Methods For Treating And/Or Preventing Hypersomnias
20220387546 · 2022-12-08
Inventors
Cpc classification
A61K38/02
HUMAN NECESSITIES
C07K14/5759
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
G01N33/6803
PHYSICS
International classification
A61K38/02
HUMAN NECESSITIES
C12N15/63
CHEMISTRY; METALLURGY
Abstract
Compounds, compositions, and methods for treating and/or preventing a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy and associated diseases or disorders.
Claims
1. A method for treating and/or preventing a disease selected from the group consisting of a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, and an associated disease or disorder in a subject in need thereof, the method comprising administering to the subject an agent that modulates a level of methylation of at least one methylation site within a 5′ region upstream from a transcription start site of a human hypocretin neuropeptide precursor (HCRT) gene.
2. The method of claim 1, wherein the disease is narcolepsy.
3. The method of claim 1, wherein the agent decreases the level of methylation of the at least one methylation site within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene.
4. The method of claim 1, wherein the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene comprises one or more regulatory elements associated with said HCRT gene.
5. The method of claim 1, wherein the at least one methylation site is in a CpG region located between base pairs -241 and -242 upstream of the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene.
6. The method of claim 5, wherein the CpG region is in a Pax5-Ets1 binding site (ccggag).
7. The method of claim 1, wherein the agent is selected from the group consisting of a chemical compound, a peptide or analog thereof, an antibody or an antigen-binding fragment of said antibody, a nucleic acid, and a combination thereof.
8. The method of claim 7, wherein the chemical compound possesses DNA-demethylating properties.
9. The method of claim 8, wherein the chemical compound possessing DNA-demethylating properties is selected from the group consisting of nucleoside DNMT inhibitors, 5-aza-2′-deoxycytidine, 5-fluoro-2′-deoxycytidine, and zebularine, non-nucleoside inhibitors of DNMT, Hydrazinophthalazines-derivates, polyphenol (−)-epigallocatechin-3-gallate (EGCG), procainamide, and a combination thereof.
10. The method of claim 7, wherein the peptide or analog thereof is able to modulate epigenetic mechanisms and is selected from the group consisting of Romidepsin, Burkholdacs, Spiruchostatins, Thailandepsin, FR901375, Largazole, Plitidepsin, Chlamydocin, Trapoxins, CHAP, Apidicin, Microsporins, Azumamides, FR235222, AS1387392, and a combination thereof.
11. The method of claim 7, wherein the nucleic acid is selected from the group consisting of a nucleic acid encoding an miRNA, an siRNA, a piRNA, an hnRNA, an snRNA, an sgRNA, an esiRNA, an shRNA, an antisense oligonucleotide, a variant thereof, a fragment thereof, and a combination thereof.
12. The method of claim 1, further comprising one or more additional therapeutic agent.
13. A plasmid or a vector comprising one or more nucleic acid(s) encoding the miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, and/or antisense oligonucleotide of claim 11.
14. A host cell comprising the plasmid or vector of claim 13.
15. A nucleic acid encoding the miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, and/or antisense oligonucleotide of claim 11.
16. A pharmaceutical composition comprising a therapeutically effective amount of: i) an agent modulating a level of methylation of at least one methylation site within a 5′ region upstream from a transcription start site of a human hypocretin neuropeptide precursor (HCRT) gene, ii) a plasmid or a vector comprising the agent; iii) a host cell comprising the plasmid or vector; or iv) a nucleic acid encoding the agent; and a pharmaceutically acceptable carrier and/or diluent.
17. The pharmaceutical composition of claim 16, wherein the agent is a chemical compound, a peptide or analog thereof, an antibody or an antigen-binding fragment of said antibody or a nucleic acid.
18. The pharmaceutical composition of claim 16, further comprising one or more additional therapeutic agent.
19. The pharmaceutical composition of claim 18, wherein the one or more additional therapeutic agent is administered concomitantly, separately or staggered.
20. The pharmaceutical composition of claim 18, wherein the one or more additional therapeutic agent is a histone deacetylase agent.
21. A method of treating and/or preventing a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, or an associated disease or disorder, in a subject in need thereof, the method comprising administering a therapeutically-effective amount of one or more pharmaceutical compositions to the subject, the one or more pharmaceutical compositions comprising: i) an agent modulating a level of methylation of at least one methylation site within a 5′ region upstream from a transcription start site of a human hypocretin neuropeptide precursor (HCRT) gene, ii) a plasmid or a vector comprising the agent; iii) a host cell comprising the plasmid or vector; or iv) a nucleic acid encoding the agent; and a pharmaceutically acceptable carrier and/or diluent.
22. The method of claim 21, wherein the disease is narcolepsy.
23. The method of claim 21, further comprising administering one or more additional therapeutic agent.
24. The method of claim 23, wherein the one or more additional therapeutic agent is administered concomitantly, separately or staggered.
25. The method of claim 23, wherein the one or more additional therapeutic agent is a histone deacetylase agent.
26. A method for detecting narcolepsy, in a biological sample of a subject, said method comprising: a) determining a level and/or concentration of hypocretin (type 1 and/or type 2), wherein a low level and/or low concentration of said hypocretin (type 1 and/or type 2), when compared to a control sample, is indicative of the subject being susceptible to develop or to have a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, or an associated disease or disorder; and b) administering at least one pharmaceutical composition comprising a therapeutically effective amount of i) an agent modulating a level of methylation of at least one methylation site within a 5′ region upstream from a transcription start site of a human hypocretin neuropeptide precursor (HCRT) gene, or ii) a plasmid or a vector comprising the agent, or iii) a host cell comprising the plasmid or the vector, or iv) a nucleic acid encoding the agent; and a pharmaceutically acceptable carrier and/or diluent.
27. A method for detecting narcolepsy, in a biological sample of a subject, said method comprising: a) determining a level and/or concentration of Qrfp, wherein a low level and/or low concentration of said Qrfp, when compared to a control sample, is indicative of the subject being susceptible to develop or to have a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, or an associated disease or disorder; and b) administering at least one pharmaceutical composition comprising a therapeutically effective amount of i) an agent modulating a level of methylation of at least one methylation site within a 5′ region upstream from the transcription start site of a human hypocretin neuropeptide precursor (HCRT) gene, or ii) a plasmid or a vector comprising the agent, or iii) a host cell comprising the plasmid or the vector, or iv) a nucleic acid encoding the agent; and a pharmaceutically acceptable carrier and/or diluent.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0015]
[0016]
[0017]
[0018]
[0019]
[0020] Values are average of 3 wells measured in duplicate over 3 different transfections (n=9/vector) reported as a percent of the reference unmethylated vector. Error bars=1 sd.
DESCRIPTION OF THE INVENTION
[0021] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The publications and applications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.
[0022] In the case of conflict, the present specification, including definitions, will control. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in art to which the subject matter herein belongs. As used herein, the following definitions are supplied in order to facilitate the understanding of the present invention.
[0023] Reference throughout this specification to “one aspect”, “an aspect”, “another aspect”, “a particular aspect”, “combinations thereof” means that a particular feature, structure or characteristic described in connection with the invention aspect is included in at least one aspect of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same aspect. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more aspects.
[0024] The term “comprise(s)”, or “comprising” is generally used in the sense of include(s)/including, that is to say, permitting the presence of one or more features or components. The terms “comprise(s)” and “comprising” also encompass the more restricted ones “consist(s)” and “consisting”, respectively.
[0025] As used in the specification and claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0026] The term “about,” particularly in reference to a given quantity, is meant to encompass deviations of plus or minus ten (10) percent (+/−10%).
[0027] As used herein, “one or more” agent(s)/compound(s) means “at least one” agent or compound, e.g. a combination of two, three, four, five, six, etc. . . . agents/compounds.
[0028] The term “treatment and/or prevention” or “treating and/or preventing” means any administration of a composition, pharmaceutical composition, agent, compound, etc. . . . of the disclosure to a subject for the purpose of: (i) preventing the disease, that is, causing the clinical symptoms of the disease not to develop; (ii) inhibiting the disease, that is, arresting the development of clinical symptoms; and/or (iii) relieving the disease, that is, causing the regression of clinical symptoms.
[0029] In the context of the present invention, the disease is selected from the group comprising, or consisting of, a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, and associated diseases or disorders. Non-limiting examples of neurological diseases are usually selected from the group comprising, or consisting of, neuroinflammatory diseases (such as e.g. multiple sclerosis, traumatic brain injury, autoimmune neuroinflammatory of the CNS and spinal cord) and hypersomnias of central origin. Preferably, the neurological disease is hypersomnia, most preferably narcolepsy, more preferably narcolepsy with cataplexy also called narcolepsy type 1 or NT1.
[0030] Neurobehavioral disorders are selected from the group comprising, or consisting of, autism spectrum, fragile X syndrome, ADHD, traumatic brain injury, or a combination thereof.
[0031] Neurodegenerative diseases are selected from the group comprising, or consisting of, Alzheimer's disease, Parkinson's disease, Huntington's disease, Spinocerebellar ataxia and Amyotrophic Lateral Sclerosis or a combination thereof.
[0032] Neuropsychiatric diseases are selected from the group comprising, or consisting of, Schizophrenia, depression, bipolar disease, anxiety, or a combination thereof.
[0033] As used herein the terms “subject”/“subject in need thereof”, or “patient”/“patient in need thereof” are well-recognized in the art, and, are used interchangeably herein to refer to a mammal, including dog, cat, rat, mouse, monkey, cow, horse, goat, sheep, pig, camel, and, most preferably, a human. In some cases, the subject is a subject in need of treatment or a subject with a disease or disorder. However, in other aspects, the subject can be a normal subject. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered. Preferably, the subject is a human, most preferably a human suffering from a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, and associated diseases or disorders or a human that might be at risk of a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, and associated diseases or disorders. In an aspect of the invention, the subject is a human suffering from, at risk of suffering form, hypersomnia, most preferably narcolepsy, more preferably narcolepsy with cataplexy also called narcolepsy type 1 or NT1.
[0034] The present invention is based, in part, on the surprising results showing that an epigenetic silencing instead of HCRT neuronal loss causes narcolepsy. Epigenetic mechanisms include DNA methylation, histone modifications, chromatin structure and microRNAs. DNA methylation and histone modifications are the major mechanisms for gene silencing. The Inventors have evaluated the promoter methylation of HCRT in DNA extracts from lateral hypothalami of 7 narcolepsy with cataplexy and 7 control subjects. As shows in
[0035] An aspect of the invention concerns an agent for use in the treatment and/or prevention of a neurological disease, a neuropsychiatric or neurobehavioral disease, a neurodegenerative disease, and associated diseases or disorders, preferably narcolepsy and hypersomnias, wherein the agent modulates the level of methylation of at least one methylation site within the 5′ region upstream from the transcription start of the hypocretin neuropeptide precursor (HCRT) gene.
[0036] Preferably, the agent decreases the level of methylation of said at least one methylation site within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene.
[0037] Usually, the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene comprises one or more regulatory elements associated with said HCRT gene. Preferably, said at least one methylation site is a CpG region upstream of the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene, most preferably a CpG located between base pairs -241 and -242 upstream of the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene on chromosome 17. Most preferably, the CpG region is in a Pax5-Ets1 binding site (ccggag).
[0038] Hypersomnias, as used herein, are diseases manifested in excessive daytime sleepiness (EDS) not caused by disturbed nocturnal sleep or misaligned circadian rhythms. Central hypersomnias includes narcolepsy with and without cataplexy, recurrent hypersomnia, idiopathic hypersomnia, with and without long sleep time, behaviorally induced insufficient sleep syndrome, hypersomnia and narcolepsy due to medical conditions, and finally hypersomnia induced by substance intake.
[0039] In one aspect, the agent of the invention is selected from the group comprising, or consisting of, a chemical compound, a peptide or analog or derivative thereof, an antibody or an antigen-binding fragment of said antibody and a nucleic acid, or a combination thereof.
[0040] As used herein, a “chemical compound” is a compound that produces change by virtue of its chemical composition and its effects on living tissues and organisms. The chemical compound may be a small molecule inhibitor (SMI) of DNA methylation or possesses DNA-demethylating properties, preferably a non-peptidyl molecule.
[0041] Preferably, the non-peptidyl chemical compound possessing DNA methylation inhibition or DNA-demethylating properties is selected from the group comprising, or consisting of, nucleoside DNMT inhibitors (such as e.g. 5-azacytidine (Vidaza), 5-aza-2′-deoxycytidine (Decitabine or Dacogen), 5-fluoro-2′-deoxycytidine, and zebularine), non-nucleoside inhibitors of DNMT, Hydrazinophthalazines-derivates (hydralazine and dihydralazine), polyphenol (−)-epigallocatechin-3-gallate (EGCG), and procainamide, or a combination thereof as well as those described in Hauser et al., 2018. Most preferably, the small molecule inhibitor is a DNA methyltransferase inhibitor.
[0042] Methods for testing the DNA-demethylating properties of a compound (non-peptidyl chemical compound, peptide or nucleic acid) are well known in the art and include those described in de la Cruz-Hernandez et al., 2011 or Pérez-Cárdenas et al., 2018.
[0043] As used herein, the terms “peptide”, “protein”, “polypeptide”, “polypeptidic” and “peptidic” are used interchangeably to designate a series of amino acid residues, in linear or circular conformation, connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
[0044] The term “derivative” of a peptide of the invention shall be taken to mean a peptide that is derived from an inhibitory peptide of the invention as described herein e.g., a fragment or processed form of the peptide, wherein the active portion of the base peptide is not modified e.g., a functional fragment. Moreover, it is known that changes at the N- and/or C-terminus of a peptide do not greatly affect its function or can even stabilize it. Accordingly. peptides (i.e. derivatives) which differ in N- and/or C-terminus of the peptides of reference are also covered by the present invention.
[0045] The term “analog”, as used herein, shall be taken to mean a peptide wherein the active portion is modified e.g., to comprise one or more naturally-occurring and/or non-naturally-occurring amino acids, provided that the peptide analog is, e.g., capable of preventing partially or completely the interaction between the at least one methylation site within the 5′ region upstream from the transcription start of the hypocretin neuropeptide precursor (HCRT) gene and a DNA methyltransferase. For example, the term “analog” encompasses an inhibitory peptide comprising one or more conservative amino acid changes. In another example, an “analog” comprises one or more D-amino acids, a combination of D- and L-amino acids, and various unnatural amino acids (e.g., α-methyl amino acids, Cα-methyl amino acids, and Nα-methyl amino acids, etc) to convey special properties) known in the art. In this respect, such a retroinverso peptide analog may optionally include an additional component, such as, for example, a protein transduction domain, which may also be retroinverted.
[0046] Preferably, the peptide, analog or derivative thereof of the invention is able to modulate epigenetic mechanisms. The peptide, analog or derivative can directly interact with DNA in the at least one methylation site within the 5′ region upstream from the transcription start of the hypocretin neuropeptide precursor (HCRT) gene, causing strand separation and initiation of gene transcription. These peptides, analog or derivative thereof are usually comprised of four amino acids and are called short peptides (see e.g. Janssens et al., 2019). Alternatively, the peptide, analog or derivative thereof can bind to the at least one methylation site within the 5′ region upstream from the transcription start of the hypocretin neuropeptide precursor (HCRT) gene making it inaccessible for DNA methyltransferases, resulting in unmethylated regulatory regions and gene activation. The peptide can be endogenic, food-derived, found in the environment (microbes, fungi, etc. . . . ) or synthetic.
[0047] The peptide, analog, or derivative thereof, when synthetic, is preferably synthesized using a chemical method known to the skilled artisan (e.g. solid phase, liquid phase, or peptide condensation, or any combination thereof), and can include natural and/or unnatural amino acids. Amino acids used for peptide synthesis may be standard Boc (Nα-amino protected Nα-t-butyloxycarbonyl) amino acid resin with the deprotecting, neutralization, coupling and wash protocols of the original solid phase procedure of Merrifield, J. Am. Chem. Soc., 85:2149-2154, 1963, or the base-labile Nα-amino protected 9-fluorenylmethoxycarbonyl (Fmoc) amino acids described by Carpino and Han, J. Org. Chem., 37:3403-3409, 1972. Both Fmoc and Boc Nα-amino protected amino acids can be obtained from various commercial sources, such as, for example, Fluka, Bachem, Advanced Chemtech, Sigma, Cambridge Research Biochemical, Bachem, or Peninsula Labs.
[0048] The peptide, analog, or derivative thereof, of the invention may be conjugated to a cell membrane permeable carrier either directly or by a spacer (e.g. via one, or more glycines). In this case the cell membrane permeable carrier is preferably a peptide, most preferably a positively charged amino acid rich peptide such as arginine rich peptides. Usually arginine rich peptides are selected from the group comprising the HIV-TAT 48-57 peptide, the FHV-coat 35-49 peptide, the HTLV-II Rex 4-16 peptide and the BMV gag 7-25 peptide. Preferably, the arginine rich peptide is HIV-TAT 48-57 peptide.
[0049] As used herein, the terms “nucleic acid”, “polynucleotide,” and “oligonucleotide” are used interchangeably and refer to any kind of deoxyribonucleotide (e.g. DNA, cDNA, . . . ) or ribonucleotide (e.g. RNA, miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, antisense oligonucleotide, . . . ) polymer or a combination of deoxyribonucleotide and ribonucleotide (e.g. DNA/RNA) polymer, in linear or circular conformation, and in either single—or double—stranded form. These terms are not to be construed as limiting with respect to the length of a polymer and can encompass known analogues of natural nucleotides, as well as nucleotides that are chemically modified in the base, sugar and/or phosphate moieties.
[0050] The nucleic acid of the invention is selected from the group comprising, or consisting of, an acid nucleic encoding an miRNA, an siRNA, a piRNA, an hnRNA, an snRNA, an sgRNA, an esiRNA, an shRNA, peptide, an analog, or derivative thereof of the invention, and an antisense oligonucleotide (e.g. antisense oligonucleotides targeting DNMT enzymes such as the MG98 antisense oligonucleotide against the 3′ untranslated region of DNMT1 mRNA antisense and described in Medina-Franco et al., 2015), or a combination thereof.
[0051] Chemical modifications of said nucleic acid or nucleotides can comprise modifications to the nucleobases, the backbone residues, and/or the internucleoside linkers of said oligonucleotides.
[0052] Modifications to one or more nucleobases of said oligonucleotides may comprise one or more alkylated purines and pyrimidines, acylated purines and pyrimidines, and other heterocycles. These classes of pyrimidines and purines are known in the art and include pseudoisocytosine, N4,N4-ethanocytosine, 8-hydroxy-N-6-methyladenine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5 fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxy-methylaminomethyl uracil, dihydrouracil, inosine, N6-isopentyl-adenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyl uracil, 5-methoxy amino methyl-2-thiouracil, -D-mannosylqueosine, 5-methoxycarbonylmethyluracil, 5-methoxyuracil, 2 methylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, psueouracil, 2-thiocytosine, 5-methyl-2 thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil 5-oxyacetic acid, queosine, 2-thiocytosine, 5-propyluracil, 5-propylcytosine, 5-ethyluracil, 5-ethylcytosine, 5-butyluracil, 5-pentyluracil, 5-pentylcytosine, and 2, 6,diaminopurine, methylpsuedouracil, 1-methylguanine and 1-methylcytosine.
[0053] Modifications to one or more backbone residues of said nucleic acids or oligonucleotides may comprise one or more of the following: 2′ sugar modifications such as 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-methoxyethoxy, 2′-Fluoro (2′-F), 2′-Allyl, 2′-O-[2-(methylamino)-2-oxoethyl], 2′-O-(N-methylcarbamate); 4′ sugar modifications including 4′-thio, 4′-CH2-O-2′-bridge, 4-(CH2)2-O-2′-bridge; Locked Nucleic Acid (LNA); Peptide Nucleic Acid (PNA); Intercalating nucleic acid (INA); Twisted intercalating nucleic acid (TINA); Hexitol nucleic acids (HNA); arabinonucleic acid (ANA); cyclohexane nucleic acids (CNA); cyclohexenylnucleic acid (CeNA); threosyl nucleic acid (TNA); Morpholino oligonucleotides; Gap-mers; Mix-mers; Incorporation Arginine-rich peptides; addition of 5′-phosphate to synthetic RNAs; RNA Aptamers; or any combinations thereof.
[0054] Modifications to one or more internucleoside linkers of said oligonucleotides may comprise one or more of the following: Phosphorothioate, phosphoramidate, phosphorodiamidate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate and phosphoranilidate, or any combinations thereof.
[0055] In general, an analog of a particular nucleotide has the same base-pairing specificity; i.e., an analog of A will base-pair with T. For example, a nucleic acid according to the invention, can be modified to enhance expression and reduce possible toxicity by including one or more modified nucleoside e.g. using pseudo-U or 5-Methyl-C.
[0056] The terms “microRNA,” “miRNA,” and “MiR” are interchangeable and refer to endogenous or artificial non-coding RNAs that are capable of regulating gene expression. It is believed that miRNAs function via RNA interference, e.g. by regulating the gene expression encoding a DNMT enzyme.
[0057] The terms “siRNA” and “short interfering RNA” are interchangeable and refer to single-stranded or double-stranded RNA molecules that are capable of inducing RNA interference. SiRNA molecules typically have a duplex region that is between 18 and 30 base pairs in length. In one aspect, the siRNA interferes with the RNA of a DNMT enzyme.
[0058] The terms “piRNA” and “Piwi-interacting RNA” are interchangeable and refer to a class of small RNAs involved in gene silencing. PiRNA molecules typically are between 26 and 31 nucleotides in length. In one aspect, the piRNA interferes with the RNA of a DNMT enzyme.
[0059] The terms “snRNA” and “small nuclear RNA” are interchangeable and refer to a class of small RNAs involved in a variety of processes including RNA splicing and regulation of transcription factors. The subclass of small nucleolar RNAs (snoRNAs) is also included. The term is also intended to include artificial snRNAs. In one aspect, the snRNAs interfere with the RNA of a DNMT enzyme.
[0060] The terms “ASO” and “antisense oligonucleotide” are interchangeable and refer to endogenous or artificial non-coding RNAs that are capable of regulating gene expression by targeting the mRNA encoding a DNMT enzyme. Examples of ASOs include GapmeRs (see Yokota and Maruyama, 2020)
[0061] As used herein, an “antibody” is a protein molecule that reacts with a specific antigenic determinant or epitope and belongs to one or five distinct classes based on structural properties: IgA, IgD, IgE, IgG and IgM. The antibody may be a polyclonal (e.g. a polyclonal serum) or a monoclonal antibody, including but not limited to fully assembled antibody, single chain antibody, antibody fragment, and chimeric antibody, humanized antibody as long as these molecules are still biologically active and still bind to at least one peptide of the invention. Preferably the antibody is a monoclonal antibody. Preferably also the monoclonal antibody will be selected from the group comprising the IgG1, IgG2, IgG2a, IgG2b, IgG3 and IgG4 or a combination thereof. Most preferably, the monoclonal antibody is selected from the group comprising the IgG1, IgG2, IgG2a, and IgG2b, or a combination thereof. The antibody of the invention is preferably an anti-DNMT enzyme antibody that acts as an inhibitor of the activity of said DNMT enzyme.
[0062] An “antigen binding fragment” comprises a portion of a full-length antibody. Examples of antigen binding fragments include Fab, Fab′, F(ab′)2, and Fv fragments; diabodies; minobodies; nanobodies; linear antibodies (Zapata et al. (1995) Protein Eng. 8(10):1057-1062); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
[0063] The present invention also contemplates a plasmid or a vector, preferably a gene delivery vector or plasmid, that comprises, or consists of, one or more nucleic acid(s) encoding an miRNA, a siRNA, a piRNA, a hnRNA, a snRNA, a esiRNA, a shRNA, or an antisense oligonucleotide, or a combination thereof, of the present invention. As used herein, a “vector” is capable of transferring nucleic acid sequences to target cells and is, preferably, selected from the group comprising, or consists of, viral vectors, non-viral vectors, particulate carriers, and liposomes, or a combination thereof.
[0064] Suitable vectors include derivatives of SV40 and known bacterial plasmids, e. g., E. coli plasmids col El, pCRl, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e. g., the numerous derivatives of phage X, e. g., NM989, and other phage DNA, e. g., Ml 3 and filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
[0065] Various viral vectors are used for delivering nucleic acid to cells in vitro or in vivo. Non-limiting examples are vectors based on Herpes Viruses, Pox- viruses, Adeno-associated virus, Lentivirus, and others. In principle, all of them are suited to deliver the expression cassette comprising an expressible nucleic acid molecule that codes for a miRNA, a siRNA, a piRNA, a hnRNA, a snRNA, a esiRNA, a shRNA, and an antisense oligonucleotide of the invention. In a preferred aspect, said viral vector is an adenoviral vector, preferably a replication competent adenovirus.
[0066] Alternatively, the gene delivery vector of the invention, preferably a viral vector, is issued for delivering a gene editing system, such as for example a meganuclease, a zinc finger nuclease (ZFN), transcription activator-like effector-based nuclease (TALEN), or a CRISPR-based system, said vector comprising i) at least one sgRNA, or crRNA and tracrRNA, targeting a regulatory sequence within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene, ii) a structure-guided endonuclease such as an RNA-guided endonuclease, and ii) a structure-guided including inactivate Cas9 with DNA methylation modification enzyme DNMT or Tet (dCas9-DNMT/Tet).
[0067] As described herein, the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene comprises one or more regulatory elements associated with said HCRT gene. Preferably, said at least one methylation site is in a CpG region located between base pairs -241 and -242 upstream of the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene. Most preferably, the CpG region is in a Pax5-Ets1 binding site (ccggag) that will be targeted by the at least one sgRNA, or crRNA and tracrRNA.
[0068] Any suitable naturally occurring, or engineered, RNA-guided endonuclease can be employed as long as it is effective for specifically binding the regulatory sequence within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene of the invention and it may be selected from the non-limiting group comprising Cas9, Cpf1, and FEN-1. Preferably, the RNA-guided endonuclease is a catalytically dead RNA-guided endonuclease, most preferably a catalytically dead Cas9 (dCas9).
[0069] More preferably, the catalytically dead RNA-guided endonuclease such as, e.g. the dCas9, is fused to one or more DNA methylation modification enzymes such as, e.g. Dnmt or Tet, allowing for targeted modification of DNA methylation (as described, e.g. in Xu et al., 2016 and Liu et al., 2019, which disclosures are incorporated herein by reference)
[0070] Also contemplated in the present invention is a host cell comprising a plasmid or vector of the invention or one or more nucleic acid(s) encoding the miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, and/or antisense oligonucleotide of the invention. The host cell can be any prokaryotic or eukaryotic cell, preferably the host cell is a eukaryotic cell, most preferably the host cell is a mammalian cell. Even more preferably, the host cell is a human neuronal cell, a glial cell and/or a stem cell (e.g. iPSCs).
[0071] The invention further provides pharmaceutical compositions comprising a therapeutically effective amount of i) an agent modulating the level of methylation of at least one methylation site within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene, or ii) a plasmid or a vector of the invention, or iii) a host cell of the invention, and a pharmaceutically acceptable carrier and/or diluent.
[0072] Preferably, the agent is a chemical compound, a peptide or analog thereof, an antibody or an antigen-binding fragment of said antibody or a nucleic acid, as described herein.
[0073] The term “ therapeutically effective amount” as used herein means an amount of a pharmaceutical composition of the invention high enough to significantly positively modify the symptoms and/or condition to be treated, but low enough to avoid serious side effects (at a reasonable risk/benefit ratio), within the scope of sound medical judgment.
[0074] The therapeutically effective amount of the pharmaceutical composition of the invention is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient. A physician of ordinary skill in the art can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, and associated diseases or disorders, preferably narcolepsy.
[0075] The therapeutically effective amount of the pharmaceutical composition of the invention as described herein, will vary depending upon the subject treated and the particular mode of administration. For example, a time-release formulation intended for oral administration to humans may contain approximately 0.10 to 500 mg of active material compounded with an appropriate and convenient amount of carrier material which may vary from about 5 to about 95% of the total compositions. It is preferred that the pharmaceutical composition be prepared which provides easily measurable amounts for administration. Typically, a therapeutically effective amount to be administered systemically is about 0.1 mg/kg to about 100 mg/kg and depends upon a number of factors including, for example, the age and weight of the subject (e.g., a mammal such as a human), the precise condition requiring treatment and its severity, the route of administration, and will ultimately be at the discretion of the attendant physician or veterinarian. The therapeutically effective amount of the pharmaceutical composition of the invention, as described herein, will also vary depending upon the acetylation phenotype of the patient.
[0076] Preferably, the subject will be administered one or more doses per day, week, or month, such as daily, for example, from 1 to 10 times daily, or more (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, times daily). The administration will be stopped once the clinical symptoms are arrested and/or the level and/or concentration of hypocretin (type 1 and/or type 2), when compared to a control sample or reference range, is considered normal. Any method capable of determining the level and/or concentration of hypocretin (type 1 and/or type 2) is contemplated by this disclosure.
[0077] Suitable routes of administration of the pharmaceutical composition of the invention include parenteral administration, such as subcutaneous (SC), intraperitoneal (IP), intramuscular (IM), intravenous (IV), or infusion, oral and pulmonary, nasal, topical, transdermal, and suppositories. Where the composition is administered via pulmonary delivery, the therapeutically effective dose is adjusted such that the soluble level of the agent is equivalent to that obtained with a therapeutically effective dose that is administered parenterally, for example SC, IP, IM, or IV. In some preferred aspects of the invention, the pharmaceutical composition is administered by IV or nasal delivery.
[0078] In other aspects of the invention, the pharmaceutical composition of the invention is a i) sustained-release formulation, or a formulation that is administered using a sustained-release device, ii) a controlled release formulation or iii) a slow release formulation. Sustained-release devices are well known in the art, and include, for example, transdermal patches, and miniature implantable pumps that can provide for drug delivery over time in a continuous, steady-state fashion at a variety of doses to achieve a sustained-release effect with a non-sustained-release pharmaceutical composition. Controlled release formulations as well as slow release formulations are also well known in the art.
[0079] “Pharmaceutically acceptable carrier or diluent” means a carrier or diluent that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes carriers or diluents that are acceptable for human pharmaceutical use.
[0080] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
[0081] Pharmaceutically acceptable excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
[0082] Also contemplate are pharmaceutical compositions that are formulated so as to deliver the agent of the invention to the brain across the blood-brain barrier (BBB). These pharmaceutical compositions may comprise e.g. i) nanocarriers and nanoparticles made, e.g. of poly(butyl cyanoacrylate) (PBCA) or poly(lactic-co-glycolic acid) (PLGA) coated with polysorbate 80 or poloxamer 188 to enable the transport of a chemical compound of the invention, ii) viral vectors to enable the transport of a nucleic acid of the invention, iii) exosomes or liposomes, iv) molecular vectors—also known as BBB shuttles (e.g. Trojan horse antibodies), or v) the peptide or analog of the invention conjugated to PEG and/or a cell membrane carrier as described herein.
[0083] The pharmaceutical compositions may further contain one or more pharmaceutically acceptable salts such as, for example, a mineral acid salt such as a hydrochloride, a hydrobromide, a phosphate, a sulfate, etc.; and the salts of organic acids such as acetates, propionates, malonates, benzoates, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, gels or gelling materials, flavorings, colorants, microspheres, polymers, suspension agents, etc. may also be present herein. In addition, one or more other conventional pharmaceutical ingredients, such as preservatives, humectants, suspending agents, surfactants, antioxidants, anticaking agents, fillers, chelating agents, coating agents, chemical stabilizers, etc. may also be present, especially if the dosage form is a reconstitutable form. Suitable exemplary ingredients include macrocrystalline cellulose, carboxymethyf cellulose sodium, polysorbate 80, phenyletbyl alcohol, chiorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, parachlorophenol, gelatin, albumin and a combination thereof. A thorough discussion of pharmaceutically acceptable excipients is available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991) which is incorporated by reference herein.
[0084] In one aspect, the pharmaceutical composition further comprises one or more additional therapeutic agent that can be administered concomitantly, separately or staggered. The one or more additional therapeutic agent can be any pharmaceutical composition, in particular any pharmaceutical composition useful in the treatment and/or prevention of a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy and associated diseases or disorders.
[0085] Preferably, the one or more additional therapeutic agent is a histone deacetylase (HDAC) agent usually selected from the group comprising, or consisting of, a chemical compound, a peptide or analog thereof and a nucleic acid (see for example Janssens et al. 2019 and Hauser et al., 2018, which disclosure is incorporated herein by reference). In case the histone deacetylase agent is a non-peptidyl chemical compound, it will be selected among the non-limiting group comprising, or consisting of, valproic acid, sodium butyrate, nicotinamide, Vorinostat, Trichostatin, Givinostat, and similar agents, or a combination thereof.
[0086] A peptide or analog thereof having histone deacetylase properties will be selected among the non-limiting group comprising, or consisting of, Romidepsin, Burkholdacs, Spiruchostatins, Thailandepsin, FR901375, Largazole, Plitidepsin, Chlamydocin, Trapoxins, CHAP, Apidicin, Microsporins, Azumamides, FR235222 and AS1387392, or a combination thereof.
[0087] The invention also provides the use of compositions and pharmaceutical compositions of the invention in the preparation of a medicament for the treatment and/or prevention of a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy and associated diseases or disorders.
[0088] The invention also provides a method of treating and/or preventing a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy and associated diseases or disorders, in a subject in need thereof, the method comprising administering a therapeutically-effective amount of one or more pharmaceutical compositions to the subject, the one or more pharmaceutical compositions comprising i) an agent modulating the level of methylation of at least one methylation site within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene, or ii) a plasmid or a vector of the invention, or iii) a host cell of the invention, and a pharmaceutically acceptable carrier and/or diluent.
[0089] In one aspect, the method of treating and/or preventing further comprises administering a therapeutically-effective amount of a pharmaceutical composition comprising one or more one or more additional therapeutic agent, in particular any pharmaceutical composition useful in the treatment and/or prevention of a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy and associated diseases or disorders.
[0090] Preferably, the one or more additional therapeutic agent is a histone deacetylase (HDAC) agent
[0091] The compositions or pharmaceutical compositions of the invention, are administered concomitantly, separately or staggered.
[0092] Combined or concomitant administration can include co-administration, either in a single pharmaceutical formulation or using separate formulations, or consecutive administration in either order but generally within a time period such that all active agents can exert their biological activities simultaneously. Preparation and dosing schedules for such agents can be used according to manufacturers' instructions or as determined empirically by the skilled practitioner.
[0093] The present disclosure further discloses a method for detecting a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy, and associated diseases or disorders, in a biological sample which comprises (a) determining the level and/or concentration of hypocretin (type 1 and/or type 2), wherein a low level and/or low concentration of said hypocretin (type 1 and/or type 2), when compared to a control sample, is indicative of the subject being susceptible to develop or to have a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, preferably narcolepsy and associated diseases or disorders.
[0094] Further disclosed is a method of detecting narcolepsy, preferably narcolepsy with cataplexy, in a biological sample of a subject, said method comprising
[0095] a) determining the level and/or concentration of Qrfp, wherein a low level and/or low concentration of said Qrfp, when compared to a control sample, is indicative of the subject being susceptible to develop or to have a neurological disease, a neuropsychiatric disease, a neurodegenerative disease, and associated diseases or disorders,
[0096] Determining the level and/or concentration of Qrfp or hypocretin (type 1 and/or type 2) comprise determining the level and/or concentration of the proteins or of their respective transcripts (mRNA).
[0097] The detection of the Qrfp or hypocretin (type 1 and/or type 2) proteins comprises determining the presence, the amount and/or the level of said proteins. Non-limiting detection and examination methods include one- and two-dimensional gel electrophoresis, ELISA, high performance liquid chromatography (HPLC), mass spectrometry (MS) related techniques such as MS-MS, matrix-assisted laser desorption/ionization time-of-flight MS, surface enhanced laser desorption/ionization time-of-flight MS, liquid chromatography-MS, various antibody arrays, multiplex bead analysis, NMR, Western blot analysis, etc.
[0098] The level and/or concentration of a Qrfp or hypocretin (type 1 and/or type 2) transcripts in a biological sample can be measured or determined using any technique that is suitable for detecting transcript expression levels in a biological sample. Suitable techniques for determining transcript expression levels in cells from a biological sample (e.g. Northern blot analysis, RT-PCR, quantitative RT-PCR, microRNA microarray, in situ hybridization, Next-generation sequencing (NGS) in the methods of the invention are well known to those of skill in the art.
[0099] Alternatively, the level of a transcript in a biological sample can be measured or determined indirectly by measuring abundance levels of cDNAs, amplified RNAs or DNAs, or by measuring quantities or activities of RNAs, or other molecules that are indicative of the expression level of the transcript. Preferably, the level of a transcript in a biological sample is determined indirectly in the methods of the invention by measuring abundance levels of cDNAs.
[0100] The methods of detecting disclosed above further comprise a step of (c) administering at least one pharmaceutical composition comprising a therapeutically effective amount of i) an agent modulating the level of methylation of at least one methylation site within the 5′ region upstream from the transcription start site of the human hypocretin neuropeptide precursor (HCRT) gene as described herein, or ii) a plasmid or a vector of the invention, or iii) a host cell of the invention, and a pharmaceutically acceptable carrier and/or diluent.
[0101] As used herein, a “biological sample” refers to a sample of a cell or cells, tissue, or fluid isolated from a subject, including but not limited to, for example, blood, plasma, serum, fecal matter, urine, bone marrow, bile, cerebrospinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components. Preferably, the biological sample is a fluid, most preferably the biological sample is cerebrospinal fluid.
[0102] The present disclosure also discloses a computer implemented method for detecting the neurological disease, neuropsychiatric disease, neurodegenerative disease, preferably narcolepsy, and associated diseases or disorders, as described above.
[0103] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications without departing from the spirit or essential characteristics thereof. The invention also includes all of the steps, features, compositions and agents referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present disclosure is therefore to be considered as in all aspects illustrated and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein. Various references are cited throughout this Specification, each of which is incorporated herein by reference in its entirety. The foregoing description will be more fully understood with reference to the following Examples.
EXAMPLES
Material & Methods
Brain Tissue, DNA Preparation
[0104] Formalin fixed sections (2-4 sections/subject) through the lateral hypothalamus from 7 narcolepsy patients and 7 controls were obtained through international collaborators (4 patients and 4 controls from USA, 2 patients and 2 controls from France, and 1 patient and 1 control from the Netherlands). Sections were washed with PBS and genomic DNA was extracted with AIAmp DNA FFPE Tissue kit (Qiagen). For gene expression, RNA was extracted from fresh frozen the lateral hypothalamus of 4 narcolepsy patients and 4 controls as described in Honda, 2009.
DNA Methylation Analysis
[0105] Five hundred ng of DNA was treated with sodium bisulfite using the EpiTect Fast DNA Bisulfite kit (Qiagen). Primers for nested PCR (2 fragments for HCRT, 1 for PDYN) were designed with MethPrimer (Li and Dahiya, 2002) (Table 1).
TABLE-US-00001 TABLE 1 Bisulfite primers used in this study. SEQ ID No. Hcrt First GAAGAAGGTTTTGGAGTTTGATAGTT 2 fragment: F1 First CTATACCCCTAATCACCCCCTTAT 3 fragment: R1 First TTGGGTGTAAGGTGGTTTTATTAGT 4 fragment: F2 First TTATAACCCACTCCCAAAAATCTAA 5 fragment: R2 Second GGATTGTTGTTGGTTGTTTTATTTT 6 fragment: F1 Second CTATACCCCTAATCACCCCCTTAT 7 fragment: R1 Second ATAAGGGGGTGATTAGGGGTATAG 8 fragment: F2 Second TTATAACCCACTCCCAAAAATCTAA 9 fragment: R2 Pdyn F1 GTTGTGTTTTTGTTAGGGTTAGTGT 10 R1 CAAAAACTAAAACAATCTTCTAATCAC 11 F2 GTTTGGTATTAGTTTAGGTATGTATTA 12 GAG R2 CAAAAACTAAAACAATCTTCTAATCAC 13 Hcrtr2 F1 GGTGTTATTGTTGTAGTTTTTAGTGT 14 R1 AACTCTTAAATTTCATTCAACTCC 15 F2 GAGGTATTGGTTTAGTAATTTTTTA 16 R2 AACTCTTAAATTTCATTCAACTCC 17
[0106] Two methods were used to quantify CpG methylation. In the first method PCR amplicons were gel purified followed by Sanger sequencing. Sequence trace files were analyzed by ESME software (Lewin et al., 2004) resulting in average methylation at each CpG. In the second method purified PCR amplicons (100 ng) were used to prepare sequencing libraries the TruSeq Nano DNA LT Library Preparation Kit (Illumina) with the following modifications. Purified bisulfite PCR products were not sheared, but directly subjected to end repair and then cleaned up with a single round of purification beads at a 1.8× ratio. The standard protocol was strictly followed for the subsequent steps. Libraries were quantified with a fluorimetric method (QubIT, Thermo Fischer) and their size pattern evaluated with the Fragment Analyzer (Agilent). An equimolar pool of each libraries was prepared and loaded at 10 pM (with 25% PhiX spike in for generating sequencing diversity) for a 150 cycles paired end run on a MiSeq instrument (Illumina) using a v2 reagent kit. Sequencing data were demultiplexed using the bcl2fastq conversion software (version 2.20, Illumina). Quality control was performed to keep only read-pairs that could be reconstructed (between 59 and 67% of the reads). On average, 287,852 reads (range 219,476-349,712 reads) were obtained par subject. A weight matrix profile was prepared from the reference sequence to take into account the C to T alterations caused by bisulfite treatment and the reads were aligned to the profile using pfsearch from pftools. A summary table counting the number of occurrences of each nucleotide along the fragment of interest was produced and the ratio of methylated C nucleotides was computed as a percentage of methylation for each position.
Hcrt Promotor Cloning and Site Directed Mutagenesis
[0107] 1800 base pairs of the human Hcrt promoter upstream of the transcription start site, were cloned in multiple cloning site of the pCpG-basic vector (gift from Dr. Michael Rehli lab) upstream of Firefly luciferase sequence. Single nucleotide mutagenesis was performed according to Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E0552s). The mutated plasmids were transformed in Pir1 bacterial strain and sequenced. The confirmed colonies were cultured at large scale and maxi-plasmid preparations were carried out using HiSpeed Plasmid Maxi Kit (Qiagen, 12662). CpG Methyltransferase, M.SssI (New England Biolabs, M0226s) was used to methylate the CpG sites on the Hcrt promoter.
Luciferase Assay
[0108] The primary mouse hypothalamic cells and cell lines were cultured in 24 well pates and the day after were transfected with methylated and non-methylated plasmids. The transfection was performed using X-tremeGENE™ HP DNA Transfection Reagent (Sigma, 06 366 244 001) with the DNA to reagent ration of 1:3. The transfected plasmids were mixed with Firefly and Renilla luciferases with ratio of 19:1. 48 hours after transfection the cells were lysed and prepared for the luciferase activity measurement according to Promega kit (E1910). Luciferase activity was measured using glomax 96 microplate luminometer from Promega. The Firefly luciferase activity was normalized to Renilla activity.
Results
CpG Methylation
[0109] We have used bisulfite sequencing and two methods were employed to determine CpG methylation. The first method employs direct Sanger sequencing of PCR amplicons, which measures the average methylation of all DNA molecules in a tissue. The second method employs high throughput single DNA molecule sequencing. 12 of the 13 CpG sites (all except the first CpG in
[0110] The hypermethylated site is indicated in bold in
Post-Mortem Analysis
[0111] Post-mortem analysis of narcolepsy patients indicated that two other neuropeptide PDYN (Dynorphin) and NPTX2 (Narp), which colocalize with HCRT are also lost in the lateral hypothalamus. Interestingly, PDYN and NARP, as HCRT gene, have a CpG island in their promoters, suggesting that the hypermethylation of HCRT neurons may silence other colocalized genes with CpG rich promoters. NPTX2 promoter contains a very high density CpG island which makes bisulfite sequencing very difficult. We therefore tested the methylation of PDYN promoter by bisulfite sequencing. All 10 CpGs tested (positions: -423, -416, -376, -374, -347, -342, -334, -323, -309, -295, on chromosome 20) were more methylated in narcoleptics than in controls and 2 (positions -342 and -295) were significantly hypermethylated (
Effect of Methylation on Gene Transcription
[0112] To test the effect of methylation on gene transcription we performed luciferase assays. The 1800 bp of human proximal Hcrt promoter was cloned in a CpG-Free luciferase reporter vector (pCpGL). Two different vectors were tested: pCpGL with the human Hcrt promoter (Reference Unmethylated), and pCpGL with the methylated (in vitro methylation by M.Sssl enzyme) human Hcrt promoter (Reference Methylated). Both vectors were transfected in 3 cell lines as well as mouse primary hypothalamic cultures. Methylation of the Hcrt promoter decreased the expression of luciferase by 60 to 90% (p<10-3) in the 4 cell culture conditions (
REFERENCES
[0113] Ahuja N, Sharma AR, Baylin SB (2016) Epigenetic Therapeutics: A New Weapon in the War Against Cancer. Annu Rev Med 67:73-89. [0114] Candelaria M, Herrera A, Labardini J, Gonzalez-Fierro A, Trejo-Becerril C, Taja-Chayeb L, Perez-Cardenas E, de la Cruz-Hernandez E, Arias-Bofill D, Vidal S, Cervera E, Duenas-Gonzalez A (2011) Hydralazine and magnesium valproate as epigenetic treatment for myelodysplastic syndrome. Preliminary results of a phase-II trial. Ann Hematol 90:379-387. [0115] Candelaria M, Gallardo-Rincon D, Arce C, Cetina L, Aguilar-Ponce J L, Arrieta O, Gonzalez-Fierro A, Chavez-Blanco A, de la Cruz-Hernandez E, Camargo M F, Trejo-Becerril C, Perez-Cardenas E, Perez-Plasencia C, Taja-Chayeb L, Wegman-Ostrosky T, Revilla-Vazquez A, Duenas-Gonzalez A (2007) A phase II study of epigenetic therapy with hydralazine and magnesium valproate to overcome chemotherapy resistance in refractory solid tumors. Ann Oncol 18:1529-1538. [0116] Chen Y H, Huang Y S, Chen C H (2013) Increased plasma level of tumor necrosis factor alpha in patients with narcolepsy in Taiwan. Sleep Med 14:1272-1276. [0117] Dauvilliers Y, Abril B, Mas E, Michel F, Tafti M (2009) Normalization of hypocretin-1 in narcolepsy after intravenous immunoglobulin treatment. Neurology 73:1333-1334. [0118] Dauvilliers Y, Abril B, Charif M, Quittet P, Bauchet L, Carlander B, Touchon J (2007) Reversal of symptomatic tumoral narcolepsy, with normalization of CSF hypocretin level. Neurology 69:1300-1301. [0119] Dauvilliers Y, Montplaisir J, Cochen V, Desautels A, Einen M, Lin L, Kawashima M, Bayard S, Monaca C, Tiberge M, Filipini D, Tripathy A, Nguyen B H, Kotagal S, Mignot E (2010) Post-H1N1 narcolepsy-cataplexy. Sleep 33:1428-1430. [0120] E de la Cruz-Hernandez, E Perez-Cardenas, L Taja-Chayeb, A Chavez-Blanco, C Trejo-Becerril, J Trujillo, J L Medina-Franco, A Dueñas-Gonzalez. DNA Demethylating Activity of Hydralazine in Cancer Cell Lines. Life Sciences and Medicine Research, Volume 2011 [0121] Espinoza-Zamora J R, Labardini-Mendez J, Sosa-Espinoza A, Lopez-Gonzalez C, Vieyra-Garcia M, Candelaria M, Lozano-Zavaleta V, Toledano-Cuevas D V, Zapata-Canto N, Cervera E, Duenas-Gonzalez A (2017) Efficacy of hydralazine and valproate in cutaneous T-cell lymphoma, a phase II study. Expert Opin Investig Drugs 26:481-487. [0122] Hallmayer J et al. (2009) Narcolepsy is strongly associated with the T-cell receptor alpha locus. Nat Genet 41:708-711. [0123] Hauser A T1, Robaa D2, Jung M3. Epigenetic small molecule modulators of histone and DNA methylation. Curr Opin Chem Biol. 2018 August; 45:73-85. doi:10.1016/j.cbpa.2018.03.003. [0124] Himmerich H, Beitinger P A, Fulda S, Wehrle R, Linseisen J, Wolfram G, Himmerich S, Gedrich K, Wetter T C, Pollmacher T (2006) Plasma levels of tumor necrosis factor alpha and soluble tumor necrosis factor receptors in patients with narcolepsy. Arch Intern Med 166:1739-1743. [0125] Hohjoh H, Terada N, Miki T, Honda Y, Tokunaga K (2001) Haplotype analyses with the human leucocyte antigen and tumour necrosis factor-alpha genes in narcolepsy families. Psychiatry Clin Neurosci 55:37-39. [0126] Hohjoh H, Nakayama T, Ohashi J, Miyagawa T, Tanaka H, Akaza T, Honda Y, Juji T, Tokunaga K (1999) Significant association of a single nucleotide polymorphism in the tumor necrosis factor-alpha (TNF-alpha) gene promoter with human narcolepsy. Tissue Antigens 54:138-145. [0127] Honda M, Eriksson K S, Zhang S, et al. IGFBP3 colocalizes with and regulates hypocretin (orexin). PLoS One. 2009;4(1):e4254. doi:10.1371/journal.pone.0004254 [0128] Janssens, Y., Wynendaele, E., Vanden Berghe, W. et al. Peptides as epigenetic modulators: therapeutic implications. Clin Epigenet 11, 101 (2019) [0129] Kashiwagi M T T, Hara K, Suzuki S, Wakamiya E, Shimizu T, et al. (2004) Sleepiness due to Wernicke's encephalopathy with bilateral hypothalamic lesion in a 5-year-old girl. Sleep Suppl: A315. [0130] Latorre D, Kallweit U, Armentani E, Foglierini M, Mele F, Cassotta A, Jovic S, Jarrossay D, Mathis J, Zellini F, Becher B, Lanzavecchia A, Khatami R, Manconi M, Tafti M, Bassetti C L, Sallusto F (2018) T cells in patients with narcolepsy target self-antigens of hypocretin neurons. Nature 562:63-68. [0131] Lewin J, Schmitt A O, Adorjan P, Hildmann T, Piepenbrock C (2004) Quantitative DNA methylation analysis based on four-dye trace data from direct sequencing of PCR amplificates. Bioinformatics 20:3005-3012. [0132] Li L C, Dahiya R (2002) MethPrimer: designing primers for methylation PCRs. Bioinformatics 18:1427-1431. [0133] Liu X S, Wu H, Krzisch M, Wu X, Graef J, Muffat J, Hnisz D, Li C H4, Yuan B, Xu C, Li Y, Vershkov D, Cacace A, Young R A, Jaenisch R—Rescue of Fragile X Syndrome Neurons by DNA Methylation Editing of the FMR1 Gene. Cell. 2018 Feb. 22;172(5):979-992.e6. doi: 10.1016/j.cell.2018.01.012. Epub 2018 Feb. 15. [0134] Medina-Franco José L., Yoo Jakyung, Dueñas-González Alfonso, Chapter 13—DNA Methyltransferase Inhibitors for Cancer Therapy, Editor(s): Y. George Zheng, Epigenetic Technological Applications, Academic Press, 2015, Pages 265-290 [0135] Nishino S, Ripley B, Overeem S, Lammers G J, Mignot E (2000) Hypocretin (orexin) deficiency in human narcolepsy. Lancet 355:39-40. [0136] Nozaki H, Shimohata T, Kanbayashi T, Sagawa Y, Katada S, Satoh M, Onodera O, Tanaka K, Nishizawa M (2009) A patient with anti-aquaporin 4 antibody who presented with recurrent hypersomnia, reduced orexin (hypocretin) level, and symmetrical hypothalamic lesions. Sleep Med 10:253-255. [0137] Oka Y, Kanbayashi T, Mezaki T, Iseki K, Matsubayashi J, Murakami G, Matsui M, Shimizu T, Shibasaki H (2004) Low CSF hypocretin-1/orexin-A associated with hypersomnia secondary to hypothalamic lesion in a case of multiple sclerosis. J Neurol 251:885-886. [0138] Peyron C et al. (2000) A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat Med 6:991-997. [0139] Pérez-Cárdenas E, Taja-Chayeb L, Trejo-Becerril C, Chanona-Vilchis J, Chávez-Blanco A, Domínguez-Gómez G, Langley E, García-Carrancá A, Dueñas-González A Antimetastatic effect of epigenetic drugs, hydralazine and valproic acid, in Ras-transformed NIH 3T3 cells. Onco Targets Ther. 2018 Dec. 7;11:8823-8833. doi: 10.2147/OTT.S187306. eCollection 2018. [0140] Schroeder N A (1952) The effect of 1-hydrasinophthalasine in hypertension. Circulation 5:28-37. [0141] Seifinejad A, Li S, Mikhail C, et al. Molecular codes and in vitro generation of hypocretin and melanin concentrating hormone neurons. Proc Natl Acad Sci USA. 2019;116(34):17061-17070. [0142] Tafti Met al. (2014) DQB1 locus alone explains most of the risk and protection in narcolepsy with cataplexy in Europe. Sleep 37:19-25. [0143] Tampe B, Tampe D, Zeisberg E M, Muller G A, Bechtel-Walz W, Koziolek M, Kalluri R, Zeisberg M (2015) Induction of Tet3-dependent Epigenetic Remodeling by Low-dose Hydralazine Attenuates Progression of Chronic Kidney Disease. EBioMedicine 2:19-36. [0144] Vassalli A, Li S, Tafti M (2015) Comment on “Antibodies to influenza nucleoprotein cross-react with human hypocretin receptor 2”. Sci Transl Med 7:3141e312. [0145] Xu X, Tao Y, Gao X, Zhang L, Li X, Zou W, Ruan K, Wang F, Xu GL, Hu R. A CRISPR-based approach for targeted DNA demethylation. (2016) Cell Discov. May 3 [0146] Yokota, Toshifumi, Maruyama, Rika, Gapmers—Methods and Protocols, Springer protocols, 2020. [0147] Zambrano P, Segura-Pacheco B, Perez-Cardenas E, Cetina L, Revilla-Vazquez A, Taja-Chayeb L, Chavez-Blanco A, Angeles E, Cabrera G, Sandoval K, Trejo-Becerril C, Chanona-Vilchis J, Duenas-Gonzalez A (2005) A phase I study of hydralazine to demethylate and reactivate the expression of tumor suppressor genes. BMC Cancer 5:44. [0148] Zapata et al., Protein Eng. 8(10): 1057-1062 (1995)