Allele-specific silencing therapy for DFNA9 using antisense oligonucleotides

Abstract

The invention relates to the fields of medicine and immunology. In particular, it relates to novel antisense oligonucleotides that may be used in the treatment, prevention and/or delay of an COCH associated condition.

Claims

1. An antisense oligonucleotide moiety for the specific degradation of a mutated COCH transcript that binds to and/or is complementary to a polynucleotide with the nucleotide sequence as set forward in SEQ ID NO: 1 or in SEQ ID NO: 2.

2. An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1, wherein the antisense oligonucleotide comprises an RNA residue, a DNA residue, and/or a nucleotide analogue or equivalent, preferably wherein the antisense oligonucleotide comprises both RNA and DNA residues.

3. An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1, wherein the antisense nucleotide is a gapmer.

4. An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1, wherein the antisense oligonucleotide has a length of from about 8 to about 40 nucleotides, preferably from about 10 to about 40 nucleotides, more preferably from about 14 to about 30 nucleotides, more preferably from about 16 to about 24 nucleotides, such as 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

5. An antisense oligonucleotide for the degradation of a mutated COCH according to claim 1, wherein said antisense oligonucleotide comprises or consists of an oligonucleotide with the sequence as set forward in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33, 34, 35, 50, 53, 54, 55, 56 or 57.

6. An antisense oligonucleotide for the degradation of a mutated COCH according claim 1, comprising a 2′-O alkyl phosphorothioate modified nucleotide, such as a 2′-O-methyl modified ribose, a 2′-O-ethyl modified ribose, a 2′-O-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives.

7. A pharmaceutical composition comprising an antisense oligonucleotide for the degradation of a mutated COCH according to claim 1 and further comprising a pharmaceutically acceptable excipient.

8. A pharmaceutical composition according to claim 7, wherein the pharmaceutical composition is for administration into the cochlea.

9.-10. (canceled)

11. A method of treatment of a COCH related disease or condition requiring the degradation of mutated COCH (pre)mRNA in a subject in need thereof, comprising administration of an antisense oligonucleotide for the degradation of a mutated COCH as defined in claim 1.

12.-13. (canceled)

14. The method according to claim 11, wherein the COCH related disease or condition is a condition resulting in hearing impairment and/or vestibular dysfunction.

15. The method according to claim 11, wherein the COCH related disease or condition is a is a vestibulo-cochlear disorder.

16. The method according to claim 11, wherein the COCH related disease or condition is DFNA9.

17. The antisense oligonucleotide moiety according to claim 1, wherein the antisense oligonucleotide moiety binds to or is complementary to a polynucleotide part within SEQ ID NO: 1 or SEQ ID NO: 2.

18. The antisense oligonucleotide moiety according to claim 17, wherein the polynucleotide part has a nucleotide sequence selected from the group consisting of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26.

Description

DESCRIPTION OF THE FIGURES

[0087] FIG. 1: Schematic representation of the mutant-allele COCH haplotype analysis. A) A) Low frequency (<0.1 allele frequency) variants on the c.151C>T (p.P51S) haplotype. The 6 variants in intron 7 are c.629+1186T>C, c.629+1779delC, c.629+1807delA, c.629+1809A>C, c.629+1812A>T and c.630-208A>C. B) Low frequency (<0.1 allele frequency) variants on the c.263G>A (p.G88E) haplotype.

[0088] FIG. 2: Screening of different AON sequences that reduce the level of c.151C>T mutant COCH transcripts. A) Left panel: Relative mutant COCH expression levels after treatment with AONs complementary to c.151C>T mutation and surrounding sequence in COCH. Right panel: Relative mutant COCH expression levels after treatment with AON_X3a, complementary to the c.436+368_436+369 dupAG variant and surrounding sequence on the c.151C>T allele. All AONs were delivered in a 250 nM concentration. COCH expression is shown relative to the expression of the housekeeping gene RPS18. B) Relative mutant COCH expression levels after treatment with AONs complementary to c.436+368_436+369 dupAG variant and surrounding region, which is located on the c.151C>T mutant COCH allele. All AONs were delivered at a concentration of 250 nM. COCH expression is shown relative to the expression of the housekeeping gene RPS18.

[0089] FIG. 3: Concentration series of identified effective AONs. A) AONs were delivered in two (X1b, left panel) or three (X1e (middle panel) and X3a (right panel)) different concentrations. A significant reduction in COCH transcript levels was observed upon transfection of AON_X1b and X1e as compared to untransfected controls. Bars represent the mean mutant COCH expression relative to RPS18. **P<0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test. B) Gapmer compositions of AONs X1e (left panel), X1f (middle panel) and X3a (right panel) were delivered in three different concentrations. A significant reduction in COCH transcript levels was observed upon transfection of all three AONs in gapmer composition as compared to untransfected controls. Bars represent the mean mutant COCH expression relative to RPS18. **P<0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test.

[0090] FIG. 4: AON treatment of mutant and wildtype COCH-expressing T-REx 293 cells. A) AON treatment of mutant COCH expressing cells results in a significant reduction of mutant COCH transcripts. No difference in effect size is observed after supplementing cells with AON_X1b (targeting the region containing the c.151C>T mutation (white bar)) or AON_X3a (targeting the region containing the c.436+368_436+369 dupAG variant (grey bar)), both residing on the same allele. B) AON treatment of wildtype COCH-expressing cells shows that both the AON_X1b and AON_X3a do not affect wildtype COCH transcript levels. Both graphs depict the result of 3 replicate experiments (N=7-11 measurements). ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test.

[0091] FIG. 5: AON treatment of mutant and wildtype COCH-expressing T-REx 293 cells with continuous induction of COCH expression. A) AON treatment of mutant COCH expressing cells with gapmer AONs X1e, X1f and X3a results in a significant reduction of mutant COCH transcripts. B) AON treatment of wildtype COCH-expressing cells shows that none of the four AONs affect wildtype COCH transcript levels. Bars represent the average of 3 replicates, *P 0.05, **P 0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test.

[0092] FIG. 6. AON treatment of HEK-293T cells transiently transfected with c.263G>A mutant COCH plasmids. AON_X4a treatment of c.263G>A mutant COCH expressing cells, resulting from a transient transfection, resulted a significant decrease in mutant COCH transcripts at both 100 nM and 250 nM concentrations. Bars represent the average of 3-6 replicates, **P 0.01, ***P<0.001, One-Way ANOVA with Tukey's multiple comparison test.

DESCRIPTION OF THE SEQUENCES

[0093]

TABLE-US-00001 TABLE 1 Sequences SEQ ID NO: Name 1 mRNA COCH c.151C > T 2 mRNA COCH c.263G > A 3 Target c.151C > T + 10 4 Target c.151C > T + 5 5 Target c.151C > T 6 Target c.436 + 368_436 + 369dupAG + 10 7 Target c.436 + 368_436 + 369dupAG + 5 8 Target c.436 + 368_436 + 369dupAG 9 Target c.629 + 1779delC + 10 10 Target c.629 + 1779delC + 5 11 Target c.629 + 1779delC 12 Target c.629 + 1807delA and c.629 + 1809A > C and c.629 + 1812A > T + 10 13 Target c.629 + 1807delA and c.629 + 1809A > C and c.629 + 1812A > T + 5 14 Target c.629 + 1807delA and c.629 + 1809A > C and c.629 + 1812A > T 15 Target c.630 − 208A > C + 10 16 Target c.630 − 208A > C + 5 17 Target c.630 − 208A > C 18 Target c.734 − 304T > G + 10 19 Target c.734 − 304T > G + 5 20 Target c.734 − 304T > G 21 Target c.1477 + 9C > A + 10 22 Target c.1477 + 9C > A + 5 23 Target c.1477 + 9C > A 24 Target c.263G > A + 10 25 Target c.263G > A + 5 26 Target c.263G > A 27 AON X1a 28 AON X1b 29 AON X1c 30 AON X1d 31 AON X1e 32 AON X1f 33 AON X1g 34 AON X1h 35 AON X3a 36 Primer 37 Primer 38 Primer 39 Primer 40 Primer 41 Primer 42 Primer 43 Primer 44 Primer 45 Primer 46 Primer 47 Primer 48 Primer 49 Primer 50 AON_X4a 51 Primer 52 Primer 53 AON_X3b 54 AON_X3c 55 AON_X3d 56 AON_X3e 57 AON_X3f

EXAMPLES

Materials and Methods

[0094] Identification of Mutant Allele-Specific Variants in COCH DNA samples of three seemingly unrelated DFNA9 patients carrying the c.151C>T mutation, and one sample from a patient carrying the c.263G>A mutation, were selected for long-read single-molecule (SMRT) sequencing (Pacific Biosciences) to identify shared variants on the mutant allele. The genomic COCH sequence was divided in overlapping fragments (FIG. 1A), which were amplified with Q5 polymerase (NEB) and primers 5′-GAAGTTCGGTTCTCAGGCC-3′ (SEQ ID NO: 36) and 5′-TGCCATCGTCATACAAAAGG-3′ (SEQ ID NO: 37) (fragment 1), 5′-CAAAATCTGGAATGGTATGGAAG-3′ (SEQ ID NO: 38) and 5′-GATCAAATGCAGACCTAGCC-3′ (SEQ ID NO: 39) (fragment 2) and 5′-TCCCCTGCAGTACTTTTTGTC-3′ (SEQ ID NO: 40) and 5′-GTAAGCCAGCTTACAATAACTC-3′ (SEQ ID NO: 41) (fragment 3). Sequence results for the individual fragments were assembled based on the presence of haplotype-specific variants. Identified mutant allele-specific variants with an allele frequency<0.1 in the non-Finnish European population were validated by Sanger sequencing and segregation analysis in two seemingly unrelated families with DFNA9.
Generation of a Stable Cell Line with TET-Inducible COCH Expression.

[0095] The genomic regions of wildtype and mutant COCH exons 1 to 7 (transcript variant 1; Ref.Seq. NM_001135058.1), including the haplotype specific variants, were amplified from the translation initiation site to the splice donor site of exon 7 using primers 5′-ATGTCCGCAGCCTGGATC-3′ (SEQ ID NO: 42) and 5′-GGCTTGAACAAGGCCCACA-3′ (SEQ ID NO: 43). These sequences were subsequently cloned into the pgLAP1 vector using Gateway cloning technology (Invitrogen). Upon sequence validation, pgLAP1-wtCOCH and pgLAP1-P51S-COCH constructs were co-transfected with pOGG44, encoding Flp-Recombinase, in Flp-in™ T-REx™ 293 cells using polyethylenimine. Cells in which the COCH sequence was stably integrated within the genome were selected in DMEM media containing 100 μg/ml hygromycin. Hygromycin-resistant colonies were expanded and subsequently tested for induction of expression by tetracycline using an allele-specific TaqMan assay.

Delivery of RNase H1-Dependent Antisense Oligonucleotides

[0096] Wildtype and mutant COCH-expressing Flp-in™ T-REx™ 293 cells were cultured in high glucose DMEM-AQ (Sigma Aldrich, Saint Louis, USA) supplemented with 10% Fetal Calf Serum, 1% Penicillin/Streptomycin, Sodium Pyruvate, 15 ug/ml blasticidin and 100 ug/ml hygromycin. Cells were seeded in 12-well or 24-well plates at a confluency of .sup.˜50%. Next day, culture medium was replaced with medium containing 0.25 μg/ml tetracycline to induce transcript of the introduced COCH gene. After twenty hours, tetracycline-containing medium was refreshed, and cells were transfected with AONs (for AONs used see table 2) using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions, in a 1:2 ratio of AON (in μg) and lipofectamine reagent (in μl). AON doses are calculated as final concentration in the culture medium. 24 hours after transfection, cells were sampled to quantify COCH transcript levels. To specifically investigate COCH transcript degradation, tetracycline induction of COCH expression was terminated by replacement of the culture medium with Optimem (Sigma Aldrich) prior to transfection. In these experiments, cells were sampled 5 hours after transfection.

TABLE-US-00002 TABLE 2 AONs tested SEQ ID AON NO Target Sequence X1a 27 C.151C > T CCUGAGCAGAGGACATCUGC X1b 28 C.151C > T CCCTGAGCAGAGGACATCUG X1c 29 C.151C > T CCCCTGAGCAGAGGACAUCU X1d 30 C.151C > T TGAGCAGAGGACATCTGCTT X1e 31 C.151C > T AGCCCCCTGAGCAGAGGACA X1f 32 C.151C > T GCAGCCCCCTGAGCAGAGGA X1g 33 C.151C > T CTGAGCAGAGGACATCTGCT X1h 34 C.151C > T CCCTGAGCAGAGGACATCTG X3a 35 c.436 + 368_436 + ATAGCTAGACCTCTGTCTAA 369dupAG X3b 53 c.436 + 368_436 + UCAUAGCTAGACCTCTGUCU 369dupAG X3c 54 c.436 + 368_436 + AUCATAGCTAGACCTCUGUC 369dupAG X3d 55 c.436 + 368_436 + CAUCATAGCTAGACCTCUGU 369dupAG X3e 56 c.436 + 368_436 + AGCTAGACCTCTGTCTAAAA 369dupAG X3f 57 c.436 + 368_436 + UAGCTAGACCTCTGTCUAAA 369dupAG X4a 50 c.263G > A AUAGACTCGTACAGGUUCCC

Delivery of RNase H1-Dependent Antisense Oligonucleotides to Transiently Transfected Cells.

[0097] Regular HEK-293T cells were cultured in high glucose DMEM-AQ (Sigma Aldrich, Saint Louis, USA) supplemented with 10% Fetal Calf Serum, 1% Penicillin/Streptomycin and 1 mM Sodium Pyruvate. Cells were seeded in 12-well plates in a volume of 1 ml/well, to reach a confluency of ±70% on the day of transfection. Prior to transfection, culture medium was replaced with 1 ml fresh medium. Cells were transfected with a combination of 500 ng of plasmid expressing c.263G>A COCH (SEQ ID NO: 2), and an allele-specific AON X4a (SEQ ID NO: 50) to a final concentration of 250 nM in the culture medium. Transfections were conducted with polyethylenimine (PEI) as described in Roosing et al, 2014. 24 hours post-transfection, cells were sampled for RNA analysis and quantification of COCH transcript levels.

RNA Extraction and cDNA Synthesis

[0098] Total RNA was extracted from cells using Trizol Reagent (Invitrogen) according to manufacturer's instructions. First strand cDNA was generated using the iScript gDNA clear cDNA synthesis kit (Bio-Rad, Hercules, USA) using a fixed amount of RNA input (250 ng) in a 10 ul reaction volume. The obtained cDNA was diluted four times and used for transcript analysis.

Quantification of COCH Transcript Levels

[0099] Four microliters of diluted cDNA was used as input in an allele-specific TaqMan assay using primers 5′-GGACATCAGGAAAGAGAAAGCAGAT-3′ (SEQ ID NO: 44) and 5′-CCCATACACAGAGAATTCCTCAAGAG-3′ (SEQ ID NO: 45), a wildtype allele-specific VIC-labeled probe 5′-CCCCCTGGGCAGAG-3′(SEQ ID NO: 46) and a mutant allele-specific FAM-labeled probe 5′-CCCCCTGAGCAGAG-3′ (SEQ ID NO: 47). Abundance of mutant and wildtype COCH transcripts was calculated relative to the expression of the housekeeping gene RPS18, and normalized to TET-induced samples without AON treatment. Primers used to amplify RPS18 are 5′-ATACAGCCAGGTCCTAGCCA-3′ (SEQ ID NO: 48) and 5′-AAGTGACGCAGCCCTCTATG-3′ (SEQ ID NO: 49).

Results

Identification of Therapeutic Targets

[0100] Due to the non-haploinsufficiency mechanism of disease underlying DFNA9, blocking the transcription of or translation from the mutant allele has the potential to halt the progression of the disease. For the development of an antisense oligonucleotide-based therapeutic strategy, reliable discrimination between the mutant and the wildtype allele is of vital importance. Targeting the disease-causing mutation is a commonly used option to discriminate between alleles. However, the disease-causing mutations of DFNA9 are mostly single nucleotide substitutions, leaving little room to design a reliable and robust allele-specific therapy. We sequenced the complete wildtype and mutant alleles of DFNA9 patients with the frequently occurring founder mutations c.151C>T and c.263G>A to identify additional mutant allele-specific variants that can used as targets for the development of antisense therapy. This resulted in the identification of 12 additional intronic variants in cis with the c.151C>T mutation in COCH (FIG. 1A; Table 3), with an allele frequency between 0.04 and 0.1 in the non-Finnish European population according to the GnomAD database (https://gnomad.broadinstitute.org/).

TABLE-US-00003 TABLE 3 Allele-specific variants in the c.151C > T mutant COCH haplotype with an allele frequency <0.1. AA freq. GnomAD Eur location position identifier c. HGVS change non-Finnish e4 69 (151) [chr14: g.31346846 (GRCh37/hg19)] rs28938175 c.151C > T Pro51Ser n.a. i4 −239 [chr14: g.31347778 (GRCh37/hg19)] rs143609554 c.240 − 239A > T T: 0.05378 i6 +185 [chr14: g.31348876 (GRCh37/hg19)] rs7140538 c.436 + 185G > T T: 0.05481 i6 +370/2 bp [chr14: g.31349060_31349061 rs10701465 c.436 + 368_436 + dupAG: 0.05476 (GRCh37/hg19)] 369dupAG i8 +1186 [chr14: g.31351126 (GRCh37/hg19)] rs186627205 c.629 + 1186T > C C: 0.05432 i8 +1779/1 bp [chr14: g.31351719 (GRCh37/hg19)] rs200080665 c.629 + 1779delC delC: 0.05399 i8 +1807/1 bp [chr14: g.31351747 (GRCh37/hg19)] rs368638521 c.629 + 1807delA n.a. i8 +1809 [chr14: g.31351749 (GRCh37/hg19)] rs554238963 c.629 + 1809A > C C: 0.0994 (dbSNP) i8 +1812 [chr14: g.31351752 (GRCh37/hg19)] rs184635675 c.629 + 1812A > T T: 0.05427 i8 −208 [chr14: g.31353551 (GRCh37/hg19)] rs2295128 c.630 − 208A > C C: 0.05253 i9 −304 [chr14: g.31354296 (GRCh37/hg19)] rs28362773 c.734 − 304T > G G: 0.07141 i11 +9 [chr14: g.31355527 (GRCh37/hg19)] rs17097458 c.1477 + 9C > A A: 0.05364 i11 −1474/1 bp [chr14: g.31357348 (GRCh37/hg19)] rs398024681 c.1478 − 1474delT n.a.

Antisense Oligonucleotides Complementary to Sequences Containing Allele-Discriminating Variants Significantly Reduce Mutant COCH Transcript Levels.

[0101] As frequently-used patient-derived cell models, such as fibroblasts, hardly express the COCH gene, we generated stable transgenic cell models in which mutant or wildtype COCH alleles can be expressed using a tetracycline-inducible promoter. To identify AONs with the ability to degrade mutant COCH transcripts, cells were seeded in multi-well plates, and subsequently treated with tetracycline to induce COCH expression. Next, cells were treated with different AONs complementary to the c.151C>T mutation and flanking sequence (target X1, FIG. 2A, left panel). In this initial screen to identify the optimal AON sequences, a single well was transfected per AON sequence, with the exception of AON_X1b. Except for AON_X1a, all AONs directed against target X1 resulted in a reduction of mutant COCH transcript levels. In a separate experiment, the potential of AON X3a (complementary to the c.436+368_436+369 dupAG variant and surrounding sequence on the c.151C>T COCH allele; target X3) to degrade mutant COCH transcripts was analyzed (in triplo) using a dose of 250 nM (FIG. 2A, right panel). Transfection of cells with AON X3a indeed also resulted in a reduction of c.151C>T COCH transcript levels. Upon the observed reduction of c.151C>T COCH transcript levels after treatment with AON X3a, we investigated a mixture of gapmer and non-gapmer AON sequences directed against the c.436+368_436+369 dupAG variant for their ability reduce c.151C>T COCH transcript levels (FIG. 2B). In particular, treatment of cells with AONs X3a, X3b, X3e and X3g resulted in a decrease in c.151C>T COCH transcript levels.

[0102] The ability of AON X1b, X1e and X3a to induce the degradation of c.151C>T-containing COCH transcripts was subsequently investigated using an AON concentration of 25, 100 and 250 nM (FIG. 3). Quantitative analyses revealed that AON X1b and X1e were able to degrade c.151C>T COCH transcripts in a dose-dependent manner. For AON X3a, a mild decrease of c.151C>T COCH transcript levels was observed at a concentration of 100 nM (p=0.07). In FIG. 3A, AON X1b (left panel), but not AONs X1e (middle panel) and X3a (right panel) had a gapmer composition. Therefore, we next investigated the effect of AON sequences X1e and X3a in gapmer composition (FIG. 3B) at concentrations of 100 and 250 nM. We furthermore included a third AON directed against the c.151C>T target (AON X1f). Quantitative analyses revealed that gapmer AON X1e was able to degrade c.151C>T COCH transcripts in a dose-dependent manner (FIG. 3B, left panel). In addition, gapmer AONs X1f and X3e also resulted in a significant decrease of c.151C>T mutant COCH transcripts compared to cells treated with a control AON. In contrast with AON X1e, the maximum reduction in mutant COCH transcript level appears to be already achieved at the lowest dose tested (FIG. 3B, middle and right panel).

[0103] To show that the AON molecules indeed increased degradation of COCH transcripts, and not interfered with the induction of COCH expression, a second experimental paradigm was used. Cells were seeded and subsequently treated with tetracycline to induce COCH expression. After 20 hours, tetracycline was washed away to stop the induction of COCH expression. From this moment onwards, COCH transcripts undergo natural breakdown at a speed that can be increased by the delivery of AONs complementary to the target sequence. In this paradigm, we furthermore investigated the allele-specificity of the different AONs.

[0104] Upon transfection in the mutant (c.151C>T) COCH-expressing T-REx 293 cells, AON_X1b (directed at the region containing the c.151C>T mutation) and AON_X3a (directed at the region containing the c.436+368_436+369 dupAG variant), both resulted in a significant reduction of mutant COCH transcript levels as compared to untreated cells. Using this experimental setup, no difference in effect size between AONs directed at the different targets was observed. Furthermore, both AONs show a high binding specificity for the c.151C>T-mutant COCH allele, as no decrease in wildtype COCH transcript levels is observed when wildtype COCH-expressing T-REx 293 cells were transfected with these AONs (FIG. 4B).

[0105] Thus, these data nicely show that the AONs induce increase breakdown of c.151C>T COCH transcripts. We additionally, investigated the effects of selected AONs under continuous COCH transcription (FIG. 5). This situation better resembles the continuous expression of COCH in the human cochlea. Transfection of c.151C>T mutant COCH expressing cells with 100 nM AONs X1e, X1f and X3a resulted in a significant decrease of c.151C>T COCH transcripts as compared to control transfected cells (FIG. 5A). Transfection of the same cells with AON X1b, effective under halted COCH transcription (FIG. 4), resulted in a non-significant decrease of mutant COCH transcripts. Likely higher concentrations of AON X1b, are required to induce as significant decrease in mutant COCH transcript levels under continuous COCH transcription. Transfection of the same AONs in cells expressing wildtype COCH transcripts, had no significant effect on the levels of wildtype COCH transcripts as compared to control transfected cells, indicating specificity for the mutant allele for these AONs (FIG. 5B).

[0106] The fact that AON_X3a targets an intronic variant that is specific to the c.151C>T mutant COCH allele, and AON_X1f targets the mutation itself, have result in a similar decrease in mutant COCH transcripts, indicates that targeting mutant allele-specific variants is also a powerful method to decrease mutant COCH transcript levels.

[0107] Finally, we investigated the effect of AONs specific to the c.263G>A mutant COCH allele. The c.263G>A mutation, was discovered as a founder mutation in the America population, and also leads to DFNA9. We co-transfected plasmids encoding c.263G>A mutant COCH with AON_X4a in regular HEK-293T cells. AON_X4a was able to induce a significant decrease in c.263G>A mutant COCH transcripts (FIG. 6).

CONCLUSION

[0108] Overall, our results demonstrate that the delivery of antisense oligonucleotides can be used to specifically decrease the levels of mutant COCH transcripts. DFNA9 is a dominantly inherited disease, where the protein encoded by the mutant COCH gene interferes with normal function of the cochlea and the vestibular organ. DFNA9 patients all have a single healthy copy of the COCH gene that, in absence of mutant cochlin proteins, is sufficient for normal function of the inner ear (Robertson et al., 2008; JanssensdeVarebeke et al., 2018). Therefore, AONs according to the invention can be used in the treatment of human subjects suffering from hearing impairment and/or vestibular dysfunction due to mutations in the COCH gene.

REFERENCES

[0109] Bom S J H, Kemperman M H, Huygen P L M, Luijendijk M W J, Cremers C W R J. Cross-sectional analysis of hearing threshold in relation to age in a large family with cochleovestibular impairment thoroughly genotyped for DFNA9/COCH. Ann. Otol. Rhinol. Laryngol. 2003 March; 112(3):280-6. [0110] Crosby J R, Zhao C, Jiang C, Bai D, Katz M, Greenlee S, et al. Inhaled ENaC antisense oligonucleotide ameliorates cystic fibrosis-like lung disease in mice. J. Cyst. Fibros. 2017 November; 16(6):671-80. [0111] de Kok Y J, Born S J, Brunt T M, Kemperman M H, van Beusekom E, van der Velde-Visser S D, et al. A Pro51Ser mutation in the COCH gene is associated with late onset autosomal dominant progressive sensorineural hearing loss with vestibular defects. Hum Mol Genet. 1999 February; 8(2):361-6. [0112] Gallant E, Francey L, Fetting H, Kaur M, Hakonarson H, Clark D, et al. Novel COCH mutation in a family with autosomal dominant late onset sensorineural hearing impairment and tinnitus. Am J Otolaryngol. 2013 May; 34(3):230-5. [0113] Ikezono T, Omori A, Ichinose S, Pawankar R, Watanabe A, Yagi T. Identification of the protein product of the Coch gene (hereditary deafness gene) as the major component of bovine inner ear protein. Biochim Biophys Acta. 2001 Mar. 26; 1535(3):258-65. [0114] JanssensdeVarebeke SPF, Van Camp G, Peeters N, Elinck E, Widdershoven J, Cox T, et al. Bi-allelic inactivating variants in the COCH gene cause autosomal recessive prelingual hearing impairment. Eur. J. Hum. Genet. Nature Publishing Group; 2018 Feb. 15; 23:42. PMCID: PMC5891501 [0115] Jones S M, Robertson N G, Given S, Giersch A B S, Liberman M C, Morton C C. Hearing and vestibular deficits in the Coch(−/−) null mouse model: comparison to the Coch(G88E/G88E) mouse and to DFNA9 hearing and balance disorder. Hear. Res. 2011 February; 272(1-2):42-8. PMCID: PMC3039082 [0116] Jung J, Yoo J E, Choe Y H, Park S C, Lee H J, Lee H J, et al. Cleaved Cochlin Sequesters Pseudomonas aeruginosa and Activates Innate Immunity in the Inner Ear. Cell Host & Microbe. Cell Press; 2019 Apr. 10; 25(4):513-6. [0117] Kommareddi P K, Nair T S, Raphael Y, Telian S A, Kim A H, Arts H A, et al. Cochlin isoforms and their interaction with CTL2 (SLC44A2) in the inner ear. J. Assoc. Res. Otolaryngol. 2007 December; 8(4):435-46. PMCID: PMC2538338 [0118] Kordasiewicz H B, Stanek L M, Wancewicz E V, Mazur C, McAlonis M M, Pytel K A, et al. Sustained therapeutic reversal of Huntington's disease by transient repression of huntingtin synthesis. Neuron. 2012 Jun. 21; 74(6):1031-44. PMCID: PMC3383626 [0119] Liang X-H, Sun H, Nichols J G, Crooke S T. RNase H1-Dependent Antisense Oligonucleotides Are Robustly Active in Directing RNA Cleavage in Both the Cytoplasm and the Nucleus. 2017 Sep. 6; 25(9):2075-92. Retrieved from: http://linkinghub.elsevier.com/retrieve/pii/S1525001617302629 [0120] Nagy I, Trexler M, Patthy L. The second von Willebrand type A domain of cochlin has high affinity for type I, type II and type IV collagens. Febs Lett. John Wiley & Sons, Ltd; 2008 Dec. 10; 582(29):4003-7. [0121] Robertson N G, Cremers C W R J, Huygen P L M, Ikezono T, Krastins B, Kremer H, et al. Cochlin immunostaining of inner ear pathologic deposits and proteomic analysis in DFNA9 deafness and vestibular dysfunction. Hum Mol Genet. 2006 Apr. 1; 15(7):1071-85. [0122] Robertson N G, Jones S M, Sivakumaran T A, Giersch A B S, Jurado S A, Call L M, et al. A targeted Coch missense mutation: a knock-in mouse model for DFNA9 late-onset hearing loss and vestibular dysfunction. Hum Mol Genet. Oxford University Press; 2008 Nov. 1; 17(21):3426-34. PMCID: PMC2566528 [0123] Robertson N G, Lu L, Heller S, Merchant S N, Eavey R D, McKenna M, et al. Mutations in a novel cochlear gene cause DFNA9, a human nonsyndromic deafness with vestibular dysfunction. Nat. Genet. 1998 November; 20(3):299-303. [0124] Vickers T A, Crooke S T. Antisense Oligonucleotides Capable of Promoting Specific Target mRNA Reduction via Competing RNase H1-Dependent and Independent Mechanisms. Buratti E, editor. PLoS One. 2014 Oct. 9; 9(10):e108625. [0125] Wang L, Kempton J B, Brigande J V. Gene Therapy in Mouse Models of Deafness and Balance Dysfunction. Front Mol Neurosci. 2018; 11:300. PMCID: PMC6123355 [0126] Yao J, Py B F, Zhu H, Bao J, Yuan J. Role of protein misfolding in DFNA9 hearing loss. Journal of Biological Chemistry. American Society for Biochemistry and Molecular Biology; 2010 May 14; 285(20):14909-19. PMCID: PMC2865277 [0127] Roosing, S., Lamers, I. J. C., de Vrieze, E., van den Born, L. I., Lambertus, S., Arts, H. H., et al. Disruption of the basal body protein POC1B results in autosomal-recessive cone-rod dystrophy. American Journal of Human Genetics; 2014, 95(2), 131-142. PMCID: PMC4129401