COMBINED THERAPY FOR MUSCULAR DISEASES

Abstract

The present invention relates to the treatment of muscular diseases.

Claims

1. A method for treating a muscular disease, comprising administering to a subject in need thereof a combination product comprising: a GDF5 pathway-activating substance and at least one other active ingredient suitable for the treatment of the muscular disease.

2. The method according to claim 1, wherein the GDF5 pathway-activating substance is: a vector comprising a gene encoding GDF5, such as human GDF5; or recombinant GDF5, such as recombinant human GDF5.

3. The method according to claim 16, wherein the at least one other active ingredient is the combination of (i) an antisense oligonucleotide (AON) capable of inducing an exon-skipping in a dystrophin pre-mRNA, and (ii) a viral vector, such as an AAV vector, encoding a Duchenne muscular dystrophy therapeutic product, wherein said component (i) is administered before administering component (ii).

4. The method according to claim 3, wherein the viral vector of component (ii) is either (a) coding an antisense oligonucleotide able to induce exon-skipping within a dystrophin pre-mRNA, (b) encoding dystrophin gene-editing means, or (c) coding a functional dystrophin protein.

5. The method according to claim 3, wherein said AON is a phophorodiamidate morpholino oligomer, such as a peptide-phosphorodiamidate morpholino oligomer, in particular a Pip6a-PMO oligomer.

6. The method according to claim 3, wherein said viral vector of component (ii) encodes an U7-AON.

7. The method according to claim 3, wherein said viral vector of component (ii) encodes a functional truncated dystrophin such as a mini- or micro-dystrophin.

8. The method according to claim 3, wherein the GDF5 pathway-activating substance is administered: before administration of component (i); during administration of component (i); between administration of component (i) and administration of component (ii); during administration of component (ii); or after administration of component (ii).

9. The method according to claim 17, wherein the at least one other active ingredient is an antisense oligonucleotide (AON) capable of inducing an exon-skipping in the SOD1 pre-mRNA, thereby leading to the incorporation of a premature stop codon into the mature mRNA.

10. The method according to claim 1, wherein the at least one other active ingredient is a vector comprising a gene encoding a survival of motor neuron protein, such as the SMN1 or SMN2 gene.

11. A kit comprising: a GDF5 pathway-activating substance; and at least one other active ingredient.

12. The kit according to claim 11, wherein the at least one other active ingredient comprises: an isolated AON capable of inducing an exon-skipping in a dystrophin pre-mRNA; and a Duchenne muscular dystrophy therapeutic viral vector.

13. The kit according to claim 12, wherein the Duchenne muscular dystrophy viral vector encodes an antisense oligonucleotide able to induce exon-skipping within a dystrophin pre-mRNA; encodes a dystrophin gene-editing means; or encodes a functional dystrophin protein.

14. The kit according to claim 11, wherein the GDF5 pathway-activating substance is a vector, such as a plasmid or viral vector, in particular a viral vector, more particularly an AAV vector, comprising a gene encoding GDF5, in particular human GDF5.

15. The kit according to claim 11, wherein the GDF5 pathway-activating substance is recombinant GDF5, in particular recombinant human GDF5.

16. The method of claim 1, wherein the muscular disease is Duchenne muscular dystrophy.

17. The method of claim 1, wherein the muscular disease is amyotrophic lateral sclerosis.

Description

LEGEND OF THE FIGURES

[0134] FIG. 1. Viral Genomes are Efficiently Maintained in Pip6a-PMO Rescued Mdx Muscles

[0135] (a) TAs from mdx and wt mice were injected with 1 nmole of Pip6a-PMO two weeks (−2 w) before the injection of 1E+11 vg of the non-therapeutic AAV1-U7scr vector (day 0, d0). Control mdx and wt TAs were injected with AAV1-U7scr vector alone. Four TAs were injected per group. The mice were sacrificed 3 weeks later (3 w). (b) Dystrophin rescue monitored by immunostaining with the NCL-DYS2 monoclonal antibody on transverse sections of TA muscles. One representative immuno-stained section is shown per condition. (c) Dystrophin restoration evaluated by western blotting with NCL-DYS1 monoclonal antibodies (upper panel) on whole protein extracts from the PPMO-treated muscles (lower panel: α-actinin) Dystrophin restoration was quantified by ImageJ software and expressed as the percentage of dystrophin expression in wt muscle. (d) Quantification of AAV genomes by absolute Taqman qPCR. AAV genome content is expressed as the AAV genome number relative to the value obtained for the non PPMO-treated mdx muscles. The data represent the mean values of 4 muscles per group±SEM. n. s.: non-significant, ***p<0.001, Student's t-test. One of two representative experiments is shown.

[0136] FIG. 2. Pip6a-PMO Pre-Treatment Allows Important Dystrophin Rescue at Low AAV-U7ex23 Dose after 6 Months

[0137] (a) Mdx TAs were injected with 1 nmole of Pip6a-PMO two weeks (−2w) before the injection of 1E+10 vg of therapeutic AAV1-U7ex23 vector (day 0, d0). Control mdx TAs were injected with PPMO or AAV1-U7ex23 vector alone. Four TAs were injected per group. The mice were sacrificed 6 months later (6m). (b) Level of exon 23 skipping estimated by nested RT-PCR. The 901 bp PCR product corresponds to full-length dystrophin transcripts whereas the 688 bp product corresponds to transcripts lacking exon 23. (c) Quantification of exon 23 skipping performed by relative TaqMan qPCR and expressed as a percentage of total dystrophin transcripts. (d) Quantification of AAV genomes by absolute Taqman qPCR. AAV genome content is expressed as the AAV genome number relative to the value obtained for the non PPMO-treated mdx muscles. The data presented in (c) and (d) represent the mean values of the four TAs per group±SEM. *p<0.05, ***p<0.001, Student's t-test. (e) Dystrophin restoration evaluated by western blotting with NCL-DYS1 monoclonal antibodies (upper panel) on whole protein extracts from the treated muscles (lower panel: α-actinin) Dystrophin restoration was quantified by ImageJ software and expressed as the percentage of dystrophin expression in wt muscle.

[0138] FIG. 3. Effect of Pip6a-PMO Pre-Treatment on AAV1 Mediated Micro-Dystrophin Gene Therapy

[0139] (a) Mdx TAs were injected with 1 nmole of Pip6a-PMO two weeks (−2w) before injection of 1E+10 vg of AAV1-MD1 micro-dystrophin expressing vector (day 0, d0). Control mdx TAs were injected with PPMO or AAV1-MD1 vector alone. Five TAs were injected per group. The mice were sacrificed 4 weeks later (4 w). (b) Quantification of AAV genomes by absolute Taqman qPCR. AAV genome content is expressed as the AAV genome number relative to the value obtained for the non PPMO-treated mdx muscles. The data represent the mean values of the 5 muscles per group±SEM. *p<0.05, Student's t-test. (c) Expression of PPMO-induced dystrophin (DYS, 427 kDa) and micro-dystrophin (μDYS, 132 kDa) evaluated by western blotting with MANEX1011B monoclonal antibodies (upper panel) on whole protein extracts from the treated muscles (lower panel: α-actinin)

[0140] FIG. 4. GDF5 Overexpression in Young Mice Muscle.

[0141] A-C: RT-qPCR for (A) Gdf5, (B) Cacnbl-E (Ex2-3) and (C) Cacnbl-D in adult TAs innervated (Inn) or denervated for 15 days (Den) treated with Scra or GDF5. A: minimum medium axis=150; minimum top axis=3000.

[0142] D, E: Immunofluorescence images of TA Inn (top) or Den (bottom) treated with (D) Scra or (E) GDF5, stained with GDF5 (Magenta), CaVβ1E (Yellow). Bar: 10 am.

[0143] F, G: RT-qPCR for (F) Id1 and (G) Id2 in TAs Inn or Den treated with Scra or GDF5.

[0144] H, I: Haematoxylin and eosin (H/E) staining of TAs Inn (top) or Den (bottom) treated with (H) Scra or (I) GDF5. Bar 100 μm.

[0145] J, K: Sirius red (SR) staining of TAs Inn (top) or Den (bottom) treated with (J) Scra or (K) GDF5. Bar 100 μm.

[0146] L: Muscle/body-weight ratio of Inn or Den adult TAs treated with Scra or GDF5.

[0147] A: Means±s.e.m. (n=6) *P<0.05, ***P<0.001, *P<0.05, ** P<0.01, ***P<0.001; (two stage linear step-up procedure of Benjamini, Krieger and Yekutieli, with Q=1%. Each row was analyzed individually, without assuming a consistent SD).

[0148] B, C, F-G, L: Means±s.e.m. (n=6) *P<0.05, ***P<0.001, *P<0.05, ** P<0.01, ***P<0.001, (ordinary one-way Anova—by Sidak's test).

EXAMPLES

Materials and Methods

Viral Vector Production and Animal Experiments

[0149] A three-plasmid transfection protocol was used with pAAV(U7smOPT-SD23/BP22), pAAV(U7smOPT-scr) and codon optimized pΔAR4-R23/ΔCT (MD1) plasmids for generation of single-strand AAV1-U7ex23 (7), AAV1-U7scr (13) and AAV1-MD1 (37) vectors. AAV-GDF5 has been generated by direct cloning of Gdf5 ORF (NM_008109.2), flanked by EcoRI and NheI sites (GeneArt string; ThermoFisher), in pSMD2 AAV2 vectors backbones, under CMV promoter. pSUPER retro puro Scr ShRNA (SCRA) was a gift from John Gurdon (Addgene plasmid #30520). BamHI site has been inserted by PCR and the H1-SCRA cassette has been cloned in pSMD2-sh through BamHI and SalI sites. The final viral preparations were kept in PBS solution at −80° C. Vector titers were determined by real-time PCR and expressed as vector genomes per ml (vg/ml). Three-month-old mdx mice were injected into the Tibialis anterior (TA) muscles with 1 nmole of Pip6a-PMO oligonucleotides (GGCCAAACCTCGGCTTACCTGAAAT-SEQ ID NO:11) (20). Additionally, 50 μl of AAV1-U7scr, AAV1-U7ex23 or AAV1-MD1 containing 1E+10 or 1E+11 vg were injected into C57BL/6 (wt) or mdx TAs. AAV-GDF5 was injected into 8 week-old C57BL/6 TAs at 5E+10. As control, 8-week-old C57/BL6 mice were injected using the same procedure with SCRA AAV vector. Mice were sacrificed 10 or 12 weeks after the injection. These animal experiments were performed at the Myology Research

[0150] Center, Paris, France, according to the guidelines and protocols approved by the Institutional Review Board. A minimum of four mice were injected per group for each experiments. At sacrifice, muscles were collected, snap-frozen in liquid nitrogen-cooled isopentane and stored at −80° C.

Denervation Experiments

[0151] Ten weeks after injection of mice with AAV, the sciatic nerve was neuroectomized (ablation of a 5-mm segment of the sciatic nerve) under general anesthesia (Isofluorane, 3% induction, 2% maintenance) with Buprenorphine (vetergesic 1 mg/Kg, subcutaneous). Mice were sacrificed 1, 3, 7 or 15 days after denervation, and TA were dissected, weighed and thereafter frozen in isopentane precooled in liquid nitrogen and stored at −80 ° C. until histology or molecular analysis.

Viral Genome Quantification

[0152] Genomic DNA was extracted from mouse muscles using Puregene Blood kit (Qiagen). Copy number of AAV genomes and genomic DNA were measured on 10Ong of genomic DNA by absolute quantitative real-time PCR on a StepOnePlus™ (Applied Biosystems) using the TaqmanR Universal Master Mix

[0153] (Applied Biosystems). Primers (forward: CTCCATCACTAGGGGTTCCTTG (SEQ ID NO:3) and reverse: GTAGATAAGTAGCATGGC (SEQ ID NO:4)) and probe (TAGTTAATGATTAACCC (SEQ ID NO:5)) were used to specifically amplify the viral genome sequence. As a reference sample, a pAAV plasmid was 10-fold serially diluted (from 10.sup.7 to 10.sup.1 copies). All genomic DNA samples were analyzed in duplicates.

RT-PCR Analysis

[0154] Total RNA was isolated from mouse muscle with NucleoSpin® RNA II (Macherey-Nagel), and reverse transcription (RT) performed on 200ng of RNA by using the Superscript™ II and random primers (Life technologies). Non-skipped and skipped dystrophin transcripts were detected by nested PCR and quantified as described (9).

Gene Expression Analysis by RT-QPCR

[0155] Total RNA was prepared from TA cryosections using TRizol (Life Technologies) following the manufacturer's instructions. Complementary DNA was generated with Superscript II Reverse transcriptase (Life Technologies), amplified using PCR Master Mix (M7505, Promega) for RT-PCR oranalyzed by real-time qPCR. Real-time qPCR was performed on StepOne Plus Real-Time PCR System (Applied Biosystems) using Power SyberGreen PCR MasterMix (Applied Biosystems). All data were analyzed using the ΔΔCT method and normalized to PO (mouse acidic ribosomal phosphoprotein) mRNA expression levels. The sample reference to calculate mRNA fold change is indicated in each panel. Primers used are listed

TABLE-US-00004 Gene Name Primer Sequence Specie PO fw CTCCAAGCAGATGCAGCAGA mouse PO rv ATAGCCTTGCGCATCATGGT mouse Id-2 fw CTCCAAGCTCAAGGAACTGG mouse Id-2 rv ATTCAGATGCCTGCAAGGAC mouse Id-1 fw AGTGAGCAAGGTGGAGATCC mouse Id-1 rv GATCGTCGGCTGGAACAC mouse Gdf5 fw ATGCTGACAGAAAGGGAGGTAA mouse Gdf5 rv GCACTGATGTCAAACACGTACC mouse

Western Blot Analysis

[0156] Protein extracts were obtained from pooled muscle sections treated with 125 mM sucrose, 5 mM Tris-HCl pH 6.4, 6% of XT Tricine Running Buffer (Bio-Rad), 10% SDS, 10% Glycerol, 5% β-mercaptoethanol. The samples were purified with the Pierce Compat-Able™ Protein Assay preparation Reagent Set (Thermo Scientific) and the total protein concentration was determined with the Pierce BCA Protein Assay Kit (Thermo Scientific). Samples were denatured at 95° C. for 5 minutes and 100 μg of protein were loaded onto Criterion XT Tris-acetate precast gel 3-8% (Bio-Rad). Membrane was probed with primary monoclonal antibodies directed against dystrophin (NCL-DYS1, 1:50, Leica Biosystems; MANEX1011B, 1:50, kindly gifted by The Muscular Dystrophy Association Monoclonal Antibody Resource (38)) and α-actinin (1:1000, Sigma-Aldrich), followed by incubation with a sheep anti-mouse secondary antibody (horseradish peroxidase conjugated; 1:15000) and Pierce ECL Western Blotting Substrate (Thermo Scientific).

Immunohistochemistry and Histology

[0157] TA sections of 12 μm were cut and examined for dystrophin expression using the NCL-DYS2 monoclonal antibody (Leica Biosystems). Rabbit polyclonal antibody for 041 C-terminus (AP16144b) was purchased from AbGent and the mouse monoclonal to GDF5 was obtained by Santa Cruz Biotechnologies (SC-373744). Fluorescent secondary antibodies goat anti-rabbit and goat anti-mouse were purchased from Life technologies.

[0158] For H&E staining, sections were fixed in 4% PFA for 10 min, washed in PBS and then stained in haematoxylin for 5 min and eosin for 30 sec. The muscle sections were further dried in gradually increasing concentration of ethanol/water solutions and, after fixation in 100% xylene, were mounted in Vectamount (Vector Laboratories). Sirius Red staining was performed to analyze total collagen I and III content. Muscle cryosections were fixed in PFA 4% for 10 min, washed in water and dried in 100% ethanol for 5 min. Sections were then stained in Picro-Sirius Red (0.3%) solution for 1 h while protected from light. After a washing in acidified water (5 min in acetic acid 0.5% vol/vol), sections were fixed in 100% ethanol (3 washes for 5 min) and the final dehydration was performed in xylene 100%, mounted in Vectamount and visualized using a macroscope Nikon AZ100. Confocal images were taken with Leica SPE or a Nikon Ti2 microscope equipped with a motorized stage and a Yokogawa CSU-W1 spinning disk head coupled with a Prime 95 sCMOS camera (Photometrics).

Results

Effect of Dystrophin Restoration by AON Pre-Treatment on Non-Therapeutic Viral Genome Maintenance

[0159] In order to induce temporary dystrophin expression at the sarcolemma of Mdx myofibers, Mdx Tibialis anterior (TA) muscles were injected with 11 μg of Pip6a-PMO (20), a peptide-phosphorodiamidate morpholino (PPMO) antisense oligonucleotide that is particularly efficient for mdx exon skipping. The non-therapeutic AAV-U7scr vectors (carrying a scrambled, non-specific sequence) were injected in the same muscles two weeks later (FIG. 1a), when dystrophin rescue was optimal, at a high dose (1E+11 viral genomes). We had previously shown that these U7scr vectors, which are unable to induce exon skipping and thereby to rescue dystrophin expression, are drastically lost within three weeks from dystrophin-deficient mdx muscle (13).

[0160] Following AON pre-treatment inducing exon skipping, three weeks after AAV1-U7scr injection, immunofluorescence staining revealed a strong dystrophin restoration and its correct localization at the sarcolemma in mdx injected muscles (FIG. 1b). Dystrophin levels were quantified in mdx muscles by western blotting and showed that the AON pre-treatment resulted in 56 to 98% of quasi-dystrophin restoration compared to normal levels (FIG. 1c). As expected (13), the viral genome content analyzed by quantitative PCR (qPCR) was 6 times higher in wild-type muscles (wt) than in non AON treated mdx muscles. Interestingly, the viral genome content analyzed by qPCR in the mdx AON treated group is similar to the one observed in wt muscles (FIG. 1d). Therefore, a significant dystrophin expression induced by PPMO pre-treatment at the time of AAV1-U7scr injection protects against the rapid loss of AAV1-U7scr genomes in mdx muscles comparable to what was observed in wt muscles.

Effect of Pip6a-PMO Pre-Treatment on Dystrophin Rescue at Low Dose of Therapeutic AAV-U7ex23

[0161] AAV1 vectors encoding the U7ex23 (AAV1-U7ex23) allow efficient exon 23 skipping and therefore quasi-dystrophin rescue in the mdx muscles. To evaluate the benefit of an AON pre-treatment on the quasi-dystrophin rescue via AAV1-U7ex23, we injected 11 μg of Pip6a-PMO antisense oligonucleotides into mdx TAs two weeks before injection of AAV1-U7ex23 vectors (FIG. 2A). A low vector dose (1E+10 viral genomes) was chosen as this dose allows a weak quasi-dystrophin rescue (less than 5% of the normal levels) (13).

[0162] The benefit of AAV1-U7ex23 injection was analysed six months later when dystrophin rescue induced by the single PPMO injection was nearly abolished. Levels of exon 23 skipping analyzed by nested RT-PCR (FIG. 2b) and quantified by qPCR (FIG. 2c) in mdx TAs treated with AAV1-U7ex23 or PPMO alone were low as expected, respectively 9 and 6% of skipped transcripts, leading to the synthesis of rescued dystrophin around 2% of the normal level (FIG. 2e). Conversely, TAs treated sequentially with PPMOs and AAV1-U7ex23 showed 54% of skipped transcripts (FIGS. 2c) and 20% of the normal levels of dystrophin (FIG. 2e). AAV genome copy number quantified by absolute qPCR was 8 fold higher in the dual PPMO/AAV1-U7ex23 treated muscles than in AAV1-U7ex23 only injected muscles (FIG. 2D). These data demonstrate that the PPMO pre-treatment allowed a better maintenance of the therapeutic U7ex23 genomes in the mdx muscles six months after the AAV-U7 injections and remarkably resulted in a 10 fold improvement of the rescued dystrophin amount.

Pip6a-PMO Pre-Treatment Significantly Increases the Efficacy of AAV1 Mediated Micro-Dystrophin Gene Therapy

[0163] To evaluate the efficacy of an AON pre-treatment on AAV-micro-dystrophin gene therapy, we injected Pip6a-PMO AONs into mdx TAs two weeks before injection of AAV1-MD1 vector (1E+10 vg) expressing a murine micro-dystrophin (MD1) (37) (FIG. 3a). Four weeks later, a strong dystrophin restoration was observed in PPMO-treated mdx TAs induced by the PPMO pre-treatment (FIG. 3c). AAV genome copy number and micro-dystrophin expression were 3-fold higher in the PPMO/AAV1-MD1 treated muscles than in AAV1-MD1 only treated muscles (FIG. 3b & c), illustrating the PPMO pre-treatment benefit on AAV-micro-dystrophin gene therapy. This experiment establishes the proof of concept that the AON pre-treatment is capable of enhancing all AAV-based gene therapies for DMD.

Effect of GDF5 Overexpression

[0164] We overexpressed GDF5 in young TAs (FIG. 4A, D, E) which induced Cacnb1-E transcription in innervated TAs compared to scrambled (FIG. 4 B, D, E) without affecting Cacnb1-D expression (FIG. 4 C). Nevertheless, GDF5 over-expression and its activated signaling checked by Id-1 and Id-2 transcription (FIG. 4 F, G) increased mostly innervated muscle mass (FIG. 4 H-L).

Discussion

[0165] AAV genomes are rapidly lost from dystrophic muscles during AAV-U7-mediated exon-skipping therapy, certainly because of their episomal nature and the fragility of the dystrophic muscle fibers that undergo cycles of necrosis/generation, show abnormally leaky membranes, and in addition are characterized by increased excretion of exosomes and microparticles (36). We showed here that a significant (>60%) quasi-dystrophin rescue following PPMO pre-treatment at the moment of AAV-U7 injections allows an efficient maintenance of the viral genomes in mdx muscles three weeks later. Additionally, this initial maintenance of viral genomes increases quasi-dystrophin restoration by AAV-U7, around 6 fold at RNA level and around 10 fold at protein level six months later.

[0166] The PPMO pre-treatment resulted in substantial dystrophin expression at the time of AAV-U7 injection. This likely reduces, like in normal control muscle, the membrane abnormalities leading to AAV genome loss before AAV-U7 induced quasi-dystrophin expression occurs. Once established, a AAV-U7 mediated high quasi-dystrophin expression will be maintained because it will by itself prevent transgene loss. Hence, by allowing the maintenance of high viral genome content in the critical period between AAV injection and AAV-mediated transgene expression in the treated dystrophic muscles, PPMO-mediated quasi-dystrophin restoration guarantees a long-lasting benefit of AAV-U7 treatment.

[0167] This pre-treatment could be induced by any AONs allowing substantial quasi-dystrophin rescue (i.e. using different skippable mutations and different target sequences and different AON chemistries such as tricyclo-DNA (36)) using the principle demonstrated here with the PPMO chemistry.

[0168] This AON pre-treatment is applicable to all therapeutic approaches for Duchenne myopathy using AAV vectors, in particular AAV-U7-mediated exon skipping and classical gene therapy with transfer of functional micro-dystrophin cDNAs into muscles, as demonstrated thanks to the data presented herein.

[0169] In addition, it is herein shown that muscle mass is increased when GDF5 is overexpressed, meaning that muscles to be treated can further be protected during the application of the above therapeutic strategy thanks to the administration of either a vector expressing GDF5, or a recombinant GDF5 protein.

[0170] On the eve of clinical trials using AAV-based therapies for DMD patients, this study underscores the strong impact of combined approaches to improve the benefit of AAV-based therapies allowing the use of lower and thus safer vector doses for a larger level of dystrophin expression in the long term.

REFERENCES

[0171] 1. Harper, S. Q., Hauser, M. A., DelloRusso, C., Duan, D., Crawford, R. W., Phelps, S. F., Harper, H. A., Robinson, A. S., Engelhardt, J. F., Brooks, S. V. et al. (2002) Modular flexibility of dystrophin: implications for gene therapy of Duchenne muscular dystrophy. Nat. Med., 8, 253-261. [0172] 2. Goemans, N. M., Tulinius, M., van den Akker, J. T., Burm, B. E., Ekhart, P. F., Heuvelmans, N., Holling, T., Janson, A. A., Platenburg, G. J., Sipkens, J. A. et al. (2011) Systemic administration of PRO051 in Duchenne's muscular dystrophy. N. Engl. J. Med., 364, 1513-1522. [0173] 3. Cirak, S., Arechavala-Gomeza, V., Guglieri, M., Feng, L., Torelli, S., Anthony, K., Abbs, S., Garralda, M. E., Bourke, J., Wells, D. J. et al. (2011) Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment:

[0174] an open-label, phase 2, dose-escalation study. Lancet, 378, 595-605. [0175] 4. Mendell, J. R., Rodino-Klapac, L. R., Sahenk, Z., Roush, K., Bird, L., Lowes, L. P., Alfano, L., Gomez, A. M., Lewis, S., Kota, J. et al. (2013) Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann. Neurol., 74, 637-647. [0176] 5. Voit, T., Topaloglu, H., Straub, V., Muntoni, F., Deconinck, N., Campion, G., de Kimpe, S. J., Eagle, M., Guglieri, M., Hood, S. et al. (2014) Safety and efficacy of drisapersen for the treatment of Duchenne muscular dystrophy (DEMAND II): an exploratory, randomised, placebo-controlled phase 2 study. Lancet Neurol., 13, 987-996. [0177] 6. Brun, C., Suter, D., Pauli, C., Dunant, P., Lochmuller, H., Burgunder, J. M., Schumperli, D. and Weis, J. (2003) U7 snRNAs induce correction of mutated dystrophin pre-mRNA by exon skipping. Cell Mol. Life Sci., 60, 557-566. [0178] 7. Goyenvalle, A., Vulin, A., Fougerousse, F., Leturcq, F., Kaplan, J. C., Garcia, L. and Danos, O. (2004) Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science, 306, 1796-1799. [0179] 8. Denti, M. A., Rosa, A., D'Antona, G., Sthandier, O., De Angelis, F. G., Nicoletti, C., Allocca, M., Pansarasa, O., Parente, V., Musaro, A. et al. (2006) Chimeric adeno-associated virus/antisense U1 small nuclear RNA effectively rescues dystrophin synthesis and muscle function by local treatment of mdx mice. Hum. Gene Ther., 17, 565-574. [0180] 9. Goyenvalle, A., Babbs, A., Wright, J., Wilkins, V., Powell, D., Garcia, L. and Davies, K. E. (2012) Rescue of severely affected dystrophin/utrophin-deficient mice through scAAV-U7snRNA-mediated exon skipping. Hum. Mol. Genet., 21, 2559-2571. [0181] 10. Bish, L. T., Sleeper, M. M., Forbes, S. C., Wang, B., Reynolds, C., Singletary, G. E., Trafny, D., Morine, K. J., Sanmiguel, J., Cecchini, S. et al. (2012) Long-term restoration of cardiac dystrophin expression in golden retriever muscular dystrophy following rAAV6-mediated exon skipping. Mol. Ther., 20, 580-589. [0182] 11. Vulin, A., Barthelemy, I., Goyenvalle, A., Thibaud, J. L., Beley, C., Griffith, G., Benchaouir, R., Le, H. M., Unterfinger, Y., Lorain, S. et al. (2012) Muscle function recovery in golden retriever muscular dystrophy after AAV1-U7 exon skipping. Mol. Ther., 20, 2120-2133. [0183] 12. Lorain, S., Gross, D. A., Goyenvalle, A., Danos, O., Davoust, J. and Garcia, L. (2008) Transient immunomodulation allows repeated injections of AAV1 and correction of muscular dystrophy in multiple muscles. Mol. Ther., 16, 541-547. [0184] 13. Le Hir, M., Goyenvalle, A., Peccate, C., Precigout, G., Davies, K. E., Voit,T., Garcia, L. and Lorain, S. (2013) AAV Genome Loss From Dystrophic Mouse Muscles During AAV-U7 snRNA-mediated Exon-skipping Therapy. Mol. Ther., 21, 1551-1558. [0185] 14. Cartegni, L., Chew, S. L., and Krainer, A. R. (2002). Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 3, 285-298.

[0186] 15. Reed, R., and Maniatis, T. (1988). The role of the mammalian branchpoint sequence in pre-mRNA splicing. Genes & development 2, 1268-1276. [0187] 16. Aartsma-Rus, A., van Vliet, L., Hirschi, M., Janson, A. A., Heemskerk, H., de Winter, C. L., de Kimpe, S., van Deutekom, J. C., t Hoen, P. A., and van Ommen, G. J. (2009). Guidelines for antisense oligonucleotide design and insight into splice-modulating mechanisms. Mol Ther 17, 548-553. [0188] 17. Brown S C, Fassati A, Popplewell L, Page A M, Henry M D, Campbell K P, Dickson G. Dystrophic phenotype induced in vitro by antibody blockade of muscle alpha-dystroglycan-laminin interaction. J Cell Sci. 1999 January; 112 (Pt 2):209-16. [0189] 18. Kumar, P., Wu, H., McBride, J. L., Jung, K. E., Kim, M. H., Davidson, B. L., Lee, S. K., Shankar, P., and Manjunath, N. (2007). Transvascular delivery of small interfering RNA to the central nervous system. Nature 448, 39-43. [0190] 19. Betts, C., Saleh, A. F., Arzumanov, A. A., Hammond, S. M., Godfrey, C., Coursindel, T., Gait, M. J., and Wood, M. J. (2012). Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy Nucleic acids 1, e38. [0191] 20. Lehto, T., Castillo, A. A., Gauck, S., Gait, M. J., Coursindel, T., Wood, M. J., Lebleu, B. and Boisguerin, P. (2014) Cellular trafficking determines the exon skipping activity of Pip6a-PMO in mdx skeletal and cardiac muscle cells. Nucleic Acids Res., 42, 3207-3217. [0192] 21. Yamada, T., Das Gupta, T. K., and Beattie, C. W. (2013). p28, an anionic cell-penetrating peptide, increases the activity of wild type and mutated p53 without altering its conformation. Molecular pharmaceutics 10, 3375-3383. [0193] 22. Malhotra, M., Tomaro-Duchesneau, C., Saha, S., Kahouli, I., and Prakash, S. (2013). Development and characterization of chitosan-PEG-TAT nanoparticles for the intracellular delivery of siRNA. International journal of nanomedicine 8, 2041-2052. [0194] 23. Lundberg, M., Wikstrom, S., and Johansson, M. (2003). Cell surface adherence and endocytosis of protein transduction domains. Mol Ther 8, 143-150. [0195] 24. Lu, Q. L., Mann, C. J., Lou, F., Bou-Gharios, G., Morris, G. E., Xue, S. A., Fletcher, S., Partridge, T. A. and Wilton, S. D. (2003) Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat. Med., 9, 1009-1014. [0196] 25. Gregorevic P, Allen J M, Minami E, Blankinship M J, Haraguchi M, Meuse L, Finn E, Adams M E, Froehner S C, Murry C E, Chamberlain J S. rAAV6-microdystrophin preserves muscle function and extends lifespan in severely dystrophic mice. Nat Med. 2006 July; 12(7):787-9. [0197] 26. Koo T, Okada T, Athanasopoulos T, Foster H, Takeda S, Dickson G. Long-term functional adeno-associated virus-microdystrophin expression in the dystrophic CXMDj dog. J Gene Med. 2011 September; 13(9):497-506. [0198] 27. Shin J H, Pan X, Hakim C H, Yang H T, Yue Y, Zhang K, Terjung R L, Duan D. Microdystrophin ameliorates muscular dystrophy in the canine model of duchenne muscular dystrophy. Mol Ther. 2013 April; 21(4): 750-7 [0199] 28. Mendell J R, Campbell K, Rodino-Klapac L, Sahenk Z, Shilling C, Lewis S, Bowles D, Gray S, Li C, Galloway G, Malik V, Coley B, Clark K R, Li J, Xiao X, Samulski J, McPhee S W, Samulski R J, Walker C M. Dystrophin immunity in Duchenne's muscular dystrophy. N Engl J Med. 2010 Oct. 7; 363(15):1429-37. [0200] 29. Gao, G., Vandenberghe, L. H., Alvira, M. R., Lu, Y., Calcedo, R., Zhou, X., and Wilson, J. M. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol 78, 6381-6388. [0201] 30. Gao, G. P., Alvira, M. R., Wang, L., Calcedo, R., Johnston, J., and Wilson, J. M. (2002). Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci USA 99, 11854-11859. [0202] 31. McCarty, D. M., Monahan, P E, and Samulski, R. J. (2001). Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8, 1248-1254. [0203] 32. Cazzella, V., Martone, J., Pinnaro, C., Santini, T., Twayana, S. S., Sthandier, O., D'Amico, A., Ricotti, V., Bertini, E., Muntoni, F., et al. (2012). Exon 45 skipping through U1-snRNA antisense molecules recovers the Dys-nNOS pathway and muscle differentiation in human DMD myoblasts. Mol Ther 20, 2134-2142. [0204] 33. De Angelis, F. G., Sthandier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G., and Bozzoni, I. (2002). Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc Natl Acad Sci U S A 99, 9456-9461. [0205] 34. Goyenvalle, A., Vulin, A., Fougerousse, F., Leturcq, F., Kaplan, J. C., Garcia, L., and Danos, O. (2004). Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 306, 1796-1799. [0206] 35. Schumperli, D., and Pillai, R. S. (2004). The special Sm core structure of the U7 snRNP: far-reaching significance of a small nuclear ribonucleoprotein. Cell Mol Life Sci 61, 2560-2570. [0207] 36. Duguez, S., Duddy, W., Johnston, H., Laine, J., Le Bihan, M. C., Brown, K. J., Bigot, A., Hathout, Y., Butler-Browne, G. and Partridge, T. (2013) Dystrophin deficiency leads to disturbance of LAMP1-vesicle-associated protein secretion. Cell Mol. Life Sci., 70, 2159-2174. [0208] 37. Foster, H., Sharp, P. S., Athanasopoulos, T., Trollet, C., Graham, I. R., Foster, K., Wells, D. J., Dickson, G. (2008) Codon and mRNA sequence optimization of microdystrophin transgenes improves expression and physiological outcome in dystrophic mdx mice following AAV2/8 gene transfer. Mol. Ther., 16, 1825-1832. [0209] 38. Bartlett, R. J., Stockinger, S., Denis, M. M., Bartlett, W. T., Inverardi, L., Le, T. T., thi Man, N., Morris, G. E., Bogan, D. J., Metcalf-Bogan, J., Kornegay, J. N. (2000) In vivo targeted repair of a point mutation in the canine dystrophin gene by a chimeric RNA/DNA oligonucleotide. Nat. Biotechnol., 18, 615-622.