Polyporus squamosus-derived recombinant lectin specific for sialic acid linkage

10281460 ยท 2019-05-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for producing a Polyporus squamosus-derived PSL1b recombinant lectin, which binds specifically to sialic acid containing glycoconjugates, from an Escherichia coli PSL1b strain (deposit number: KCTC12507BP) or a Pichia pastoris PSL1b strain (deposit number: KCTC12500BP) and a lectin produced thereby. The recombinant lectin of the present invention can be useful as an active ingredient of a composition or a kit for measuring or detecting glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having sialic acid moieties.

Claims

1. A method for preparing an active recombinant lectin of mushroom Polyporus squamosus-derived PSL1b binding specifically to alpha(2,6)-linked sialic acid comprising the following steps: a) culturing a transformant transfected with an expression vector comprising a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 1 encoding the lectin binding specifically to alpha(2,6)-linked sialic acid; and b) separating and purifying the active recombinant lectin binding specifically to alpha(2,6)-linked sialic acid from the culture product of step (a).

2. The method according to claim 1, wherein the transformant is a bacteria or a yeast.

3. The method according to claim 2, wherein the bacteria are selected from the group consisting of Staphylococcus aureus, E. coli, B. cereus, Salmonella typimurium, Salmonella choleraesuis, Yersinia enterocolitica, and Listeria monocytogenes.

4. The method according to claim 2, wherein the yeast is selected from the group consisting of Pichia, Saccharomyces, Kluyveromyces, Yallowia, Hansenula, and Candida.

5. The method according to claim 1, wherein the transformant is cultured in a solution containing isopropyl-D-thiogalactopyranoside (IPTG).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:

(2) FIG. 1 is a schematic diagram illustrating the plasmid pET-PSL1b 8 His expressing the recombinant lectin PSL1b binding specifically to alpha(2,6) sialic acid originated from Polyporus squamosus which has been chemically synthesized in E. coli.

(3) FIG. 2 is a schematic diagram illustrating the plasmid pPICZ-PSL1b 8 His expressing the recombinant lectin PSL1b binding specifically to alpha(2,6) sialic acid originated from Polyporus squamosus which has been chemically synthesized in yeast.

(4) FIG. 3 is a diagram illustrating the recombinant lectin produced in E. coli, confirmed by SDS-PAGE.

(5) FIG. 4 is a diagram illustrating the recombinant lectin produced in yeast, confirmed by SDS-PAGE.

(6) FIG. 5 is a diagram illustrating the result of lectin blotting presenting the measurement of alpha(2,6) sialic acid of the sialylated glycoprotein added with sialic acid on the asialofetuin mediated by (2,6)-sialyltransferase by using the recombinant lectin PSL1b.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

(7) Hereinafter, the present invention is described in detail.

(8) The present invention provides a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 1 encoding lectin binding specifically to alpha(2,6) sialic acid.

(9) The present invention also provides a polypeptide composed of the amino acid sequence represented by SEQ. ID. NO: 2.

(10) The present invention also provides an expression vector comprising the polynucleotide above.

(11) The present invention also provides a transformant transfected by the expression vector above.

(12) The present invention also provides a bacterial transformant transfected by the expression vector above.

(13) The bacteria above are preferably selected from the group consisting of Staphylococcus aureus, E. coli, B. cereus, Salmonella typimurium, Salmonella choleraesuis, Yersinia enterocolitica, and Listeria monocytogenes, and among these E. coli is more preferred.

(14) In a preferred embodiment of the present invention, the present inventors screened gene sequence candidates by using query sequences provided by National Center for Biotechnology Information (NCBI, accession no. AB120707) in order to produce the Polyporus squamosus-derived recombinant lectin protein. Based on the sequences screened by the present inventors, the polynucleotide in 879 bp containing guanine and cytosine 44.7% via codon optimization and RNA secondary structure optimization was chemically synthesized at DNA 2.0 Co (USA) in order to induce the optimum expression of the target gene in the heterologous host system. The polynucleotide sequence synthesized in the present invention and the polypeptide produced from the same by transcription and translation are represented by SEQ. ID. NO: 1 and SEQ. ID. NO: 2 respectively. Changes in the wild type gene encoding the Polyporus squamosus-derived lectin PSL1b and the chemically synthesized gene (see Table 1) and codon (see Table 2) were presented. Based on the polynucleotide gene information confirmed before, the primers represented by SEQ. ID. NO: 3 and SEQ. ID. NO: 4 were constructed in order to clone the lectin protein in the E. coli expression vector (see Table 3). Escherichia coli BL21-CodonPlus(DE3)-RIL was transfected with the recombinant plasmid pET-PSL1b 8 His (see FIG. 1) whose gene sequence had been identified in order to produce the recombinant PSL1b protein therein. The recombinant strain Escherichia coli PSL1b expressing the recombinant lectin PSL1b of the invention was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), on Nov. 1, 2013 (KCTC12507BP). Based on the polynucleotide gene information identified above, the primers represented by SEQ. ID. NO: 7 and SEQ. ID. NO: 8 were constructed in order to clone the lectin protein in the yeast expression vector (see Table 4). Pichia pastoris X-33 was transfected with the recombinant plasmid pPICZ-PSL1b 8 His (see FIG. 2) whose gene sequence had been identified in order to produce the recombinant lectin PSL1b therein. The recombinant strain Pichia pastoris PSL1b expressing the recombinant lectin PSL1b of the invention was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), on Oct. 7, 2013 (KCTC12500BP). After culturing the recombinant E. coli of the invention, target cells were obtained from the culture medium by centrifugation. To separate the recombinant lectin from the collected cells, HisTrap FF column chromatography was performed. As a result, the recombinant lectin was eluted. To purify the recombinant lectin eluted above, Superose 12 column chromatography was performed and as a result, proteins in different sizes were eluted. The eluted proteins were concentrated by using AmiconUltra Centrifugal filter 10K. The crude extract for the recombinant lectin purification obtained above proceeded to SDS-PAGE, followed by Coommassie Brilliant Blue staining. The purity and the molecular weight of the purified lectin protein were analyzed by using Precision Plus Protein Standards (Bio-Rad, USA) as the standard proteins. As a result, the size of the purified recombinant PSL1b protein separated from E. coli was confirmed to be about 32 kDa (see FIG. 3). In addition, in order to purify the recombinant lectin from yeast, the transfected recombinant yeast strain constructed by the method of the invention described above was cultured and the culture solution was collected. To separate yeast cells and the culture medium from the yeast culture solution, centrifugation was performed. The precipitate was eliminated and the supernatant was obtained. To purify the recombinant lectin from the crude enzyme solution above, HisTrap FF column chromatography was performed. As a result, the recombinant lectin was eluted. The eluted proteins were concentrated by using AmiconUltra Centrifugal filter 10K. The crude protein solution obtained above proceeded to SDS-PAGE, followed by Coommassie Brilliant Blue staining. The purity and the size of the purified lectin protein were analyzed by using Precision Plus Protein Standards (Bio-Rad, USA) as the standard proteins. As a result, the size of the recombinant PSL1b protein separated and purified from yeast was about 40 kDa, which was a little larger than that of the protein separated from E. coli. The increase of the size was presumed because of the potential 3 N-linked glycosylations containing the corresponding lectin sequence (see FIG. 4). To investigate the selective binding of the protein separated above, lectin blotting was performed. As a result, lectin blot signal was observed in the basic structure of N-linked glycan structure such as Neu5Ac(2,6)Gal(1,4)GlcNAc and in the fetuin containing O-linked glycan structure such as Neu5Ac (2,6)Gal, Neu5Ac (2,6)Gal(1,3)GalNA, Neu5Ac(2,6)[Gal(1,3)]GalNA, Neu5Ac(2,6)Gal(1,3)[Neu5Ac(2,6)]GalNAc], Neu5Ac(2,6)Gal(1,3)[Neu5Ac(2,6)Gal(1,4)GlcNAc(1,6)]GalNAc. However, any signal on the lectin-blotting membrane was not observed in the non-sialylated fetuin, the negative control, which contains Gal(1,4)GlcNAc for N-linked glycan and Gal, Gal(1,3)GalNA, [Gal(1,3)]GalNA, Gal(1,3)[Gal(1,4)GlcNAc(1,6)]GalNAc for O-linked glycans, and the fetuin containing alpha(2,3) sialic acid (bovine serum fetuin) (see FIG. 5), either.

(15) Therefore, the present invention relates to the active recombinant lectin protein of the Polyporus squamosus-derived isolectin PSL1b binding specifically to glycoconjugates containing alpha(2,6)-linked sialic acid moieties. The present invention provides a method for producing the Polyporus squamosus-derived PSL1b recombinant lectin, which specifically binds to sialic acid containing glycoconjugates, from an Escherichia coli PSL1b strain (deposit number: KCTC12507BP) or a Pichia pastoris PSL1b strain (deposit number: KCTC12500BP) and the lectin produced thereby. The recombinant lectin of the present invention can be effectively used for the measurement of glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having sialic acid moieties and as an active ingredient of the composition or the kit for the measurement or detection of the cell lines, bacteria, and viruses having sialoglycoconjugates.

(16) The present invention also provides a method for preparing the recombinant lectin binding specifically to alpha(2,6) sialic acid, comprising the following steps:

(17) (a) culturing the bacterial transformant of the invention; and

(18) (b) separating and purifying the recombinant lectin from the culture product of step (a).

(19) The present invention also provides a method for preparing the recombinant lectin binding specifically to alpha(2,6) sialic acid, comprising the following steps:

(20) (a) culturing the bacterial transformant above; and

(21) (b) separating and purifying the recombinant lectin from the culture product of step (a).

(22) The present invention also provides the recombinant lectin binding specifically to alpha(2,6) sialic acid prepared by the method above.

(23) The present invention also provides a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 5.

(24) The present invention also provides a polypeptide composed of the amino acid sequence represented by SEQ. ID. NO: 6.

(25) The polypeptide above preferably includes 8 histidine residues at C-terminal of the total amino acid sequence, but not always limited thereto.

(26) The present invention also provides a yeast transformant transfected with the expression vector above.

(27) The yeast herein is preferably selected from the group consisting of Pichia, Saccharomyces, Kluyveromyces, Yallowia, Hansenula, and Candida, and Pichia is more preferred.

(28) The present invention also provides a method for preparing the recombinant lectin binding specifically to alpha(2,6) sialic acid, comprising the following steps:

(29) (a) culturing the yeast transformant above; and

(30) (b) separating and purifying the recombinant lectin from the culture product of step (a).

(31) The present invention also provides the recombinant lectin binding specifically to alpha(2,6) sialic acid prepared by the method above.

(32) The present invention also provides a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 9.

(33) The present invention also provides a polypeptide composed of the amino acid sequence represented by SEQ. ID. NO: 10.

(34) The polypeptide above preferably includes the signal sequence for the secretory expression at N-terminal in the total amino acid sequence, but not always limited thereto.

(35) The present invention also provides a recombinant Escherichia coli strain deposited under the deposit number KCTC12507BP that can produce the recombinant lectin PSL1b protein binding specifically to alpha(2,6)sialic acid containing glycoconjugates.

(36) The present invention also provides a recombinant yeast (Pichia pastoris) strain deposited under the deposit number KCTC12500BP that can produce the recombinant lectin PSL1b protein binding specifically to alpha(2,6)sialic acid containing glycoconjugates.

(37) The present invention also provides a method for preparing the recombinant lectin binding specifically to alpha(2,6)sialic acid comprising the following steps:

(38) (a) culturing the strain above; and

(39) (b) separating and purifying the recombinant lectin from the culture product of step (a).

(40) The present invention also provides the recombinant lectin binding specifically to alpha(2,6)sialic acid prepared by the method above.

(41) The present invention also provides the lectin binding specifically to the sugar chain structure selected from the group consisting of the followings:

(42) sialylated glycan wherein NeuAc or NeuGc(2.fwdarw.6) is added to Gal or Glc residue;

(43) sialylated glycan wherein NeuAc or NeuGc(2.fwdarw.6) is added to Gal(1.fwdarw.4)Glc or Glc(1.fwdarw.4)Glc residue;

(44) sialylated glycan wherein NeuAc or NeuGc(2.fwdarw.6) is added to Gal(1.fwdarw.4)GlcNAc or Gal(1.fwdarw.3)GlcNAc residue;

(45) sialylated glycan wherein NeuAc or NeuGc(2.fwdarw.6) is added to Gal(1.fwdarw.3)[Fuc(1.fwdarw.4)]GlcNAc residue; and

(46) sialylated glycan wherein NeuAc or NeuGc(2.fwdarw.6) is added to Gal(1.fwdarw.4)[Fuc(1.fwdarw.3)]GlcNAc.

(47) The present invention also provides a kit for the measurement or quantification of glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having alpha(2,6)sialic acid moieties using the recombinant lectin of the invention.

(48) The present invention also provides the recombinant lectin PSL1b protein binding selectively to alpha(2,6)sialic acid containing glycoconjugates and having the size of 30 kDa60 kDa, which has been separated and purified by the method of the invention.

(49) The present invention also provides a kit for the monitoring, measurement or quantification of the cell lines, bacteria, or viruses having sialoglycoconjugates comprising alpha(2,6)sialic acid on the surface thereof using the recombinant lectin of the invention.

(50) The present invention also provides a use of the kit for the measurement or quantification of the glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having alpha(2,6)sialic acid containing glycoconjugates using the recombinant lectin of the invention.

(51) The present invention also provides a use of the kit for the monitoring, measurement or quantification of the cell lines, bacteria, or viruses having sialoglycoconjugates comprising alpha(2,6)sialic acid on the surface thereof using the recombinant lectin of the invention.

(52) The present invention also provides a method for the measurement or quantification of the sialylated glycoconjugates composed of the glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having sialic acid moieties, which comprises the following steps:

(53) (a) contacting the test sample to the recombinant lectin of the invention; and

(54) (b) analyzing the glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides binding to the lectin above.

(55) The present invention also provides a method for the measurement or quantification of the cell lines, bacteria, or viruses having sialic acid sugar chains, which comprises the following steps:

(56) (a) contacting the test sample to the recombinant lectin of the invention; and

(57) (b) analyzing the cells, bacteria, or viruses binding to the lectin above.

(58) The Escherichia coli PSL1b strain (Deposit No: KCTC12507BP) or Pichia pastoris PSL1b strain (Deposit No: KCTC12500BP) of the present invention can produce efficiently the Polyporus squamosus-derived PSL1b recombinant lectin binding specifically to sialic acid containing glycoconjugates, so that the strain of the invention can be effectively used as an active ingredient of a composition or a kit for measuring or detecting glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having sialic acid moieties.

(59) Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

(60) However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

Example 1: Synthesis of Gene for the Production of the Polyporus squamosus-Derived Recombinant Lectin Protein

(61) To produce the Polyporus squamosus-derived recombinant lectin protein, the following experiment was performed.

(62) Particularly, the gene information about the Polyporus squamosus-derived lectin was obtained by screening all the similar sequences by using query sequence of National center for Biotechnology Information (NCBI, accession no. AB120707). Based on the sequences screened by the present inventors, the polynucleotide in 879 bp containing guanine and cytosine 44.7% via codon optimization and RNA secondary structure optimization was chemically synthesized at DNA 2.0 Co (USA) in order to induce the optimum expression of the target gene in the heterologous host system. The polynucleotide sequence synthesized in the present invention and the polypeptide produced from the same by transcription and translation are represented by SEQ. ID. NO: 1 and SEQ. ID. NO: 2 respectively. The physical and chemical changes in the wild type gene encoding Polyporus squamosus-derived lectin PSL1b and in the chemically synthesized gene are shown in Table 1. The codon changes are presented in Table 2.

(63) TABLE-US-00001 TABLE 1 Chemically Content Wild type gene synthesized gene Size of polynucleotide (bp) 879 879 Gene identity (%) 100 77 Translated amino acid (a.a.) 293 293 GC content (%) 53.23 44.70 Stability of RNA 2.sup.nd structure 423.8 338.4 (G, kcal/mol)

(64) TABLE-US-00002 TABLE2 Content (%) Content (%) Content (%) Content (%) Wild Synthesized Wild Synthesized Wild Synthesized Wild Synthesized Codon type type Codon type type Codon type type Codon type type TTT 1.70 2.38 TCT 1.02 1.36 TAT 1.36 2.04 TGT 0.00 0.68 TTC 3.41 2.73 TCC 1.02 1.70 TAC 3.07 2.38 TGC 1.02 0.34 TTA 0.00 0.68 TCA 0.34 1.36 TAA 0.00 0.00 TGA 0.34 0.34 TTG 0.68 2.04 TCG 0.34 0.68 TAG 0.00 0.00 TGG 3.41 3.41 CTT 0.68 0.68 CCT 1.36 1.02 CAT 1.02 1.36 CGT 1.36 0.68 CTC 2.04 0.00 CCC 0.68 0.34 CAC 1.70 1.36 CGC 1.02 0.00 CTA 0.00 0.34 CCA 0.00 1.02 CAA 1.02 2.38 CGA 0.34 0.34 CTG 1.36 1.02 CCG 0.34 0.00 CAG 2.73 1.36 CGG 0.34 0.00 ATT 1.70 2.04 ACT 1.36 3.75 AAT 3.75 3.75 AGT 0.68 0.68 ATC 2.38 2.38 ACC 5.46 1.36 AAC 2.38 2.38 AGC 2.73 0.68 ATA 1.02 0.68 ACA 1.02 2.73 AAA 1.36 2.04 AGA 0.34 2.04 ATG 2.38 2.38 ACG 0.68 0.68 AAG 2.38 1.70 AGG 0.68 0.68 GTT 1.70 2.38 GCT 2.73 5.11 GAT 3.75 3.41 GGT 2.38 6.48 GTC 2.38 1.36 GCC 3.07 1.70 GAC 2.73 3.07 GGC 4.43 1.02 GTA 0.34 0.68 GCA 2.04 3.07 GAA 1.70 1.36 GGA 2.38 3.41 GTG 1.36 1.36 GCG 2.04 0.00 GAG 1.02 1.36 GGG 1.70 0.00

Example 2: Cloning and Construction of a Transformant Strain for the Production of the Polyporus squamosus-Derived Recombinant Lectin Protein from E. coli

(65) Polymerase chain reaction (PCR) was performed to produce the Polyporus squamosus-derived recombinant lectin protein from E. coli.

(66) Particularly, primers were constructed for the cloning of the lectin protein of Example 1 into the E. coli expression vector based on the gene information of the polynucleotide identified by the method of Example 1. As shown in Table 3, the constructed primers are represented by SEQ. ID. NO: 3 and SEQ. ID. NO: 4. Polymerase chain reaction (PCR) was performed by using the chemically synthesized polynucleotide as a template. PCR conditions for the amplification of the 897 gene encoding the said lectin gene were as follows: denaturation at 94 C. for 30 seconds, annealing at 52 C. for 30 seconds, extension at 72 C. for 1 minute 20 seconds, 35 cycles from denaturation to extension. The amplified gene was purified with DNA purification kit (QIAGEN PCR purification kit, Valencia, Calif., USA). The purified gene and the vector pET39b (Novagen, USA) for the cloning of a corresponding gene in E. coli were treated with proper restriction enzymes and the gene fragment treated with the restriction enzymes was separated on agarose gel, followed by purification using the same purification kit as the above. The purified gene fragment was ligated with the cloning vector pET39b, and E. coli DH5 was transfected with the vector. Plasmid was separated from the transfected E. coli, followed by DNA sequencing (Genotech, Daejeon, Korea). The final recombinant plasmid prepared by the method above was named pET-PSL1b 8 His (FIG. 1). The gene cloned into the expression vector was 909 bp (SEQ. ID. NO: 5) that could encode the recombinant lectin protein produced in E. coli and was encoding the amino acid sequence comprising total 302 amino acid residues represented by SEQ. ID. NO: 6 and had 8 histidines at C-terminal, by which the recombinant lectin protein could be easily separated through metal ion affinity chromatography (IMAC) column. The recombinant plasmid pET-PSL1b 8 His whose gene sequence had been identified was introduced in E. coli BL21-CodonPlus(DE3)-RIL to produce the recombinant lectin PSL1b protein. The recombinant strain Escherichia coli PSL1b expressing the recombinant lectin PSL1b was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), on Nov. 1, 2013 (KCTC12507BP).

(67) TABLE-US-00003 TABLE3 SEQ.ID.NO Sequence SEQ.ID.NO:3 5-TTTTTTTTCATATGAGTTTCGAGGGACATG GAATCTAC-3 SEQ.ID.NO:4 5-TTAACTCGAGGAACAATCCAAAATATGCTT TATAAC-3

Example 3: Cloning and Construction of a Transformant Strain for the Production of the Polyporus squamosus-Derived Recombinant Lectin Protein from Yeast

(68) Polymerase chain reaction (PCR) was performed to produce the Polyporus squamosus-derived recombinant lectin protein from yeast.

(69) Particularly, primers were constructed for the cloning of the lectin protein of Example 1 into the yeast expression vector based on the gene information of the polynucleotide identified by the method of Example 1. As shown in Table 4, the constructed primers are represented by SEQ. ID. NO: 7 and SEQ. ID. NO: 8. Polymerase chain reaction (PCR) was performed by using the chemically synthesized polynucleotide as a template. PCR conditions for the amplification of the 915 bp gene encoding the said lectin gene were as follows: denaturation at 94 C. for 30 seconds, annealing at 52 C., for 30 seconds, extension at 72 C. for 1 minute, 40 cycles from denaturation to extension. The amplified gene was purified with DNA purification kit (QIAGEN PCR purification kit, Valencia, Calif., USA). The purified gene and the vector pPICZ (Invitrogen, Carlsbad, Calif., USA) for the cloning of a corresponding gene in yeast (Pichia pastoris) were treated with proper restriction enzymes and the gene fragment treated with the restriction enzymes was separated on agarose gel, followed by purification using the same purification kit as the above. The purified gene fragment was ligated with the cloning vector pPICZ, and E. coli DH5 was transfected with the vector. Plasmid was separated from the transfected E. coli, followed by DNA sequencing (Genotech, Daejeon, Korea). The final recombinant plasmid prepared by the method above was named pPICZ-PSL1b 8 His (FIG. 2). The 1,173 bp long sequence (SEQ. ID. NO: 9) encoding the recombinant lectin protein produced in yeast (Pichia pastoris) via cloning in the expression vector above was encoding the amino acid sequence (SEQ. ID. NO: 10) comprising total 390 amino acid residues represented by SEQ. ID. NO: 8 and had signal peptide comprising 89 amino acid residues at its N-terminus regions and had 8 histidines at its C-terminus regions, by which the recombinant lectin protein could be easily separated through immobilized metal ion affinity chromatography (IMAC) column. The recombinant plasmid pPICZ-PSL1b 8 His whose gene sequence had been identified was introduced in Pichia pastoris X-33 to produce the recombinant lectin PSL1b protein. The recombinant strain Pichia pastoris PSL1b expressing the recombinant lectin PSL1b was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), on Oct. 7, 2013 (KCTC12500BP).

(70) TABLE-US-00004 TABLE4 SEQ.ID.NO Sequence Pp_PS1b-F 5-AGAATTCTCTTTCGAGGGACATGGAATC (SEQ.ID.NO:7) TAC-3 Pp_PSL1b-R 5-AATCTAGATCAGTGATGGTGATGGTGAT (SEQ.ID.NO:8) GGTGATGGAACAACCCAAAATATGCTTTATA AC-3

Example 4: Purification of the Recombinant Lectin from E. coli

(71) <4-1> Recombinant E. coli Strain Culture

(72) The recombinant E. coli constructed by the method described in Example 2 was pre-cultured in Luria-Bertani (LB) medium (trypton 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) containing antibiotics at 37 C. for at least 10 hours. The pre-culture solution of the recombinant E. coli was inoculated in LB medium at the volume of 1/100, followed by culture at 37 C. until OD.sub.600 reached 0.60.8. To induce the expression of the recombinant PSL1b lectin, isopropyl-D-thiogalactopyranoside (IPTG) was added thereto at the final concentration of 1.0 mM, followed by further culture at 30 C. for 6 hours. The cells were collected from the culture solution by centrifugation.

(73) <4-2> Separation of the Recombinant Lectin by HisTrap FF Column Chromatography

(74) To separate the recombinant lectin from the cells obtained by the method described in Example <4-1>, chromatography was performed using a HisTrap FF chromatography column.

(75) Particularly, the cells obtained by the same manner as described in Example <4-1> were washed with 50 mM Tris-HCl buffer (pH 7.6) three times. The cells were then lysed by sonication for 15 minutes in the same buffer. To eliminate unbroken cells and insoluble proteins from the cell lysate, centrifugation was performed at 10,000 rpm for 30 minutes. And the resultant cell residues precipitated in there were eliminated. The cell lysate was loaded in a HisTrap FF column (0.72.5 cm) equilibrated with 50 mM Tris-HCl buffer (pH 8.0) containing 10 mM imidazole and 0.25 M NaCl using Amersham-Pharmacia FPLC system (GE-Healthcare, USA). The column was washed with the same buffer of 20 times the column volume. The recombinant lectin was eluted with imidazole gradient from 10 mM to 500 mM in 50 mM tris-HCl buffer (pH 8.0) containing 0.25 M NaCl. At this time, the flow rate was 1 ml per minute and the fraction size was 0.5 mL per fraction tube. The protein eluted from the fractions displaying the peaks was concentrated by using an Amicon15 Ultra Centrifugal 10K filter.

(76) <4-3> Separation of the Recombinant Protein by Superose 12 Column Chromatography

(77) To separate the recombinant protein separated by using the HisTrap FF chromatography column by the method described in Example <4-2> with more purity, chromatography was performed using a Superose 12 column.

(78) Particularly, the recombinant protein separated by the method described in Example <4-2> was loaded in Superose 12 column (1.030 cm) (GE-Healthcare, USA) equilibrated with 50 mM Tris-HCl buffer (pH 8.0). Protein was eluted according to the size using the same buffer (1 ml/min). The protein eluted from the fractions displaying the peaks was concentrated by using AmiconUltra Centrifugal filter 10K.

(79) <4-4> Confirmation of the Recombinant Lectin Protein by SDS-PAGE

(80) To confirm the recombinant protein separated by the method of Example <4-3> with more purity, SDS-PAGE was performed.

(81) Particularly, the crude enzyme solution obtained by the method of Example <4-3> was separated by SDS-PAGE, followed by staining with Coommassie Brilliant Blue. The purity and size of the purified lectin protein was analyzed by using Precision Plus Protein Standards (Bio-Rad, USA) as the standard proteins.

(82) As a result, as shown in FIG. 3, the size of the recombinant PSL1b protein separated and purified from E. coli was about 32 kDa (FIG. 3).

Example 5: Purification of the Recombinant Lectin from Yeast

(83) <5-1> Recombinant Yeast Strain Culture

(84) The recombinant yeast strain constructed by the method described in Example 3 was pre-cultured in YPD medium (Yeast extract 10 g/L, Bactopeptone 20 g/L, Dextrose 20 g/L) at 30 C. for at least 24 hours. The recombinant yeast strain pre-culture solution was inoculated in 1.5 L of main culture medium at the ratio of 1:100 (v/v). The composition of the main culture medium was as follows (per 1 liter): 50 mL glycerol, 833 mL distilled water, 0.9 g CaSO.sub.4, 14.67 g K.sub.2SO.sub.4, 11.67 g MgSO.sub.4.7H.sub.2O, 9 g (NH.sub.4).sub.2SO.sub.4, 167 mL Hexametaphosphate solution (150 g hexametaphosphate per 1 L distilled water), and 4 mL trace element solution. Main culture was performed in 2 liter Jar fermentor (Jar fermentor, Kobiotech, Korea). The yeast was cultured at the aeration rate of 0.3 vvm, 1,000 rpm, pH 4.86.4, 30 C. pH was controlled during the culture with 10% (v/v) phosphoric acid solution and ammonia water. The yeast cells were cultured until the glycerol content in the culture medium reached up to 5 g/L. Then, 5 ml of methanol was fed thereto in order to induce the expression of the lectin protein. The methanol content in the medium was monitored at a regular interval. 1 g/L, the equivalent amount of methanol was added. 48 hours after the first methanol injection, the culture solution was collected.

(85) <5-2> Separation of Yeast Cells and Medium

(86) To separate the yeast cells and the culture medium from the yeast culture solution prepared by the method described in Example <5-1>, centrifugation was performed.

(87) Particularly, centrifugation was performed using SUPRA 22K centrifuge (Hanil Science Inc., Korea) equipped with A1000S-4S rotor at 4 C., 7,000 rpm for 30 minutes. The precipitated yeast cells were discarded and the supernatant was obtained. The obtained supernatant was stirred, during which ammonium sulfate in the solid phase was slowly added thereto until the concentration reached 80% (saturation concentration). The supernatant added with ammonium sulfate was stirred at 4 C. for at least 12 hours. Then, centrifugation was performed at 4 C., 7,000 rpm for 1 hour. The supernatant was eliminated and the precipitate was obtained. The precipitate was dissolved in 50 mM Tris-HCl buffer (pH 8.0), which was loaded in Slide-A-Lyzerdialysis Cassette (Thermo Scientific, Rockford, USA). The crude protein solution containing the recombinant protein was dialyzed in 5 L of the same buffer as the above. After 12 hours of dialysis, the crude protein solution was centrifuged using SUPRA 22K centrifuge (Hanil Science Inc., Korea) equipped with A500S-6N rotor at 4 C., 12,000 rpm for 30 minutes. The precipitate was eliminated and the supernatant was obtained.

(88) <5-3> Separation of the Recombinant Lectin by HisTrap FF Column Chromatography

(89) To separate the recombinant lectin from the crude protein solution obtained by the method described in Example <5-2>, the following experiment was performed.

(90) Particularly, the crude protein solution was loaded in a HisTrap FF column (0.72.5 cm) equilibrated with 50 mM Tris-HCl buffer (pH 8.0) containing 10 mM imidazole and 0.25 M NaCl using Amersham-Pharmacia FPLC system (GE-Healthcare, USA). The column was washed with the same buffer at the volume of 20 times the volume of the solution. The recombinant lectin was eluted with imidazole gradient from 10 mM to 500 mM in 50 mM tris-HCl buffer (pH 8.0) containing 0.25 M NaCl. At this time, the elution rate was 1 ml per minute and the fraction size was 0.5 mL per fraction tube. The protein eluted from the fractions displaying the peaks was concentrated by using an AmiconUltra Centrifugal 10K filter.

(91) <5-4> Confirmation of the Recombinant Lectin Protein by SDS-PAGE

(92) To confirm the purified lectins in the fraction pools obtained by the method of Example <5-3>, SDS-PAGE was performed.

(93) Particularly, the purified lectins in the fraction pools obtained by the method of Example <5-3> was separated by SDS-PAGE, followed by staining with Coommassie Brilliant Blue. The purity and the molecular weight of the purified lectin protein was analyzed by using Precision Plus Protein Standards (Bio-Rad, USA) as the standard proteins.

(94) As a result, as shown in FIG. 4, the size of the recombinant PSL1b protein separated and purified from yeast above was about 40 kDa, which was a little bigger than the size of the recombinant PSL1b protein separated and purified from E. coli. The size difference was assumed due to the potential three N-linked glycosylation sites included in the corresponding lectin sequence.

Example 6: Measurement of Glycoprotein Containing Sialic Acid Moieties by Lectin Blot Analysis

(95) Lectin blotting was performed to investigate the selective binding force of the protein separated by the method of Example <5-4>.

(96) Particularly, lectin blotting was performed with the glycoprotein wherein sialylation was completed by the reaction between non-sialylated glycoprotein not added with sialic acid sugar chains and CMP-N-acetylneuraminic acid (CMP-Neu5Ac) in the presence of (2,6)-sialyltransferase. For in vitro sialylation, the cell extract expressing (2,6)-sialyltransferase was mixed with 1 mg/mL of the sialic acid receptor non-sialylated fetuin (asialofetuin) as a glycoprotein substrate, 0.5 mg/mL of the sialic acid donor CMP-Neu5Ac, 10 mM MnCl.sub.2, 1% Triton X-100, and 0.02 unit TEV (Tobacco Etch Virus) protease in PBS (phosphate buffered saline), followed by reaction at 25 C. for 6 hours. After the enzymatic sialyation, the sialylated glycoprotein was analyzed by lectin blotting to confirm the addition of sialic acid. Each enzyme reaction product respectively containing non-sialylated fetuin or sialylated fetuin was mixed with 5 Laemmli buffer, which was then heated for 10 minutes. The fetuin samples were separated by 8% SDS-PAGE electrophoresis. The proteins separated on the SDS-PAGE gel were transferred on a nitrocellulose membrane at 15 V for 1 hour by using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad, USA). The protein-transferred membrane was washed with phosphate buffered saline (PBS) and then incubated in PBS containing 3% bovine serum albumin (BSA) for 1 hour. The membrane was washed again with PBS containing 0.5% Tween (PBST) 3 times and then loaded in 3% BSA-PBS containing 1 mg/ml of the biotin-conjugated recombinant PSL1b lectin protein prepared above, followed by culture at room temperature for 4 hours. The biotinylation conjugation of the recombinant PSL1b lectin protein was performed by using Antibody Biotinylation Kit (Genomine, Korea). After incubation of the membrane with the biotin-conjugated lectin, the membrane was washed with PBST 6 times for 10 minutes, followed by reaction with 0.2 mg/mL of horseradish peroxidase(HRP)-conjugated anti-biotin antibody (1:500, Sigma-Aldrich) for 1 hour. The membrane was washed with PBST 6 times for 10 minutes by the same manner as described above. At last, the sialylated protein was detected by ECL kit (GE Healthcare, USA).

(97) As a result, as shown in FIG. 5, lectin blot signal was observed in the basic structure of N-linked glycan such as Neu5Ac(2,6)Gal(1,4)GlcNAc and in the fetuin containing O-linked glycans such as Neu5Ac(2,6)Gal, Neu5Ac(2,6)Gal(1,3)GalNA, Neu5Ac(2,6)[Gal(1,3)]GalNA, Neu5Ac(2,6)Gal(1,3)[Neu5Ac(2,6)]GalNAc], Neu5Ac(2,6)Gal(1,3)[Neu5Ac(2,6)Gal(1,4)GlcNAc(1,6)]GalNAc. However, any signal on the lectin blotting membrane was not observed in the non-sialylated fetuin, the negative control, which contains Gal(1,4)GlcNAc for N-linked glycan and Gal, Gal(1,3)GalNA, [Gal(1,3)]GalNA, Gal(1,3)[Gal(1,4)GlcNAc(1,6)]GalNAc for O-linked glycans, and the fetuin containing alpha(2,3) sialic acid (bovine serum fetuin) (FIG. 5).

INDUSTRIAL APPLICABILITY

(98) The present invention relates to a method for producing, separating, and purifying the recombinant lectin as an active protein comprising the steps of synthesizing the polynucleotide encoding PSL1b lectin protein; and introducing the synthetic polynucleotide gene in a heterologous host to construct the recombinant strains Escherichia coli PSL1b (KCTC12507B) and Pichia pastoris PSL1b (KCTC12500BP) in order to produce the PSL1b lectin as a recombinant protein that binds specifically to alpha(2,6)-linked sialic acid. The recombinant protein of the present invention can be effectively used as an active ingredient of a composition or a kit for measuring or detecting glycoproteins, glycopeptides, glycolipids, sugar precursors, or oligosaccharides having sialic acid moieties containing the recombinant lectin specifically binding to alpha(2,6)-linked sialic acid, or a composition or a kit for measuring or detecting cell lines, bacteria, and viruses having sialoglycoconjugates containing the recombinant lectin specifically binding to alpha(2,6)-linked sialic acid.

DEPOSIT NUMBER

(99) Depositary Authority: Korea Research Institute of Bioscience and Biotechnology

(100) Deposit Number: KCTC12507BP

(101) Deposit Day: 20131101

(102) Depositary Authority: Korea Research Institute of Bioscience and Biotechnology

(103) Deposit Number: KCTC12500BP

(104) Deposit Day: 20131007

(105) Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended Claims.