbial Cell Factories, 15:159 [0271] Song, P., et al., 2011. Fungal Biology, 115, 49-53. [0272] Sprague, G. F., et al., 1977. Journal of Bacteriology, 129, 1335-1342. [0273] Sharma, S., et al., 2012. Plant Signaling and Behaviour, 7, 1337-1345. [0274] Tomaszewska, L., et al., 2012. Journal of Industrial Microbiology & Biotechnology, 39, 1333-1343. [0275] Wang, H. J., et al., 1999, Journal of Biotechnology, 181:5140-5148 [0276] Wu, Z. L., 2011, PLoS One, 6, e23172. [0277] Zinjarde, S. S., 2014. Food chemistry, 152, 1-10.